ANALYSIS OF RHYTHMIC GENE TRANSCRIPTION USING THE TimeR, A NOVEL
TECHNOLOGY TO CAPTURE ZEBRAFISH EMBRYOS
by
LAIN XYLIA PIERCE
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation Advisor: Dr. Jennifer O. Liang, PhD
Department of Genetics
CASE WESTERN RESERVE UNIVERSITY
August 2008 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______
candidate for the ______degree *.
(signed)______(chair of the committee)
______
______
______
______
______
(date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein.
Table of Contents
Table of Contents 1
List of Tables 3
List of Figures 3
Abstract 5
Chapter 1: Background and Significance
Circadian Rhythms 7
The Importance of Circadian Rhythms in Humans 8
The Clock, Cell Division and Cancer 10
The Vertebrate Circadian System 12
The Mammalian Molecular Clock 13
The Zebrafish Molecular Clock 15
Photoreception and Circadian Entrainment 16
Studying the Circadian Clock 17
Summary of Scientific Contributions 18
Chapter 2: The Time Reaper 5channel Automatic Liquid Dispenser: a new tool for studying zebrafish development
Abstract 21
Introduction 22
Results and Discussion 23
Design and use of the TimeR 23
1
The TimeR is an effective tool for fixing zebrafish embryos 25
Materials and Methods 27
Acknowledgements 29
Chapter3: Novel functions for Period 3 and Exorhodopsin in rhythmic transcription and melatonin biosynthesis within the zebrafish pineal organ
Abstract 43
Introduction 44
Results 45 exorh transcription is rhythmic 45
Otx5 activates exorh transcription 46
Per3 negatively regulates exorh transcription during the day 47
Loss of Exorh protein reduces transcription from the exorh promoter 48
Exorh does not initiate transcription of red opsin 50
Exorh is required for high levels of aanat2 expression 50
Discussion 50
Exorh protein is important for gene transcription in the zebrafish pineal organ 50
The pattern of exorh transcription is controlled by a combination of tissuespecific and rhythmic factors 51
Experimental Procedures 55
Acknowledgements 57
2
Chapter 4: Discussion and Future Directions
Novel function for Exorh in regulating gene transcription in the zebrafish pineal organ 86
Novel function for Per3 in regulating the phase of expression for a rhythmic gene. Per3 had been identified but function was not well understood 88
Rhythmic genes are regulated by tissue specific factors that restrict special expression and rhythmic factors that generate the daily changes in mRNA levels 91
Connections between phototransduction and circadian rhythms 94
References 100
3
List of Tables
Chapter 2
Supplementary Parts List 51
Chapter 3
Table 1: Overexpression of Otx5 induces ectopic expression of the exorh:GFP transgene 70
Supplementary Table 1: Analysis of exorh expression using the Student’s t‐test 85
4
List of Figures
Chapter 1
Figure 1: The Vertebrate Circadian System 24
Figure 2: The Mammalian Circadian Clock 26
Figure 3: Alignment of amino acid sequences across visual and pineal Opsins 28
Figure 4: Phylogenetic tree comparing zebrafish exorhodopsin to other vertebrate Opsins 30
Chapter 2
Figure 1: The TimeR 42
Figure 2: Flow of liquids through the TimeR 44
Figure 3: The strength and pattern of the signal from WISH is indistinguishable between embryos fixed with the TimeR and embryos fixed manually 46
Figure 4: Whole mount immunostaining on TimeR and manually fixed embryos 48
Figure 5: Temperature of fixative does not diminish the effectiveness or accuracy of either WISH or Immunostaining 50
Chapter 3
Figure 1. There are significant changes in exorh expression levels between day and night 72
Figure 2. Otx5 controls the tissue‐spec ificity of exorh transcription 74
Figure 3. Daytime expression of exorh is increased in embryos lacking Per3 76
5
Chapter 3 Figures cont.
Figure 4. Expression from the exorh promoter is decreased in embryos lacking Exorh protein 79
Figure 5. Exorh is required for high levels of aanat2 tran s cription 81
Figure 6. Model for the regulation of exorh expression 83
Supplem entary Figure 1. Exorh protein is required for exorh transcription throughout the circadian cycle 84
Chapter 4
Figure 1. The Molecular Pathway Between Light and Transcription 97
Figure 2: Conclusions and Future Directions 99
6
Analysis of Rhythmic Gene Transcription using the TimeR, a Novel Technology
to Capture Zebrafish Embryos
Abstract
by
LAIN XYLIA PIERCE
Circadian rhythms are predictable oscillations in behavior such as the sleep wake cycle and biomolecular profiles such as rhythmic changes in gene transcription. These oscillations receive entraining cues from environmental inputs such as the light/dark photoperiod that regulate endogenous molecular clocks which in turn produce rhythmic outputs.
The zebrafish pineal organ is an excellent model to study these molecular profiles because phototransducive molecules as well as the clock and its outputs are all housed within the same cells. Additionally, zebrafish embryos undergo rapid and external development such that the molecular pineal clock is functional in as little as
24 hours post fertilization.
However, capturing embryonic samples at all time points in the circadian cycle can be challenging. Not only is the health of the researcher compromised when working odd hours but experimental results may be altered by handling samples at inappropriate times. To address this issue, I have led the research and design of a new technology.
7
The Time Reaper 5‐Channel Automatic Liquid Dispenser (TimeR) delivers up
to 50 mL of paraformaldehyde to embryos in a Petri dish at preset times. In testing
the TimeR I have shown that the pattern of expression for a number of genes is
indistinguishable between embryos fixed manually versus remotely and that the
TimeR is also suitable for fixing embryos for whole mount immunostaining. The
TimeR was used frequently in securing data for the body of my dissertation work.
The zebrafish opsin protein Exo‐rhodopsin (Exorh) is expressed in pineal
photoreceptors and is a candidate to mediate the effects of environmental light on
pineal rhythms and melatonin synthesis. We demonstrate that Exorh has an
important role in regulating gene transcription within the pineal. In developing embryos that lack Exorh, expression of the exorh gene itself and of the melatonin synthesis gene serotonin N‐acetyl transferase 2 (aanat2) are significantly reduced.
This suggests that Exorh protein at the cell membrane is part of a signaling pathway that positively regulates transcription of these genes, and ultimately melatonin production, in the pineal. Like many other opsin genes, exorh is expressed with a daily rhythm: mRNA levels are higher at night than during the day. We find that the transcription factor Orthodenticle homeobox 5 (Otx5) activates exorh transcription, while the putative circadian clock component Period 3 (Per3) represses expression during the day, thereby contributing to the rhythm of transcription. This work identifies novel roles for Exorh and Per3, and gives insight into potential interactions between the sensory and circadian systems within the pineal.
8
Chapter 1: Background and Significance
Circadian Rhythms
Circadian rhythms are biochemical and behavioral changes that occur with a period of approximately 24 hours. For example, these biorhythms control the timing of sleeping, waking, feeding and socializing. The oscillations of the clocks that drive these rhythms are self‐driven and can be steadily maintained without environmental influence. Thus, circadian rhythms allow animals to not only respond to the environment but to anticipate environmental changes. Daido(Daido, 2002) and Michael and colleagues (Michael and McClung, 2003; Michael et al., 2003) theorize that clock entrainment produces evolutionary fitness, which may explain the fact that nearly every organism studied to date possesses a circadian clock.
The circadian clock is a self‐sustained oscillator driven by a set of feed‐back loops. One full revolution of the clock requires approximately 24 hours to be completed. However, the word “approximately” cannot be overstated. The endogenous human clock takes 24 hours 11 minutes ±16 minutes to complete a
revolution(Czeisler et al., 1999). Clearly, if left unadjusted the molecular clock
would slowly drift in and out of synchronization with the surrounding environment.
Therefore, the timing of the clock contains a certain amount of plasticity. The clock can re‐set its position in the cycle in response to daily environmental cues, with the most powerful cue being photoperiod. This daily coordination is called
“entrainment” and allows the molecular and physical behaviors of an organism to mirror appropriate environmental conditions. Clock plasticity is also beneficial
9
when considering adaptation to changes in day length due to the changing seasons
or migration and how day length affects physical security, food and mate availability. Thus, some of the same mechanisms, such as the hormone melatonin,
are involved in both circadian and seasonal rhythms (Wehr, 1997).
The Importance of Circadian Rhythms in Humans
Over the past few years the circadian clock has been implicated in a wide variety of human ailments and molecular processes. Alterations in circadian rhythms have been shown to cause a variety of human sleep disorders such as
Delayed Sleep Phase, and Familial Advanced Sleep Phase or non‐24‐hour sleep phase Syndromes (Watanabe et al., 2003). These disorders often appear in childhood and persist unless treated. The patterns of sleep irregularities are the result of a daily, endogenous period that is either significantly longer or shorter than the 24 hour environmental period. As a result of mutations in different clock genes, these individuals cannot adapt cyclic gene expression to stay in phase with their surroundings.
The primary candidates to carry mutations resulting in circadian phenotypes are the transcriptional activators of the clock and bmal gene families and the transcriptional repressors belonging to the period and cryptochrome families. A hypophosphorylation mutation in the human Period2 sequence has been isolated in people with Familial Advanced Sleep Phase Syndrome (Toh et al., 2001). A variable‐ number tandem‐repeat polymorphism in the coding region of human Period3 produces a much more subtle effect in sleep structure. There is no difference
10
between human period3 mRNA or melatonin rhythms in individuals homozygous for either the long or short allele of hper3. Yet, persons carrying the long allele display
an altered sleep structure such as marked increases in slow‐wave sleep and
electroencephalogram slow‐wave activity in non‐rapid eye movement sleep (Viola et al., 2007). Bright light therapy and/or the administration of melatonin at precise times have shown some success in treating these disorders (reviewed in Zisapel
2001)(Zisapel, 2001).
Subtle mutations in core clock genes influence not only sleep cycles but the
quality of sleep and the regulation of emotion. Stereotypic sleep/wake disturbances
have been characterized for a variety of psychiatric diagnoses such as Major
Depressive Disorder (MDD), Seasonal Affective Disorder (SAD), Bipolar Disorder
(BPD) and Schizophrenia(Lamont et al., 2007). While biological factors that cause
the sleep disorders associated with MDD have not been identified, certain allelic
combinations of the human clock, bmal and period3 genes may increase risk of
experiencing SAD. The characteristic sleep/wake disturbances seen in BPD patients
suggest a phase advanced circadian clock and several polymorphisms in the human clock gene have been associated with the disease.
Insomnia is often present in people with Schizophrenia. Not surprisingly, polymorphisms in human clock, human period1 and human period3 have been associated with the schizophrenia phenotype (Lamont et al., 2007). Smith‐Magenis syndrome (SMS) is another disorder with strong neurological and circadian phenotypes. It is caused by a deletion on chromosome 17 and results in developmental delay. Patients also present with severe sleep disturbances caused
11
by the daytime secretion of melatonin. This has been successfully corrected using beta‐blocker sun glasses in the morning and a clinically significant dose of melatonin in the evening (De Leersnyder, 2006; De Leersnyder et al., 2001).
The Clock, Cell Division and Cancer
Excessive exposure to light may produce health risks in people who possess a functional clock. Studies have shown that women who work swing or graveyard shifts are at a greater risk of developing breast cancer than women who work during the natural environmental photoperiod (Davis et al., 2001). The risk of developing cancer increases with the number of hours or years spent working in an environment that artificially extends the daily light period. It is thought that over‐ exposure to light results in a daily reduction of melatonin synthesis which may relate to the increased cancer risk (Davis et al., 2001).
Animal models have supported this hypothesis. Leon‐Blanco et al. (2003) reported that tumor size and metastasis were greatly reduced in vivo in mice that were given melatonin in their drinking water. The investigators’ in vitro studies further showed that application of melatonin to MCF‐7 cells (a human breast cancer cell line) reduced the activity of telomerase sub‐units TERT and TR as evidenced by a reduction in mRNA levels of these sub‐units (Leon‐Blanco et al., 2003). It has long been believed that telomerase is inappropriately active in cancer cells allowing the cells to proliferate. This study provided the first insight into a molecular mechanism that potentially accounts for the ability of melatonin to suppress tumor growth.
12
Because of these findings, the core clock genes are a newer subject of examination in patients suffering with cancer. One study of 55 Taiwanese women with breast cancer found that all three human period genes were found, not to contain base pair mutations, but to have become dysregulated in breast cancer cells
(Chen et al., 2005). Healthy cells in the same breast tissue exhibited normal human period1, 2 and 3 expression (Chen et al., 2005). A much larger American study of
Caucasian women discovered alleles of hper3 that varied in exonic length(Zhu et al.,
2005). One form increased breast cancer risk 1.7 fold among younger women. It is unknown if or how the additional length affected translation (Zhu et al., 2005). For men, predictors of prostrate cancer risk are very important. A large population‐ based case‐control study performed in China identified several variants in circadian clock genes but only one variant bore a phenotype. One human cryptochrome2 allele was associated with a 1.7‐fold increase in prostate cancer risk when compared to a second allele (Chu et al., 2007). It is most likely that these alterations in circadian gene regulation will not be limited to specific cancers. The Lin group found both sexes diagnosed with chronic myeloid leukemia produced impaired levels of several circadian genes (Chu et al., 2007). However only the promoter of human period3 showed an irregular methylation pattern, suggesting that the inactivation of human period3 could be responsible for the suppression of the remaining circadian transcripts (Yang et al., 2006).
Not surprisingly, the molecular clock has been implicated as a crucial contributor in all forms of cell division, not just the unchecked proliferation of cancer cells. Matsuo et al. (2003) studied the gene expression profiles of several cell
13
cycle genes in mice that carried mutations in core clock components. The expression profiles of many tested genes were altered when comparing mutant to wild‐type mice. Additionally, the group showed that wee‐1 (a primary gene that regulates entry into mitosis) was directly under the control of the clock (Matsuo et al., 2003).
In zebrafish, Danilova et al. demonstrated that melatonin promotes rapid cell proliferation in the developing embryo (Danilova et al., 2004).
The Vertebrate Circadian System
Circadian rhythms are generated within a three component system (Figure
1). Environmental cues entrain endogenous, intracellular clocks. These molecular clocks then produce rhythmic biochemical outputs, in melatonin synthesis and gene transcription. In mammals, the components of this system are geared toward specialized organs. The retina detects external light cues and transmits the signal through the retinal hypothalamic tract (RHT). The RHT terminates in the suprachiasmatic nucleus (SCN) which houses a master oscillator thought to communicate the phase of the circadian cycle to other body clocks. For instance, the
SCN connects with the pineal organ which is the primary site of melatonin synthesis
(Young, 2000). Except for the retina, the specialized tissues involved in circadian regulation, such as the SCN and the pineal are housed within the skull and encased in dense brain matter making them difficult to access, manipulate and study.
In lower vertebrates, elements of the molecular clock are highly conserved.
The pineal organ in non‐mammalian vertebrates is still the primary site of melatonin synthesis and secretion but the pineal also retains functioning
14
photoreceptors. This means the detection of light cues,
phototransduction/entrainment and circadian clock outputs all co‐reside in one,
accessible organ.
The Mammalian Molecular Clock
Circadian rhythms are driven by intracellular molecular clocks composed of positive and negative feedback loops (Figure 2). The vertebrate clock is best understood in mice, but the core proteins and methods of rhythmic gene transcription are conserved for all mammals. In mice, the positive limb is comprised of Clock and BMAL (brain and muscle arylhydrocarbon receptor nuclear translocator‐like protein) which heterodimerize and bind to an E‐Box regulatory sequence within gene promoters to promote transcription of the period and
cryptochrome gene families. The murine system carries 2 cryptochrome (cry) and 3
period (per) genes reviewed in (Reppert and Weaver, 2001; Reppert and Weaver,
2002). The cryptochrome gene products mCry1 and mCry2 must translocate the
Period proteins to the nucleus in order for Clock/BMAL mediated transcription to
be repressed, thereby inhibiting transcription of the cry and per genes. Additionally,
it is Cryptochrome proteins that physically bind to the positive regulatory
heterodimer and halt transcription (Kume et al., 1999). Together, the Period and
Cryptochrome proteins make up the negative regulatory limb of the circadian clock.
Since period and cryptochrome are no longer being transcribed the concentration of
their protein population wanes and eventually releases Clock/BMAL to activate
15
circadian transcription once more. This process of transcription, translation and degradation takes approximately 24 hours.
Mice lacking either mPer1 or mPer2 display arrhythmic behavior rhythms when confronted with long term darkness (Bae et al., 2001). The phenotype worsens in the mper1/mper2 double mutant (Bae et al., 2001). However, mPer1/mPer3 and mPer2/mPer3 double mutants behave similarly to the mPer1 or mPer2 single mutants respectively (Bae et al., 2001). This would indicate the only mPer 1 and 2 are required for normal clock function (Bae et al., 2001). However, the transfection into cell culture of Period proteins alone has little effect on transcription driven by Clock/BMAL (Kume et al., 1999).
While the mPer1 and 2 proteins do not affect clock transcriptional regulation directly, they have a crucial role in the daily entrainment of the clock. During the dark phase, mper1 and mper2 transcription can be induced if animals are exposed to light. This induction “re‐sets” the position of the clock in its revolution, effectively advancing the phase of the clock. Again, mPer3 differs from mPer 1 and 2. mper3 mRNA levels are not affected by light (Field et al., 2000; Zylka et al., 1998). It must be noted that, while mPer3 does not seem to carry a significant role in the running of the circadian clock, there is one subtle phenotype in mice mutant for mPer3.
These mice display largely normal activity rhythms with the exception that the circadian pacemaker completes one full revolution a full 30 minutes faster than controls (Shearman et al., 2000). Together these auto‐regulatory feedback loops generate a lag between the time of transcription and the time of repression. This lag is crucial for maintaining the predictable phases of circadian oscillations.
16
The Zebrafish Molecular Clock
Zebrafish are known to possess the same gene families that play a role in the mammalian clock. However, due to a whole genome duplication in the ray‐finned
fishes, teleosts tend to have duplicate copies of mammalian genes. To date, the
circadian genes cloned in the zebrafish include three copies each of clock and bmal,
four period homologs and eight members of the cryptochrome gene family (Sprague
et al., 2006).
The basic themes of the mammalian clock seem to be re‐occurring in lower
vertebrates, although precise feed‐back loops have not been fully illustrated. It has
been determined that the Clock/Bmal heterodimer is present in zebrafish and
promotes transcription of the cryptochromes (cry 1a, 1b, 2a, 2b)(Cermakian et al.,
2002; Whitmore et al., 1998). Additionally, the Cryptochromes feedback on the
Clock/Bmal heterodimer to inhibit their own transcription just like in mammals
(Ishikawa et al., 2002). Specifically, zCry1a has been shown to strongly repress
Clock/BMAL activity by binding to the heterodimer and forming a stable, DNA‐
bound Clock/BMAL/Cry1a triplex (Ishikawa et al., 2002). Homologs of period 1, 2, 3
(Delaunay et al., 2003) and period4 (Vallone et al., 2004) have been identified and cloned but their function within the clock remains to be characterized. We do know that zPer2 can bind to and retain the Clock/BMAL heterodimer in the cytoplasm, weakly inhibiting transcription in vitro (Hirayama et al., 2003). However, zPer2 also has some role, either directly or indirectly, as a transcriptional activator of the circadian regulated transcript serotoninNacetyltransferase2 (aanat2), which is
17
involved in melatonin biosynthesis (Ziv et al., 2005). Light induced transcription of zPer2 contributes to the high amplitude of transcripts characteristic of night time aanat2 expression (Ziv and Gothilf, 2006).
In addition to molecular clock components, many clock regulated genes have been identified in the eyes and pineal. These include genes encoding Aanat2, the rate limiting enzyme in melatonin synthesis (Gothilf et al., 1999), Inter‐retinoid binding protein (Irbp), a membrane bound protein that transports retinoids
(Whitmore et al., 1998) and Reverb‐alpha, an orphan nuclear receptor (Delaunay et al., 2000), which acts as a transcriptional repressor of bmal in mammals (Preitner et al., 2002).
These genes are regulated, in part, by Orthodenticle Homeobox 5
(Otx5)(Gamse et al., 2002), a transcription factor belonging to the Orthodenticle
Homeobox gene family. Members of this family in vertebrates (cone rod homeobox) and Drosophila (orthodenticle) are required for photoreceptor differentiation and photoreceptor specific gene transcription (Furukawa et al., 1997; Jacobson et al.,
1998; Shen and Raymond, 2004; Vandendries et al., 1996). In zebrafish, depletion of
Otx5 causes a marked decrease in these pineal specific transcripts at all time points, classifying Otx5 as a transcriptional activator. Loss of Otx5 has no effect on the transcriptional regulation of genes expressed constitutively in the pineal, including expression of otx5 gene itself. Additionally, depletion of Otx5 has no effect on pineal development or morphology (Gamse et al., 2002).
18
The Opsin Family
Opsin proteins are 7‐transmembrane G‐protein coupled receptors expressed in animal photoreceptors. These surface proteins detect light and act as the gateway to tranduce photons into cellular signals (Terakita, 2005). Typically, Opsins are thought of in relation to image formation. Rhodopsin is expressed in rod cells and contributes to dusk or night vision while Red, Green and Blue Opsins are found in cone cells and are required for daytime color vision. However, these visual Opsins as well as a variety of non‐visual Opsins are also found in the pineal organ of lower vertebrates (Terakita, 2005).
At the time this thesis work began Pineal Opsin (Pinopsin) had been identified in the chicken (Takanaka et al., 1998) but the expression pattern and function had not been elucidated. In the mouse retina, rod and cone opsins had been shown to be expressed rhythmically (Korenbrot and Fernald, 1989; von Schantz et al., 1999) as well as iodopsin in the chick retina (Larkin et al., 1999; Pierce et al.,
1993). However, the molecular mechanism behind these fluctuations or the function of rhythmic expression was unknown.
The first candidate photopigment for fish pineal photosensitivity was cloned in 1999 (Mano et al., 1999). Since it was expressed primarily in pineal and not retinal photoreceptors, the group named it Extra‐ocular Rhodopsin (Exorh). The amino acid sequence shown greater similarity to zebrafish (74%) and chicken
(77%) Rhodopsins than to any known non‐visual Opsin (Mano et al., 1999) (Figures
3 and 4).
19
Photoreception and Circadian Entrainment
Like the mammalian clock, zebrafish rhythms coordinate with re‐setting light input. Specifically, the melatonin associated enzyme aanat2 only cycles appropriately in the pineal organ when animals are introduced to some form of a light/dark transition. (Vuilleumier et al., 2006). In a similar study, zper2 transcription was found to be light inducible. Additionally, the presence of light‐ induced zPer2 protein was required for the onset of normal aanat2 rhythms. (Ziv et al., 2005).
Clearly, in zebrafish as well as mammals, light is a dominating factor for circadian clock entrainment. Early exposure to a light/dark transition has been shown to be important for establishing aanat2 and melatonin rhythms(Ziv et al.,
2005) (Kazimi and Cahill, 1999; Vuilleumier et al., 2006) as well as inducing per2 transcription (Ziv and Gothilf, 2006; Ziv et al., 2005). Many photoreceptive Opsins have been identified in the zebrafish pineal but their non‐visual function remains elusive (Kojima and Fukada, 1999). The regulation and function of Exorh has been the primary focus of my studies.
Studying the Circadian Clock
The study of circadian gene expression requires sampling embryos around the clock. One can easily imagine the fatigue suffered by a researcher in this field.
This chronic sleep deprivation greatly increases the risk of both personal and experimental accidents. To address this issue, I led the effort to design and build a
20
machine that could deliver pre‐set volumes of paraformaldehyde to individual
embryonic samples accurately and remotely (Pierce et al., 2007).
The Time Reaper 5‐Channel Automatic Liquid Dispenser (TimeR) proved to
be reliable at delivering precise quantities of liquid remotely. Additionally, I
demonstrated that use of the TimeR did not influence the results when using either whole mount mRNA in situ hybridization or whole mount immunohistochemistry.
This new technology can provide a safe and effective alternative for collecting samples at odd hours for zebrafish researchers in many fields.
Summary of Scientific Contributions
This introduction has detailed numerous components of the circadian clock
and factors contributing to clock regulation. However, our understanding of circadian gene transcription and how it relates to clock entrainment or phase shifting remains limited. As an Opsin photopigment, Exo‐rhodopsin (Exorh) is an excellent candidate to act in the phototransduction pathway responsible for entraining the circadian clock and mediating rhythmic melatonin synthesis.
My thesis work provides a number of insights into the expression pattern, transcriptional regulation and function of exorh. First, in collaboration with my fellow graduate student Ramil Noche, I demonstrated that Exorh is required as a positive factor in regulating gene transcription within the pineal (Pierce et al. Brain research in press). Exorh protein depletion results in severely reduced expression of the exorh gene itself and of the melatonin synthesis gene (aanat2) in the developing embryonic pineal organ.
21
I have also defined several proteins that control the expression pattern of exorh. Since exorh is predominantly expressed in the pineal organ, it is an excellent candidate to be regulated by Otx5. It has been shown previously that Otx5 is required to drive transcription of a variety of rhythmically expressed genes in the pineal (Gamse et al., 2002). I have added to this body of knowledge by showing that
Orthodenticle homeobox 5 (Otx5) is required for exorh transcription at all time points. This finding fits neatly with what is known about Otx5 but also demonstrates a novel function for Otx5 in opsin regulation.
Additionally, I demonstrated a novel function for the putative core clock protein zfPer3. While a clear phenotype for mPer3 has been elusive, this work identifies zfPer3 as a transcriptional repressor of exorh. Unlike other Period proteins, zfPer3 acts not on a core clock element, but rather, on an opsin pigment that may play a role in phase shifting circadian oscillations. Since expression of zfper3 itself it rhythmic (Delaunay et al., 2000), it is likely that the protein is also expressed at varying levels. The alternating presence and absence of zfPer3’s repressive effect generates a daily rhythm in exorh expression.
22
Figure 1: The Vertebrate Circadian System
Photoreceptive pineal cells receive light entraining cues from the environment. The photoreceptor cells contain endogenous oscillators which synchronize to the light input and produce rhythmic outputs such as melatonin synthesis and changes in gene transcription.
23
Figure 1: The Circadian System
(Adapted from)
24
Figure 2: The mammalian circadian clock
The circadian clock is made up of interlocking feedback loops that complete
one full cycle about every 24 hours. The transcription factors Clock and BMAL form
a heterodimer and drive transcription of the period and cryptochrome gene family members. Once translated, the Period and Cryptochrome proteins heterodimerize and re‐enter the nucleus where they act on Clock/BMAL to inhibit their own transcription. As Period and Cryptochrome protein levels fall, the Clock/BMAL
complex is free to initiate circadian transcription again.
25
Figure 2: The Mammalian Circadian Clock
http://www.har.mrc.ac.uk/img/model.jpg
26
Figure 3: Alignment of amino acid sequences across visual and pineal Opsins
After cloning and sequencing zebrafish exorh, Mano et al. (1999) performed an amino acid sequence alignment across the Rhodopsin sequence from chicken and zebrafish and also the visual opsin sequences from chicken. zfExorh aligned most closely with zebrafish Rhodopsin (74%) and chicken Rhodopsin (77%) as shown.
27
Figure 3: Alignment of amino acid sequences across visual and pineal Opsins
“Amino acid sequence of zebrafish exo‐rhodopsin. Putative transmembrane domains I–VII are indicated by horizontal lines. The residues which are identical to those of zfExorh are shown with white characters on black backgrounds. The amino acid identities % of Exo‐rhodopsin to the various opsins are shown at the ends of the sequences.”
Note the high sequence similarity between zfExor and zfRhod and chicken Rhod but not to the visual cone opsins.
Mano, H., D. Kojima, et al. (1999). "Exorhodopsin: a novel rhodopsin expressed in the zebrafish pineal gland." Brain Res Mol Brain Res 73(12): 1108.
28
Figure 4: Phylogenetic tree comparing zebrafish exorhodopsin to other vertebrate Opsins
“Phylogenetic analyses of opsins. A. A molecular phylogenetic tree of vertebrate rhodopsins. The nodes with closed circles represent species divergences, while the nodes with open circles represent gene duplications. The deepest root node (a) was determined by using the sequences of group M2 opsins chicken green, gecko blue and goldfish green1 as outgroup. B. Relationship between exo‐rhodopsin and retinal rhodopsin of teleosts. The deepest root node (d) was determined by using the sequence of river lamprey rhodopsin as outgroup. Rh, rhodopsin; ExoRh, exo‐rhodopsin.”
Mano, H., D. Kojima, et al. (1999). "Exorhodopsin: a novel rhodopsin expressed in the zebrafish pineal gland." Brain Res Mol Brain Res 73(12): 1108.
29
Figure 4: Phylogenetic tree comparing zebrafish exorhodopsin to other vertebrate Opsins
Mano, H., D. Kojima, et al. (1999). "Exorhodopsin: a novel rhodopsin expressed in the zebrafish pineal gland." Brain Res Mol Brain Res 73(12): 1108.
30
Chapter 2: The Time Reaper 5channel Automatic Liquid Dispenser: a new tool for studying zebrafish development
Lain X. Pierce1, David Harrison2, and Jennifer Ostrom Liang1,3
1Department of Genetics, Case Western Reserve University
2General Campus Maintenance, Case Western Reserve University
3Department of Biology, Case Western Reserve University
Pierce LX, Harrison D, Liang JO. The time reaper 5channel automatic liquid
dispenser: a new tool for studying zebrafish development.
Zebrafish 2007;4(3):16977.
31
Abstract Patterning of zebrafish and other vertebrate embryos proceeds according to consistent, predictable developmental time courses. Because zebrafish spawn primarily during the first few hours after dawn, many important developmental stages typically occur during the middle of the night. As an automatic, accurate way to fix embryos at these inconvenient times, we have developed the Time Reaper 5‐ Channel Automatic Liquid Dispenser (TimeR). The TimeR delivers up to 50 mL of liquid to embryos in a Petri dish at preset times. We have used the TimeR to deliver paraformaldehyde and fix zebrafish embryos at different stages of development. We find that the pattern of expression for a number of genes is indistinguishable between embryos fixed manually and with the TimeR. The TimeR is also suitable for fixing embryos for whole mount immunostaining, but care needs to be taken to find conditions that preserve the antibody’s epitope. The TimeR is inexpensive to make, and can be constructed using tools present in most machine shops. In addition to fixing embryos, the TimeR will be useful for any experiment that requires automatic delivery of milliliter amounts of liquid.
32
Introduction Zebrafish have a unique combination of characteristics that make them an excellent model system for studying vertebrate development, physiology, and the mechanisms that underlie many diseases. These characteristics include translucency of the embryo, the ability to do forward genetic screens, and the ease of depleting and over‐expressing proteins in vivo. However, one of the potential disadvantages is that zebrafish typically spawn shortly after dawn.(Westerfield, 2000) This can make it difficult to obtain and fix embryos at the developmental stages that occur during the night. Potential solutions include collecting embryos during the night or maintaining adult fish in several different light:dark time cycles. The former solution is severely disruptive to the scientist’s sleep, and can potentially lead to sleep deprivation and an increase in both experimental and personal accidents. The latter solution requires additional, relatively expensive equipment and can dramatically increase the number of fish that must be mainta ined. The developmental progression of zebrafish is linearly dependent on temperature.(Kimmel et al., 1995) Thus, it is possible to produce the desired stage at a more convenient time by altering the temperature of the embryos. However, this is not an appropriate solution in some cases. For example, many of the genes expressed during embryogenesis are regulated by the circadian cycle or by light.3‐22 Raising fish at a temperature significantly higher or lower than the standard 28.5 ˚C could potentially cause discord between the developmental, circadian, and environmental signals that control the expression of these genes. Further, in at least one case where temperature effects were examined, left‐right asymmetry in the brain was significantly affected. When embryos were raised at 23 ˚C, approximately 25% had abnormal brain laterality, compared to less than 2% of embryos raised at 28.5 ˚C.(Liang et al., 2000). This suggests there could be other alterations in morphogenesis upon raising or lowering the temperature of zebrafish embryos.
33
As an alternative, sleep friendly and cost‐effective method, we have designed the TimeR, a device that can automatically fix zebrafish embryos and larva at precise, preset times. The TimeR functions through gravity flow, with valves controlled by digital timers. It takes only a few minutes to program, and can be constructed by a typical machine shop. To evaluate the usefulness of the TimeR, sibling embryos fixed using the TimeR and manually were processed in parallel for whole mount RNA in situ hybridization (WISH). This comparison revealed no differences in the strength or pattern of signals between the two sets of embryos, demonstrating that the TimeR can be used as part of a protocol to accurately assay gene expression. Whole mount immunostaining was also successful on TimeR‐fixed embryos. However, the strength of the signal was more variable than in WISH, suggesting that the TimeR may not be useful for comparing the amount of protein in different samples. We anticipate that the TimeR will be useful for experiments that require embryos at specific stages of development, for time courses, and for experiments where manual handling of the embryos will alter the outcome.
Results and Discussion Design and use of the TimeR We sought a cost‐effective way to fix embryos at time points outside of normal working hours. A survey of commercially available equipment found solutions that were either very expensive (automatic digital burets, syringe dispensers, automated repetitive dispensers), only handled very small volumes (automated liquid transfer technologies), or not suited to function remotely (electronic burets/semiautomatic bottle‐top dispensers). Instead of pursuing one of these methods, we designed and built the TimeR, a simple device that can add fixative to embryos at exact, predetermined times. The TimeR consists of five channels, with each channel capable of independently dispensing liquid into one set of embryos (Figure 1). Each channel is comprised of a 50 mL conical reservoir, a base fitted to hold standard sized large (90mm X 15 mm) and small (60mm X 15 mm) Petri dishes, tubing to connect the reservoir to the dish, and a simple gated valve at the bottom of the reservoir that
34
opens in response to electrical input (Figure 2). Each valve is wired to a standard 3‐ prong plug that is in turn plugged into an individual programmable digital timer that can be set to open the valve up to a week in advance. The digital timer is connected to a standard surge protector by a 14 inch extension cord, allowing easy handling and viewing of the timer while programming. When the electrical impulse from the timer opens the valve, the pre‐measured volume of solution in the conical reservoir exits by gravity flow into the Petri dishes below. To prevent evaporation but still allow for gravity flow, the lid of a small Petri dish is placed as a “cap” over the conical reservoir.
The TimeR is an effective tool for fixing zebrafish embryos We have tested the TimeR extensively as a tool for fixing embryos for later processing by WISH. Embryos were produced by natural matings, staged according to Kimmel et al., 1995, and placed in large Petri dishes containing 25 mL of aquatic system water.(Kimmel et al., 1995) In some cases 0.003% phenylthiocarbamide (PTU) was added to prevent the appearance of pigmented cells. Up to 12 hours before the desired time of fixation, the Petri dishes containing the embryos were secured in the drilled depressions in the base of the TimeR, and 25 mL of 8% paraformaldehyde (PFA) was added to the TimeR reservoir. The digital timers were set to open the valve and dispense the liquid at the appropriate, pre‐set times. Importantly, embryos were maintained at a constant temperature of 28.5 ˚C so that the progress of development relative to time could be accurately predicted.(Kimmel et al., 1995) While the TimeR does not contain a heating element, it has been designed to fit neatly in small spaces such as incubators, chemical hoods or the benchtop in a temperature controlled facility. However, we have found that proper ventilation is required when using PFA, as this fixative can produce fumes that can damage or kill the developing fish. To compare the TimeR with standard methods, embryos at specific developmental stages were fixed either manually or with the TimeR and then assayed for the expression of several genes and proteins. The stages of embryos fixed by the timer matched the predicted stage, indicating that the TimeR worked
35
accurately. In addition, there was no detectable difference in the WISH signals between manually and TimeR fixed embryos (Figure 3). The pattern of the immunostaining was also very similar between manually and TimeR fixed embryos (Figure 4). However, the strength of the signal was more variable, and for both set of embryos decreased in strength with additional time left at the embryos physiological temperature of 28.5 ˚C (Figure 4). When embryos are fixed manually, they are typically placed at 4 ˚C immediately after the PFA is added or after a four hour incubation at room temperature. However, when the TimeR is used to automatically fix samples, the embryos can remain in warm (28 ˚C) fix for several hours. The decrease in signal after increased time in warm fix suggests that WISH and immunostaining on TimeR embryos could be less effective due to extensive crosslinking during the extra time in warm fix. To determine if this was the case, embryos were kept in 4% PFA for 6 days, with subsets of embryos transferred from 28.5 ˚C to 4 ˚C at different time points. Embryos were processed in parallel for WISH or for whole mount immunostaining. The signal from WISH was indistinguishable among embryos kept from 0‐ 121 hours in warm PFA (Figure 5A‐C). This was true even for probes that typically give very poor signals (Figure 5B and C). This suggests that embryos fixed automatically by the TimeR will continue to suitable for in situ hybridization with many or most antisense probes even if they remain at physiological temperature for many hours after the addition of PFA. However, we cannot rule out the possibility that some probes or some stages of development may not give as consistent results. As in the previous experiment, the pattern of the antibody staining was similar in all of the embryos but differed in strength (Figure 5D). However, there was no clear correlation between time in warm fix and strength of the signal (Figure 5D). This suggests that the TimeR can be used effectively for immunostaining, but that conditions that give consistent and strong staining will have to be determined for each antibody and each protein epitope. We conclude that the TimeR is an effective tool for preparing zebrafish embryos for in situ hybridization and immunohistochemistry. There are many types
36
of experiments that could also benefit from a system that adds liquid reagents at preset times, such as the application of mutagenic reagents, pharmaceuticals, or solutions to alter salt/pH conditions.
Materials and Methods The TimeR was constructed by the Case Western Reserve University Engineering Services and Fabrication Center and the wiring was assembled by Case Western Reserve University Campus Maintenance. The unit was constructed using standard plastic milling and fabrication techniques commonly available in most academic machine shops, and included the use of a Computer Numerical Control Milling Machine, a Bridgeport Milling Machine, and an Engine Lathe.
Mechanical Components The liquids to be dispensed were contained in 50 mL reservoirs made of PVC. The reservoirs were constructed by drilling out 1¾" outer diameter (OD), 2½" length (L) solid cylinders to create a well measuring 1½" inner diameter (ID), 2¼" deep. To facilitate delivery of the liquid, the bottom of the reservoirs were tapered 45° towards a ¼" ID opening at the bottom. The conical reservoirs were connected to the gated valves by a PVC pipe nipple. The 3/8" male National Pipe Thread (NPT) fittings on each end of the pipe nipple were connected to female NPT fittings on the bottom and top of the conical reservoirs and solenoid valves, respectively. The male fittings on each end of the pipe nipple were covered with Teflon tape to prevent leakage. The gated valves that control delivery of the liquid were Polypropylene Direct‐Acting Miniature Solenoid Valves (McMaster‐Carr, Atlanta, GA, USA). The key features of these valves are (1) they remain closed until electrically energized, and (2) the polypropylene offers higher chemical resistance than other possible compositions, such as PVC. The bottom of the solenoid valve was connected to a Nylon 3/8" male NPT fitting x ¼" multi‐barbed pipe to tube adaptor (McMaster‐Carr, Atlanta, GA, USA). Tygon tubing (3/8" OD, ¼" ID) was fitted tightly onto the barbed fitting at one end
37
(Fisher Scientific, Pittsburgh , PA), while the other end was threaded through a hole in the top of a Petri dish on the TimeR’s base. The base of the TimeR was composed of a 10½" X 16" X ½" sheet of clear polycarbonate designed to let light reach the embryos. 2¼" and 3½" D nested depressions were drilled under each channel of the TimeR to securely hold large and small Petri dishes.
Electrical Components The solenoid valves contained 18 American Wire Gauge (AWG) copper wires that were connected to 18AWG 3 prong wire conductors. The electrical connections between the valves and the wire conductors were contained within a water tight chamber composed of a 16" X 16" square tube of PVC. The wires from the valves entered the chamber through 1½" OD PVC tubes glued to ½" holes in the side of the chamber, and the 3 prong wire conductor left the chamber via waterproof strain relief fittings (McMaster‐Carr, Atlanta, GA). The ends of the chamber were made water tight by clamping 4½" X 3 ¼" X ½" pieces of PVC over Buna‐N Rubber Gaskets (McMaster‐Carr, Atlanta, GA). The plugs of the wire conductors were connected to Wall Mount Electronic Digital Timers (McMaster‐Carr, Atlanta, GA, USA), which then controlled the opening time of the solenoid valves. The input voltage of the digital timers is 120 Volts with a load rating of 16 Amps, and they can be programmed for as many as 8 on/off cycles in a week. Importantly, these timers can precisely control the timing of valve opening, as they can turn off or on within one minute. This is much faster than electromechanical timers, which have an on/off time of approximately 30 minutes. The plug of each channel’s wire conductor connects to a single digital timer. To protect the TimeR from electrical surges, all units are plugged into a power strip before being routed to the wall outlet. For ease of handling, each digital timer was plugged into the power strip using an 18 AWG 14" Power Strip Liberator (SmartHomeUSA.com, Smithtown, NY, USA).
Whole mount in situ hybridization
38
All embryos were raised and fixed with chorions intact unless natural hatching had occurred. Samples were fixed in 4% PFA in Phosphate Buffered Saline (PBS) at 4 °C for at least 24 hours before being washed with PBS + 0.1% Tween‐20. Transcripts of cyclops, collagen type II alpha 1a (col2a1a), eph receptor A4a (epha4a), exorhodopsin, goosecoid (gsc), and tropomyosin alpha (tpma) were detected by WISH as previously described (Liang et al., 2000; Mano et al., 1999; Sampath et al., 1998; Stachel et al., 1993; Thisse, 2004; Thisse et al., 1994; Xu et al., 1994; Yan et al., 1995). Stained embryos were visualized using a Zeiss Axioplan2 imaging microscope. Digital images were captured with a Zeiss AxioCam HRm camera (Carl Zeiss MicoImaging Inc. Thornwood, NY, USA) in conjunction with SPOT RTke 7.4 Slider Digital Camera along with SPOT Software version 4.5.9.1 (Diagnostic Instruments Sterling Heights, MI, USA).
Whole mount immunostaining Embryos labeled using the GFP antibody were fixed in their chorions while the larvae labeled using the zpr‐1 antibody hatched naturally before they were fixed. Whole mount immunostaining was achieved by modifying a published protocol.(Gerald B. Downes, 2002) Briefly, embryos and larvae were fixed and then dehydrated in methanol before being rinsed with 0.5% Triton‐X100 in PBS three times for five minutes. Larvae were exposed to 0.1% collagenase for 90 minutes, blocked for one hour in PBDT (1% Bovine Serum Albumin, 1% Dimethyl Sulphoxide, and 0.001% Triton‐X100 in PBS). The zpr‐1 antibody was diluted to 1:200 in PBDT and incubated overnight at 4 °C.(Liu et al., 2007) The following day, samples were washed four times for one hour in 0.5% Triton‐X. Goat anti‐mouse Oregon Green (Molecular Probes Carlsbad, CA, USA) was diluted to 1:2000 in PBDT and incubated overnight at 4°C. The GFP antibody (Clontech Mountain View, CA, USA) was diluted to 1:200 in PBDT and the GFP protein in the floating head: GFP transgenic line was detected using goat anti‐rabbit Alexa Fluor 594 (Molecular Probes Carlsbad, CA, USA) at a dilution of 1:2000.(Gamse et al., 2003) After addition of the antibody, samples were covered in aluminum foil to prevent photobleaching of the secondary
39
antibody. On the third day, larvae were rinsed three times for one hour each in PBS before being prepared for microscopy. Images were captured as described above.
Acknowledgements The authors thank Drs. Steven Farber (Carnegie Institution of Washington) and Brian McDermott (Case Western Reserve University) for their helpful comments on the manuscript, Dr. Joshua Gamse (Vanderbilt University), Dr. Marnie Halpern (Carnegie Institution of Washington), Dr. Victoria Prince (University of Chicago), Dr. Steve Wilson (University College London) and Drs. Bernard and Christine Thisse (Institut de Génétique et Biologie Moléculaire et Celluaire) for generously sharing reagents and fish strains. Kristine Ilagan, Ramil Noche, and Po‐Nien Lu (Case Western Reserve University), and Dr. Christine Beatty and Dr. Bridget Arduini (Ohio State University) provided valuable technical help. This work was supported in part by Research Grant No.T32 HD07104‐29 Normal and Abnormal Development from the NIH/CHHD Institutional Pre‐Doctoral Research Training Grant (L.X.P.) and by an NSF Academic Careers in Engineering and Science Opportunity Grant (J.O.L).
40
Figure 1: The TimeR.
(A) Front and (B) aerial views of the TimeR show the five independent channels housed in one unit and indicate its features and dimensions.
Note that individual channels are horizontally staggered to reduce the overall size of the unit. PVC (dark grey) is used for the majority of the TimeR due to its chemical resistant properties as well as its affordability and availability in a number of shapes and sizes. So that the embryos are exposed to normal light levels, the base is constructed from the translucent polycarbonate, which also has excellent chemical resistance. All measurements are in inches. CT=conical taper, ID=internal diameter.
41
Figure 1
42
Figure 2: Flow of liquids through the TimeR.
Liquid (in our case paraformaldehyde) travels from the conical reservoir through the pipe nipple. When the solenoid valve is triggered to open by an electrical impulse, the liquid empties by gravity flow into the Tygon tubing attached below the solenoid valve by a nylon barbed fitting. Plastic tubing is fed through a hole drilled into the lid of a large or small Petri dish. The Petri dish is seated and aligned beneath the reservoir and valve by a predrilled depression in the base. All units are in inches. AWG=American wire gauge, ID=inner diameter.
43
Figure 2
44
Figure 3: The strength and pattern of the signal from WISH is
indistinguishable between embryos fixed with the TimeR and embryos fixed manually.
Sibling embryos were raised in the same temperature controlled incubators, and then fixed at the same times manually or using the TimeR. They were then processed in parallel for WISH to assay the expression of the indicated genes. A, B, E, and F are dorsal views, anterior to the top. C, D, G, and H are lateral views, anterior to the left, dorsal to the top. AF are images of the entire embryo, and G, H are images of the tail just above the hind yolk. fp=floorplate, hc=hypochord, hpf=hours post fertilization, nc=notochord, pp=prechordalplate. Scale bar=100 2m A‐F, 50 2m
G‐H.
45
Figure 3
46
Figure 4: Whole mount immunostaining on TimeR and manually fixed
embryos.
Sibling embryos were raised in the same temperature controlled incubators
then fixed at the same times manually or using the TimeR. Subsets of embryos were
either moved to 4°C immediately or after two days. They were then processed in
parallel for whole mount immunostaining to assay the expression of A, B Green
Fluorescent Protein (GFP) expression in the notochord (open arrowheads) of the
floating head:enhanced GFP transgenic line, or CF staining of the pineal
photoreceptors (open arrowheads) with the antibody zpr‐1. All views are lateral
with anterior to the left and dorsal to the top. A, B are images of the trunk near the
posterior end of the hind yolk. CF are images of the head. Scale bars=50 2m A‐B,
150 2m C‐F.
47
Figure 4
48
Figure 5: Temperature of fixative does not diminish the effectiveness or accuracy of either WISH or Immunostaining.
Sibling embryos were raised at 28.5 °C and fixed at approximately 24 hpf (A,
B), the 21 somite stage (C), or 79 hpf (D). Sets of embryos were transferred from
28.5 °C to 4 °C over the next 5‐6 days, maintained at 4 °C for the indicated time, and then transferred to 100% methanol and stored at ‐20 °C. The embryos were then
processed in parallel for WISH (A, B, C) with antisense probes for the indicated
genes, or for whole mount immunohistochemistry (D) with the indicated antibody.
A contains images of the entire embryo, with closed arrowheads indicating the
anterior midbrain (amb), caudal notochord (cn), and rhombomeres (r). B, C, and D
contain images of the head, with the pineal organ (open arrowheads) and eyes (e)
indicated. Note that at this stage of development, exorhodopsin is expressed in only a
few cells of the development pineal and cyclops transcripts in the pineal are difficult
to detect.18, 23, 24, 34 Despite this, the strength of the WISH signals across the
panels of B and
C are similar. All images are anterior left, dorsal to the top. Scale bars=1002m.
49
Figure 5
50
AVAILABLE FROM MCMASTERCARR, ATLANTA, GA, USA
PART DESCRIPTION SPECIFICATIONS NUMBER Polypropylene Solenoid Valve Wire 1/2" NPT Female, 150 PSI, 120 7877K53 Leads VAC Durable Nylon Multi‐Barbed Tube 1/4" Tube ID X 3/8" NPT Male 5372K113 Fitting Adapter Pipe
Nylon Liquid‐Tight Cord Grip 1/2" NPT, .20"‐.35" Cord 69915K54 Fitting Straight Standard Diameter
Buna‐N Rubber Sheet Gasket 8525T22 1/16" Thick, 24" X 24" Gray PVC (Type I) Square 3" Square, .098" Wall 85095K84 Tube Thickness, 5' Length
Gray PVC (Type I) Round Tube 8749K11 1‐5/8" OD X 9/16" ID Gray PVC (Type I) Rod 8745K43 1/2" Diameter Gray PVC (Type I) Rod 8745K24 1‐3/4" Diameter Gray PVC (Type I) Rectangular Bar 8740K59 1/2" Thick, 3" Width Thick‐Wall Dark Gray PVC 3/8" Pipe X 1‐1/2" L, Threaded 4882K23 Threaded Pipe Nipple Ends, Schedule 80
Polycarbonate Sheet, 8574K45 1/2" Thick, 12" X 24" Clear
Digital Plug‐in Clock‐Actuated 7001K25 2 Outlets , 120 VAC, 15 Amps Switch Outlet Mount Two Conductor Power Cord NEMA 1‐15 Plug, SPT‐1‐Flat 7248K22 18/2 Awg, 9' Length
AVAILABLE FROM FISHER SCIENTIFIC, PITTSBURGH, PA, USA PART DESCRIPTION SPECIFICATIONS NUMBER
Saint‐Gobain* Tygon* R‐3603 Clear 14‐169‐ I.D.: 1/4 in.; Wall Thickness: Laboratory Tubing ‐‐ 10 ft. 3C 1/16 in.; O.D.: 3/8 in.
AVAILABLE FROM http://www.SmartHomeUSA.COM, USA PART DESCRIPTION SPECIFICATIONS NUMBER 121‐ Power Strip Liberator, 14" 3‐prong 18AWG, 125v/10a 2550
51
Chapter3: Novel functions for Period 3 and Exorhodopsin
in rhythmic transcription and melatonin biosynthesis within the zebrafish
pineal organ
Lain X. Pierce1, Ramil R. Noche2, Olga Ponomareva2, Christopher Chang2, and
Jennifer O. Liang1,2
1Department of Genetics
2Department of Biology
Case Western Reserve University
10900 Euclid Avenue
Cleveland, OH 44106
Pierce LX, Nocke RR, Ponomareva O, Chang C and Liang JO
Brain Research in press
52
Abstract Entrainment of circadian clocks to environmental cues such as photoperiod ensures that daily biological rhythms stay in synchronization with the Earth’s rotation. The vertebrate pineal organ has a conserved role in circadian regulation as the primary source of the nocturnal hormone melatonin. In lower vertebrates, the pineal has an endogenous circadian clock as well as photoreceptive cells that regulate this clock. The zebrafish opsin protein Exo‐rhodopsin (Exorh) is expressed in pineal photoreceptors and is a candidate to mediate the effects of environmental light on pineal rhythms and melatonin synthesis. We demonstrate that Exorh has an important role in regulating gene transcription within the pineal. In developing embryos that lack Exorh, expression of the exorh gene itself and of the melatonin synthesis gene serotonin Nacetyl transferase 2 (aanat2) are significantly reduced. This suggests that Exorh protein at the cell membrane is part of a signaling pathway that positively regulates transcription of these genes, and ultimately melatonin production, in the pineal. Like many other opsin genes, exorh is expressed with a daily rhythm: mRNA levels are higher at night than during the day. We find that the transcription factor Orthodenticle homeobox 5 (Otx5) activates exorh transcription, while the putative circadian clock component Period 3 (Per3) represses expression during the day, thereby contributing to the rhythm of transcription. This work identifies novel roles for Exorh and Per3, and gives insight into potential interactions between the sensory and circadian systems within the pineal.
53
Introduction Circadian rhythms are physiological and behavioral changes that occur with a period of approximately 24 hours. These oscillations are driven by an intracellular molecular clock and are self‐sustaining even in the absence of environmental cues. However, the clock is entrained each day by light or other external stimuli. Since the period of circadian clocks is typically slightly longer or shorter than 24 hours, this entrainment has a critical role in ensuring that daily biological rhythms stay in synchronization with the world around. In vertebrates, the pineal organ has a central role in the regulation of circadian rhythms as the primary source of circulating melatonin (Simonneaux and Ribelayga, 2003). Melatonin is made during the night and acts to regulate circadian and seasonal rhythms, including daily sleep/wake cycles. In mammals, melatonin also feeds back to regulate the primary circadian clock located in the suprachiasmatic nucleus (SCN), and thus serves as a strong entraining factor (Skene et al., 1996). Poor regulation of pineal melatonin rhythms has been related to sleep disorders, feelings of fatigue and confusion, and an increase in cancer risk (Arendt, 2006; Bartsch and Bartsch, 2006; Reid and Burgess, 2005; Richardson and Tate, 2000). Entrainment of mammalian pineal rhythms to environmental light is mediated by opsin proteins located in retinal photoreceptor and ganglion cells. These photoreceptive cells entrain the SCN clock, which then controls pineal rhythms through a multisynaptic pathway (Korf, 1994). In contrast, the pineal of lower vertebrates contains photoreceptive cells that entrain a endogenous pineal circadian clock, likely through an opsin‐mediated signaling cascade that is very similar to that found in retinal photoreceptors (Korf, 1994). In zebrafish, pineal photoreceptors have been implicated in several responses to light, including entrainment of the circadian clock, triggering the onset of pineal rhythms during development, and mediating acute suppression of melatonin by a light pulse during the dark period (Cahill, 1996; Vuilleumier et al.,
54
2006; Ziv and Gothilf, 2006; Ziv et al., 2005; Ziv et al., 2007). The pineal opsin protein Exorh is expressed in pineal photoreceptors from early embryogenesis to adulthood and is thus an excellent candidate to be mediating these light responses (Asaoka et al., 2002; Mano et al., 1999; Vuilleumier et al., 2006). Consistent with this, the action spectrum of acute melatonin suppression in isolated adult pineal organs suggests that Exorh is one of several opsins involved in this process (Ziv et al., 2007). Many of the vertebrate opsin genes involved in circadian and visual photoreception are rhythmically expressed (Bailey et al., 2003; Bailey and Cassone, 2004; Bailey and Cassone, 2005; Chaurasia et al., 2005; Dalal et al., 2003; Halstenberg et al., 2005; Hannibal et al., 2005; Holthues et al., 2005; Korenbrot and Fernald, 1989; Kucho et al., 2005; Larkin et al., 1999; Li et al., 2005; Pierce et al., 1993; Sakamoto et al., 2004; Sasagawa et al., 2003; Takanaka et al., 1998; von Schantz et al., 1999). We find that like these other opsin genes, exorh is expressed with a significant difference in day and night mRNA levels. Through in vivo over‐ expression and loss‐of‐function experiments we have identified three proteins that regulate exorh transcription. The pineal transcription factor Otx5 is required to activate exorh expression within the pinealocytes. The circadian regulated factor Period 3 (Per3), whose function in mammals has remained elusive, has an important role in influencing the timing of exorh expression. Finally, Exorh protein is required for expression of its own gene. These findings suggest a model in which tissue‐ specific factors and clock components act together to control the spatial and temporal pattern of exorh expression. In addition, we provide the first direct evidence for an in vivo function of Exorh. In addition to regulating transcription from its own gene, Exorh protein is required for high expression of aanat2, which encodes the penultimate enzyme in the melatonin synthesis pathway. Interestingly, the reduced expression of aanat2 in Exorh‐depleted embryos closely matched aanat2 expression in embryos raised in constant darkness. This suggests that Exorh could be mediating the light‐dependent initiation of aanat2 transcription and melatonin production in the developing pineal.
55
Results exorh transcription is rhythmic The exorh gene is expressed in pineal photoreceptors from approximately 18 hours post fertilization (hpf) to adulthood (Asaoka et al., 2002; Falcon et al., 2003; Mano et al., 1999; Vuilleumier et al., 2006). Vuilleumier and colleagues recently reported that exorh is expressed with a daily rhythm, with higher expression during the dark phase of the circadian cycle (Vuilleumier et al., 2006). However, they found that the day/night differences in expression were not statistically significant (Vuilleumier et al., 2006). Consistent with this, we also found differences in the day and night levels of exorh transcripts (Figure 1). However, in contrast to this earlier study, we find that the level of exorh transcripts were often significantly lower during the day than during the night (Figure 1C and Supplementary Table 1). Since Vuilleumier et al. and this study both used whole mount RNA in situ hybridization (WISH), which is a semi‐quantitative technique, this small discrepancy in our results is likely due to subtle differences in experimental conditions.
Otx5 activates exorh transcription The transcription factor Otx5 is expressed in the developing and mature pineal, and has been previously shown to be important for the expression of several circadian‐regulated pineal genes (Gamse et al., 2002). Otx5 is also a strong candidate to regulate the transcription of exorh. The exorh promoter contains three putative Otx binding sites 5’ to the translation start site. Mutation of these sites attenuates the ability of the exorh promoter to drive transgene expression in the pineal (Asaoka et al., 2002). To test whether Otx5 is required for exorh transcription, embryos were injected with an antisense morpholino (MO) that binds to the translation start site in the otx5 mRNA (otx5 MO). This MO has been previously shown to specifically and effectively knock down Otx5 protein levels (Gamse et al., 2002). Control embryos were injected with a MO containing 4 base pair mismatches (otx5 MIS) (Gamse et al., 2002). Injected embryos were raised in a light/dark (LD) cycle, fixed at regular intervals over a 24 hour period, and assayed for exorh expression. Control‐injected
56
embryos had a rhythmic pattern of exorh expression similar to that of uninjected fish (Compare Figure 1B, C with 2A, B). In contrast, Otx5‐depleted embryos had severely reduced or undetectable levels of exorh mRNA at all time points tested (Figure 2A, B). This finding indicates that Otx5 is required for exorh transcription in pineal photoreceptors. To determine whether Otx5 is capable of driving exorh expression in cells outside of the pineal, we took advantage of the exorh:Green Fluorescent Protein (exorh:GFP) transgenic line (Asaoka et al., 2002). Single blastomeres of 8‐16 cell stage zebrafish embryos were co‐injected with otx5 and Red Fluorescent Protein (RFP) mRNA. Control embryos were co‐injected with ‐galactosidase ( ‐gal) and RFP mRNA (Figure 2C). As co‐injected mRNAs are inherited together, the RFP serves as a tracer to identify the progeny of the injected cell. Embryos were allowed to develop until approximately 24 hpf and then analyzed by fluorescence microscopy. Embryos injected with RFP mRNA alone developed normally and the RFP‐ positive cells were scattered throughout the embryo. Further, ectopic GFP expression was present only very rarely in cells outside of the pineal (Figure 2C, Table 1). In embryos over‐expressing Otx5, the RFP/Otx5‐positive cells tended to be clustered together. Further, many of the red fluorescent cells were also green fluorescent, indicating that the exorh:GFP transgene was being expressed (Figure 2C, Table 1). As has been previously reported, otx5 mRNA injections also caused developmental defects, likely due to the role of Otx proteins in patterning the forebrain (Figure 2C)(Gamse et al., 2002).
Per3 negatively regulates exorh transcription during the day otx5 mRNA is expressed at constitutively high levels, and Otx5 protein is required for the activation of pineal genes expressed at dawn, during daylight, and at night, suggesting that it is active at all times of day (Gamse et al., 2002). Thus, it is unlikely that Otx5 alone could control the rhythmic expression of exorh. Instead, we hypothesized that the timing of exorh transcription is regulated by a rhythmically expressed factor, such as a component of the pineal circadian clock.
57
The putative clock component Per3 is a potential candidate for this role because the per3 gene is expressed widely in the developing zebrafish brain with a strong daily rhythm that peaks at dawn (Delaunay et al., 2000). To determine whether per3 expression is present within pinealocytes, the brains of 3 days post fertilization (dpf) fish were divided into left and right halves by a sagittal cut through the midline. At this stage, the pineal has begun to evaginate from the forebrain, and in bisected embryos appears as a distinct domain separated from the rest of the brain by a translucent area that may correspond to the developing saccus dorsalus (Figure 3A) (Kappers, 1965; Liang et al., 2000). otx5 expression can be easily distinguished within this domain (Figure 3A). per3 transcripts were also detected in the pineal domain at dawn, when per3 expression in the brain is at its highest point (Figure 3A)(Delaunay et al., 2000). In contrast, expression in the pineal was severely decreased at a night time point, when expression in the surrounding neural tissue was also low (Figure 3A)(Delaunay et al., 2000). Per proteins typically regulate the timing of gene expression by repressing gene transcription (Reppert and Weaver, 2001). Consistent with this, we found that exorh transcripts were up‐regulated during the day in embryos injected with a per3 MO (Figure 3B, C). In contrast, exorh mRNA levels were unaffected at time points during the dark period or in embryos injected with a control MO containing 5 base pair mismatches (per3 MIS)(Figure 3B, C). This indicates that Per3 is required to suppress exorh mRNA levels during the light period of the circadian cycle. aanat2 is a circadian‐regulated gene that encodes an enzyme required for melatonin biosynthesis in the pineal (Gothilf et al., 1999). aanat2 is expressed in a similar phase to exorh, with high mRNA levels at night and very low levels during the day (Gamse et al., 2002; Gothilf et al., 1999). Further, like exorh, aanat2 transcription in the pineal is activated by Otx5 (Gamse et al., 2002). However, in contrast to the results for exorh, there were no apparent effects on aanat2 transcription in Per3 depleted embryos (Figure 3B). These data suggest that Per3 is present in the pineal, and could be acting directly within pinealocytes to influence exorh expression. The per3 promoter is able to drive circadian expression of luciferase in adult zebrafish pineal organs
58
(Kaneko et al., 2006). Thus, it is possible that the role of Per3 in regulating exorh rhythms could continue through adulthood.
Loss of Exorh protein reduces transcription from the exorh promoter The early pineal‐specific expression of Exorh makes it an excellent candidate to function as a major light‐sensing photopigment in the developing pineal (Falcon et al., 2003; Ziv et al., 2005). Towards testing the function of Exorh, we designed a MO that binds to the exon 1/intron 1 junction of the exorh genomic sequence (exorh sp MO). Embryos injected with exorh MO had severely reduced levels of exorh mRNA compared to embryos injected with a control MO (Figure 4A, B). Embryos were analyzed using a probe that binds to the 3’ end of the exorh open reading frame and recognizes both correctly and incorrectly spliced transcripts (Mano et al., 1999). Thus, the reduced expression suggests that exorh transcripts were being degraded due to improper splicing, and that the exorh MO effectively knocks‐down Exorh protein. The normal onset of rhythmic exorh transcription requires exposure of embryos to a light/dark or dark/light transition (Vuilleumier et al., 2006). Since Exorh protein is likely involved in pineal photoreception, this raises the possibility that Exorh could regulate the expression of its own gene. To test this, we injected exorh sp MO into embryos carrying the exorh:GFP transgene (Asaoka et al., 2002). As this transgene does not contain the exorh sp MO binding site, its expression cannot be directly affected by the injections. Despite this, fluorescence in the pineal was significantly reduced in Exorh depleted embryos compared to embryos injected with a control MO (Figure 4C, D, G). To verify this result, the experiment was repeated using a second, non‐ overlapping MO that binds to the translation start site of the exorh mRNA (exorh atg MO). Since start site MO bind to the target mRNA but do not directly affect the levels of transcripts, the effects of this MO could be assessed by measuring expression of the endogenous gene (Nasevicius and Ekker, 2000). Consistent with the exorh sp MO results, injection of the exorh atg MO caused significantly reduced expression of exorh (Figure 4I, J, K, Supplementary Figure 1).
59
Although loss of opsin proteins can lead to photoreceptor cell death (Humphries et al., 1997; Kumar and Ready, 1995; Lem et al., 1999; Rosenfeld et al., 1992), we found no evidence for loss of photoreceptors in the Exorh depleted fish. The embryonic pineal is largely composed of photoreceptors (Asaoka et al., 2002; Gamse et al., 2002; Gamse et al., 2003; Masai et al., 1997). Therefore, if photoreceptor cells were dying, there would be a significant change in the size of the pineal. However, the length and width of the pineal otx5 expression domain, which encompasses both photoreceptor cells and projection neurons, was unaltered in fish injected with either exorh MO (Figure 4E, F, H, L). Therefore, it is unlikely that the reduction in exorh:GFP transgene expression was due to loss of photoreceptor cells. Instead, this suggests that the decrease was caused by a down‐regulation of exorh promoter activity.
Exorh does not initiate transcription of red opsin Being a photoreceptive organ, the pineal in zebrafish expresses a number of opsins besides exorh, including the same RGB cone pigments found in the eye (Robinson et al., 1995). The fact that activation of an Exorh‐dependent pathway is important for transcription of exorh in the pineal, suggests that initiation of this same pathway could be required for expression of other pineal opsins. To test this, we determined the effect of Exorh depletion on the expression of opsin 1(cone pigments) longwavesensitive, 1 (opn1lw1), formerly known as red opsin (Robinson et al., 1995). opn1lw1 expression was not significantly different in exorh atg MO and control injected embryos (Figure 5A, C). In contrast, exorh transcripts were severely reduced in exorh atg MO injected embryos from the same experiment (Figure 5A, C).
Exorh is required for high levels of aanat2 expression Expression of the melatonin biosynthetic gene aanat2 is high at night and very low during the day, accounting in part for the vastly higher levels of melatonin made during the dark period of the circadian cycle (Gothilf et al., 1999). Previous
60
work has demonstrated that the onset of aanat2 transcription in zebrafish requires exposure of embryos to a transition in lighting conditions from dark to light or from light to dark. We found that depletion of Exorh protein caused a significant reduction of the levels of aanat2 expression in developing embryos (Figure 5A, B). Again, the control experiment done in parallel showed the expected reduction in exorh transcripts following Exorh depletion (Figure 5A, B). This suggests that Exorh could be wholly or partially responsible for triggering aanat2 transcription in response to changes in lighting conditions.
Discussion Exorh protein is important for gene transcription in the zebrafish pineal organ Exorh protein shares a 70% sequence identity with the photoreceptive retinal opsin protein Rhodopsin, and is predicted to have seven transmembrane domains typical of G‐protein coupled receptors (Mano et al., 1999). These observations, together with the early pineal‐specific expression of exorh, are consistent with Exorh functioning as a major light‐sensing molecule in the developing zebrafish pineal. Previous work demonstrates that expression of exorh and aanat2 in the pineal does not initiate normally when embryos are raised in constant darkness (Vuilleumier et al., 2006; Ziv et al., 2005). For instance, expression of aanat2 is reduced by 58‐68% when embryos are moved to constant darkness shortly after fertilization (Ziv et al., 2005). Here, we provide some of the first evidence that Exorh is involved in this light response in developing embryos. In particular, MO‐mediated depletion of Exorh protein caused a very similar reduction (>50%) as raising embryos in darkness. This suggests a mechanism wherein light received by Exorh protein initiates a signaling cascade that ultimately results in onset of high levels of aanat2 and exorh transcription (Figure 6). The most likely role for Exorh is as a pineal photopigment. Consistent with the pineal photoreceptors being active at these early stages, other potential components of a pineal phototransduction cascade, such as the components of transducin heterotrimeric G‐proteins, are also expressed in the developing pineal
61
(Brockerhoff et al., 2003; Liu et al., 2007; Shen and Raymond, 2004). However, we do not yet know how the phototransduction cascade interfaces with the pineal transcriptional machinery. Previous work on the aanat2 regulation by Yoav Gothilf and colleagues gives some insight into how this might occur. The light‐dependent onset of aanat2 transcription in the pineal requires Per2 (Ziv and Gothilf, 2006; Ziv et al., 2005). Transcription of the per2 gene itself is induced by light (Cermakian et al., 2002; Ziv and Gothilf, 2006; Ziv et al., 2005). Thus, Per2 has the potential to act as an intermediate between Exorh on the cell membrane and clock components such as Clock/BMAL on the aanat2 promoter (Figure 6).
The pattern of exorh transcription is controlled by a combination of tissue specific and rhythmic factors This study demonstrates that exorh expression has a significant daily rhythm in the embryonic and larval pineal photoreceptors of zebrafish. Further, we define the in vivo functions of three proteins, Exorh itself, Otx5, and Per3 in the regulation of the exorh expression pattern (Figure 6). We find that Exorh protein is required for normal transcription from its own promoter, suggesting that a phototransduction pathway containing Exorh regulates exorh transcription. Further, we find that Otx5 and Per3 have complementary roles. Our loss‐ and gain‐of‐function experiments strongly suggest that Otx5 functions as an activator to induce exorh transcription in the cells of the pineal. In contrast, Per3 influences the phase of expression by suppressing transcription during the day. Many other opsin genes are also expressed with a strong daily rhythm (Bailey et al., 2003; Bailey and Cassone, 2004; Bailey and Cassone, 2005; Chaurasia et al., 2005; Dalal et al., 2003; Halstenberg et al., 2005; Hannibal et al., 2005; Holthues et al., 2005; Korenbrot and Fernald, 1989; Kucho et al., 2005; Larkin et al., 1999; Li et al., 2005; Pierce et al., 1993; Sakamoto et al., 2004; Sasagawa et al., 2003; Takanaka et al., 1998; von Schantz et al., 1999). However, the function of this rhythmic expression is not well understood. One possibility is that transcription is rhythmic in order to drive rhythmic expression of the Exorh protein. For instance, the cyclic pattern of exorh closely matches the expression of several cone opsin
62
genes, which peak at dusk and remain highly expressed through the dark period (Halstenberg et al., 2005; Korenbrot and Fernald, 1989). Interestingly, cone cells are not used for vision during this period of high expression. Korenbrot and Fernald proposed that it is metabolically advantageous to accumulate opsin protein during the dark period before rapid turnover begins at dawn (Korenbrot and Fernald, 1989), and this could be the case for Exorh as well. Another possibility is that Exorh is required for a critical function during the night. There is some evidence to support this hypothesis, as Exorh has been implicated in the acute suppression of melatonin levels that occurs when adult zebrafish are exposed to a light pulse during the night (Ziv et al., 2007). However, rhythmic transcription is not always followed by cyclic expression or cyclic activity of the encoded protein. For instance, expression of the interphotoreceptor retinoid binding protein (irbp) gene in the zebrafish retina has a strong circadian rhythm, while protein levels remain essentially constant (Cunningham and Gonzalez‐ Fernandez, 2000). Similar to the case with cone opsin, it is thought the high expression of irbp mRNA during the day compensates for high turnover of IRBP protein. Otx5 has now been shown to be required for the expression of four rhythmically expressed pineal genes (exorh, aanat2, irbp, and reverbalpha), but not for the expression of three non‐rhythmic pineal genes (otx5, cone rod homeobox (crx), and floating head) ((Gamse et al., 2002) and this study). Together, this suggests that the role of Otx5 is to activate the expression of circadian genes within pinealocytes. Otx5 likely acts by binding to the promoters of its target genes, as the exorh and aanat2 promoters both have three putative Otx binding sites (Appelbaum et al., 2005; Asaoka et al., 2002). However, we think it unlikely that Otx5 is involved in generating the rhythm of expression. Instead, the evidence suggests that Otx5 is constitutively active. Otx5 depletion causes loss of exorh expression at all time points tested. Further, previous work demonstrates that Otx5 is required for the expression of genes expressed at night (aanat2), day (irbp) and dawn (reverb alpha) (Gamse et al., 2002).
63
In support of a role for Otx5 as a transcriptional activator of pineal genes, ectopic expression of Otx5 induces transcription from the exorh and aanat2 promoters in cells outside of the pineal and eye (this study and (Appelbaum et al., 2005)). However, there is an interesting exception to the role of Otx5 as a transcriptional activator. Although Otx5 is expressed widely in the developing eye, it appears to have little or no role in regulating retinal genes. For instance, aanat2 and exorh are expressed only in a small subset of the Otx5 positive cells in the eye, indicating that Otx5 is not sufficient to activate expression of these genes in most retinal photoreceptors (Gamse et al., 2002; Vuilleumier et al., 2006). Similarly, depletion of Otx5 causes severely reduced pineal expression of irbp and the G protein T1 subunit genes, while their retinal transcription remains unaffected (Chen et al., 2007; Gamse et al., 2002). Conversely, depletion of the related Otx family member Crx reduces transcription in the eye but not in the pineal (Chen et al., 2007; Gamse et al., 2002; Shen and Raymond, 2004). A probable explanation is that other transcriptional regulators cooperate with Otx5 and Crx to control the tissue specificity of transcription. As evidence for this, Asaoka and colleagues have identified an element (Pineal expression‐promoting element; PIPE) within the exorh promoter that confers the ability to drive pineal expression on the normally retina‐ specific rhodopsin promoter (Asaoka et al., 2002). The protein(s) that binds to this element has not yet been identified. Here, we also identify a novel role for Per3 in the regulation of exorh transcriptional rhythms, with loss of Per3 causing increased expression specifically during the light period of the circadian cycle. While the functions of vertebrate Per1 and Per2 proteins are well established, the function of Per3 has been difficult to define. In mice, Per1 and Per2 have central roles in the feedback loops of the circadian clock and in resetting the clock in response to environmental light cues (Reppert and Weaver, 2001). In contrast, per3 knock out mice have only a slight decrease in the period of their circadian clock (Shearman et al., 2000). In humans, certain polymorphisms in the per3 gene and misregulation of per3 expression have been associated with breast cancer, chronic myeloid leukemia, bipolar disorder, and
64
the structure of the sleep/wake cycle (Chen et al., 2005; Nievergelt et al., 2006; Viola et al., 2007; Yang et al., 2006; Zhu et al., 2005). The fact that per3 mRNA is present within pinealocytes raises the possibility that Per3 protein could be acting cell autonomously to effect these changes. However, we do not yet understand the biochemical basis of Per3 activity in exorh regulation. Per proteins typically act to repress the transcriptional activity of Clock/BMAL heterodimers. However, there are no canonical Clock/BMAL binding sites within the functional 1.1 kb exorh promoter region identified by Asaoka and colleagues (Asaoka et al., 2002). Further, a search of genomic sequences 5 kb upstream of the exorh start codon, all of the exorh introns, and the 751 bp of available exorh downstream sequence reveals only one canonical Clock/BMAL binding site, located at position ‐2040 within the exorh 5’ UTR (data not shown). Although it is possible that this site mediates transcription by Clock/BMAL, it seems unlikely as functional Clock/BMAL binding sites tend to be found in closely spaced clusters. For instance, functional Clock/BMAL sites within the aanat2 promoter are found within a 257 bp Pineal Restrictive Downstream Module (PRDM) that contains three Otx binding sites and two Clock/BMAL binding sites (Appelbaum et al., 2005; Appelbaum et al., 2004). Similarly, the promoter for the Otx5 target gene reverb alpha contains a 165 bp region upstream of the translation start site that contains two Clock/BMAL binding sites that are essential for Clock/BMAL mediated transcription in COS‐1 cells (Triqueneaux et al., 2004). One possibility is that there are additional Clock/BMAL sites further upstream or downstream of the coding sequence or non‐canonical binding sites that we do not recognize. Alternatively, the lack of a clear Clock/BMAL regulatory unit could indicate that Per3 is acting to suppress exorh transcription indirectly through the regulation of another gene or through a mechanism that does not require Clock/BMAL (Figure 6). In summary, our study makes three important advances in our understanding of pineal rhythms. Importantly, it defines the first in vivo role for Exorh protein in the regulation of transcription of its own gene and of aanat2. Second, it provides further evidence for the role of Otx5 as a major activator of
65
rhythmic pineal genes. Finally, we establish a new role for Per3 as a key factor controlling the timing of exorh expression.
Experimental Procedures Zebrafish Adult, embryonic, and larval fish were housed at 28.5°C in a 14:10 hr light/dark (LD) cycle. Fish strains included wildtype (WT) fish that were descendants of fish purchased from Scientific Hatcheries (Huntington Beach, CA, USA) or AB (Eugene, OR, USA), and exorh:GFP transgenic fish (Asaoka et al., 2002). Embryos were obtained by natural matings and raised in aquatic system water containing 0.003% phenylthiocarbamide to inhibit the development of pigment. All embryos and larva were kept in temperature‐controlled circadian incubators with LD cycles that matched parental lighting conditions. Position within the 24 circadian cycle was noted as Zeitgeber Time (ZT), with ZT0 corresponding to the time lights turned on and ZT14 corresponding to the time lights turned off. All procedures were approved by the Institutional Animal Care and Use Committee of Case Western Reserve University, and were designed to minimize pain and discomfort.
MO injections MO were manufactured by GeneTools, LLC (Philomath, OR, USA), with the following sequences: per3 MO, 5’‐AGGAAAGCCGTCTCCCCCTGGCATT‐3’; per3 MIS, 5’ AGcAAAcCCGTgTCCCgCTGcCATT‐3’; exorh sp MO, 5’‐ TTGTAGTGTGCTCACCGCCGAGTGT‐3’; exorh atg MO 5’‐ AGTTGGGTCCCTCCGTCCCGTTCAT‐3’ standard control (ctl) MO, 5’‐ CCTCTTACCTCAGTTACAATTTATA‐3’. The sequences for the otx5 MO and otx5 MIS were as previously described (Gamse et al., 2002). The exorh sp MO was designed using exorh genomic sequences obtained from the Sanger Center (Ensemble Gene ID ENSDARG00000046115). 1‐2 cell stage WT embryos were injected with either 4 ng otx5 MO/otx5 MIS, 3 ng per3 MO/per3 MIS, 3 ng exorh sp MO/ctl MO or 1.5 ng exorh atg MO in 1x
66
Danieau buffer (Nasevicius and Ekker, 2000) with a PLI‐90 picoinjector (Harvard Apparatus, Holliston, Massachusetts, USA). The injected embryos were then raised and fixed in time courses as described in the figure legends.
WISH Embryos were fixed in 4% paraformaldehyde in PBS at 4°C for at least 24 hours before being washed with PBS + 20% Tween 20. Samples were stored in 100% methanol at ‐20°C unless processed by in situ hybridization immediately. Transcripts of exorh (Mano et al., 1999), opn1lw1 (Robinson et al., 1995), otx5 (Gamse et al., 2002), per3 (Delaunay et al., 2000) and aanat2 (Gothilf et al., 1999) were detected by WISH as previously described (Liang et al., 2000). Stained embryos were visualized using a Zeiss Axioplan2 imaging microscope. Digital images were captured with a Zeiss AxioCam HRm camera (Carl Zeiss MicoImaging Inc. Thornwood, NY, USA) in conjunction with OpenLab software (Scientific Software, Inc. Pleasanton, CA, USA) or with a SPOT RTke 7.4 slider Digital Camera along with SPOT Software version 4.5.9.1 (Diagnostic Instruments Sterling Heights, MI, USA).
Quantification and Statistical Analysis Digital images were converted to 8‐bit grayscale using Adobe Photoshop CS2 version 9.0.1 (Apple software Cupertino, CA, USA). The optical density (OD) for a specified area was calculated from digital images of the pineal using ImageJ software version 1.36b (National Institutes of Health, Bethesda, MD, USA). The quantified area was the same for all samples within a single experiment. For Figure 1B, the OD of the WISH signal was calculated for three pineal organs per time point. The values in each experiment were normalized by setting the highest OD reading to 100 and all other readings as a percentage thereof. Data were analyzed using one‐way ANOVA with Tukey’s post hoc comparison of means and the Independent Two Sample Student’s t‐Test in OriginLab 7.5 (OriginLab Corporation, Northampton, MA, USA).
67
Sectioning Embryos at 3 dpf were processed for WISH with a probe for per3 or otx5. The brain was then sectioned by a sagittal cut through the midline using a standard disposable scalpel. For image capture, the sample was positioned so that the cut surface of the brain faced the camera.
mRNA injections The mMessage Machine Kit (Ambion Inc. Austin, Tx, USA) was used to synthesize capped mRNA in vitro from the pCS2+otx5, pCS2+ ‐gal, and pCS2+ RFP plasmids (Gamse et al., 2002; Rupp et al., 1994; Turner and Weintraub, 1994). Single blastomeres of 8‐16 cell stage exorh:GFP embryos were injected with 0.5‐1.5 nl of mRNA solution using a PLI‐90 injector.
Acknowledgements The authors thank Drs. Kathleen Molyneaux, Greg Matera, Marge Sedensky, Phil Morgan, and Marnie Halpern for their helpful comments on the manuscript, Drs. David Klein (National Institutes of Health), Yoav Gothilf (Tel Aviv University), and Bernard and Christine Thisse (Institut de Génétique et Biologie Moléculaire et Celluaire) for generously sharing plasmids, Dr. Yoshitaka Fukada (The University of Tokyo) for generously providing the exorh (‐1055):GFP transgenic line and the exorh cDNA, Dr. Mario Caccamo (Sanger Center) for advice on exorh genomic sequence, and Ms. Allisan Aquilina‐Beck, Ms. Kristine Ilagan, and Mr. Brian Chen for their expert technical assistance. This work was supported in part by Research Grant No. 5‐FY02‐259 from the March of Dimes Birth Defects Foundation and Research Grant (J.O.L), No.T32 HD07104‐29 Normal and Abnormal Development from the NIH/CHHD Institutional Pre‐Doctoral Research Training Grant (L.X.P.), and Phi Beta Kappa Students Research Awards (O.P. and R.R.N.).
68
Table 1: Overexpression of Otx5 induces ectopic expression of the exorh:GFP transgene
Pattern of ectopic GFP expression mRNA injected Colocalized Not colocalized No with RFP with RFP GFP 240 pg β‐gal & 0 0 24 240 pg RFP
360 pg β‐gal & 0 1 38 360 pg RFP
120 pg otx5 & 4 0 9 120 pg RFP
240 pg otx5 & 18 1 13 240 pg RFP
360 pg otx5 & 3 0 2 360 pg RFP The indicated mixtures of mRNAs were injected into single blastomeres of exorh:GFP embryos at the 8‐16 cell stage. Live or lightly fixed embryos were examined by fluorescence microscopy at approximately 24 hpf.
69
Figure 1. There are significant changes in exorh expression levels between day and night.
(A) Dorsal view of the head of a 2 dpf embryo showing the position of the exorh positive cells of the pineal (arrow) relative to the eyes (e). (B) Embryos were raised in a 14:10 hour LD cycle, fixed starting at 50 hpf, and processed for WISH with a probe for exorh. Zeitgeiber (ZT) indicates position within the circadian cycle, with ZT0=lights on and ZT14=lights off. Dorsal views, anterior to top. Experiment was repeated three times with similar results (n≥10 embryos per time point for the experiment shown). (C) exorh mRNA levels were measured and analyzed as described in Experimental Procedures. Normalized data from three independent experiments are included, with each diamond representing the signal from one embryo (n>6 embryos per time point). White diamonds indicate lights were on (ZT2 and ZT8), and black diamonds indicate lights were off (ZT14 and ZT20). One way
ANOVA, which compares all of the sample groups to each other, indicates that the means of samples taken at different points throughout the circadian cycle are not all the same (p=0.0004). Letters (a, b, c, d) denote groups of samples that are not significantly different from one another according to Tukey’s post‐hoc comparison of means (p<0.05). The mean and one standard deviation for each group are indicated by the red lines overlaying the data points. To provide further information, the p values for pairwise comparisons between each of the sample groups are listed in Supplementary Table 1. Scale bars= 50μm (A) and 20μm (B).
70
Figure 1
71
Figure 2. Otx5 controls the tissuespecificity of exorh transcription.
(A) 1‐4 cell stage embryos were injected with otx5 MO or otx5 MIS and then raised in a LD cycle. Time points were collected beginning at 50 hpf, and assayed by
WISH for exorh expression (n≥10 embryos per time point). Experiment was repeated twice with similar results. Dorsal views, anterior to the top. Scale
bar=20μm. (B) Quantification of the digital images shown in A (carried out as
described in Experimental Procedures). All measurements taken from the otx5 MO
samples were pooled into one set and the measurements from the otx5 MIS into asecond data set. Analysis using the Independent Two Sample Student’s t‐Test indicates that the signal in the Otx5 MO injected embryos is significantly lower than in the Otx5 MIS embryos (OD=0.53 + 0.09 and 1.01 + 0.21 for otx5 MO and otx5 MIS, respectively, p=0.0004). (C) otx5 or β‐gal mRNA was co‐injected with RFP mRNA into a single blastomere of 8‐16 cell stage exorh:GFP embryos. Live or fixed embryos were examined at 24 hpf by fluorescence microscopy. The embryo co‐injected with