DOCSLIB.ORG

Molecular Phylogeny of Two Slave-Making Ants: Rossomyrmex and Polyergus (Hymenoptera: Formicidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Phylogeny of Two Slave-Making Ants: Rossomyrmex and Polyergus (Hymenoptera: Formicidae) Ann. Zool. Fennici 39: 267–271 ISSN 0003-455X Helsinki 10 October 2002 © Finnish Zoological and Botanical Publishing Board 2002 Molecular phylogeny of two slave-making ants: Rossomyrmex and Polyergus (Hymenoptera: Formicidae) Eisuke Hasegawa1, Alberto Tinaut2* & Francisca Ruano2 1) Center for Ecological Research, Kyoto University, Kyoto 606-01 and Labo- ratory of Wildlife Conservation, National Institute for Environmental Studies. Onogawa 16-2, Tsukuba 305, Japan; Present address: Laboratory of Animal Ecology, Department of Ecology and Systematics, Graduate School of Agriculture, Hokkaido University. Kita-ku, 060-8589 Sapporo, Japan (e-mail: [email protected]) 2) Department of Animal Biology and Ecology, University of Granada, ESP-18071 Granada, Spain (e-mail: [email protected]) Received 23 April 2001, accepted 11 May 2002 Hasegawa, E., Tinaut, A. & Ruano, F. 2002: Molecular phylogeny of two slave- making ants: Rossomyrmex and Polyergus (Hymenoptera: Formicidae). — Ann. Zool. Fennici 39: 267–271. Using mitochondrial cytochrome oxidase I gene (COI), we established the phyloge- netic relationship between two slave-making genera of the tribe Formicini: Polyergus and Rossomyrmex. The resulting phylogenetic tree presents two well-defi ned groups: Formica + Polyergus, and Proformica + Cataglyphis + Rossomyrmex. Our result con- tradicts prior classifi cations which considered Polyergus and Rossomyrmex to be sister genera. These results imply that slave-making in the two taxa evolved independently. Introduction ize Formica and Proformica, respectively. All current phylogenies consider Polyergus The genus Polyergus is composed of fi ve spe- a sister genus to Formica, but the phylogenetic cies (Bolton 1995) endemic to the Holarctic position of the genus Rossomyrmex has been region. In Rossomyrmex, only 2 species have repeatedly revised since its initial description been identifi ed: R. proformicarum Arnoldi from by Arnoldi (1928). Arnoldi found similarities the Tian-Shan (Kazakhstan) and Caspian steppes between Rossomyrmex and Proformica, and (Russia), and R. minuchae Tinaut from the Sierra between Polyergus, Formica and Cataglyphis, Nevada mountains (Spain). Polyergus and Ros- but did not establish the phylogenetic relation- somyrmex are slave-making ants, which parasit- ships among these taxa (Arnoldi 1928). In sub- * Corresponding author 268 Hasegawa et al. • ANN. ZOOL. FENNICI Vol. 39 A Formica B Melophorus ? Formica Polyergus Polyergus Rossomyrmex ? Rossomyrmex Bajcaridris ? Gen. nov Proformica Alloformica Proformica Cataglyphis ? Alloformica Fig. 1. Phylogenetic rela- tionships in the tribe Formi- cini hypothesized by Agosti Cataglyphis 1989 (A) and 1994 (B). Table 1. Species, localities and Genbank accession sequent papers, Rossomyrmex was considered number. derived from Formica-like ancestors and phyl- logenetically related near Formica and/or Pol- Species Collecting Genbank accesion yergus (Wilson 1971, Brown 1973, Buschinger location number 1990, Hölldobler & Wilson 1990). Agosti (1989) (Fig. 1A) placed it, with doubt, between Cataglyphis the Formica/Polyergus group and Proformica, C. bicolor Morocco AB010942 C. fl oricola Spain AB010936 Alloformica, Bajcaridris and Cataglyphis. Later C. rosenhaueri Spain AB010941 Agosti (1994) (Fig. 1B) changed Rossomyrmex C. velox Spain AB010933 to a position derived from Polyergus, upholding Formica a classical opinion which considers two groups F. cunicularia Spain AB010926 of genera with close phylogenetic ties: on one F. exsecta Poland AB010927 side, Formica L., Polyergus Latreille and Ros- F. fusca Spain AB010925 somyrmex Arnoldi, and, on the other, Bajcarid- F. truncorum Japan AB010929 ris Agosti, Proformica Ruzsky, Alloformica F. yesensis Japan AB010928 Lasius Dlussky and Cataglyphis Foerster. According L. niger Germany AB007981 to this phylogeny, the two slave-making genera, Plagiolepis Polyergus and Rossomyrmex, are grouped P. pygmaea Spain AB010938 together and are considered to be sister taxa. Proformica Tinaut et al. (1994), however, reported that, P. ferreri Spain AB010935 on the basis of male genitalia, Rossomyrmex P. longiseta Spain AB010934 appears to be more closely related to Proformica Polyergus and Cataglyphis than to Formica. P. rufescens Spain AB010931 In the present paper, we use molecular tech- P. samurai Japan AB010930 Rossomyrmex niques to determine the phylogenetic position of R. minuchae Spain AB010937 Rossomyrmex and Polyergus. ANN. ZOOL. FENNICI Vol. 39 • Molecular phylogeny Rossomyrmex and Polyergus 269 Materials and methods product were sequenced using Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin The species Elmer) on an ABI 373A automated sequencer. The accuracy of the target sequence of a species The species used and their sampling sites are was confi rmed by comparing the sequence from given in Table 1. For outgroup species, we have one of a pair of primers with the complementary considered two species: Plagiolepis pygmaea sequence from the other primer. Latreille (tribe Plagiolepidini) and Lasius niger L. (tribe Lasiini), both from the Formicinae sub- family. Phylogenetic reconstruction The phylogenetic relationship between the spe- DNA extraction and sequencing cies was reconstructed using the software PAUP 4.0b5 (Swofford 1998). We used two different DNA from one individual of each species was algorithms to estimate the phylogeny: neigh- extracted from ants preserved in 99.9% etha- bour joining (NJ), and maximum parsimony nol. A DNA extraction kit (DNeasy Tissue Kit, (MP). For NJ, we selected Kimura’s two-param- QIAGEN), was used, following the manufactur- eter distance as an index of genetic distances er’s instructions. between sequences. In addition, we used a We designed primers for the mitochondrial gamma function with 0.5 shape variable to cor- cytochrome oxidase subunit I (COI) gene by rect between-site-rate variations. For MP, we comparing the sequences of the fruit fl y Dro- equally weighted all substitutions. Robustness sophila melanogaster (de Bruijn 1983) and the of the resulting topologies were examined by a honey bee Apis mellifera L. (Crozier & Crozier bootstrap test with 1000 resamplings. 1993). We searched for conservative regions in which more than 90% of the sequences matched between the two species. Two primer pairs were Results designed (given as 5´–3´): CI13: ATAATTTTTTTTATAGTTATACC The target region was 1104-bp nucleotides CI14: ATTTCTTTTT TTCCTCTTTC; and in length, but the primer region itself and CI21: CTTTATCAACATTTATTTTGATTTTT sequences near the primers could not be deter- CI24: TCCTAA AAAATGTTGAGGAAA. mined accurately. As a result, we obtained a In total, we obtained 1104bp sequence within 974-bp sequence from each species. These COI from these primer pairs. sequences are deposited at the DDBJ database The target fragment was amplifi ed by PCR (see Table 1). in a programmable thermal cycler (PTC-100, Figure 2 shows NJ and MP trees with boot- MJ Research Inc.). Each PCR contained a strap probabilities of each node. We also esti- 50 µl reaction volume of the following compo- mated the maximum-likelihood tree, using the nents: 100 ng DNA, 10 mM Tris-HCl (pH 8.3), HYK 85 model. The ML estimation resulted in 50 mM KCl, 2 mM MgCl2, 0.001% gelatine, the same topology as the unweighted MP, and 20 pmol of primers, and 0.4U Taq DNA polymer- thus the ML tree is not presented. We did not ase (GeneTaq, NipponGene). Amplifi cation was provide a phylogram with branch-length infor- 30 cycles per 1 min at 94 °C, 1 min at 45 °C, mation because our main concern in this study and 3 min at 60 °C. Amplifi cation products can be resolved without branch length. Branch were purifi ed with a DNA-purifi cation kit (PCR lengths can be determined using the above-men- Purifi cation Kit, QIAGEN), and suspended in tioned deposited sequences. 25 µl of TE buffer. Both strands of each PCR Two clades were well supported in all 270 Hasegawa et al. • ANN. ZOOL. FENNICI Vol. 39 A: NJ 60 Formica (Serviformica) fusca 52 Formica (S.) cunicularia 99 Formica (Coptoformica) exsecta Formica (str.) yessensis 91 100 Formica (str.) truncorum Polyergus samurai 100 Polyergus rufescens 59 100 Proformica longiseta 65 Proformica ferreri Rossomyrmex minuchae 41 Cataglyphis velox 24 Cataglyphis bicolor 77 24 Cataglyphis rosenhaueri Cataglyphis floricola Plagiolepis pygmaea Lasius niger Fig. 2. The estimated phylogenetic relation- ships between the exam- B: Unweighted MP 62 Formica (Serviformica) fusca ined species. Topologies 69 Formica (S.) cunicularia were derived from two 100 Formica (str.) yessensis estimation algorithms (A: 94 Formica (str.) truncorum 52 Formica (Coptoformica) exsecta NJ and B: unweighted Polyergus samurai MP). The numbers 100 Polyergus rufescens at branches represent 65 100 Proformica longiseta boot strap probabilities 32 Proformica ferreri 40 Rossomyrmex minuchae from 1000 resamplings. 58 Cataglyphis bicolor Descriptive statistics of 48 Cataglyphis velox the unweighted MP tree 80 Cataglyphis rosenhaueri Cataglyphis floricola were TL = 1059, CI = Plagiolepis pygmaea 0.5467, HI= 0.4533, RI = Lasius niger 0.4888 and RC = 0.2673. cases, one including Formica and Polyergus to be ancestral, although this could change with and the other consisting of Cataglyphis, Pro- the inclusion of other genera and is not currently formica and Rossomyrmex. The bootstrap sup- supported by the bootstrap analysis. Indeed the port for both groups was 57%–94% for the bootstrap support was low for all clades (Fig. 2), Formica/Polyergus clade and 77%–85% for except
Load more

Recommended publications
  • FLIGHTS of the ANT POLYERGUS LUCIDUS MAYR* Flights of Ants At
    FLIGHTS OF THE ANT POLYERGUS LUCIDUS MAYR* BY MARY TALBOT Lindenwood College, St. Charles, Missouri Flights of ants at the Edwin S. George Reserve, Livingston County, Michigan, have been studied over a number of years (Talbot 956, I959, 963, I964, 966, and Kannowski 959a, 959b). This paper is another in the flight series and concerns the slave-making ant, Polyergus lucidus Mayr. Polyergus colonies are scattered over the George Reserve, living in open ields or at woods' edge and forming mixed colonies with Formica pallidefulva nitidiventris Emery. The flights recorded here took place mainly from the Lawn Colony, where 26 flights were seen during 1960, 96, and 1962. These. observations were supplemented, fo.r comparison, by records of seven flights from two other colonies. The main flights, of Polyergus at he Reserve took place during August. They began in late July a.nd extended into early or mid- September. July 31, 1962 was rhe date of the earliest flight seen, although a dealate female was found on July 28, 1964. The latest flight recorded, on September 9, 1963, liberated only three males. The flight season at any one colony is long, probably a month to six weeks, and the time of starting and stopping flights must vary considerably from. colony to colony, depending on local environment o the nest and rate. of maturing of the brood. Polyergus spread the. maturing of brood of winged ants over an ex- tended period, and flights began long before all of the adults had emerged. Winged pupae have been found as early in the year as June 19, 1962, and as late as September I, 1964.
    [Show full text]
  • Morphology of the Novel Basimandibular Gland in the Ant Genus Strumigenys (Hymenoptera, Formicidae)
    insects Article Morphology of the Novel Basimandibular Gland in the Ant Genus Strumigenys (Hymenoptera, Formicidae) Chu Wang 1,* , Michael Steenhuyse-Vandevelde 1, Chung-Chi Lin 2 and Johan Billen 1 1 Zoological Institute, University of Leuven, Naamsestraat 59, Box 2466, B-3000 Leuven, Belgium; [email protected] (M.S.-V.); [email protected] (J.B.) 2 Department of Biology, National Changhua University of Education, Changhua 50007, Taiwan; [email protected] * Correspondence: [email protected] Simple Summary: Ants form a diverse group of social insects that are characterized by an over- whelming variety of exocrine glands, that play a key function in the communication system and social organization of the colony. Our focus goes to the genus Strumigenys, that comprise small slow-moving ants that mainly prey on springtails. We discovered a novel gland inside the mandibles of all 22 investigated species, using light and electron microscopy. As the gland occurs close to the base of the mandibles, we name it ‘basimandibular gland’ according to the putative description given to this mandible region in a publication by the eminent British ant taxonomist Barry Bolton in 1999. The gland exists in both workers and queens and appeared most developed in the queens of Strumigenys mutica. These queens in addition to the basimandibular gland also have a cluster of gland cells near the tip of their mandibles. The queens of this species enter colonies of other Strumigenys species and parasitize on them. We expect that the peculiar development of these glands inside the mandibles of these S. mutica queens plays a role in this parasitic lifestyle, and hope that future research can shed more light on the biology of these ants.
    [Show full text]
  • Fecundity of Ant Queens in Relation to Their Age and the Mode of Colony Founding L
    Insectes Sociaux, Paris Masson, Paris, 1990 1990, Volume 37, n ~ 2, pp. 116-130 FECUNDITY OF ANT QUEENS IN RELATION TO THEIR AGE AND THE MODE OF COLONY FOUNDING L. KELLER (1) and L. PASSERA (2) (1) Musde Zoologique, Palais de Rumine, CP 448, 1000 Lausanne 17, Switzerland (2) Laboratoire d'Entomologie, Universitd Paul Sabatier, 118, route de Narbonne, F 31062 Toulouse Cedex, France, U.A. C.N.R.S. 303 Regu le 23 janvier 1989 Accept6 le 15 juin 1989 SUMMARY The change over time in the fecundity and weight of queens was investigated in three monogynous, independent colony founding species, Lasius niger, Camponotus ligniperda and C. herculaneus, and two polygynous dependent colony founding species, Plagiolepis pygmaea and Iridomyrmex humilis. Queens of the three species founding independently exhibited a similar pattern with a significant loss of weight between mating and the emergence of the first workers. In contrast, weights of queens of the species employing dependent colony founding remained more stable. Fecundity of queens founding inde- pendently increased slowly with time whereas fecundity of queens founding dependently reached the maximum level some weeks after the beginning of the first reproductive season. These results are discussed in relation to some differences in the life history (e.g., life-span) between queens utilizing independent and dependent colony founding. RESUME Fdcondit6 des reines de fourmis en relation avec leur &ge et le mode de fondation de la soci6t6 On a 6tud6 dans ce travail les variations en fonction du temps de la f6condit6 et du poids des reines fondatrices de trois esp6ces monogynes h fondation ind6pendante (Lasius niger, Camponotus ligniperda, Camponotus herculeanus) et de deux esp6ces polygynes h fondation d6pendante (Plagiolepis pygmaea et Iridomyrmex humilis).
    [Show full text]
  • Raid Organization and Behavioral Development in the Slave-Making Ant Polyergus Lucidus Mayr E
    Insectes Sociaux, Paris Masson, Paris, 1984 1984, Volume 31, n ~ 4, pp. 361-374 RAID ORGANIZATION AND BEHAVIORAL DEVELOPMENT IN THE SLAVE-MAKING ANT POLYERGUS LUCIDUS MAYR E. COOL-KWAIT (1) and H. TOPOFF (2) (1) Department of Biology, City College of Cuny, New York, N.Y. I003i, U.S.A. (2) Department of Psychology, Hunter College of Cuny, New York, N.Y. 10021, U.S.A and The American Museum of Natural History, New York, N.Y. 10024, U.S.A. Requ le 5 septembre 1983. Accept6 le 18 juin 1984. SUMMARY Mixed-species colonies of Polyergus lucidus and Fdrmica schaufussi xvere studied in New York. Slave raids were conducted in late afternoon, past the peak in diurnal temperature. Multiple raids on different Formica colonies xvere common, as ~vere re-raids on the same colony. In laboratory nests, about 75 % of the raided Formica brood was eaten. Of 27 days on ,which raids occurred in the laboratory, 25 ~vere on Formica nests scouted on the day of the raid. Polyergus scouts are among the oldest individuals in the colony, and call~ws do not participate in scouting during the entire season of their eclosion. The group of Polyergus workers that circle on the surface near the nest prior to raiding has a dynamic composition.. The most frequent behavioral transition ~vas from circling on one day to scouting on the next. The next most common change was from SCOUting to circling. The first scouting of the spring season occurred only one day after the appearance of Polyergus larvae. The first slave raid 'was conducted 4 days later.
    [Show full text]
  • Nansei Islands Biological Diversity Evaluation Project Report 1 Chapter 1
    Introduction WWF Japan’s involvement with the Nansei Islands can be traced back to a request in 1982 by Prince Phillip, Duke of Edinburgh. The “World Conservation Strategy”, which was drafted at the time through a collaborative effort by the WWF’s network, the International Union for Conservation of Nature (IUCN), and the United Nations Environment Programme (UNEP), posed the notion that the problems affecting environments were problems that had global implications. Furthermore, the findings presented offered information on precious environments extant throughout the globe and where they were distributed, thereby providing an impetus for people to think about issues relevant to humankind’s harmonious existence with the rest of nature. One of the precious natural environments for Japan given in the “World Conservation Strategy” was the Nansei Islands. The Duke of Edinburgh, who was the President of the WWF at the time (now President Emeritus), naturally sought to promote acts of conservation by those who could see them through most effectively, i.e. pertinent conservation parties in the area, a mandate which naturally fell on the shoulders of WWF Japan with regard to nature conservation activities concerning the Nansei Islands. This marked the beginning of the Nansei Islands initiative of WWF Japan, and ever since, WWF Japan has not only consistently performed globally-relevant environmental studies of particular areas within the Nansei Islands during the 1980’s and 1990’s, but has put pressure on the national and local governments to use the findings of those studies in public policy. Unfortunately, like many other places throughout the world, the deterioration of the natural environments in the Nansei Islands has yet to stop.
    [Show full text]
  • Radiation in Socially Parasitic Formicoxenine Ants
    RADIATION IN SOCIALLY PARASITIC FORMICOXENINE ANTS DISSERTATION ZUR ERLANGUNG DES DOKTORGRADES DER NATURWISSENSCHAFTEN (D R. R ER . N AT .) DER NATURWISSENSCHAFTLICHEN FAKULTÄT III – BIOLOGIE UND VORKLINISCHE MEDIZIN DER UNIVERSITÄT REGENSBURG vorgelegt von Jeanette Beibl aus Landshut 04/2007 General Introduction II Promotionsgesuch eingereicht am: 19.04.2007 Die Arbeit wurde angeleitet von: Prof. Dr. J. Heinze Prüfungsausschuss: Vorsitzender: Prof. Dr. S. Schneuwly 1. Prüfer: Prof. Dr. J. Heinze 2. Prüfer: Prof. Dr. S. Foitzik 3. Prüfer: Prof. Dr. P. Poschlod General Introduction I TABLE OF CONTENTS GENERAL INTRODUCTION 1 CHAPTER 1: Six origins of slavery in formicoxenine ants 13 Introduction 15 Material and Methods 17 Results 20 Discussion 23 CHAPTER 2: Phylogeny and phylogeography of the Mediterranean species of the parasitic ant genus Chalepoxenus and its Temnothorax hosts 27 Introduction 29 Material and Methods 31 Results 36 Discussion 43 CHAPTER 3: Phylogenetic analyses of the parasitic ant genus Myrmoxenus 46 Introduction 48 Material and Methods 50 Results 54 Discussion 59 CHAPTER 4: Cuticular profiles and mating preference in a slave-making ant 61 Introduction 63 Material and Methods 65 Results 69 Discussion 75 CHAPTER 5: Influence of the slaves on the cuticular profile of the slave-making ant Chalepoxenus muellerianus and vice versa 78 Introduction 80 Material and Methods 82 Results 86 Discussion 89 GENERAL DISCUSSION 91 SUMMARY 99 ZUSAMMENFASSUNG 101 REFERENCES 103 APPENDIX 119 DANKSAGUNG 120 General Introduction 1 GENERAL INTRODUCTION Parasitism is an extremely successful mode of life and is considered to be one of the most potent forces in evolution. As many degrees of symbiosis, a phenomenon in which two unrelated organisms coexist over a prolonged period of time while depending on each other, occur, it is not easy to unequivocally define parasitism (Cheng, 1991).
    [Show full text]
  • Recerca I Territori V12 B (002)(1).Pdf
    Butterfly and moths in l’Empordà and their response to global change Recerca i territori Volume 12 NUMBER 12 / SEPTEMBER 2020 Edition Graphic design Càtedra d’Ecosistemes Litorals Mediterranis Mostra Comunicació Parc Natural del Montgrí, les Illes Medes i el Baix Ter Museu de la Mediterrània Printing Gràfiques Agustí Coordinadors of the volume Constantí Stefanescu, Tristan Lafranchis ISSN: 2013-5939 Dipòsit legal: GI 896-2020 “Recerca i Territori” Collection Coordinator Printed on recycled paper Cyclus print Xavier Quintana With the support of: Summary Foreword ......................................................................................................................................................................................................... 7 Xavier Quintana Butterflies of the Montgrí-Baix Ter region ................................................................................................................. 11 Tristan Lafranchis Moths of the Montgrí-Baix Ter region ............................................................................................................................31 Tristan Lafranchis The dispersion of Lepidoptera in the Montgrí-Baix Ter region ...........................................................51 Tristan Lafranchis Three decades of butterfly monitoring at El Cortalet ...................................................................................69 (Aiguamolls de l’Empordà Natural Park) Constantí Stefanescu Effects of abandonment and restoration in Mediterranean meadows .......................................87
    [Show full text]
  • Borowiec Et Al-2020 Ants – Phylogeny and Classification
    A Ants: Phylogeny and 1758 when the Swedish botanist Carl von Linné Classification published the tenth edition of his catalog of all plant and animal species known at the time. Marek L. Borowiec1, Corrie S. Moreau2 and Among the approximately 4,200 animals that he Christian Rabeling3 included were 17 species of ants. The succeeding 1University of Idaho, Moscow, ID, USA two and a half centuries have seen tremendous 2Departments of Entomology and Ecology & progress in the theory and practice of biological Evolutionary Biology, Cornell University, Ithaca, classification. Here we provide a summary of the NY, USA current state of phylogenetic and systematic 3Social Insect Research Group, Arizona State research on the ants. University, Tempe, AZ, USA Ants Within the Hymenoptera Tree of Ants are the most ubiquitous and ecologically Life dominant insects on the face of our Earth. This is believed to be due in large part to the cooperation Ants belong to the order Hymenoptera, which also allowed by their sociality. At the time of writing, includes wasps and bees. ▶ Eusociality, or true about 13,500 ant species are described and sociality, evolved multiple times within the named, classified into 334 genera that make up order, with ants as by far the most widespread, 17 subfamilies (Fig. 1). This diversity makes the abundant, and species-rich lineage of eusocial ants the world’s by far the most speciose group of animals. Within the Hymenoptera, ants are part eusocial insects, but ants are not only diverse in of the ▶ Aculeata, the clade in which the ovipos- terms of numbers of species.
    [Show full text]
  • Recovery of Domestic Behaviors by a Parasitic Ant (Formica Subintegra) in the Absence of Its Host (Formica Subsericea)
    BearWorks MSU Graduate Theses Spring 2019 Recovery of Domestic Behaviors by a Parasitic Ant (Formica Subintegra) in the Absence of Its Host (Formica Subsericea) Amber Nichole Hunter Missouri State University, [email protected] As with any intellectual project, the content and views expressed in this thesis may be considered objectionable by some readers. However, this student-scholar’s work has been judged to have academic value by the student’s thesis committee members trained in the discipline. The content and views expressed in this thesis are those of the student-scholar and are not endorsed by Missouri State University, its Graduate College, or its employees. Follow this and additional works at: https://bearworks.missouristate.edu/theses Part of the Behavior and Ethology Commons, Entomology Commons, and the Other Ecology and Evolutionary Biology Commons Recommended Citation Hunter, Amber Nichole, "Recovery of Domestic Behaviors by a Parasitic Ant (Formica Subintegra) in the Absence of Its Host (Formica Subsericea)" (2019). MSU Graduate Theses. 3376. https://bearworks.missouristate.edu/theses/3376 This article or document was made available through BearWorks, the institutional repository of Missouri State University. The work contained in it may be protected by copyright and require permission of the copyright holder for reuse or redistribution. For more information, please contact [email protected]. RECOVERY OF DOMESTIC BEHAVIORS BY A PARASITIC ANT (FORMICA SUBINTEGRA) IN THE ABSENCE OF ITS HOST (FORMICA
    [Show full text]
  • Above-Belowground Effects of the Invasive Ant Lasius Neglectus in an Urban Holm Oak Forest
    U B Universidad Autónoma de Barce lona Departamento de Biología Animal, de Biología Vegetal y de Ecología Unidad de Ecología Above-belowground effects of the invasive ant Lasius neglectus in an urban holm oak forest Tesis doctoral Carolina Ivon Paris Bellaterra, Junio 2007 U B Universidad Autónoma de Barcelona Departamento de Biología Animal, de Biología Vegetal y de Ecología Unidad de Ecología Above-belowground effects of the invasive ant Lasius neglectus in an urban holm oak forest Memoria presentada por: Carolina Ivon Paris Para optar al grado de Doctora en Ciencias Biológicas Con el Vº. Bº.: Dr Xavier Espadaler Carolina Ivon Paris Investigador de la Unidad de Ecología Doctoranda Director de tesis Bellaterra, Junio de 2007 A mis padres, Andrés y María Marta, y a mi gran amor Pablo. Agradecimientos. En este breve texto quiero homenajear a través de mi más sincero agradecimiento a quienes me ayudaron a mejorar como persona y como científica. Al Dr Xavier Espadaler por admitirme como doctoranda, por estar siempre dispuesto a darme consejos tanto a nivel profesional como personal, por darme la libertad necesaria para crecer como investigadora y orientarme en los momentos de inseguridad. Xavier: nuestras charlas más de una vez trascendieron el ámbito académico y fue un gustazo escucharte y compartir con vos algunos almuerzos. Te prometo que te enviaré hormigas de la Patagonia Argentina para tu deleite taxonómico. A Pablo. ¿Qué puedo decirte mi amor qué ya no te haya dicho? Gracias por la paciencia, el empuje y la ayuda que me diste en todo momento. Estuviste atento a los más mínimos detalles para facilitarme el trabajo de campo y de escritura.
    [Show full text]
  • Morphological Comparison of the Male Genitalia of Formica
    Morphological comparison of them a l e genitalia of Formica fuscagroup (Hymenoptera: Formicidae) inK o r e a Min-Soo D o n g 1, S a m - K y u K i m * 1,* Department o f Applied Biology, K a n g w o n National University, Chuncheon 24341, Korea Abstract Taxonomic significance ofm a l e genitalia havew e l l known inm a n y insects but largely ignored inanttaxonomy due tocollecting difficulties ofmale. Nevertheless, recent studies showed thatgenitalic structure ofm a l e ant canbeagood diagnostic character inspecies level, noattempt has beenm a d e onKorean antusing m a l e genitalia. W e were abletom a k e m a n y collections accompanying w i t h males, rendering ittoexamine m a l e genitalia in detail f o r thef i r s t time inKorea. A s thebeginning ofthestudy ofm a l e genitalia ofKorean ants,w e provide morphological comparison between F o r m i c a fuscaLinnaeus, 1758, F. hayashi Terayama & Hashimoto, 1996 and F. japonicaMotschoulsky, 1866, ingenitalic structure. Significance ofm a l e genitalia inKorean anttaxonomy isdiscussed. Photographs anddescription of m a l e antsare provided inthis study. K e y words: A n t , Formicidae, Genitalia, Taxonomy, Morphology Introduction The antsbelonging toF o r m i c a fuscaspecies group areblack-colored antscommonly found throughout Europe asw e l l asparts ofSouthern A s i a andAfrica. I t isgenerally very difficult todistinguish themf r o m each other due totheir highdegree ofmorphological similarities. F o r thisreason, m a n y myrmecologists are struggling toidentify thematthespecies level.
    [Show full text]
  • Redalyc.Polinización Por Hormigas
    Ecosistemas ISSN: 1132-6344 [email protected] Asociación Española de Ecología Terrestre España de Vega, C.; Gómez, J.M. Polinización por hormigas: conceptos, evidencias y futuras direcciones Ecosistemas, vol. 23, núm. 3, septiembre-diciembre, 2014, pp. 48-57 Asociación Española de Ecología Terrestre Alicante, España Disponible en: http://www.redalyc.org/articulo.oa?id=54032954007 Cómo citar el artículo Número completo Sistema de Información Científica Más información del artículo Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto Ecosistemas 23(3): 48-57 [Septiembre-Diciembre 2014] Doi.: 10.7818/ECOS.2014.23-3.07 Artículo publicado en Open Access bajo los términos AEET de Creative Commons attribution Non Comercial License 3.0. eREVIScTA CoIENTÍFsICA DiEs ECOLtOGeÍA Y MmEDIO AaMBIENs TE ASOCIACIÓN ESPAÑOLA MONOGRÁFICO: ISSN 1697-2473 / Open access DE ECOLOGÍA TERRESTRE Ecología reproductiva de las plantas disponible en www.revistaecosistemas.net Polinización por hormigas: conceptos, evidencias y futuras direcciones C. de Vega 1*, J.M. Gómez 2,3 (1) Estación Biológica de Doñana, Consejo Superior de Investigaciones Científicas (CSIC), Avenida de Américo Vespucio s/n, 41092 Sevilla, España. (2) Estación Experimental de Zonas Áridas. CSIC. Ctra. Sacramento s/n. La Cañada de San Urbano. 04120 Almería, España. (3) Departamento de Ecología. Facultad de Ciencias. Universidad de Granada. 18071 Granada, España. * Autor de correspondencia: C. de Vega [[email protected]] > Recibido el 31 de diciembre de 2013 - Aceptado el 10 de marzo de 2014 de Vega, C., Gómez, J.M.
    [Show full text]