DOCSLIB.ORG

The Role of Serotonin in Breast Cancer Stem Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Serotonin in Breast Cancer Stem Cells molecules Review The Role of Serotonin in Breast Cancer Stem Cells William D. Gwynne 1 , Mirza S. Shakeel 2, Adele Girgis-Gabardo 2 and John A. Hassell 2,* 1 Department of Surgery, McMaster University, Hamilton, ON L8S 4L8, Canada; gwynnewd@mcmaster.ca 2 Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, ON L8S 4L8, Canada; shahbaz.shakeel3@gmail.com (M.S.S.); gabardoa@mcmaster.ca (A.G.-G.) * Correspondence: hassell@mcmaster.ca Abstract: Breast tumors were the first tumors of epithelial origin shown to follow the cancer stem cell model. The model proposes that cancer stem cells are uniquely endowed with tumorigenic capacity and that their aberrant differentiation yields non-tumorigenic progeny, which constitute the bulk of the tumor cell population. Breast cancer stem cells resist therapies and seed metastases; thus, they account for breast cancer recurrence. Hence, targeting these cells is essential to achieve durable breast cancer remissions. We identified compounds including selective antagonists of multiple serotonergic system pathway components required for serotonin biosynthesis, transport, activity via multiple 5-HT receptors (5-HTRs), and catabolism that reduce the viability of breast cancer stem cells of both mouse and human origin using multiple orthologous assays. The molecular targets of the selective antagonists are expressed in breast tumors and breast cancer cell lines, which also produce serotonin, implying that it plays a required functional role in these cells. The selective antagonists act synergistically with chemotherapy to shrink mouse mammary tumors and human breast tumor xenografts primarily by inducing programmed tumor cell death. We hypothesize those serotonergic proteins of diverse activity function by common signaling pathways to maintain cancer stem cell viability. Here, we summarize our recent findings and the relevant literature regarding the role of Citation: Gwynne, W.D.; Shakeel, serotonin in breast cancer. M.S.; Girgis-Gabardo, A.; Hassell, J.A. The Role of Serotonin in Breast Cancer Stem Cells. Molecules 2021, 26, Keywords: breast cancer; breast cancer stem cells; serotonin; serotonergic system antagonists; 3171. https://doi.org/10.3390/ G-protein receptors; kinase signaling cascades molecules26113171 Academic Editors: Marcello Leopoldo and Enza Lacivita 1. Introduction Breast cancer is the second most common cancer in women and the leading cause Received: 23 April 2021 of cancer-related deaths worldwide [1]. Despite increased screening and new targeted Accepted: 24 May 2021 therapies, the global incidence of breast cancer continues to increase [2]. Moreover, cytotoxic Published: 26 May 2021 therapies used to treat breast cancer frequently do not achieve long lasting remissions. In fact, roughly 30% of women diagnosed with invasive breast cancer relapse and 90% of Publisher’s Note: MDPI stays neutral these individuals die from metastases. Hence, new therapies are needed that ensure long with regard to jurisdictional claims in lasting remissions. published maps and institutional affil- iations. 1.1. Breast Cancer Clinical and Molecular Subtypes Breast tumors were first classified based on their hormone receptor status (estrogen (ER) and/or progesterone receptors (PR)), whether they overexpressed HER2, or did not express either ER, PR, or HER2, termed triple-negative breast cancer (TNBC) [3]. Global Copyright: © 2021 by the authors. gene expression profiling was subsequently used to molecularly classify breast tumors Licensee MDPI, Basel, Switzerland. into various subtypes: luminal A (ER+ and/or PR+/−); luminal B (ER+ and/or PR+/−) This article is an open access article and either HER2 overexpressing or not; basal-like (triple negative breast cancers (TNBC), distributed under the terms and do not express hormone receptors nor overexpress HER2; and normal-like. Luminal conditions of the Creative Commons A tumors comprise a low fraction of proliferating cells (defined by Ki67-positive cells), Attribution (CC BY) license (https:// whereas luminal B tumors are composed of a high fraction of dividing tumor cells. HER-2 creativecommons.org/licenses/by/ 4.0/). overexpressing breasts tumors do not express ER or PR or express them at low levels. Molecules 2021, 26, 3171. https://doi.org/10.3390/molecules26113171 https://www.mdpi.com/journal/molecules Molecules 2021, 26, x FOR PEER REVIEW 2 of 16 Molecules 2021, 26, 3171 2 of 16 2 overexpressing breasts tumors do not express ER or PR or express them at low levels. Normal-like tumors are similar to luminal A tumors. The prognosis for patients with breastNormal-like cancer is tumors linked are to their similar subtype to luminal in the Aorder tumors. from Thebest prognosisto worst prognosis: for patients luminal with A;breast normal-like; cancer is luminal linked to B, their HER2-overexpre subtype in thessing; order and from TNBC. best to Therapies worst prognosis: are tailored luminal for patientsA; normal-like; consistent luminal with their B, HER2-overexpressing; breast tumor subtype. and For TNBC. example, Therapies patients are with tailored HER-2 for overexpressingpatients consistent or ER+ with breast their tumors breast are tumor treated subtype. with monoclonal For example, antibodies patients or with small HER-2 mol- eculesoverexpressing that target or these ER+ receptors, breast tumors or in the are case treated of ER+ with tumors, monoclonal block antibodiesthe synthesis or of small es- trogen.molecules Unfortunately, that target these resistance receptors, to these orin drugs the case often of develops ER+ tumors, in patients. block the synthesis of estrogen. Unfortunately, resistance to these drugs often develops in patients. 1.2. Breast Cancer Stem Cells 1.2. Breast Cancer Stem Cells Breast cancer recurrence has been attributed to breast cancer stem cells [4], which are functionallyBreast cancerdefined recurrence by their capacity has been to attributed initiate tumor to breast growth cancer following stem cells their [4], transplan- which are tationfunctionally into mice defined and are by consequently their capacity also to initiate termed tumor breast growth tumor-initiating following theircells (BTICs) transplanta- [5]. BTICtion intoare micerefractory and are to consequentlycancer therapies, also s termedeed metastases, breast tumor-initiating and account for cells breast (BTICs) cancer [5]. recurrenceBTIC are refractory (Figure 1). to Analyses cancer therapies, of the mamma seedry metastases, tumors from and various account transgenic for breast mouse cancer modelsrecurrence of breast (Figure cancer1). Analyses revealed of that the like mammary human breast tumors tumors, from various these also transgenic follow the mouse can- cermodels stem cell of breast model cancer [6–9]. The revealed model that proposes like human that genetic breast or tumors, epigenetic these changes also follow in tissue- the specificcancer stemcells cellyield model tumor [6 –cells9]. Thewith model stem proposescell-like properties, that genetic including or epigenetic the capacity changes for in limitlesstissue-specific self-renewal cells yield and tumordifferentiation cells with [10]. stem The cell-like cellular properties, heterogene includingity of tumors the capacity is due tofor the limitless aberrant self-renewal differentiation and of differentiation the stem-like tumor [10]. The cells. cellular Hence, heterogeneity breast tumors ofcomprise tumors ais cellular due to hierarchy the aberrant of BTIC differentiation at their apex of theand stem-likenon-tumorigenic tumor cells. proliferating Hence, breastand differen- tumors tiatingcomprise progeny a cellular of these hierarchy cells at of their BTIC base. at their Whether apex BTIC and non-tumorigenicoriginate from normal proliferating breast and differentiating progeny of these cells at their base. Whether BTIC originate from stem cells or whether their frequency differs among breast tumors of distinct subtypes has normal breast stem cells or whether their frequency differs among breast tumors of distinct not yet been unequivocally established. subtypes has not yet been unequivocally established. Figure 1. The breast cancer stem cell model for disease recurrence. Schematic conveying the clinical implications of Figuretherapy-resistant 1. The breast BTIC. cancer Standard stem cell of care model consisting for disease of surgery recurrence. and cytotoxic Schematic therapies conveying principally the clinical eradicate implications non-BTIC. of ther- BTIC apy-resistantremain dormant BTIC. until Standard seeding of local care or consisting distant disease of surgery recurrences. and cytotoxic therapies principally eradicate non-BTIC. BTIC remain dormant until seeding local or distant disease recurrences. 1.3. Epithelial to Mesenchymal Transition and BTIC, Therapeutic Implications 1.3. Epithelial to Mesenchymal Transition and BTIC, Therapeutic Implications Studies during the last decade demonstrate that the induction of an epithelial to Studies during the last decade demonstrate that the induction of an epithelial to mes- mesenchymal transition (EMT) can endow “non-tumorigenic” breast tumor cells with enchymal transition (EMT) can endow “non-tumorigenic” breast tumor cells with BTIC BTIC activity, implying that breast tumor cells transition between non-tumorigenic and activity,tumorigenic implying states that [11 breast–13]. These tumor findings cells transition have therapeutic between non-tumorigenic implications [14 ].and Cytotoxic tumor- igenictherapies states eradicate [11–13].
Load more

Recommended publications
  • Strategies for Managing Sexual Dysfunction Induced by Antidepressant Medication
    King’s Research Portal DOI: 10.1002/14651858.CD003382.pub3 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Taylor, M. J., Rudkin, L., Bullemor-Day, P., Lubin, J., Chukwujekwu, C., & Hawton, K. (2013). Strategies for managing sexual dysfunction induced by antidepressant medication. Cochrane Database of Systematic Reviews, (5). https://doi.org/10.1002/14651858.CD003382.pub3 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact librarypure@kcl.ac.uk providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • Designing Inhibitors Via Molecular Modelling Methods for Monoamine Oxidase Isozymes a and B Filiz Varnali Kadir Has Universit
    DESIGNING INHIBITORS VIA MOLECULAR MODELLING METHODS FOR MONOAMINE OXIDASE ISOZYMES A AND B FİLİZ VARNALI KADİR HAS UNIVERSITY 2012 DESIGNING INHIBITORS VIA MOLECULAR MODELLING METHODS FOR MONOAMINE OXIDASE ISOZYMES A AND B FİLİZ VARNALI M.S. in Computational Biology and Bioinformatics, Kadir Has University, 2012 Submitted to the Graduate School of Science and Engineering in partial fulfilment of the requirements for the degree of Master of Science in Computational Biology and Bioinformatics KADİR HAS UNIVERSITY 2012 DESIGNING INHIBITORS VIA MOLECULAR MODELING METHODS FOR MONOAMINE OXIDASE ISOZYMES A AND B Abstract In drug development studies, a large number of new drug candidates (leads) have to be synthesized and optimized by changing several moieties of the leads in order to increase efficacies and decrease toxicities. Each synthesis of these new drug candidates include multi-steps procedures. Overall, discovering a new drug is a very time-consuming and very costly works. The development of molecular modelling programs and their applications in pharmaceutical research have been formalized as a field of study known computer assisted drug design (CADD) or computer assisted molecular design (CAMD). In this study, using the above techniques, Monoamine Oxidase isozymes, which play an essential role in the oxidative deamination of the biogenic amines, were studied. Compounds that inhibit these isozymes were shown to have therapeutic value in a variety of conditions including several psychiatric and neurological as well as neurodegenerative diseases. First, a series of new pyrazoline derivatives were screened using molecular modelling and docking methods and promising lead compounds were selected, and proposed for synthesis as novel selective MAO-A or –B inhibitors.
    [Show full text]
  • Discrimination Between Mechanism-Based Inactivation and Tight Binding Inhibitor Behavior
    Biomedical Chemistry: Research and Methods 2020, 3(1), e00115. DOI: 10.18097/bmcrm00115 1 EXPERIMENTAL RESEARCH A SIMPLE APPROACH FOR PILOT ANALYSIS OF TIME-DEPENDENT ENZYME INHIBITION: DISCRIMINATION BETWEEN MECHANISM-BASED INACTIVATION AND TIGHT BINDING INHIBITOR BEHAVIOR O.A. Buneeva, L.N. Aksenova, A.E. Medvedev* Institute of Biomedical Chemistry, 10 Pogodinskaya str., Moscow, 119121 Russia; *e-mail: professor57@yandex.ru The increase in enzyme inhibition developed during prolonged incubation of an enzyme preparation with a chemical substance may be associated with both the non-covalent and also with covalent enzyme-inhibitor complex formation. The latter case involves catalytic conversion of a mechanism-based irreversible inhibitor (a poor substrate) into a reactive species forming covalent adduct(s) with the enzyme and thus irreversibly inactivating the enzyme molecule. Using a simple approach, based on comparison of enzyme inhibition after preincubation with a potential inhibitor at 4ºC or 37ºC we have analyzed inhibition of monoamine oxidase A (MAO A) by known MAO inhibitors pargyline and pirlindole (pyrazidol). MAO A inhibitory activity of pirlindole (reversible tight binding inhibitor of MAO A) assayed after mitochondrial wash was basically the same for the incubation at both 4ºC and 37ºC. In contrast to pirlindole, the effect of pargyline (mechanism based irreversible MAO inhibitor) strongly depended on the temperature of the incubation medium. At 37ºC the residual activity MAO A in the mitochondrial fraction after washing was significantly lower than in the mitochondrial samples incubated with pargyline at 4ºC. Results of this study suggest that using analysis of both time- and temperature-dependence of inhibition it is possible to discriminate mechanism-based irreversible inhibition and reversible tight binding inhibition of target enzym Key words: enzyme inhibition; time-dependent and temperature-dependent inhibition; mechanism-based inhibitors; reversible tight binding inhibitors DOI: 10.18097/BMCRM00115 INTRODUCTION (England).
    [Show full text]
  • Attendee Guidelines
    (Temple of Eternal Sound) Attendee Guidelines 1. Introduction 2. Practical Guidelines -Preparation -Contraindications -Food -Clothing -Cleansing -During the Session -Suggested Best Practices -Temple Practices & Ritual Norms -Single Sacrament Sanctuary 3. Code of Ethics 4. Dietary Guidelines 5. Medical Information 6. Attendee Waiver Céu do Som Welcome, Thank you for your interest in our Forest Family Circles, Realisation Retreats and Wisdom Works at the Temple of Céu do Som & Abuelatree Sanctuary. You are endeavouring to participate in what, for us, is one of the most profound and meaningful doorways into the mysteries of the Sacred & Profound. The following pages are practical suggestions outlining our expectations, guidelines and safety measures to ensure harmony for you, for our work and for our community. We seek to uphold a high standard in regards to the safe space of transformation and realisation that may create a positive impact through healing and integration of our participants. The guidelines in this booklet all serve a direct purpose. We ask that each one be approached with due respect. It is not necessary to subscribe to our points of view in order to receive the sacrament. We do not discriminate and find that ultimately it is up to the individual to discover what is true for them. Así Céu do Som PRACTICAL GUIDELINES Preparation for the spiritual study Contraindications (refer to Medical Information section for more details) 1. If you are uncertain about any contraindications or factors please ask. 2. If you have any personal concerns a meeting can be arranged prior in order to discuss. 3. If you are taking any prescription medication, namely antidepressants, antipsychotics or SSRI's please speak to us (Refer to Medical Information section).
    [Show full text]
  • Dawson, S., Maund, E., Stuart, B., Moore, M., Christopher, D
    Dawson, S. , Maund, E., Stuart, B., Moore, M., Christopher, D., Geraghty, A. WA., & Kendrick, T. (2019). Managing Antidepressant Discontinuation: A Systematic Review. Annals of Family Medicine, 17(1), 52-60. https://doi.org/10.1370/afm.2336 Peer reviewed version License (if available): Other Link to published version (if available): 10.1370/afm.2336 Link to publication record in Explore Bristol Research PDF-document This is the accepted author manuscript (AAM). The final published version (version of record) is available online via the Annals of Family Medicine at https://doi.org/10.1370/afm.2336 . Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ Supplemental materials for: Maund E, Stuart B, Moore M, et al. Managing antidepressant discontinuation: a systematic review. Ann Fam Med. 2019;17(1):52-60. 1 Supplemental APPENDIX 1 - SEARCH STRATEGIES MEDLINE Ovid MEDLINE(R) Epub Ahead of Print, In-Process & Other Non-Indexed Citations, Ovid MEDLINE(R) Daily and Ovid MEDLINE(R) 1946 to 23 March 2017 Search Query Items ID# found 1 exp ANTIDEPRESSIVE AGENTS/ 133782 2 exp NEUROTRANSMITTER UPTAKE INHIBITORS/ 133192 3 (psychotropic* or antidepress* or anti depress* or ((serotonin or norepinephrine or 136112 noradrenaline or nor epinephrine or nor adrenaline or neurotransmitt* or dopamine*) and (uptake or reuptake or re-uptake)) or noradrenerg* or antiadrenergic or anti adrenergic or SSRI* or SNRI* or TCA* or tricyclic* or tetracyclic* or heterocyclic*).ti,kf,hw.
    [Show full text]
  • Proteostasis of Glial Intermediate Filaments: Disease Models, Tools, and Mechanisms
    PROTEOSTASIS OF GLIAL INTERMEDIATE FILAMENTS: DISEASE MODELS, TOOLS, AND MECHANISMS Rachel Anne Battaglia A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Cell Biology and Physiology in the School of Medicine. Chapel Hill 2021 Approved by: Natasha T. Snider Carol Otey Keith Burridge Douglas Cyr Mohanish Deshmukh Damaris Lorenzo i © 2021 Rachel Anne Battaglia ALL RIGHTS RESERVED ii ABSTRACT Rachel Anne Battaglia: Proteostasis of Glial Intermediate Filaments: Disease Models, Tools, and Mechanisms (Under the direction of Natasha T. Snider) Astrocytes are a major glial cell type that is crucial for the health and maintenance of the Central Nervous System (CNS). They fulfill diverse functions, including synapse formation, neurogenesis, ion homeostasis, and blood brain barrier formation. Intermediate filaments (IFs) are components of the astrocyte cytoskeleton that support many of these functions in healthy individuals. However, upon cellular stress or genetic mutations, IF proteins are prone to accumulation and aggregation. These processes are thought to contribute to disease pathogenesis of different tissue-specific disorders, but therapeutic targeting of IFs is hindered by a lack of pharmacological tools to modulate their assembly and disassembly states. Moreover, the mechanisms that govern the formation and dissolution of IF aggregates are poorly defined. In this dissertation, I investigate IF aggregates called Rosenthal fibers (RFs), which form in astrocytes of patients with two pediatric neurodegenerative diseases, Alexander disease (AxD) and Giant Axonal Neuropathy (GAN). My aim was to gain a better understanding of the mechanisms of how astrocyte IF protein aggregates form and interrogate the role of post- translational modifications (PTMs) in this process.
    [Show full text]
  • Pharmacological Interventions for Preventing Post-Traumatic Stress Disorder (PTSD) (Review)
    Pharmacological interventions for preventing post-traumatic stress disorder (PTSD) (Review) Amos T, Stein DJ, Ipser JC This is a reprint of a Cochrane review, prepared and maintained by The Cochrane Collaboration and published in The Cochrane Library 2014, Issue 7 http://www.thecochranelibrary.com Pharmacological interventions for preventing post-traumatic stress disorder (PTSD) (Review) Copyright © 2014 The Cochrane Collaboration. Published by John Wiley & Sons, Ltd. TABLE OF CONTENTS HEADER....................................... 1 ABSTRACT ...................................... 1 PLAINLANGUAGESUMMARY . 2 SUMMARY OF FINDINGS FOR THE MAIN COMPARISON . ..... 4 BACKGROUND .................................... 6 OBJECTIVES ..................................... 7 METHODS ...................................... 7 RESULTS....................................... 13 Figure1. ..................................... 14 Figure2. ..................................... 17 Figure3. ..................................... 18 ADDITIONALSUMMARYOFFINDINGS . 23 DISCUSSION ..................................... 26 AUTHORS’CONCLUSIONS . 27 ACKNOWLEDGEMENTS . 28 REFERENCES ..................................... 28 CHARACTERISTICSOFSTUDIES . 33 DATAANDANALYSES. 56 Analysis 1.1. Comparison 1 Propranolol versus placebo, Outcome 1 Treatment efficacy. 56 Analysis 1.2. Comparison 1 Propranolol versus placebo, Outcome 2 Sensitivity analysis - observed cases. 57 Analysis 2.1. Comparison 2 Hydrocortisone versus placebo, Outcome 1 Treatment efficacy. 58 Analysis 2.2. Comparison
    [Show full text]
  • Supplementary Table S1
    SUPPLEMENTARY TABLE S1 - PRIMER SEQUENCES RT-PCR SEQUENCES Locus Left Sequence (Forward) Tm Right Sequence (Reverse) Tm Product size (bp) CCNE1 GAAATGGCCAAAATCGACAG 60.45 TCTTTGTCAGGTGTGGGGA 60.1 110 CDK2 GGCCATCAAGCTAGCAGACT 59.6 GAATCTCCAGGGAATAGGGC 59.9 102 CDK1 TGGATCTGAAGAAATACTTGGATTCTA 60.7 CAATCCCCTGTAGGATTTGG 59.2 96 AKT1 ATGAGCGACGTGGCTATTG 59.8 GTAGCCAATGAAGGTGCCAT 60.0 114 AKT2 TCCGAGGTCGACACAAGGTA 60.2 CTGGTCCAGCTCCAGTAAGC 60.1 105 AKT3 TTTGATGAAGAATTTACAGCTCAGA 59.4 TCTCATTGTCCATGCAGTCC 59.6 88 BCL-2* CCGCATCAGGAAGGCTAGAG 62.3 CTGGGACACAGGCAGGTTCT 62.6 95 BCL-XL* TGGAGTCAGTTTAGTGATGTGGA 59.6 CCAGGATGGGTTGCCATTG 64.6 102 BCL-W* GACAAGTGCAGGAGTGGATG 58.5 AAGGCCCCTACAGTTACCAG 58.7 208 MCL-1* GTAAGGAGTCGGGGTCTTCC 59.9 CCCCACAGTAGAGGTTGAGT 56.6 108 *from Liu et al Gut 2015 SUPPLEMENTARY TABLE S2 - shRNA SEQUENCES CDK2 shRNA ID SEQUENCE 1 TGCTGTTGACAGTGAGCGCCGTACGGAGTTGTGTACAAAGTAGTGAAGCCACAGATGTACTTTGTACACAACTCCGTACGTTGCCTACTGCCTCGGA 3 TGCTGTTGACAGTGAGCGCGGTTATATCCAATAGTAGAGTTAGTGAAGCCACAGATGTAACTCTACTATTGGATATAACCTTGCCTACTGCCTCGGA 5 TGCTGTTGACAGTGAGCGACGAGAGATCTCTCTGCTTAAGTAGTGAAGCCACAGATGTACTTAAGCAGAGAGATCTCTCGGTGCCTACTGCCTCGGA 6 TGCTGTTGACAGTGAGCGAAAGGATGAACAATTATATTTATAGTGAAGCCACAGATGTATAAATATAATTGTTCATCCTTCTGCCTACTGCCTCGGA 8 TGCTGTTGACAGTGAGCGAAGGGATTGTGCTTCATTCCAATAGTGAAGCCACAGATGTATTGGAATGAAGCACAATCCCTGTGCCTACTGCCTCGGA SUPPLEMENTARY TABLE S3 - DATASET FOR ANALYSIS FROM PROJECT ACHILLES CELL LINE CCNE1 COPY NUMBER CCNE1 EXPRESSION CAOV4_OVARY High High EFO21_OVARY High High JHOC5_OVARY High High KURAMOCHI_OVARY High High
    [Show full text]
  • Dopamine Receptors
    Tocris ScientificDopamine Review Receptors Series Tocri-lu-2945 Dopamine Receptors Philip G. Strange1 and Kim Neve2 History 1School of Pharmacy, University of Reading, Whiteknights, It was not until the late 1950s that dopamine was recognized Reading, RG6 6AJ, UK, Email: P.G.Strange@rdg.ac.uk as a neurotransmitter in its own right, but the demonstration of its non-uniform distribution in the brain, distinct from the 2 VA Medical Center and Department of Behavioral Neuroscience, distribution of noradrenaline, suggested a specific functional Oregon Health & Science University, Portland, OR 97239, USA, role for dopamine.1 Interest in dopamine was intensified by Email: nevek@ohsu.edu the realization that dopamine had an important role in the Professor Philip Strange has worked on the structure and pathogenesis or drug treatment of certain neurological disorders, function of G protein-coupled receptors for many years. A major e.g. Parkinson’s disease and schizophrenia.2,3 This led to much focus of his work has been the receptors for the neurotransmitter research on the sites of action of dopamine and the dopamine dopamine, with particular emphasis on their role as targets receptors (Box 1). One milestone was the suggestion by Cools for drugs and understanding the mechanisms of agonism and and van Rossum, based on anatomical, electrophysiological inverse agonism at these receptors. and pharmacological studies, that there might be more than one kind of receptor for dopamine in the brain.4 Biochemical Professor Kim Neve has studied dopamine receptors for most studies on dopamine receptors in the 1970s based on second of his scientific career, with an emphasis on relating structural messenger assays (e.g.
    [Show full text]
  • Antidepressants for Preventing Postnatal Depression (Review)
    Cochrane Database of Systematic Reviews Antidepressants for preventing postnatal depression (Review) Molyneaux E, Telesia LA, Henshaw C, Boath E, Bradley E, Howard LM Molyneaux E, Telesia LA, Henshaw C, Boath E, Bradley E, Howard LM. Antidepressants for preventing postnatal depression. Cochrane Database of Systematic Reviews 2018, Issue 4. Art. No.: CD004363. DOI: 10.1002/14651858.CD004363.pub3. www.cochranelibrary.com Antidepressants for preventing postnatal depression (Review) Copyright © 2018 The Cochrane Collaboration. Published by John Wiley & Sons, Ltd. TABLE OF CONTENTS HEADER....................................... 1 ABSTRACT ...................................... 1 PLAINLANGUAGESUMMARY . 2 SUMMARY OF FINDINGS FOR THE MAIN COMPARISON . ..... 4 BACKGROUND .................................... 7 OBJECTIVES ..................................... 8 METHODS ...................................... 8 RESULTS....................................... 13 Figure1. ..................................... 14 Figure2. ..................................... 16 Figure3. ..................................... 17 Figure4. ..................................... 19 Figure5. ..................................... 20 ADDITIONALSUMMARYOFFINDINGS . 21 DISCUSSION ..................................... 24 AUTHORS’CONCLUSIONS . 25 ACKNOWLEDGEMENTS . 26 REFERENCES ..................................... 26 CHARACTERISTICSOFSTUDIES . 28 DATAANDANALYSES. 35 Analysis 1.1. Comparison 1 Nortriptyline versus placebo, Outcome 1 Recurrence of postpartum major depressive disorder....................................
    [Show full text]
  • Monoamine Oxidase a Inhibitory Potency and Flavin
    Biochemical Pharmacology 65 (2003) 1867–1874 Monoamine oxidase A inhibitory potency and flavin perturbation are influenced by different aspects of pirlindole inhibitor structure Robert M.G. Hynsona, Johan Woutersb, Rona R. Ramsaya,* aCentre for Biomolecular Sciences, University of St. Andrews, North Haugh, St. Andrews, Fife KY16 9ST, UK bInstitut de Recherches Microbiologiques Wiame, 1 Av. E.Gryzon, 1070 Brussels, Belgium Received 26 August 2002; accepted 17 February 2003 Abstract Reversible inhibitors of monoamine oxidase A (MAO A) are used as antidepressants. The influence of inhibitors such as pirlindole (pyrazinocarbazole) on the redox co-factor (flavin adenine dinucleotide, FAD) is a key factor in the inhibition. The kinetic, spectral, and thermodynamic changes induced by four closely related pirlindole analogues have been determined to investigate their interaction with the FAD in the active site of MAO A. For a model of flavin–inhibitor stacking, more favourable association would be expected between lumiflavin and the flatter analogues with a double bond at N3, and indeed lower Ki values were found. However, the spectral changes induced by inhibitor binding to MAO A were 45% less for inhibitors with a double bond. Both in the absence and presence of the double bond, compounds with cyclohexyl at C8 induced 85% larger decrease in absorbance at 500 nm than did those with a methyl substituent. In contrast, the Ki values for the cyclohexyl compounds were lower, indicating greater affinity despite the lower perturbation of the flavin spectrum. All inhibitors stabilised the semiquinone of the FAD when MAO A was titrated with dithionite and prevented further reduction. These results indicate that the active site of MAO A is far more sensitive to structural variation than would be predicted by the simple flavin stacking model.
    [Show full text]
  • Mitigation of NADPH Oxidase 2 Activity As a Strategy to Inhibit Peroxynitrite Formation
    Mitigation of NADPH Oxidase 2 Activity as a Strategy to Inhibit Peroxynitrite Formation Jacek Zielonka, Monika Zielonka, Lynn Verplank, Gang Cheng, Micael Hardy, Olivier Ouari, Mehmet Menaf Ayhan, Radoslaw Podsiadly, Adam Sikora, J Lambeth, et al. To cite this version: Jacek Zielonka, Monika Zielonka, Lynn Verplank, Gang Cheng, Micael Hardy, et al.. Mitigation of NADPH Oxidase 2 Activity as a Strategy to Inhibit Peroxynitrite Formation. Journal of Biologi- cal Chemistry, American Society for Biochemistry and Molecular Biology, 2016, 291, pp.7029-7044. 10.1074/jbc.M115.702787. hal-01400640 HAL Id: hal-01400640 https://hal-amu.archives-ouvertes.fr/hal-01400640 Submitted on 28 Nov 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. JBC Papers in Press. Published on February 2, 2016 as Manuscript M115.702787 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M115.702787 Nox2 inhibition as anti-nitration strategy Mitigation of NADPH oxidase 2 activity as a strategy to inhibit peroxynitrite formation Jacek Zielonka1, Monika Zielonka1, Lynn
    [Show full text]