DOCSLIB.ORG

Retracted 7/17/2020

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Retracted 7/17/2020 RESEARCH Novel Orthobunyavirus Causing Severe Kidney Disease in Broiler Chickens, Malaysia, 2014–2017 Vilmos Palya, Edit Walkóné Kovács, Szilvia Marton, Tímea Tatár-Kis, RETRACTEDBalázs Felföldi, Barbara Forró, Marianna Domán, Krisztián Bányai During 2014–2017, we isolated a novel orthobunyavirus likely reflecting a minor role of orthobunyaviruses in from broiler chickens with severe kidney lesions in the state poultry diseases (5). of Kedah, Malaysia; we named the virus Kedah fatal kidney Since 2014, sporadic cases of a new disease in broiler syndrome virus (KFKSV). Affected chickens became listless chickens, manifested as clinical signs of lethargy accompa- and diarrheic before dying suddenly. Necropsies detected nied by some gastrointestinal symptoms and sudden death pale and swollen kidneys with signs of gout, enlarged and from severe kidney damage, have been reported in north- fragile livers, and pale hearts. Experimental infection of broiler chickens with KFKSV reproduced the disease and western Malaysia. We identified and characterized the etio- pathologic conditions observed in the field, fulfilling the logic agent of this disease. Koch’s postulates. Gene sequencing indicated high nucleo- tide identities between KFKSV isolates (99%) and moderate Materials and Methods nucleotide identities with the orthobunyavirus Umbre virus in the large (78%), medium (77%), and small (86%) ge- Detection and Identification of the Etiologic Agent nomic segments. KFKSV may be pathogenic for other host We collected samples of kidney and cecal tonsils from af- species, including humans. fected chickens in the field that died and submitted them to the Scientific Support and Investigation Laboratory of n recent years, numerous arboviruses have reportedly Ceva-Phylaxia7/17/2020 (Budapest, Hungary) for detection of pos- Icaused major outbreaks among domestic or wild birds sible viral agents. The tissue samples were homogenized (1,2). Most arboviruses associated with widespread to give ≈10% (wt/vol) suspension in phosphate-buffered epizootics are members of the Flaviviridae family, al- saline pH 7.2. The homogenized samples were centrifuged though the poultry industry has been affected by other at 1,000 × g for 15 min at 4°C and then filtered through arboviruses (3–5). The order Bunyavirales comprises a 0.45-µm membrane. We inoculated 0.2 mL of the fil- at least 9 families and 13 genera. Of the major genera, tered supernatant via the chorioallantoic cavity into spe- only viruses of the Orthobunyavirus, Orthohantavirus, cific pathogen free (SPF) eggs, 9–11 days old, divided into Orthonairovirus, and Phlebovirus genera infect verte- groups of 5. After inoculation, we checked eggs daily for brates (6–8). Orthobunyavirus is the most diverse genus 7 days and discarded those that died within 24 h. The cho- within the Bunyavirales order, comprising ≈170 viruses rioallantoic fluid was harvested aseptically from embryos classified into >18 serogroups on the basis of antigenic that died after 24 h, and these embryos were examined for relationships; this serology correlates well with the phy- the presence of gross pathologic lesions. If at the end of logenetic analyses (9). For birds, particularly domestic the 7-day observation period no embryos had died, we re- poultry, descriptions of natural infections with orthobu- moved the eggs with live embryos and kept them at 4°C for nyaviruses are scarce (10,11). Hubálek et al., in a recent 24 h and then collected the chorioallantoic fluid for the next comprehensive review on arboviruses, listed only a few passage. We conducted 3 blind passages before consider- orthobunyaviruses pathogenic to domestic poultry, most ing a sample negative for pathogens. The chorioallantoic fluid of the embryos showing Author affiliations: Ceva-Phylaxia Veterinary Biologicals Co. Ltd., pathologic lesions was inoculated onto LMH (chicken Budapest, Hungary (V. Palya, E.W. Kovács, T. Tatár-Kis, hepatocellular carcinoma) and Vero (African green B. Felföldi); Hungarian Academy of Sciences, Budapest monkey kidney) cell cultures and checked for cytopatho- (S. Marton, B. Forró, M. Domán, K. Bányai) genic agents. LMH cells were also used for propagation DOI: https://doi.org/10.3201/eid2506.181661 and titration of the isolated virus and for reisolation of 1110 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 25, No. 6, June 2019 Orthobunyavirus Causing Kidney Disease in Chickens the virus from kidney samples from experimentally in- Development of Diagnostic RT-PCR fected chickens. For assay development and quantification of the novel or- Supernatants of tissue cultures showing cytopathologic thobunyavirus genomic RNA in organ samples of the ex- changes were centrifuged at 10,000 × g for 5 min, and 200 perimental animals, we extracted viral RNA as previously µL of the supernatant was used for nucleic acid extraction described and designed primers and probes for the S ge- by use of the ZiXpress32 Viral Nucleic Acid Extraction Kit nomic segment of the novel orthobunyavirus. The reaction and ZiXpress32 robot (Zinexts Life Science, http://www. mixture of quantitative RT-PCR (qRT-PCR) that we used Zinexts.com). Random primed reverse-transcription PCR was composed of 10 µL 2× qPCRBIO Probe 1-Step Mix (RT-PCR)RETRACTED was performed as described elsewhere (12,13). (PCR Biosystems, http://www.pcrbio.com), 1.6 µL S gene We subjected 100 ng of cDNA to enzymatic fragmenta- specific forward (5′ GGGTAGCACTAGCATTTATCCA tion and adaptor ligation, following the manufacturer’s 3′) and reverse (5′ TGTAGACACCCACAAACGTATC recommendations (NEBNext Fast DNA Fragmentation & 3′) primers (each from 10 μM stock solutions), 0.5 µL S Library Prep Set for Ion Torrent; New England Biolabs, gene specific probe (5′ [FAM] AGCTCACATACGAG- https://www.neb.com). The resulting cDNA libraries were GATACACAGGA [BHQ] 3′) from a 10 μmol/L stock measured on Qubit 2.0 equipment by using the Qubit ds- solution, 1 µL 20× RTase with RNase inhibitor, 0.3 µL DNA BR Assay kit (Invitrogen, https://www.thermofisher. nuclease-free water, and 5 µL RNA. The thermal profile com). The isothermal emulsion PCR that produced clonally of the qRT-PCR was as follows: reverse transcription at amplified libraries was conducted according to the manu- 50°C for 10 min terminated by heating to 95 °C for 2 min, facturer’s protocol by using the IA 500 kit (Life Technolo- followed by amplification performed in 40 cycles consist- gies, https://www.thermofisher.com). Enrichment of the ing of denaturation at 95°C for 5 s and hybridization and templated beads (on an Ion OneTouch ES machine; Life elongation at 60°C for 20 s. Throughout the study, we used Technologies) and further steps of presequencing setup a Mic qPCR cycler (Bio Molecular Systems, https://bio- were performed according to the manufacturer’s 200-bp molecularsystems.com), kindly provided for the project by protocol. We strictly followed the sequencing protocol rec- Péter Kisfali, Amplicon Ltd.). ommended for the Ion PGM Hi-Q View Sequencing Kit on To test the assay specificity, we used a number of vi- a 316 v2 chip (Life Technologies). ruses from our strain collection, including avian nephritis Sanger sequencing was used to validate results ob- virus (Astroviridae); QX-like, 4/91-like, and Massachu- tained by the viral metagenomics approach. Primer pairs setts-like infectious bronchitis virus strains (Coronaviri- were designed to amplify 0.8–1.2-kb fragments (not dae); representative isolates of avian metapneumovirus A, shown). The BrightDye Terminator Cycle Sequencing Kit B,7/17/2020 and C and Newcastle disease virus (Paramyxoviridae); (NimaGen, https://www.nimagen.com) was used in the isolates of influenza (H9N2) and (H5N8) viruses (Ortho- amplification reaction, and dye-labeled products were run myxoviridae); and Tembusu virus (Flaviviridae). on an ABI 3500 sequencer (Life Technologies). Sequence reads obtained by next-generation sequencing Experimental Reproduction of the Disease were trimmed by using CLC Genomics Workbench version We tested the pathogenicity of 1 of the isolates 7 (http://www.clcbio.com). The minimal read length param- (D2756/1/2014/MY) in 5-day-old broiler chickens pur- eter was set to 40. The same software was used to assemble chased from a commercial hatchery in Hungary. We in- the genome sequence. After visually inspecting the sequence oculated 10 chickens with 0.2 mL of 5.1 log10 50% tissue mappings, we created 1 consensus sequence for all 3 genome culture infective dose (TCID50) of the isolate by either the segments (small [S], medium [M], and large [L]). Sanger se- subcutaneous or oral route; for negative controls, we inocu- quencing outputs were analyzed by using BioEdit software lated 5 chickens of the same age with phosphate-buffered (14). Sequence contigs from the 2 sequencing platforms saline pH 7.2. We kept all birds in isolators with negative were assembled and further edited by using GeneDoc (15) pressure and monitored them daily for overt clinical signs and BioEdit software and then analyzed by similarity search and death for 26 days after inoculation. with BLAST (14–16). We deposited newly generated nucle- We recorded gross lesions of birds that died during otide sequences into GenBank (accession nos. MK047401– the 26-day postinoculation period and collected samples MK047415). Multiple alignments were prepared by using from the spleen, liver, kidney, heart, pancreas, small in- the TranslatorX online program (17) and manually adjusted testine, bursa, and thymus and placed them in 10% buff- in GeneDoc, whereas phylogenetic analysis by the maxi- ered formalin for histologic analysis. We also collected mum-likelihood and the neighbor-joining methods was per- tissue samples (spleen, liver, kidney, heart, intestine, formed by using MEGA6 software (18). The coding poten- and bursa) from 5 chickens in the subcutaneously infect- tial was predicted by using ORF Finder (http://www.ncbi. ed group and 4 chickens from the orally infected group nlm.nih.gov/gorf/gorf.html). that died and processed them for viral RNA detection by Emerging Infectious Diseases • www.cdc.gov/eid • Vol.
Load more

Recommended publications
  • California Encephalitis Orthobunyaviruses in Northern Europe
    California encephalitis orthobunyaviruses in northern Europe NIINA PUTKURI Department of Virology Faculty of Medicine, University of Helsinki Doctoral Program in Biomedicine Doctoral School in Health Sciences Academic Dissertation To be presented for public examination with the permission of the Faculty of Medicine, University of Helsinki, in lecture hall 13 at the Main Building, Fabianinkatu 33, Helsinki, 23rd September 2016 at 12 noon. Helsinki 2016 Supervisors Professor Olli Vapalahti Department of Virology and Veterinary Biosciences, Faculty of Medicine and Veterinary Medicine, University of Helsinki and Department of Virology and Immunology, Hospital District of Helsinki and Uusimaa, Helsinki, Finland Professor Antti Vaheri Department of Virology, Faculty of Medicine, University of Helsinki, Helsinki, Finland Reviewers Docent Heli Harvala Simmonds Unit for Laboratory surveillance of vaccine preventable diseases, Public Health Agency of Sweden, Solna, Sweden and European Programme for Public Health Microbiology Training (EUPHEM), European Centre for Disease Prevention and Control (ECDC), Stockholm, Sweden Docent Pamela Österlund Viral Infections Unit, National Institute for Health and Welfare, Helsinki, Finland Offical Opponent Professor Jonas Schmidt-Chanasit Bernhard Nocht Institute for Tropical Medicine WHO Collaborating Centre for Arbovirus and Haemorrhagic Fever Reference and Research National Reference Centre for Tropical Infectious Disease Hamburg, Germany ISBN 978-951-51-2399-2 (PRINT) ISBN 978-951-51-2400-5 (PDF, available
    [Show full text]
  • Guide for Common Viral Diseases of Animals in Louisiana
    Sampling and Testing Guide for Common Viral Diseases of Animals in Louisiana Please click on the species of interest: Cattle Deer and Small Ruminants The Louisiana Animal Swine Disease Diagnostic Horses Laboratory Dogs A service unit of the LSU School of Veterinary Medicine Adapted from Murphy, F.A., et al, Veterinary Virology, 3rd ed. Cats Academic Press, 1999. Compiled by Rob Poston Multi-species: Rabiesvirus DCN LADDL Guide for Common Viral Diseases v. B2 1 Cattle Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 2 Deer and Small Ruminants Please click on the principle system involvement Generalized viral disease Respiratory viral disease Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 3 Swine Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 4 Horses Please click on the principle system involvement Generalized viral diseases Neurological viral diseases Respiratory viral diseases Enteric viral diseases Abortifacient/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 5 Dogs Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Back to the Beginning DCN LADDL Guide for Common Viral Diseases v.
    [Show full text]
  • 2020 Taxonomic Update for Phylum Negarnaviricota (Riboviria: Orthornavirae), Including the Large Orders Bunyavirales and Mononegavirales
    Archives of Virology https://doi.org/10.1007/s00705-020-04731-2 VIROLOGY DIVISION NEWS 2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales Jens H. Kuhn1 · Scott Adkins2 · Daniela Alioto3 · Sergey V. Alkhovsky4 · Gaya K. Amarasinghe5 · Simon J. Anthony6,7 · Tatjana Avšič‑Županc8 · María A. Ayllón9,10 · Justin Bahl11 · Anne Balkema‑Buschmann12 · Matthew J. Ballinger13 · Tomáš Bartonička14 · Christopher Basler15 · Sina Bavari16 · Martin Beer17 · Dennis A. Bente18 · Éric Bergeron19 · Brian H. Bird20 · Carol Blair21 · Kim R. Blasdell22 · Steven B. Bradfute23 · Rachel Breyta24 · Thomas Briese25 · Paul A. Brown26 · Ursula J. Buchholz27 · Michael J. Buchmeier28 · Alexander Bukreyev18,29 · Felicity Burt30 · Nihal Buzkan31 · Charles H. Calisher32 · Mengji Cao33,34 · Inmaculada Casas35 · John Chamberlain36 · Kartik Chandran37 · Rémi N. Charrel38 · Biao Chen39 · Michela Chiumenti40 · Il‑Ryong Choi41 · J. Christopher S. Clegg42 · Ian Crozier43 · John V. da Graça44 · Elena Dal Bó45 · Alberto M. R. Dávila46 · Juan Carlos de la Torre47 · Xavier de Lamballerie38 · Rik L. de Swart48 · Patrick L. Di Bello49 · Nicholas Di Paola50 · Francesco Di Serio40 · Ralf G. Dietzgen51 · Michele Digiaro52 · Valerian V. Dolja53 · Olga Dolnik54 · Michael A. Drebot55 · Jan Felix Drexler56 · Ralf Dürrwald57 · Lucie Dufkova58 · William G. Dundon59 · W. Paul Duprex60 · John M. Dye50 · Andrew J. Easton61 · Hideki Ebihara62 · Toufc Elbeaino63 · Koray Ergünay64 · Jorlan Fernandes195 · Anthony R. Fooks65 · Pierre B. H. Formenty66 · Leonie F. Forth17 · Ron A. M. Fouchier48 · Juliana Freitas‑Astúa67 · Selma Gago‑Zachert68,69 · George Fú Gāo70 · María Laura García71 · Adolfo García‑Sastre72 · Aura R. Garrison50 · Aiah Gbakima73 · Tracey Goldstein74 · Jean‑Paul J. Gonzalez75,76 · Anthony Grifths77 · Martin H. Groschup12 · Stephan Günther78 · Alexandro Guterres195 · Roy A.
    [Show full text]
  • Hantavirus Disease Were HPS Is More Common in Late Spring and Early Summer in Seropositive in One Study in the U.K
    Hantavirus Importance Hantaviruses are a large group of viruses that circulate asymptomatically in Disease rodents, insectivores and bats, but sometimes cause illnesses in humans. Some of these agents can occur in laboratory rodents or pet rats. Clinical cases in humans vary in Hantavirus Fever, severity: some hantaviruses tend to cause mild disease, typically with complete recovery; others frequently cause serious illnesses with case fatality rates of 30% or Hemorrhagic Fever with Renal higher. Hantavirus infections in people are fairly common in parts of Asia, Europe and Syndrome (HFRS), Nephropathia South America, but they seem to be less frequent in North America. Hantaviruses may Epidemica (NE), Hantavirus occasionally infect animals other than their usual hosts; however, there is currently no Pulmonary Syndrome (HPS), evidence that they cause any illnesses in these animals, with the possible exception of Hantavirus Cardiopulmonary nonhuman primates. Syndrome, Hemorrhagic Nephrosonephritis, Epidemic Etiology Hemorrhagic Fever, Korean Hantaviruses are members of the genus Orthohantavirus in the family Hantaviridae Hemorrhagic Fever and order Bunyavirales. As of 2017, 41 species of hantaviruses had officially accepted names, but there is ongoing debate about which viruses should be considered discrete species, and additional viruses have been discovered but not yet classified. Different Last Updated: September 2018 viruses tend to be associated with the two major clinical syndromes in humans, hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary (or cardiopulmonary) syndrome (HPS). However, this distinction is not absolute: viruses that are usually associated with HFRS have been infrequently linked to HPS and vice versa. A mild form of HFRS in Europe is commonly called nephropathia epidemica.
    [Show full text]
  • Hantavirus Host Assemblages and Human Disease in the Atlantic Forest
    RESEARCH ARTICLE Hantavirus host assemblages and human disease in the Atlantic Forest 1,2 1,3 4,5,6 Renata L. MuylaertID *, Ricardo Siqueira Bovendorp , Gilberto Sabino-Santos Jr , Paula R. Prist7, Geruza Leal Melo8, Camila de FaÂtima Priante1, David A. Wilkinson2, Milton Cezar Ribeiro1, David T. S. Hayman2 1 Departamento de Ecologia, Universidade Estadual Paulista (UNESP), Rio Claro, Brazil, 2 Molecular Epidemiology and Public Health Laboratory, Infectious Disease Research Centre, Hopkirk Research Institute, Massey University, Palmerston North, New Zealand, 3 PPG Ecologia e ConservacËão da Biodiversidade, LEAC, Universidade Estadual de Santa Cruz, IlheÂus, BA, Brazil, 4 Center for Virology Research, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto, SP, Brazil, 5 Department of Laboratory a1111111111 Medicine, University of California San Francisco, San Francisco, California, United States of America, 6 Vitalant Research Institute, San Francisco, California, United States of America, 7 Instituto de BiocieÃncias, a1111111111 Departamento de Ecologia, Universidade de SaÄo Paulo (USP), SaÄo Paulo, SP, Brazil, 8 Programa de PoÂs- a1111111111 GraduacËão em Biodiversidade Animal, Universidade Federal de Santa Maria, Santa Maria, RS, Brazil a1111111111 a1111111111 * [email protected] Abstract OPEN ACCESS Several viruses from the genus Orthohantavirus are known to cause lethal disease in Citation: Muylaert RL, Bovendorp RS, Sabino- humans. Sigmodontinae rodents are the main hosts responsible for hantavirus transmission Santos G, Jr, Prist PR, Melo GL, Priante CdF, et al. in the tropical forests, savannas, and wetlands of South America. These rodents can shed (2019) Hantavirus host assemblages and human different hantaviruses, such as the lethal and emerging Araraquara orthohantavirus. Factors disease in the Atlantic Forest.
    [Show full text]
  • Zwiesel Bat Banyangvirus, a Potentially Zoonotic Huaiyangshan
    www.nature.com/scientificreports OPEN Zwiesel bat banyangvirus, a potentially zoonotic Huaiyangshan banyangvirus (Formerly known as SFTS)–like banyangvirus in Northern bats from Germany Claudia Kohl1*, Annika Brinkmann1, Aleksandar Radonić2, Piotr Wojtek Dabrowski2, Andreas Nitsche1, Kristin Mühldorfer3, Gudrun Wibbelt 3 & Andreas Kurth1 Bats are reservoir hosts for several emerging and re-emerging viral pathogens causing morbidity and mortality in wildlife, animal stocks and humans. Various viruses within the family Phenuiviridae have been detected in bats, including the highly pathogenic Rift Valley fever virus and Malsoor virus, a novel Banyangvirus with close genetic relation to Huaiyangshan banyangvirus (BHAV)(former known as Severe fever with thrombocytopenia syndrome virus, SFTSV) and Heartland virus (HRTV), both of which have caused severe disease with fatal casualties in humans. In this study we present the whole genome of a novel Banyangvirus, named Zwiesel bat banyangvirus, revealed through deep sequencing of the Eptesicus nilssonii bat virome. The detection of the novel bat banyangvirus, which is in close phylogenetic relationship with the pathogenic HRTV and BHAV, underlines the possible impact of emerging phenuiviruses on public health. Te Banyangvirus genus, currently classifed as part of the Phenuviridae family in the order Bunyavirales, is char- acterized by a tri-segmented, negative- or ambisense ssRNA genome of 11–19 kb length in total. Four structural proteins are encoded on the genome: the L protein (RNA-dependent RNA polymerase) on segment L, two gly- coproteins Gn and Gc on segment M, the nucleocapsid protein on segment N and the nonstructural protein NSs on segment S. Banyangviruses can infect vertebrates and invertebrates and have caused febrile infections, encephalitis and severe fevers with fatal outcome in humans, therefore being increasingly reported as emerging pathogens of public health importance1–3.
    [Show full text]
  • Detection and Genetic Characterization of Puumala
    Detection and Genetic Characterization of Puumala Orthohantavirus S-Segment in Areas of France Non-Endemic for Nephropathia Epidemica Séverine Murri, Sarah Madrières, Caroline Tatard, Sylvain Piry, Laure Benoit, Anne Loiseau, Julien Pradel, Emmanuelle Artige, Philippe Audiot, Nicolas Leménager, et al. To cite this version: Séverine Murri, Sarah Madrières, Caroline Tatard, Sylvain Piry, Laure Benoit, et al.. Detection and Genetic Characterization of Puumala Orthohantavirus S-Segment in Areas of France Non-Endemic for Nephropathia Epidemica. Pathogens, MDPI, 2020, 9 (9), pp.721. 10.3390/pathogens9090721. hal-03275200 HAL Id: hal-03275200 https://hal.inrae.fr/hal-03275200 Submitted on 30 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License pathogens Article Detection and Genetic Characterization of Puumala Orthohantavirus S-Segment in Areas of France Non-Endemic for Nephropathia Epidemica Séverine Murri 1, Sarah Madrières 1,2, Caroline Tatard 2, Sylvain Piry 2 , Laure Benoit
    [Show full text]
  • Taxonomy of the Order Bunyavirales: Update 2019
    Archives of Virology (2019) 164:1949–1965 https://doi.org/10.1007/s00705-019-04253-6 VIROLOGY DIVISION NEWS Taxonomy of the order Bunyavirales: update 2019 Abulikemu Abudurexiti1 · Scott Adkins2 · Daniela Alioto3 · Sergey V. Alkhovsky4 · Tatjana Avšič‑Županc5 · Matthew J. Ballinger6 · Dennis A. Bente7 · Martin Beer8 · Éric Bergeron9 · Carol D. Blair10 · Thomas Briese11 · Michael J. Buchmeier12 · Felicity J. Burt13 · Charles H. Calisher10 · Chénchén Cháng14 · Rémi N. Charrel15 · Il Ryong Choi16 · J. Christopher S. Clegg17 · Juan Carlos de la Torre18 · Xavier de Lamballerie15 · Fēi Dèng19 · Francesco Di Serio20 · Michele Digiaro21 · Michael A. Drebot22 · Xiaˇoméi Duàn14 · Hideki Ebihara23 · Toufc Elbeaino21 · Koray Ergünay24 · Charles F. Fulhorst7 · Aura R. Garrison25 · George Fú Gāo26 · Jean‑Paul J. Gonzalez27 · Martin H. Groschup28 · Stephan Günther29 · Anne‑Lise Haenni30 · Roy A. Hall31 · Jussi Hepojoki32,33 · Roger Hewson34 · Zhìhóng Hú19 · Holly R. Hughes35 · Miranda Gilda Jonson36 · Sandra Junglen37,38 · Boris Klempa39 · Jonas Klingström40 · Chūn Kòu14 · Lies Laenen41,42 · Amy J. Lambert35 · Stanley A. Langevin43 · Dan Liu44 · Igor S. Lukashevich45 · Tāo Luò1 · Chuánwèi Lüˇ 19 · Piet Maes41 · William Marciel de Souza46 · Marco Marklewitz37,38 · Giovanni P. Martelli47 · Keita Matsuno48,49 · Nicole Mielke‑Ehret50 · Maria Minutolo3 · Ali Mirazimi51 · Abulimiti Moming14 · Hans‑Peter Mühlbach50 · Rayapati Naidu52 · Beatriz Navarro20 · Márcio Roberto Teixeira Nunes53 · Gustavo Palacios25 · Anna Papa54 · Alex Pauvolid‑Corrêa55 · Janusz T. Pawęska56,57 · Jié Qiáo19 · Sheli R. Radoshitzky25 · Renato O. Resende58 · Víctor Romanowski59 · Amadou Alpha Sall60 · Maria S. Salvato61 · Takahide Sasaya62 · Shū Shěn19 · Xiǎohóng Shí63 · Yukio Shirako64 · Peter Simmonds65 · Manuela Sironi66 · Jin‑Won Song67 · Jessica R. Spengler9 · Mark D. Stenglein68 · Zhèngyuán Sū19 · Sùróng Sūn14 · Shuāng Táng19 · Massimo Turina69 · Bó Wáng19 · Chéng Wáng1 · Huálín Wáng19 · Jūn Wáng19 · Tàiyún Wèi70 · Anna E.
    [Show full text]
  • Diversity and Evolution of Viral Pathogen Community in Cave Nectar Bats (Eonycteris Spelaea)
    viruses Article Diversity and Evolution of Viral Pathogen Community in Cave Nectar Bats (Eonycteris spelaea) Ian H Mendenhall 1,* , Dolyce Low Hong Wen 1,2, Jayanthi Jayakumar 1, Vithiagaran Gunalan 3, Linfa Wang 1 , Sebastian Mauer-Stroh 3,4 , Yvonne C.F. Su 1 and Gavin J.D. Smith 1,5,6 1 Programme in Emerging Infectious Diseases, Duke-NUS Medical School, Singapore 169857, Singapore; [email protected] (D.L.H.W.); [email protected] (J.J.); [email protected] (L.W.); [email protected] (Y.C.F.S.) [email protected] (G.J.D.S.) 2 NUS Graduate School for Integrative Sciences and Engineering, National University of Singapore, Singapore 119077, Singapore 3 Bioinformatics Institute, Agency for Science, Technology and Research, Singapore 138671, Singapore; [email protected] (V.G.); [email protected] (S.M.-S.) 4 Department of Biological Sciences, National University of Singapore, Singapore 117558, Singapore 5 SingHealth Duke-NUS Global Health Institute, SingHealth Duke-NUS Academic Medical Centre, Singapore 168753, Singapore 6 Duke Global Health Institute, Duke University, Durham, NC 27710, USA * Correspondence: [email protected] Received: 30 January 2019; Accepted: 7 March 2019; Published: 12 March 2019 Abstract: Bats are unique mammals, exhibit distinctive life history traits and have unique immunological approaches to suppression of viral diseases upon infection. High-throughput next-generation sequencing has been used in characterizing the virome of different bat species. The cave nectar bat, Eonycteris spelaea, has a broad geographical range across Southeast Asia, India and southern China, however, little is known about their involvement in virus transmission.
    [Show full text]
  • Impact of Landscape on Host–Parasite Genetic Diversity and Distribution Using the Puumala Orthohantavirus–Bank Vole System
    microorganisms Article Impact of Landscape on Host–Parasite Genetic Diversity and Distribution Using the Puumala orthohantavirus–Bank Vole System Maria Razzauti 1,* , Guillaume Castel 1 and Jean-François Cosson 2 1 CBGP, INRAE, CIRAD, IRD, Montpellier SupAgro, Université Montpellier, 34000 Montpellier, France; [email protected] 2 UMR BIPAR, Animal Health Laboratory, ANSES, INRAE, Ecole Nationale Vétérinaire d’Alfort, Université Paris-Est, 94700 Maisons-Alfort, France; [email protected] * Correspondence: [email protected] Abstract: In nature, host specificity has a strong impact on the parasite’s distribution, prevalence, and genetic diversity. The host’s population dynamics is expected to shape the distribution of host-specific parasites. In turn, the parasite’s genetic structure is predicted to mirror that of the host. Here, we study the tandem Puumala orthohantavirus (PUUV)–bank vole system. The genetic diversity of 310 bank voles and 33 PUUV isolates from 10 characterized localities of Northeast France was assessed. Our findings show that the genetic diversity of both PUUV and voles, was positively correlated with forest coverage and contiguity of habitats. While the genetic diversity of voles was weakly structured in space, that of PUUV was found to be strongly structured, suggesting that the dispersion of voles was not sufficient to ensure a broad PUUV dissemination. Genetic diversity of PUUV was mainly shaped by purifying selection. Genetic drift and extinction events were better Citation: Razzauti, M.; Castel, G.; reflected than local adaptation of PUUV. These contrasting patterns of microevolution have important Cosson, J.-F. Impact of Landscape on consequences for the understanding of PUUV distribution and epidemiology.
    [Show full text]
  • Borna Disease Virus Infection in Animals and Humans
    Synopses Borna Disease Virus Infection in Animals and Humans Jürgen A. Richt,* Isolde Pfeuffer,* Matthias Christ,* Knut Frese,† Karl Bechter,‡ and Sibylle Herzog* *Institut für Virologie, Giessen, Germany; †Institut für Veterinär-Pathologie, Giessen, Germany; and ‡Universität Ulm, Günzburg, Germany The geographic distribution and host range of Borna disease (BD), a fatal neuro- logic disease of horses and sheep, are larger than previously thought. The etiologic agent, Borna disease virus (BDV), has been identified as an enveloped nonsegmented negative-strand RNA virus with unique properties of replication. Data indicate a high degree of genetic stability of BDV in its natural host, the horse. Studies in the Lewis rat have shown that BDV replication does not directly influence vital functions; rather, the disease is caused by a virus-induced T-cell–mediated immune reaction. Because antibodies reactive with BDV have been found in the sera of patients with neuro- psychiatric disorders, this review examines the possible link between BDV and such disorders. Seroepidemiologic and cerebrospinal fluid investigations of psychiatric patients suggest a causal role of BDV infection in human psychiatric disorders. In diagnostically unselected psychiatric patients, the distribution of psychiatric disorders was found to be similar in BDV seropositive and seronegative patients. In addition, BDV-seropositive neurologic patients became ill with lymphocytic meningoencephali- tis. In contrast to others, we found no evidence is reported for BDV RNA, BDV antigens, or infectious BDV in peripheral blood cells of psychiatric patients. Borna disease (BD), first described more predilection for the gray matter of the cerebral than 200 years ago in southern Germany as a hemispheres and the brain stem (8,19).
    [Show full text]
  • Orthohantaviruses Belonging to Three Phylogroups All Inhibit Apoptosis in Infected Target Cells
    www.nature.com/scientificreports OPEN Orthohantaviruses belonging to three phylogroups all inhibit apoptosis in infected target cells Received: 13 July 2018 Carles Solà-Riera1, Shawon Gupta1,2, Hans-Gustaf Ljunggren1 & Jonas Klingström 1 Accepted: 3 December 2018 Orthohantaviruses, previously known as hantaviruses, are zoonotic viruses that can cause hantavirus Published: xx xx xxxx pulmonary syndrome (HPS) and hemorrhagic fever with renal syndrome (HFRS) in humans. The HPS-causing Andes virus (ANDV) and the HFRS-causing Hantaan virus (HTNV) have anti-apoptotic efects. To investigate if this represents a general feature of orthohantaviruses, we analysed the capacity of six diferent orthohantaviruses – belonging to three distinct phylogroups and representing both pathogenic and non-pathogenic viruses – to inhibit apoptosis in infected cells. Primary human endothelial cells were infected with ANDV, HTNV, the HFRS-causing Puumala virus (PUUV) and Seoul virus, as well as the putative non-pathogenic Prospect Hill virus and Tula virus. Infected cells were then exposed to the apoptosis-inducing chemical staurosporine or to activated human NK cells exhibiting a high cytotoxic potential. Strikingly, all orthohantaviruses inhibited apoptosis in both settings. Moreover, we show that the nucleocapsid (N) protein from all examined orthohantaviruses are potential targets for caspase-3 and granzyme B. Recombinant N protein from ANDV, PUUV and the HFRS-causing Dobrava virus strongly inhibited granzyme B activity and also, to certain extent, caspase-3 activity. Taken together, this study demonstrates that six diferent orthohantaviruses inhibit apoptosis, suggesting this to be a general feature of orthohantaviruses likely serving as a mechanism of viral immune evasion. Orthohantaviruses, of the order Bunyavirales and previously known as hantaviruses, are small single-stranded negative-sense RNA viruses with a tri-segmented genome (S, M and L segments) encoding four to fve proteins.
    [Show full text]