DOCSLIB.ORG

Rabbit Anti-MRPS18A/FITC Conjugated Antibody-SL17815R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rabbit Anti-MRPS18A/FITC Conjugated Antibody-SL17815R SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-MRPS18A/FITC Conjugated antibody SL17815R-FITC Product Name: Anti-MRPS18A/FITC Chinese Name: FITC标记的Mitochondrion核糖体蛋白S18A抗体 28S ribosomal protein S18 3 mitochondrial; 28S ribosomal protein S18a mitochondrial; Alias: HumanS18b; mitochondrial ribosomal protein S18 3; mitochondrial ribosomal protein S18A; MRP S18 3; MRP S18 a; MRPS18 3; S18bmt; S18mt a. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Cow,Horse,Sheep, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 19kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human MRPS18A Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01Mwww.sunlongbiotech.com TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% Product Detail: protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. A pseudogene corresponding to this gene is found on chromosome 3p. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010] Function: MRPS18A is 1 of more than 70 protein components of mitochondrial ribosomes which are encoded by the nuclear genome. Mitochondria have their own translation system for production of 13 proteins essential for oxidative phosphorylation. Subcellular Location: Mitochondrial Similarity: Belongs to the ribosomal protein S18P family. Database links: Entrez Gene: 55168 Human Omim: 611981 Human SwissProt: Q9NVS2 Human Unigene: 520149 Human Important Note: This product as supplied is intended for research use only, not for use in human, therapeuticwww.sunlongbiotech.com or diagnostic applications. .
Load more

Recommended publications
  • Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation
    From THE DEPARTMENT OF MICROBIOLOGY TUMOR AND CELL BIOLOGY (MTC) Karolinska Institutet, Stockholm, Sweden ROLE OF MITOCHONDRIAL RIBOSOMAL PROTEIN S18-2 IN CANCEROGENESIS AND IN REGULATION OF STEMNESS AND DIFFERENTIATION Muhammad Mushtaq Stockholm 2017 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by E-Print AB 2017 © Muhammad Mushtaq, 2017 ISBN 978-91-7676-697-2 Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation THESIS FOR DOCTORAL DEGREE (Ph.D.) By Muhammad Mushtaq Principal Supervisor: Faculty Opponent: Associate Professor Elena Kashuba Professor Pramod Kumar Srivastava Karolinska Institutet University of Connecticut Department of Microbiology Tumor and Cell Center for Immunotherapy of Cancer and Biology (MTC) Infectious Diseases Co-supervisor(s): Examination Board: Professor Sonia Lain Professor Ola Söderberg Karolinska Institutet Uppsala University Department of Microbiology Tumor and Cell Department of Immunology, Genetics and Biology (MTC) Pathology (IGP) Professor George Klein Professor Boris Zhivotovsky Karolinska Institutet Karolinska Institutet Department of Microbiology Tumor and Cell Institute of Environmental Medicine (IMM) Biology (MTC) Professor Lars-Gunnar Larsson Karolinska Institutet Department of Microbiology Tumor and Cell Biology (MTC) Dedicated to my parents ABSTRACT Mitochondria carry their own ribosomes (mitoribosomes) for the translation of mRNA encoded by mitochondrial DNA. The architecture of mitoribosomes is mainly composed of mitochondrial ribosomal proteins (MRPs), which are encoded by nuclear genomic DNA. Emerging experimental evidences reveal that several MRPs are multifunctional and they exhibit important extra-mitochondrial functions, such as involvement in apoptosis, protein biosynthesis and signal transduction. Dysregulations of the MRPs are associated with severe pathological conditions, including cancer.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Download Special Issue
    BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Copyright © 2014 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data,JuliaTzu-YaWeng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Volume2014,ArticleID814092,3pages Evolution of Network Biomarkers from Early to Late Stage Bladder Cancer Samples,Yung-HaoWong, Cheng-Wei Li, and Bor-Sen Chen Volume 2014, Article ID 159078, 23 pages MicroRNA Expression Profiling Altered by Variant Dosage of Radiation Exposure,Kuei-FangLee, Yi-Cheng Chen, Paul Wei-Che Hsu, Ingrid Y. Liu, and Lawrence Shih-Hsin Wu Volume2014,ArticleID456323,10pages EXIA2: Web Server of Accurate and Rapid Protein Catalytic Residue Prediction, Chih-Hao Lu, Chin-Sheng
    [Show full text]
  • Parent of Origin Gene Expression in a Founder Population Identifies Two New
    bioRxiv preprint doi: https://doi.org/10.1101/344457; this version posted June 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Imprinted genes in a founder population 4 5 Parent of origin gene expression in a founder population identifies two new 6 imprinted genes at known imprinted regions. 7 8 9 10 Sahar V. Mozaffari1,2*, Michelle M. Stein2, Kevin M. Magnaye 2, Dan L. Nicolae1,2,3, Carole 11 Ober1,2 12 13 1Committee on Genetics, Genomics & Systems Biology, University of Chicago, Chicago, 14 Illinois, United States of America 15 2Department of Human Genetics, University of Chicago, Chicago, Illinois, United States of 16 America 17 3Department of Statistics, University of Chicago, Chicago, Illinois, United States of America 18 19 * Corresponding author 20 E-mail: [email protected] (SVM) 21 1 bioRxiv preprint doi: https://doi.org/10.1101/344457; this version posted June 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 22 Abstract 23 Genomic imprinting is the phenomena that leads to silencing of one copy of a gene 24 inherited from a specific parent. Mutations in imprinted regions have been involved in diseases 25 showing parent of origin effects.
    [Show full text]
  • The Ribosomal Protein Genes and Minute Loci of Drosophila
    Open Access Research2007MarygoldetVolume al. 8, Issue 10, Article R216 The ribosomal protein genes and Minute loci of Drosophila melanogaster Steven J Marygold*, John Roote†, Gunter Reuter‡, Andrew Lambertsson§, Michael Ashburner†, Gillian H Millburn†, Paul M Harrison¶, Zhan Yu¶, Naoya Kenmochi¥, Thomas C Kaufman#, Sally J Leevers* and Kevin R Cook# Addresses: *Growth Regulation Laboratory, Cancer Research UK London Research Institute, Lincoln's Inn Fields, London WC2A 3PX, UK. †Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2 3EH, UK. ‡Institute of Genetics, Biologicum, Martin Luther University Halle-Wittenberg, Weinbergweg, Halle D-06108, Germany. §Institute of Molecular Biosciences, University of Oslo, Blindern, Olso N-0316, Norway. ¶Department of Biology, McGill University, Dr Penfield Ave, Montreal, Quebec H3A 1B1, Canada. ¥Frontier Science Research Center, University of Miyazaki, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan. #Department of Biology, Indiana University, E. Third Street, Bloomington, IN 47405-7005, USA. Correspondence: Steven J Marygold. Email: [email protected]. Kevin R Cook. Email: [email protected] Published: 10 October 2007 Received: 17 June 2007 Revised: 10 October 2007 Genome Biology 2007, 8:R216 (doi:10.1186/gb-2007-8-10-r216) Accepted: 10 October 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/10/R216 © 2007 Marygold et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
    [Show full text]
  • Integrative Systems Biology Applied to Toxicology
    Integrative Systems Biology Applied to Toxicology Kristine Grønning Kongsbak PhD Thesis January 2015 Integrative Systems Biology Applied to Toxicology Kristine Grønning Kongsbak Søborg 2015 FOOD-PHD-2015 PhD Thesis 2015 Supervisors Professor Anne Marie Vinggaard Senior Scientist Niels Hadrup Division of Toxicology and Risk Assessment National Food Institute Technical University of Denmark Associate Professor Aron Charles Eklund Center for Biological Sequence Analysis Department for Systems Biology Technical University of Denmark Associate Professor Karine Audouze Mol´ecules Th´erapeutiques In Silico Paris Diderot University Funding This project was supported financially by the Ministry of Food, Agriculture and Fisheries of Denmark and the Technical University of Denmark. ©Kristine Grønning Kongsbak FOOD-PHD: ISBN 978-87-93109-30-8 Division of Toxicology and Risk Assessment National Food Institute Technical University of Denmark DK-2860 Søborg, Denmark www.food.dtu.dk 4 Summary Humans are exposed to various chemical agents through food, cosmetics, pharma- ceuticals and other sources. Exposure to chemicals is suspected of playing a main role in the development of some adverse health effects in humans. Additionally, European regulatory authorities have recognized the risk associated with combined exposure to multiple chemicals. Testing all possible combinations of the tens of thousands environmental chemicals is impractical. This PhD project was launched to apply existing computational systems biology methods to toxicological research. In this thesis, I present in three projects three different approaches to using com- putational toxicology to aid classical toxicological investigations. In project I, we predicted human health effects of five pesticides using publicly available data. We obtained a grouping of the chemical according to their potential human health ef- fects that were in concordance with their effects in experimental animals.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name 28S ribosomal protein S18a, mitochondrial Gene Symbol Mrps18a Organism Rat Gene Summary human homolog is a structural component of the mitochondrial ribosome small (18s) subunit Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.103049 Ensembl Gene ID ENSRNOG00000019511 Entrez Gene ID 301249 Assay Information Unique Assay ID qRnoCEP0030758 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000026499 Amplicon Context Sequence CAGAAGTAAGTTCCAACATCCCTGCCCTGTTTGTGGAGGACAGTGGTTCTGGCA GGAGGGGCAAGCACATCTTCTGGAAGGTTCTAGTCAGGATCTTCAGCAGTATCC CTCCCATTAGTGCATCAGCTTCA Amplicon Length (bp) 101 Chromosome Location 9:16133673-16133803 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 99 R2 0.9998 cDNA Cq 20.59 cDNA Tm (Celsius) 83 gDNA Cq 25.53 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Mrps18a, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Clinical Efficacy and Immune Regulation with Peanut Oral
    Clinical efficacy and immune regulation with peanut oral immunotherapy Stacie M. Jones, MD,a Laurent Pons, PhD,b Joseph L. Roberts, MD, PhD,b Amy M. Scurlock, MD,a Tamara T. Perry, MD,a Mike Kulis, PhD,b Wayne G. Shreffler, MD, PhD,c Pamela Steele, CPNP,b Karen A. Henry, RN,a Margaret Adair, MD,b James M. Francis, PhD,d Stephen Durham, MD,d Brian P. Vickery, MD,b Xiaoping Zhong, MD, PhD,b and A. Wesley Burks, MDb Little Rock, Ark, Durham, NC, New York, NY, and London, United Kingdom Background: Oral immunotherapy (OIT) has been thought to noted during OIT resolved spontaneously or with induce clinical desensitization to allergenic foods, but trials antihistamines. By 6 months, titrated skin prick tests and coupling the clinical response and immunologic effects of peanut activation of basophils significantly declined. Peanut-specific OIT have not been reported. IgE decreased by 12 to 18 months, whereas IgG4 increased Objective: The study objective was to investigate the clinical significantly. Serum factors inhibited IgE–peanut complex efficacy and immunologic changes associated with OIT. formation in an IgE-facilitated allergen binding assay. Secretion Methods: Children with peanut allergy underwent an OIT of IL-10, IL-5, IFN-g, and TNF-a from PBMCs increased over protocol including initial day escalation, buildup, and a period of 6 to 12 months. Peanut-specific forkhead box protein maintenance phases, and then oral food challenge. Clinical 3 T cells increased until 12 months and decreased thereafter. In response and immunologic changes were evaluated. addition, T-cell microarrays showed downregulation of genes in Results: Of 29 subjects who completed the protocol, 27 ingested apoptotic pathways.
    [Show full text]
  • Mitochondrial Ribosomal Proteins: Candidate Genes for Mitochondrial Disease James E
    March/April 2004 ⅐ Vol. 6 ⅐ No. 2 review Mitochondrial ribosomal proteins: Candidate genes for mitochondrial disease James E. Sylvester, PhD1, Nathan Fischel-Ghodsian, MD2, Edward B. Mougey, PhD1, and Thomas W. O’Brien, PhD3 Most of the energy requirement for cell growth, differentiation, and development is met by the mitochondria in the form of ATP produced by the process of oxidative phosphorylation. Human mitochondrial DNA encodes a total of 13 proteins, all of which are essential for oxidative phosphorylation. The mRNAs for these proteins are translated on mitochondrial ribosomes. Recently, the genes for human mitochondrial ribosomal proteins (MRPs) have been identified. In this review, we summarize their refined chromosomal location. It is well known that mutations in the mitochondrial translation system, i.e., ribosomal RNA and transfer RNA cause various pathologies. In this review, we suggest possible associations between clinical conditions and MRPs based on coincidence of genetic map data and chromosomal location. These MRPs may be candidate genes for the clinical condition or may act as modifiers of existing known gene mutations (mt-tRNA, mt-rRNA, etc.). Genet Med 2004:6(2):73–80. Key Words: mitochondrial, ribosomal proteins, oxidative phosphorylation, candidate genes, translation Most of the energy requirements for cell growth, differenti- THE MITORIBOSOME ation, and development are met by the mitochondrial ATP Human cells contain two genomes and two protein synthe- produced by the process of oxidative phosphorylation. Mito- sizing (translation) systems. The first is the nuclear genome of chondrial DNA encodes 13 essential proteins of this oxidative 3 ϫ 109 bp that has 30,000 to 40,000 genes coding a much phosphorylation system.
    [Show full text]
  • Ribo-Tag Translatomic Profiling of Drosophila Oenocyte Reveals Down
    bioRxiv preprint doi: https://doi.org/10.1101/272179; this version posted February 26, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Ribo-tag translatomic profiling of Drosophila oenocyte reveals down-regulation of 2 peroxisome and mitochondria biogenesis under aging and oxidative stress 3 Kerui Huang1*, Wenhao Chen2, Hua Bai1* 4 5 1 Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, IA 6 50011, USA 7 2 Department of Electrical and Computer Engineering, Iowa State University, Ames, IA 50011, 8 USA 9 10 *Corresponding Authors: 11 12 Kerui Huang 13 Phone: 515-294-3842 14 Email: [email protected] 15 16 Hua Bai 17 Phone: 515-294-9395 18 Email: [email protected] 19 20 Running title: 21 Drosophila oenocyte Ribo-tag profiling 22 23 24 25 26 27 28 29 30 31 bioRxiv preprint doi: https://doi.org/10.1101/272179; this version posted February 26, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 32 Abstract 33 Background: Reactive oxygen species (ROS) has been well established as toxic, owing to its 34 direct damage on genetic materials, protein and lipids. ROS is not only tightly associated with 35 chronic inflammation and tissue aging but also regulates cell proliferation and cell signaling. Yet 36 critical questions remain in the field, such as detailed genome-environment interaction on aging 37 regulation, and how ROS and chronic inflammation alter genome that leads to aging.
    [Show full text]