Bradykinin Receptors Mediate Dynorphin Pronociceptive Action to Produce Persistent Pain

Bradykinin Receptors Mediate Dynorphin Pronociceptive Action To Produce Persistent Pain

Item Type text; Electronic Dissertation

Authors Chen, Qingmin

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 24/09/2021 14:59:24

Link to Item http://hdl.handle.net/10150/195460

BRADYKININ RECEPTORS MEDIATE DYNORPHIN PRONOCICEPTIVE ACTION TO PRODUCE PERSISTENT PAIN

By Qingmin Chen

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF MEDICAL PHARMACOLOGY

In Partial Fulfillment of the Requirement

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2007

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Qingmin Chen entitled “BRADYKININ RECEPTORS MEDIATE DYNORPHIN PRONOCICEPTIVE ACTION TO PRODUCE PERSISTENT PAIN” and recommend that it be accepted as fulfilling the dissertation requirement for the

Degree of Doctor of Philosophy

Frank Porreca, Ph.D. Date: 10/10/2007

Josephine Lai, Ph.D. Date: 10/10/2007

Todd Vanderah, Ph.D. Date: 10/10/2007

Edward French, Ph.D. Date: 10/10/2007

Robert Sloviter, Ph.D. Date: 10/10/2007

Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

Frank Porreca, Ph.D. Date: 10/10/2007 Dissertation Director: Frank Porreca, Ph. D.

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotations from or reproduction of this manuscript in whole or in part may be granted by the copyright holder.

Signed: Qingmin Chen

ACKNOWLEDGEMENTS

Over the course of my graduate studies at the University of Arizona, I have had the support and help of a great number of people. I would like to thank first and foremost my advisor, Dr. Frank Porreca, not only for sharing with me his vast knowledge of science, but also for his inspiring stamina, competent and foreseeing guidance, and constant support throughout the years leading up to the preparation and completion of this work. His educational advice and moral encouragement throughout all the phases of the process are extremely valuable. His brilliance in science is something I will enjoy throughout my career. I would also like to express my deepest gratitude to the members of my committee, Dr. Josephine Lai, Dr. Todd Vanderah, Dr. Edward French and Dr. Robert Sloviter for their valuable comments, suggestions and support throughout my entire educational and research experience at the University of Arizona and helping me achieve my doctoral degree here. In addition, very special thanks go to Dr. Michael Ossipov and Dr. Tamara King, who are always there to help on any kind of problems I encountered. I would also like to thank Dr. Miaw-Chyi Luo and Cinzia Cantu for helping with RT-PCR data; Dr. Louis Vera-Portocarrero and Marina Vardanyan for helping with pancreatitis model; Peg Davis for helping me with the American culture, language and proofreading my manuscripts and dissertation; also Lisa Majuta for being such an excellent lab manager and information center. I sincerely thank all of my lab-mates for all their help including: Dongqin Zhang, Wenhong Guo, Shouwu Ma, Hamid Badghisi, Juliana Chichorro, Milena DeFelice, Becky Edelmayer, Beatriz Fioravanti, Stephanie Hartz, Shannon Holt, Mohab Ibrahim, Justin Kowal, Kiran Kumar, Dr. Phil Malan, Tim Marshall, Eddie Mata, Ohannes Melemedjian, Ramon Mercado, Tally Largent-Milnes, Miki Ota, Janice Somoza-Oyarzo, Jiyang Ren, Jill Roberts, Nicole Schechter, Nicola Stagg, Lauren Tabis, Anna Vardanyan, Laura Vogel, Ruizhong Wang, Yanhua Xie (Jennifer) and En-Tan Zhang. In addition, appreciation is also extended to all the other faculty and students of the department of Pharmacology at the University of Arizona.

TABLE OF CONTENTS

LIST OF FIGURES 9 LIST OF TABLES 12 ABBREVIATIONS 13 ABSTRACT 14

PART ONE ─ BRADYKININ RECEPTORS MEDIATE THE PRONOCICEPTIVE ACTION OF DYNORPHIN TO PRODUCE PERSISTENT PAIN IN THE NEUROPATHIC PAIN STATE 16

ABSTRACT 17

CHAPTER ONE: INTRODUCTION 19 1.1 Neuropathic pain 19 1.2 Animal models of neuropathic pain 21 1.3 Possible mechanisms of neuropathic pain 23 1.3.1 Ectopic discharge 23 1.3.2 Anatomical reorganization in the spinal cord 25 1.3.3 Sensitization in the spinal cord 26 1.3.4 Decreased inhibition in the spinal cord 26 1.3.5 Activation of decending facilitation from the RVM 27 1.3.6 Up-regulation of spinal dynorphin 28 1.3.6.1 The paradox of dynorphin 28 1.3.6.2 Non-opioid actions of dynorphin may maintain the persistent pain in neuropathic pain 30 1.3.6.3 Bradykinin receptor mediated excitatory effect of dynorphin in vitro 31 1.3.6.4 Dynorphin A raises intracellular calcium by activating voltage sensitive calcium channels 31 1.3.6.5 Dynorphin A (2-13) directly interacts with bradykinin receptors 33 1.4 Summary of research goals 35

CHAPTER TWO: MATERIALS AND METHODS 44 2.1 Animals 44 2.2 Drugs and doses 44 2.3 Surgical preparations 45 2.3.1 Subcutaneous osmotic pump implantation 45 2.3.2 Spinal nerve ligation (SNL) and sham surgery 45 2.3.3 Intrathecal catheterization 46 2.4 Behavioral testing 47 2.4.1 Von Frey test for tactile hypersensitivity 47 2.4.2 Radiant heat and hot plate test for thermal hypersensitivity 47

TABLE OF CONTENTS – Continued

2.5 Quantitative RT-PCR 48 2.6 Data analysis 49

CHAPTER THREE: RESULTS 50 3.1 Intrathecal administration of bradykinin to rats 50 3.2 Intrathecal administration of dynorphin A (2-13) to rats 50 3.3 Dynorphin-induced tactile and thermal hypersensitivities with bradykinin B2 receptor antagonist 51 3.4 Dynorphin-induced tactile and thermal hypersensitivities with bradykinin B1 receptor antagonist 52 3.5 Intrathecal dynorphin A (2-13) administered to bradykinin B2 receptor knock-out mice 52 3.6 Intrathecal injection of bradykinin B2 receptor antagonist in rats with nerve injury 53 3.7 Intrathecal injection of bradykinin B1 receptor antagonist in rats with nerve injury 54 3.8 Intrathecal co-administration of bradykinin B1 and B2 antagonist in rats with nerve injury 54 3.9 Intrathecal infusion of bradykinin B1 and B2 antagonists in rats with nerve injury 55 3.10 Systemic infusion of bradykinin B1 and B2 antagonists in rats with nerve injury 57 3.11 Local administration of bradykinin B1 and B2 antagonists in rats with nerve injury 58 3.12 Bradykinin B1 and B2 receptors’ mRNA expression in dorsal root ganglia and spinal cord after spinal nerve injury 58 3.13 Increased prodynorphin, but not kininogen, mRNA in the lumbar spinal cord after spinal nerve injury 59 3.14 Intrathecal administration of bradykinin anti-serum in rats with nerve injury 60

CHAPTER FOUR: DISCUSSION 79

PART TWO ─ ATTENUATION OF EXPERIMENTAL PANCREATITIS PAIN BY A BRADYKININ B2 RECEPTOR ANTAGONIST 88

ABSTRACT 89

CHAPTER ONE: INTRODUCTION 91 1.1 Visceral pain 91 1.2 Transmission of visceral pain 91

TABLE OF CONTENTS – Continued

1.3 Pancreatitis 93 1.4 Pancreatitis pain 93 1.5 Pathogenesis of pain in chronic pancreatitis 94 1.6 DBTC-induced persistent pancreatitis model 96 1.7 Role of kinin-kallikerin system in pancreatitis 96 1.8 Role of spinal dynorphin in pancreatitis pain 98 1.9 Summary of research goals 100

CHAPTER TWO: MATERIALS AND METHODS 104 2.1 Animals 104 2.2 Induction of pancreatitis 104 2.3 Intrathecal catheter implantation 104 2.4 Drugs and injection 105 2.5 Quantitative RT-PCR 105 2.6 Visceral pain behavioral measurements 107 2.7 Pancreatic histology 108 2.8 Data analysis 108

CHAPTER THREE: RESULTS 109 3.1 Pancreatic morphology analysis 109 3.2 Systemic B2 but not B1 receptor antagonist reverses the abdominal hypersensitivity induced by DBTC 109 3.3 mRNA expression of B1 and B2 receptor in pancreas after DBTC injection 110 3.4 Spinal B2 but not B1 receptor antagonist reverses abdominal hypersensitivity induced by DBTC 110 3.5 Spinal dynorphin anti-serum reverses the abdominal hypersensitivity induced by DBTC 111 3.6 Bradykinin B1 and B2 mRNA expression in the dorsal root ganglia and spinal cord after DBTC injection 111

CHAPTER FOUR: DISCUSSION 119

PART THREE ─ DYNORPHIN MAINTAINS CFA-INDUCED INFLAMMATORY PAIN VIA BRADYKININ RECEPTORS 124

ABSTRACT 125

CHAPTER ONE: INTRODUCTION 126

CHAPTER TWO: MATERIALS AND METHODS 128 2.1 Animals 128

TABLE OF CONTENTS – Continued

2.2 Intrathecal catherization and drug administration 128 2.3 Behavioral testing 129 2.4 Quantitative RT-PCR 129

CHAPTER THREE: RESULTS 132 3.1 Intraplantar CFA induces tactile and thermal hypersensitivities in rats 132 3.2 Intrathecal dynorphin anti-serum reverses CFA-induced tactile and thermal hypersensitivies at 72 but not 6 hours post-CFA 132 3.3 Intrathecal bradykinin antagonists reverse CFA-induced tactile and thermal hypersensitivies at 72 but not 6 hours post-CFA 134 3.4 Up-regulation of spinal dynorphin occurs at 72 but not 6 hours after intraplantar injection of CFA 135

CHAPTER FOUR: DISCUSSION 142

CONCLUSIONS 147

REFERENCES 151

LIST OF FIGURES

PART ONE

Figure 0.1 Schematic diagram of the different nerve injury models for neuropathic pain 39

Figure 0.2 L5 and L6 spinal nerve ligation induced spinal dynorphin content upregulation 40

Figure 0.3 Dynorphin A (2-13) induces calcium influx in DRG and F-11 cells 41

Figure 0.4 Inhibitory effect of VSCC blockers on dynorphin A (2-13) - induced 2+ [Ca ]i in F-11 cells 42

Figure 0.5 Inhibitory effect of B2 receptor selective antagonist 2+ HOE 140 on dynorphin A (2-13)-induced [Ca ]i in F-11 cells 43

Figure 1.1A Acute effects of intrathecal administration of bradykinin on response threshold to von Frey filaments in rats 61

Figure 1.1B Acute effects of intrathecal administration of bradykinin on response latency to radiant heat in rats 62

Figure 1.1C Acute effects of intrathecal administration of bradykinin on response latency to hotplate in rats 63

Figure 1.2 Intrathecal dynorphin A (2-13) produces reversible tactile and thermal hypersensitivities in rats 64

Figure 1.3 Effects of graded doses of i.th. HOE 140 on tactile and thermal hypersensitivity induced by dynorphin A (2-13) 65

Figure 1.4 Effects of graded doses of i.th. DALBK on tactile and thermal hypersensitivity induced by dynorphin A (2-13) 66

Figure 1.5 Effects of intrathecal dynorphin A(2-13) in bradykinin receptor knock-out and wild type mice 67

Figure 1.6 Effects of intrathecal administration of HOE 140 in SNL-induced tactile and thermal hypersensitivity 68

LIST OF FIGURES –Continued

Figure 1.7 Effects of intrathecal administration of DALBK in SNL-induced tactile and thermal hypersensitivity 69

Figure 1.8 Effects of intrathecal co-administration of HOE 140 and DALBK in SNL-induced tactile and thermal hypersensitivity 70

Figure 1.9 Effects of intrathecal infusion of HOE 140 and DALBK in SNL-induced tactile hypersensitivity 71

Figure 1.10 Effects of intrathecal infusion of HOE 140 and DALBK in SNL-induced thermal hypersensitivity 72

Figure 1.11 Effects of systemic infusion of HOE 140 and DALBK in SNL-induced tactile hypersensitivity 73

Figure 1.12 Effects of systemic infusion of HOE 140 and DALBK in SNL-induced thermal hypersensitivity 74

Figure 1.13 Effects of local administration of HOE 140 in SNL-induced tactile and thermal hypersensitivity 75

Figure 1.14 RT-PCR analysis of bradykinin B1 and B2 receptor mRNA in lumbar DRG and spinal cord in SNL rats 76

Figure 1.15 RT-PCR analysis of spinal prodynorphin and kininogen mRNA in SNL rats 77

Figure 1.16 Effect of spinal bradykinin anti-serum in SNL-induced tactile and thermal hypersensitivity 78

PART TWO

Figure 0.1 Simplified scheme of the kinin-kallikerin system 102

Figure 0.2 Dynorphin levels in the spinal cord on day 6 after DBTC-induced pancreatitis 103

Figure 1.1 Histological sections of pancreas stained with hematoxylin and eosin from rats with DBTC-induced pancreatitis 113

LIST OF FIGURES –Continued

Figure 1.2 Effects of i.p. HOE 140 and DALBK on abdominal hypersensitivity on day 7 after induction of pancreatitis 114

Figure 1.3 RT-PCR analysis of bradykinin B1 and B2 receptor mRNA expression in the pancreas on day 7 after induction of pancreatitis 115

Figure 1.4 Effects of i.t. HOE 140 and DALBK on abdominal hypersensitivity on day 7 after induction of pancreatitis 116

Figure 1.5 Effects of intrathecal dynorphin A(2-13) on abdominal hypersensitivity on day 7 after induction of pancreatitis 117

Figure 1.6 RT-PCR analysis of bradykinin B1 and B2 receptor mRNA expression in thoracic DRG and spinal cord on day 7 after induction of pancreatitis 118

PART THREE

Figure 1.1 Intraplantar CFA induces tactile and thermal hypersensitivies in rats 137

Figure 1.2 Effect of spinal dynorphin anti-serum in CFA-induced tactile and thermal hypersensitivies at 6 and 72 hours post-CFA 138

Figure 1.3 Effect of spinal B2 receptor antagonists in CFA-induced tactile and thermal hypersensitivies at 6 and 72 hours post-CFA 139

Figure 1.4 Effect of spinal B1 receptor antagonists in CFA-induced tactile and thermal hypersensitivies at 6 and 72 hours post-CFA 140

Figure 1.5 PT-PCR analysis of mRNA expression of prodynorphin in the spinal cord at 6 and 72 hours after intraplantar injection of CFA 141

LIST OF TABLES

Table 1 Ki values for dynorphin fragments 37

Table 2 Competitive radioligand binding analysis of dynorphin A (2-13) and dynorphin A (1-17) 38

ABBREVIATIONS

B1 Bradykinin B1 receptor B2 Bradykinin B2 receptor CCI Chronic constriction injury CCK Cholecystokinin CFA Complete Freund’s adjuvant CGRP Calcitonin Gene-related peptide CNS Central nervous system CP Chronic pancreatitis DALBK [Des-Arg 9, Leu 8]-bradykinin DBTC Dibutyltin dichloride DC Dorsal Colum DRG Dorsal root ganglion DLF Dorsolateral funiculus Dyn Dynorphin GABA Gamma-aminobutyric acid L5, L6 Lumbar 5, 6 NMDA N-methyl-D-aspartate PAF Peripheral afferent fibers PDYN Prodynorphin PLC P hospholipase C PKA Protein kinase A PKC Protein kinase C

ABSTRACT

Intrathecal injection of dynorphin or des-Tyr-dynorphin fragments, which do not bind to opioid receptors, produce tactile and thermal hypersensitivity in rodents. The maintenance, but not initiation, of experimental neuropathic pain depends upon pronociceptive effects of elevated levels of spinal dynorphin. Recent findings implicated a direct excitatory action of dynorphin A at bradykinin receptors in vitro . Here, the possibility that the pronociceptive actions of pharmacological dynorphin or of pathological levels of endogenous spinal dynorphin are mediated by interaction with bradykinin receptors was explored.

While spinal administration of a wide range of bradykinin did not produce hyperalgesia in rats, intrathecal injection of non-opioid des-tyrosyl-dynorphin A(2-13) produced reversible tactile and thermal hypersensitivities that were reversed by bradykinin receptor antagonists. Dynorphin-induced behavioral hyperesthesias were observed in bradykinin B2 receptor wild-type but not in B2 receptor knockout mice.

Spinal administration or infusion of B1, and especially B2, receptor antagonists reversed experimental neuropathic pain behaviors in rats with peripheral nerve injury but only when the antagonists were given at times at which dynorphin was upregulated. After nerve injury, both B1 and B2 receptor mRNA were increased in the dorsal root ganglion, but not in the spinal cord. While a marked increase in mRNA expression for prodynorphin in the lumbar spinal cord was found following nerve injury, expression of mRNA for kininogen was below detection levels. The possible interaction of spinal dynorphin with bradykinin receptors as a basis of the pronociceptive action of this

peptide was further tested in the CFA-induced inflammatory pain and DBTC-induced

pancreatitis pain. Intrathecal administration of bradykinin receptor antagonists or

dynorphin antiserum reversed DBTC-induced abdominal hypersensitivity and CFA-

induced hyperalgesia only when spinal dynorphin or prodynorphin is upregulated. The

antihyperalgesic effect of the bradykinin receptor antagonists was not due to de novo production of bradykinin.

Taken together, our results unravel a novel, non-opioid molecular target of dynorphin, and indicate that dynorphin acts at bradykinin receptors to produce persistent pain in the pathological pain states. This novel pronociceptive mechanism offers new approaches to the development of therapy for pathological pain states.

PART ONE

BRADYKININ RECEPTORS MEDIATE THE PRONOCICEPTIVE ACTION OF DYNORPHIN TO PRODUCE PERSISTENT PAIN IN THE NEUROPATHIC PAIN STATE

ABSTRACT

The maintenance, but not initiation, of experimental neuropathic pain depends

upon pronociceptive effects of elevated levels of spinal dynorphin. The intrathecal

injections of dynorphin or des-Tyr-dynorphin fragments, which do not bind to opioid receptors, produce tactile and thermal hypersensitivities in rodents reminiscent of some aspects of neuropathic pain. The mechanisms by which dynorphin elicits pronociceptive activity are unknown. Here, the possibility that the pronociceptive actions of pharmacological dynorphin or of nerve injury-induced pathological levels of endogenous spinal dynorphin are mediated by interaction with bradykinin receptors was explored.

While spinal administration of a wide range of bradykinin doses did not produce hyperalgesia in rats, intrathecal injection of non-opioid des-tyrosyl-dynorphin A(2-13) produced reversible tactile and thermal hypersensitivities that were reversed by bradykinin receptor antagonists. Dynorphin-induced behavioral hyperesthesias were observed in bradykinin B2 receptor wild-type but not in B2 receptor knockout mice.

Spinal administration and infusion of B1 and especially B2 receptor antagonists reversed experimental neuropathic pain behaviors in rats with peripheral nerve injury but only when the antagonists were given at times at which dynorphin was upregulated. The intrathecal administration of bradykinin antiserum did not blocked experimental neuropathic pain behaviors in rats in the maintain phase. After nerve injury, both B1 and

B2 receptor mRNA were increased in the dorsal root ganglion, but not in the spinal cord.

While a marked increase in mRNA expression for prodynorphin in the lumbar spinal cord was found following nerve injury, expression of mRNA for kininogen was below

detection levels. These results provide a novel, non-opioid molecular target of dynorphin, elucidate a mechanism through which hyperalgesic states may be maintained in chronic pain states and offer a novel approach for the therapy of pathological pain.

CHAPTER ONE

INTRODUCTION

Pain is defined as an "an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage”, according to the International Association for the Study of Pain (Merskey & Bogduk, 1984). Pain is often classified into two main types: acute pain and chronic pain. Acute pain is a direct physiological response to disease, inflammation, or tissue damage. It is generally self- limiting and is responsive to NSAIDs (nonsteroidal anti-inflammatory drugs) and opioids, among other therapies. Chronic pain, on the other hand, refers to a pain state in which the cause of the pain cannot be removed or otherwise treated. Chronic pain may be associated with long-term incurable or intractable medical conditions or diseases. One of the most common chronic pain states is neuropathic pain. Neuropathic pain occurs when there are structural and/or functional nervous system adaptations secondary to injury, which take place centrally or peripherally (Jensen et al., 1996). This type of pain is often triggered by an injury or caused by a disease process, and is frequently described as burning, shooting, lancinating, or electric shock qualities.

1.1 Neuropathic pain

Neuropathic pain is defined as “abnormal pain initiated or caused by a primary lesion or dysfunction in the nervous system (Merskey et al. 1984). Pain in these cases can occur and persist long after tissue repair. Common examples of neuropathic pain include phantom limb pain, post-stroke and post-spinal cord injury pain, and causalgia after nerve damage. Regardless of the underlying causes, neuropathic pain is associated with a

multiplicity of signs and symptoms, such as spontaneous pain, paresthesia, hyperalgesia, allodynia, etc. One of the most important health problems in America is the inefficient treatment of the chronic pain state. About one-third of Americans suffer from of some kind of chronic pain, and as many as one-third of these patients have abnormal pain that is resistant to commonly used medical and pharmacological interventions. Neuropathic pain, a chronic pain state, is one of most difficult conditions to treat since it responds poorly to NSAIDs and opioid analgesics. Currently, the pharmacological mainstays of clinical management are antidepressants, certain anticonvulsants, and gabapentin

(McQuay et al., 1996; Sindrup et al., 1999), but these achieve clinically significant pain relief in less than 50% of patients and are associated with sub-optimal side effect profiles

(Bridges et al., 2001).

The mechanisms involved in neuropathic pain are complex and involve both peripheral and central pathophysiologic phenomena. Research on mechanisms of neuropathic pain has been mainly focused on the changes in the peripheral nerve or spinal cord after peripheral nerve injury. Consequences after peripheral nerves injury include: peripheral nerve degeneration, ectopic foci formation due to peripheral nerve sprouts, A- beta sprouting into superficial lamina of the dorsal horn of the spinal cord, abnormal sympathetic innervation, an abnormal expression of sodium channel proteins, and increased spinal dynorphin content (Porreca et al., 1999). Several animal models have been introduced to investigate the mechanisms underlying the development of neuropathic pain. These animal models exhibit many of the clinical signs of neuropathic pain, including hyperalgesia and allodynia, and have proved useful in increasing our

understanding of both the mechanisms contributing to the development of neuropathic pain as well as potential analgesic treatments (Bennett et al., 1993).

1.2 Animal models of neuropathic pain

Over the years several animal models of peripheral neuropathic pain have been developed, especially in rodents. These neuropathic pain models have demonstrated many characteristics of neuropathic pain symptoms in various disease states of human beings. Currently, the three most common used models are the chronic constriction injury of the sciatic nerve (CCI) (Bennett and Xie, 1988), the partial sciatic nerve ligation model

(PNL) (Seltzer et al., 1990) and the spinal nerve ligation model (SNL) (Kim and Chung,

1992) (Fig. 0.1). These different models provide an opportunity to investigate mechanisms of neuropathic pain.

The CCI model is created by placing of 4 loose ligatures around the sciatic nerve at mid-thigh level with chronic gut suture. An inflammatory reaction develops in response to the catgut and consequentially causes a loss of most A-fibers and some C- fibers, but a few cell bodies are observed (Tandrup et al., 2000). This model is associated with allodynia, hyperalgesia, and possibly spontaneous pain. Thus, it is speculated that there is a significant inflammatory component in the development of the painful neuropathy in the CCI model.

The PNL (Seltzer et al., 1990) model is produced by tight ligation of one third to one half of the sciatic nerve at mid-thigh level. The Seltzer rat model developed guarding behavior of the ipsilateral hind paw and licked it often, suggesting the possibility of

spontaneous pain. The affected paw was evenly hyperesthetic to non-noxious and noxious stimuli including thermal and mechanical hyperalgesia as well as allodynia.

The SNL model mimics peripheral nerve injury. This model is produced by tight ligation of L5 and L6 spinal nerve which form the sciatic nerve (Kim and Chung, 1992).

The SNL model rats develop spontaneous pain-like behavior as well as long-lasting thermal hyperalgesia and mechanical hypersensitivity. This model induces symptoms of neuropathy much as the CCI model does, but it is more consistent and yields a complete separation between injured and intact segments. Since the L4 spinal nerve, which also forms the sciatic nerve, is left intact in the SNL model, injured and uninjured nerves from the sciatic nerve are present. This makes the nociceptive afferent pathway from the paw and ectopic foci from the site of injury easy to identify. These unique features of the SNL model allow independent experimental manipulations of the injured and intact spinal segments in future experiments to answer questions regarding mechanisms underlying causalgia.

Generally, all three of these models produce the behavioral signs of both ongoing and evoked pain. However, comparisons between the CCI, PNL, and SNL models, behavioral signs representing ongoing pain were most obvious in the CCI model while those of mechanical allodynia were greatest in the SNL model. All of these models differ in some aspects but presumably share some common mechanisms that produce neuropathic pain behavior.

In addition to the animal models of neuropathy based on a discrete peripheral nerve injury, other animal models of neuropathic pain have been developed to more

closely mimic individual disease states. An example of this is the streptozotoin model of peripheral diabetic neuropathy (Malcangio et al., 1998). In this model, a single injection of streptozotoin induces diabetes and then produces allodynia and hyperalgesia. Other examples, such as vincristine induced neuropathy and chronic inflammatory pain models produce similar neuropathic pain symptoms following long term vincristine cancer chemotherapy as well as chronic inflammatory diseases such as arthritis (Fields et al.,

1994).

1.3 Possible mechanisms of neuropathic pain

1.3.1 Ectopic Discharge

Peripheral mechanisms of neuropathic pain include peripheral sensitization, which is characterized by a lowered threshold for activation and increased response to a given stimulus, ectopic and spontaneous discharge. Following nerve injury, a large increase in the level of spontaneous firing, also termed ectopic discharge, occurs in the afferent neurons related to the injury site (Wall et al., 1974). This ectopic discharge has also been demonstrated in patients suffering neuropathic pain. The development of ectopic activity may be particularly important for the development of hyperalgesia, allodynia, and ongoing pain associated with nerve injury. Recent studies revealed that ectopic discharge originates not only from the neuroma itself but also the DRG and various sites along the nerves ((Devor and Raber, 1983; Burchiel, 1984; Study and Kral,

1996); Further, it has been shown that the generation of ectopic discharge can be initiated by noxious or non-noxious mechanical and chemical stimuli (Seltzer and Devor, 1979;

Tal and Devor, 1992; Sheen and Chung, 1993).

Alterations in the expression of sodium channels in the cell bodies and the terminal neuroma of peripheral nerves are thought to be the cause of this ectopic activity following the nerve injury. In 1989, Devor and colleagues revealed that accumulation of sodium channels in the neuroma occurs (Devor et al., 1989) and then demonstrated that sodium channels were the cause of ectopic discharge (Matzner and Devor, 1994).

Following nerve injury, it has been demonstrated that there are changes in the distribution of TTX-resistant sodium channels (Novakovic et al., 1998; Porreca et al., 1999; Gold et al., 2003), which may responsible for lowering the action potential threshold and the consequent hyperactivity.

In addition to the alterations of voltage-gated sodium channels, calcium channels have also been shown to influence the development of hyperalgesia and allodynia in the neuropathic pain state. Administration of specific antagonists for neuronal N-type calcium channels has been shown to reduce thermal hyperalgesia and mechanical allodynia in the CCI (Xiao and Bennett, 1995) and PNL models of neuropathic pain

(White and Cousins, 1998). Electrophysiological studies have shown alteration of the calcium current after peripheral nerve injury and a decrease of more specific N-type current measured in the DRG after axotomy (Baccei and Kocsis, 2000). The changes in both sodium and calcium channels are important in neuropathic pain. Such changes may lead to an increase in firing susceptibility and frequency, resulting in not only spontaneous pain, but also central sensitization.

The onset of increased afferent discharge correlates well with the onset of tactile and thermal hypersensitivities in nerve injury animal models (Han et al., 2000; Liu et al.,

2000). Ectopically generated action potentials are most pronounced during the first week after SNL and diminish significantly over time (Han et al., 2000). Liu and colleagues found ectopic discharge peaks 1 to 3 days after nerve injury and returns to control levels by day 7 to 9 (Liu et al., 2000). On the other hand, tactile hypersensitivity and thermal hypersensitivity, two main manifestations of neuropathic pain, last for at least many weeks after SNL in spits of the decreasing rate of ectopic discharge (Chaplan et al., 1994;

Bian et al., 1999; Malan et al., 2000). Therefore, these observations suggest that mechanisms contributing to the initiation and the maintenance of neuroapthic pain are different. The enhanced ectopic discharge at the early phase after nerve injury may be critical in the initiation of neuorpathic pain, while the maintenance of neuropathic pain likely depends on other mechanisms (Sah et al., 2003).

1.3.2 Anatomical reorganization in the spinal cord

There is evidence that anatomical and neurochemical changes can occur within the central nervous system (CNS) following a peripheral nerve injury. This "CNS plasticity" may play an important role in the evolution of chronic neuropathic pain. In the non-injured state, C fibers (small unmyelinated) and A-delta fibers (intermediate myelinated) terminate primarily in lamina II. A-beta fibers (large myelinated) terminate in lamina III and deeper. However, in the pathological condition, larger myelinated A- beta fibers sprout into lamina I and II of the superficial dorsal horn (Woolf et al., 1992;

Koerber et al., 1994). This anatomical reorganization in the spinal cord establishes functional synaptic contact with second-order neurons, allowing low-threshold non- noxious stimuli from A-beta fibers to be interpreted as nociceptive. However, this

hypothesis was unsatisfactory because the optimal A-beta fiber sprouting does not occur until 2 weeks post-injury (Woolf et al., 1995; Lekan et al., 1996), which did not correlate temporally with the development and maintenance of neuropathic pain after nerve injury.

Moreover, a later study demonstrated that the immunohistological marker (cholera toxin

β sub-unit) thought to label A-beta fibers selectively may also be taken by C-fiber after nerve injury (Tong et al., 1999).

1.3.3 Sensitization in the spinal cord

An important consequence of prolonged or excessive sensory input following nerve injury is the development of a sustained state of hyperexcitability of dorsal horn neurons in the spinal cord, a process called ‘ central sensitization’. This phenomenon is characterized by the presence of ‘wind-up’ (Wall and Woolf, 1986). Wind-up is characterized by an increasing response to repetitive noxious stimulation of C-fibers and is believed to be part of the sensitization process involved in many chronic pain states, and may contribute to hyperalgesia. Recent studies demonstrated that sensitization in the spinal cord appears to be associated with increased neurotransmission via NMDA receptors at the cellular level. Increased glutamate concentration has also been found in the ipsilateral dorsal horn after CCI (Kawamata and Omote, 1996). A number of studies using MK-801, an NMDA receptor antagonist, have shown that it may have a role in attenuating features of neuropathic pain (Davar et al., 1991; Mao et al., 1992; Sotgiu and

Biella, 2000).

1.3.4 Decreased inhibition in the spinal cord

A major inhibitory neurotransmitter system in the CNS, the gamma-aminobutyric acid (GABA) pathway, also plays a role in modulating the response to peripheral nerve injury. There is a more significant decrease in extracellular GABA concentration in nerve-injured rats compared to normal rats (Stiller et al., 1996). Intrathecal administration of GABA receptor agonists could also produce a dose-dependant attenuation of allodynia in SNL rats (Hwang and Yaksh, 1997). These studies again show that decreased efficacy of GABA pathway may play a role in neuropathic pain. Sivilotti and Woolf hypothesized that central sensitization might be augmented to by a decrease in the efficacy of GABA pathways (Sivilotti and Woolf, 1994).

1.3.5 Activation of descending facilitation from the RVM

The descending pathways, which have both inhibitory and facilitatory influence on spinal pain transmission, have been shown to play an important role in neuropathic pain state. Anatomical and pharmacological evidence suggest that facilitatory and inhibitory pathways are distinct and be activated at the same time and reach a homoeostatic balance in a normal acute pain state. However, an exaggerated and sustained facilitatory output occurs in the neuropathic pain state, which may break the balance and drive the expression of abnormal pain. The rostral ventromedial medulla

(RVM) as a crucial region in descending pain modulation has been shown to play an important role for the descending facilitation in neuropathic pain. Pharmacological blockade of RVM neuronal function by lidocaine microinjection abolishes SNL-induced abnormal pain behaviors ((Pertovaarai et al., 1996; Burgess et al., 2002). In addition, selective disruption of the ipsilateral dorsolateral funiculus (DLF) ─ the main conduit of

spinopetal projection from the RVM ─ abolished tactile and thermal hypersensitivity

(Ossipov et al., 2000). Recent, research indicates that descending facilitation from the

RVM may be driven endogenously by cholecystokinin (CCK) (Kovelowski et al., 2000;

Friedrich and Gebhart, 2003). Microinjection of a CCK2 antagonist blocks SNL-induced tactile and thermal hypersensitivity (Kovelowski et al., 2000). Taken together, these observations suggest that descending facilitation from the RVM is a crucial component of the neuropathic pain state.

1.3.6 Up-regulation of spinal dynorphin

1.3.6.1 The paradox of dynorphin

Dynorphin is commonly classed as an endogenous opioid peptide and is widely distributed in the central nervous system including hippocampus, amygdala, striatum, and spinal cord (Fallon and Leslie, 1986) (Khachaturian et al., 1982; Mansour et al.; 1994;

Pierce et al., 1999; Van Bockstaele et al., 1994). The dynorphins include dynorphin A, dynorphin B, alpha- and beta-neoendorphin, and big dynorphin, which consists of dynorphin A and dynorphin B sequences. They are derived from a single gene,

'prodynorphin' (Fischli et al., 1982; Xie and Goldstein, 1987; Day and Akil, 1989).

Dynorphin A (H-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Pro-Lys-Lys-Trp-Asp-Asn-Gln-OH) is a major proteolytic peptide from prodynorphin and was first isolated from the porcine pituitary in the early 1980’s (Chavkin et al., 1982). Although dynorphin was originally proposed as a ligand of the opioid kappa receptor (Chavkin et al., 1982), its affinity for other opioid receptors is well within the physiologically relevant range (Zhang et al.,

1998) (Table 1). In general, opioid agonists tend to be inhibitory. In the classic

electrophysiological study on mouse dorsal root ganglion cells, it was demonstrated that

action of dynorphin at kappa opioid receptors inhibited voltage activated calcium

channels (Werz and Macdonald, 1985). Werz and MacDonald (1983) also demonstrated that activation of mu and delta opioid receptors inhibits calcium channels. These results indicated that action of dynorphin at opioid receptors should limit either

neurotransmission or neuroexcitability and produce an inhibitory effect. However,

numerous studies have indicated that much of the pharmacology of this peptide appears

to be independent of activation of opioid receptors. Pharmacological injection of

dynorphin into the spinal cord does not produce robust antinociceptive effect. In contrast,

dynorphin and its fragments that lack the crucial N-terminal tyrosine residue necessary

for the interaction with opioid receptors (Table 1) produce neurological dysfunctions and

hindlimb paralysis, and also a long-lasting state of allodynia in rodents (Faden and

Jacobs, 1984; Long et al., 1989; Vanderah et al., 1996; Laughlin et al., 1997). Several

actions of dynorphins have been found to be insensitive to the general opioid antagonist

naloxone and kappa selective antagonist nor-binaltorphimine 2HCl (nor-BNI) (Faden and

Jacobs, 1984; Vanderah et al., 1996; Long et al., 1989). These observations strongly

suggest that these neurotoxic and excitatory effects of dynorphin are through non-opioid

mechanisms. Recently, considerable evidence has shown that non-opioid effects of

dynorphin A are apparently relevant for several pathophysiological process including

chronic neuropathic pain and spinal cord injury (Trujillo and Akil, 1991; Vanderah et al.,

1996; Wang et al. 2001; Xu et al., 2004; Tan-No et al., 2005).

1.3.6.2 Non-opioid actions of dynorphin may maintain the persistent pain in neuropathic pain

The upregulation of spinal dynorphin to pathological levels is a prominent consequence of injury (Dubner and Ruda, 1992). In rodents, pharmacological dynorphin is pronociceptive and blockade of activity of injury-induced endogenous dynorphin reverses persistent pain (Wagner et al., 1993; Wang et al, 2001; Lai et al., 2001).

Experimental nerve injury elicits signs of tactile and thermal hypersensitivity suggestive of features of human neuropathic pain (Xie and Bennett, 1988; Kim and Chung, 1992;

Ossipov et al., 2005). Peripheral nerve injury in rodents results in a time-related increase in spinal dynorphin content, peaking at approximately day 10 post-injury (Fig. 0.2)

(Kajander et al, 1990; Malan et al., 2000). Additionally, prodynorphin knock-out mice develop, but do not sustain, nerve injury induced pain (Wang et al., 2001) suggesting that nerve injury-induced pathological levels of spinal dynorphin are critical in maintaining, but not initiating, neuropathic pain (Burgess et al., 2002). The pronociceptive mechanisms of dynorphin are unknown, but do not involve opioid receptors (Vanderah et al., 1996; Tang et al., 2000; Wang et al., 2001). A direct or indirect effect of dynorphin on the NMDA receptor complex has been suggested since NMDA antagonists abolish the excitatory effects of high doses of dynorphin (Bakshi and Faden, 1990; Bakshi et al.,

1992; Skilling et al., 1992; Shukla and Lemaire, 1994) as well as the hyperalgesia elicited by non-opioid fragments of dynorphin (Vanderah et al., 1996; Laughlin et al., 1997).

However, a binding site for dynorphin at the NMDA receptor complex has not been established. Dynorphin increases calcium influx in cultured cortical cells through a site

independent of opioid receptors or the NMDA receptor complex, also indicating the

existence of an alternate excitatory mechanism (Tang et al., 2000).

1.3.6.3 Bradykinin receptors mediated excitatory effects of dynorphin in vitro

The bradykinin B2 receptor is constitutively expressed on dorsal root ganglion

(DRG) cells and on terminals of primary afferent fibers (Steranka et al., 1988), as are low levels of the B1 receptor (Wotherspoon and Winter, 2000; Ma and Heavens, 2001).

Injury increases expression of both B1 and B2 receptors in DRG cells and in central terminals of afferent fibers (Levy and Zochodne, 2000; Couture et al., 2001). Activation of bradykinin receptors in the spinal cord has been suggested to facilitate nociceptive inputs and to promote central sensitization (Pesquero et al., 2000; Wang et al., 2005).

Additionally, systemic B1 or B2 receptor antagonists reverse hyperalgesia in animals with inflammation or nerve injury (Levy and Zochodne, 2000; Yamaguchi-Sase et al.,

2003; Ferreira et al., 2005; Porreca et al., 2006) but the mechanism by which this effect may occur is unknown. A systematic evaluation of mechanisms of dynorphin-induced calcium influx into F11 cells revealed a direct interaction of dynorphin and its non-opioid fragments with bradykinin receptors. The novel site, bradykinin receptors, that mediates the effect of dynorphin on intracellular calcium concentration is a potential mechanism for excitatory actions of dynorphin in vivo.

1.3.6.4 Dynorphin A raises intracellular calcium by activating voltage sensitive calcium channels

A des-tyrosyl fragment of dynorphin A, dynorphin A (2-13), which has very low affinity for all three opioid receptor types (Table 1) was used to selectively evaluate the

non-opioid receptor mediated effects of dynorphin A. Ratiometric Fura-2 fluorescence

imaging of intracellular calcium concentration ([Ca2+]i) showed that dynorphin A (2-13) consistently induced a transient increase in [Ca2+]i in a dose-dependent manner in primary cultures of embryonic DRG (Fig . 0.3a) and in F-11 cells (Fig. 0.3b) derived from

the fusion of embryonic rat dorsal root ganglion (DRG) cells (both neuronal and non-

neuronal) and mouse neuroblastoma. The response to dynorphin A was observed only in

cells that responded to a depolarizing concentration of KCl. Dynorphin A(2-13) induced

increase in [Ca2+]i was not blocked by the opioid receptor antagonist, naloxone.

The effect of dynorphin A (2-13) was abolished by eliminating extracellular Ca2+

(Fig. 0.3d). Blockade of calcium influx by CdCl 2 and NiCl 2 had similar effect. The

increase in [Ca2+]i was not due to the activation of the phospholipase C (PLC β) pathway

to promote calcium release from intracellular stores because unlike bradykinin,

dynorphin A(2-13) did not stimulate the production of inositol phosphates in F-11 cells

( Fig. 0.3e ). Taken together, these data indicate that dynorphin A (2-13) induces a

transient increase in [Ca2+]i by calcium influx independent of opioid receptors.

The dynorphin-induced transient calcium influx was sensitive to voltage sensitive

calcium channel (VSCC) inhibitors. The L-type channel blocker, nimodipine, and the

P/Q-type channel blocker, ω-agatoxin TK, were highly effective in blocking the increase in [Ca2+]i by dynorphin A(2-13) (Fig 0.4). In contrast, the N-type channel blocker, ω-

conotoxin GVIA, the T-type channel blockers, flunarizine and ethosuximide, and the

NMDA receptor antagonist, MK-801, had no effect on dynorphin A induced increase in

[Ca2+]i.

A series of agonists and antagonists for receptors found in the DRG were tested for possible inhibition of dynorphin A (2-13)-induced calcium influx. Of these, only the bradykinin B2 receptor selective antagonist, HOE140, completely abolished the dynorphin-induced [Ca2+]i with an IC50 of 2.8 nM (Fig. 0. 5a), which is consistent with the affinity of HOE140 for the B2 receptor30. In addition, H89, a protein kinase A inhibitor, completely blocked the effect of dynorphin A (2-13). Thus, dynorphin A (2-13) may activate the B2 receptors which activate the L-type and P/Q type VSCC by a PKA dependent pathway. Previous observations established that bradykinin receptors couple predominantly to PLC β via Gq/11 to activate protein kinase C and increase [Ca2+]i by the mobilization of intracellular stores (Wetzel et al; 2001; Liebmann et al; 1996).

Bradykinin induced increase of intracellular calcium is known through the PLC β / PKC pathway (Burgess et al; 1989; Vasko et al; 1994 ;). Therefore, these data demonstrate that bradykinin receptors are sufficient to mediate the dynorphin A-induced calcium influx, which is clearly different from the intracellular calcium mobilizing effect of bradykinin.

1.3.6.5 Dynorphin A (2-13) interacts directly with bradykinin receptors

Saturation binding using [3H]bradykinin on membranes from transfected F-11 cells expressing the hB2 receptor produced a KD value of 2.0 ± 0.35 nM (n = 3) and a

Bmax value of 1030 ± 260 fmol/mg. As bradykinin has a significantly lower affinity for the B1 receptors (Falcone et al; 1993), [3H] kallidin, which binds with high affinity to both the B1 and B2 receptor, was used to characterize the hB1 receptor in the transfected

F-11 cells. The KD value of [3H]kallidin at the hB1 receptor was 2.2 ± 1.27 nM (n=3) and the Bmax value was 385 ± 14.4 fmol/mg. Table 2 shows that dynorphin A(2-13)

competed for [3H]bradykinin binding with apparent moderate affinity ranging from 1.4

µM to 2.0 µM at the rodent B2 receptors in F-11 and brain membranes from both wild

type and B1 knock-out mice and primate B2 (in COS-7 and hB2 transfected cells). At

the transfected hB1 receptor, dynorphin A (2-13) had an apparent affinity of 1.5 µM based on competition with [3H]kallidin. Thus, dynorphin A (2-13) shows similar affinity for both bradykinin receptor types. The opioids dynorphin A (1-17) and dynorphin A(2-

13) had similar affinities for the [3H]bradykinin binding site.

Dynorphin A’s actions as an endogenous opioid and as a bradykinin receptor agonist represent the first identification of a neuropeptide with intrinsic activity at two classes of G protein coupled receptors. This dual agonist activity of dynorphin A could not be predicted by its structure, which does not share any homology with bradykinin. In this regard, the evidence that bradykinin and dynorphin A may occupy distinct binding sites on the bradykinin receptor is consistent with their structural differences. The ability of dynorphin A to stimulate bradykinin receptors is not predicted by any similarity in the structure or function between the two receptor classes. The different structure-activity relationship of dynorphin A at the opioid receptors (where an N-terminal tyrosine is necessary) and bradykinin receptors (where an N-terminal tyrosine is unnecessary) is entirely consistent with the peptide’s interaction with two structurally and pharmacologically distinct receptors. As the binding of dynorphin A to bradykinin receptors does not require the N-terminal tyrosine or an intact C-terminal dynorphin A (1-

17) and dynorphin A(2-13), it implies that dynorphin A’s action at the bradykinin receptors can persist even upon proteolytic degradation of synaptic/extrasynaptic

dynorphin A. The apparent affinity and potency of dynorphin A for the bradykinin

receptors are moderate, suggesting that activation of the bradykinin receptors by

endogenous dynorphin A requires close apposition of dynorphin A containing terminals with dendritic or cell surface bradykinin receptors and sufficient release of dynorphin A.

The dorsal horn of the spinal cord represents one such anatomical site; bradykinin receptors are largely associated with the central terminals of the primary afferents in the superficial laminae, where prodynorphin interneurons are also located (Wang et al; 2001).

We have shown previously that dynorphin A(2-13) enhances capsaicin evoked CGRP release from the central terminals of the primary afferent in dorsal horn spinal cord tissue

(Gardell et al; 2002). The activation of the P/Q type VSCC by dynorphin A via the B 2

receptor shown in the present study is consistent with the potentiating effect of dynorphin

A on CGRP release from the central terminals of the primary afferent, and represents a

possible mechanism of hyperalgesia induced by spinal dynorphin A.

1.4 Summary of research goals

As described above, dynorphin was originally identified as an endogenous opioid

peptide and may produce inhibitory effects at opioid receptors. Dynorphin, however, can

elicit excitatory effects in vivo that are not mediated through opioid receptors. Although

some studies indicate that the excitatory effects of dynorphin may result from action at

NMDA receptors, dynorphin increases calcium influx in F11 cells through a site

independent of opioid receptors or the NMDA receptor complex, also indicating the

existence of an alternate excitatory mechanism (Tang et al., 2000). In addition, a binding

site for dynorphin at the NMDA receptor complex has not been established. A systematic

evaluation of mechanisms of dynorphin-induced calcium influx into F11 cells revealed a direct interaction of dynorphin, and its non-opioid fragments, with bradykinin receptors.

This was confirmed by demonstration of direct dynorphin binding to both bradykinin B1 and B2 receptors in mouse brain. Therefore, the focus of this dissertation will be to explore the possible interaction of dynorphin with bradykinin receptors as a basis of the pronociceptive actions of this peptide, or its fragments, in vivo.

Table 1. Ki values for dynorphin fragments with respect to human opioid receptors (Lai

et al., 2001)

Ki(nM)

a Dynorphin Fragment hKOR hDOR hMOR

b Dynorphin A (1-17) (Y-G-G-F-L-R-R-I-R-P-K-L-K-W-D-N- 5.3 182 6.9 Q) Dynorphin A (1-13) (Y-G-G-F-L-R-R-I-R-P-K-L-K) 6.4 141 16.4

Dynorphin A (2-17) (G-G-F-L-R-R-I-R-P-K-L-K-W-D-N-Q) >10,000 >10,000 >10,000

Dynorphin A (2-13) (G-G-F-L-R-R-I-R-P-K-L-K) >10,000 >10,000 >10,000

a KOR = κ opioid receptor; DOR = δ opioid receptor; MOR = opioid receptor. b Values represent the mean from independent experiments. The values for KOR were determined with 1.8 nM [ 3H] U69, 593 ( Kd =1.4 nM); those for DOR were determined with 1.5 nM [ 3H] pCl-DPDPE ( Kd =1.3 nM); and those for MOR were determined with 0.45 nM [ 3H] DAMGO ( Kd =0.37 nM).

Table 2. Competitive radioligand binding analysis of dynorphin A(2-13) and dynorphin A(1-17) against [ 3H]bradykinin or [ 3H]kallidin in a number of cell lines and mouse brain tissues. Dynorphin A (2-13) Radioligand Tissue Log IC50 ± s.e.m. g Ki (nM) h n [3H]bradykinin a F-11 c -5.58 ± 0.08 2,000 4 B2_F11 d -5.58 ± 0.08 2,000 2 COS-7c -5.63 ± 0.18 1,800 8 Mouse Brain (WT) e -5.56 ± 0.14 2,100 3 Mouse Brain (Bdkrb1 -/-)f -5.73 ± 0.16 1,400 2

[3H]Kallidin b B1_F11 d -5.56 ± 0.07 2,100 3

Dynorphin A (1-17) Radioligand Tissue Log IC50 ± s.e.m. g Ki (nM) h n [3H]bradykinin a F-11 c -5.75 ± 0.17 1,400 3

a 3 The K D value of [ H]bradykinin based on saturation analysis using membranes from b transfected F-11 cells expressing the human B2 receptor is 2.0 " 0.35 nM (n=3). The K D value of [ 3H]kallidin based on saturation analysis using membranes from transfected F-11 cells expressing the human B1 receptor is 2.2 " 1.27 nM (n=3). cThe rodent F-11 cells and the simian COS-7 cells express endogenous B2 receptors. dF-11 cells were stably transfected (tr.) with cDNA for either the human B1(hB1) receptor or the human B2 (hB2) receptor. eMouse whole brain membranes were prepared from wild type littermates of the transgenic mice that carried a null mutation of the B1 receptor. fMouse whole brain membranes were prepared from transgenic mice that were homozygotes at the null g mutation of the B1 receptor. The Log IC 50 " standard error (S.E.) of dynorphin A(2-13) and dynorphin A(1-17) was determined by non-linear regression analysis of data h collected from multiple independent experiments (n). The K i value was calculated from the anti-logarithmic value of the IC 50 by the Cheng and Prusoff equation based on the K D value of the respective radioligand and concentration range between 600 – 650 pM. N.D., not determined.

Figure 0.1 Schematic diagram of the different nerve injury models for neuropathic pain. In the spinal nerve ligation (SNL) model, light ligation and transection of the L5 and L6 spinal nerves are made; in the chronic constriction injury (CCI) of sciatic nerve model, several loose ligations of the sciatic nerve are made; in the partial aciatic nerve ligation (PNL) model, about ½ to 1/3 of the sciatic nerve is lightly ligated.

2 Sham-operated * 1.5 L5/L 6 ligated * 1 * * *

0.5 Dynorphin protein) (pmol/mg

0 1 2 5 10 20 35 (Malan et al., 2000) Days after L 5/L 6 spinal nerve ligation

Figure 0.2 L5 and L6 spinal nerves ligation induced spinal dynorphin upregulation. Rats were prepared with ligations of the L5 and L6 spinal nerves. At the time points indicated, the spinal cords were removed and the lumbar cord was divided into quadrants. The spinal dynorphin content of the dorsal ipsilateral quadrant was quantified. Ligation of the L5 and L6 spinal nerves produced a significant increase in dynorphin content in the lumbar segment of the spinal cord which reached a maximum by day 10. (*P < 0.05); Student's t-test.

Figure 0.3 Dynorphin A (2-13) induces calcium influx in DRG and F-11 cells. A representative recording of the change in 340 nm / 380 nm Fura-2 fluorescence over time from embryonic DRG ( a) and F-11 ( b) cells in response to dynorphin A(2-13) and KCl given at 60 s intervals; ( c) A representative recording of the change in 340nm / 380 nm Fura-2 fluorescence over time from a cell in the absence of calcium in the bath solution; (d) Cumulative score of dynorphin A(2-13)-responsive cells as a percentage of total 2+ 2+ number of cells recorded. n = 663 ([Ca ]o), 198 ([Ca ]o free), and 170 (CdCl 2/NiCl 2); (e) Dynorphin A(2-13) does not significantly stimulate PI hydrolysis in F-11 cells up to 10 :M. Data are expressed as the mean ± S.E.M. from 3 independent experiments. There is no significant difference in the effect of dynorphin in the presence or absence of naloxone ( P = 0.41 at 0.1 M, P = 0.79 at 1 M, P = 0.87 at 3 M, P = 0.54 at 10 M, respectively). Bradykinin is used as positive control.

ωωω-Agatoxin TK (P/Q blocker) 100 Nimodipine (L-type)

) 3 ωωω -Conotoxin GVIA (N-type)

1 80

(

e n i

s r

D 40

e f

m 20 5

0 -10 -9 -8 -7 -6 -5

Log [Inhibitor, M]

2+ Figure 0.4 Inhibitory effect of VSCC blockers on dynorphin A (2-13)-induced [Ca ]i in F-11 cells. Data are expressed as the percent of F-11 cells that recorded to 5 µM dynorphin A (2-13) alone.

Figure 0.5 Inhibitory effect of B2 receptor selective antagonist HOE140 on Dynorphin 2+ A(2-13)-induced [Ca ]i in F-11 cells. (a) Data are expressed as the % of F-11 cells that responded to 5 :M dynorphin A(2-13) alone. The total number of cells recorded per data point was > 110. Data are fitted by non-linear least squares analysis (GraphPad Prism). 2+ The B2 receptor selective antagonist HOE140 inhibits dynorphin A(2-13)-induced [Ca ]i with an IC 50 of 2.8 nM (Log IC 50 " S.E.M. = -8.56 " 0.52). ( b) Multiplex RT-PCR of F- 11 cells confirming expression of endogenous B2 receptor. GAPDH was co-amplified as an internal loading control. B1 receptor mRNA is rarely expressed (left panel), while B2 receptor mRNA is readily detected (right lane). B1: 334 bp. B2: 346 bp. GAPDH: 638 bp. M: 100 bp DNA ladder markers (Invitrogen).

CHAPTER TWO

MATERIALS AND METHODS

2.1 Animals

Male, Sprague-Dawley rats (Harlan, Indianapolis, IN) weighing 225-300 g and

tm1jfh male bradykinin B2 receptor knockout (B 2-/-) mice (B6; 129S7-Bdkrb2 /J) and the

corresponding wild-type (WT) control mice (B6; 129SF2/J) (Jackson Laboratory, Bar

Harbor, ME, USA) were used. Animals were maintained in cages in a climate-controlled

room on a 12-hour light/dark cycle (lights on at 6:00AM) and food and water were

available ad libitum . All testing procedures were performed in accordance with the

policies and recommendations of the International Association for the Study of Pain and

the National Institutes of Health guidelines for the handing and the use of the laboratory

animals and were approved by the Institutional Animal Care and Use Committee

(IACUC) of the University of Arizona.

2.2 Drugs and doses

All experiments used bradykinin B1 antagonist [Des-Arg 9-Leu 8]bradykinin

(DALBK; Bachem Inc, Torrance, CA,) and the bradykinin B2 antagonist HOE 140

(American Peptide Company, Inc, Sunnyvale, CA). The i. th, doses of DALBK were 50,

100 nmole/5 l. The i.th. doses of HOE 140 were 0.5, 3, 10 and 30 pmole /5 l.

Intrathecal administration of drugs were made through a catheter in a volume of 5 l followed by a 9 l saline flush. Systemic HOE 140 and DALBK pump infusion were

given at dose of 150nmole/day and 1500nmole/day respectively. Intrathecal HOE 140

and DALBK pump infusions were given at a dose of 100pmole/day and 100nmole/day

respectively. Osmotic pumps were purchased from Alzet (Model 2001) and implanted s.c. into the rats. The i. paw doses of HOE 140 were 1, 10,100 nmol/paw.

Dynorphin A(2-13) (AnaSpec Inc, San Jose, CA) (3 nmole) was injected into rats through a i. th. catheter in a volume of 5 l followed by a 9 l saline flush. Intrathecal injections to conscious mice were made into the subarachnoid space (L5 to L7) in the animals as previously described (Yaksh et al., 1976). Dynorphin A (2-13) was given at a single dose of 3 nmol in 5 l of saline.

2.3 Surgical preparations

2.3.1 Subcutaneous osmotic pump implantation

Animals were anesthetized with 0.5% halothane in 95% O 2/5% CO 2 and a small area was shaved and prepared for incision using 7.5% USB iodine followed by 75% ethanol (Fisher Scientific, Pittsburgh, PA). An incision approximately 1 cm length was made through the skin and the osmotic pump (Alzet) containing either bradykinin receptor antagonists or vehicle was inserted s.c. in the flank of the animal. For the i. th. infusion, the pump was connected to the intrathecal catheter through a polyethylene PE-

50 tubing and then sealed using super glue. The incision was then closed using autoclip wound clips (VWR; Tempe, AZ).

2.3.2 Spinal nerve ligation (SNL) and sham surgery

L5/6 spinal nerve ligation was performed according to the procedure of Kim and

Chung (Kim and Chung, 1992). Briefly, animals were anesthetized with 0.5% halothane in 95% O 2/5% CO 2. After shaving the hair on the back, each animal was placed on a surgical platform in a prone position. After surgical preparation of the rats, a 2 cm

paraspinal incision was made at the level of L4-S2. The unilateral L5 and L6 spinal nerves were exposed and tightly ligated distal to the dorsal root ganglia using 4-0 silk suture. The incisions were closed and animals were allowed to recover for at least 6 days prior to use. Sham-operated control rats were prepared in an identical manner without

L5/L6 nerve ligation. Rats that exhibit motor deficiency (such as paw dragging or dropping) or failure to exhibited subsequent tactile allodynia were excluded from the future testing. Less than 5% of the animals were excluded.

2.3.3 Intrathecal catheterization

Rats were anesthetized with ketamine (80 mg/kg) and xylazine (12 mg/kg) and implanted with intrathecal catheters (polyethylene-10 tubing; 7.5cm) directed to the level of the lumbar spinal cord as described previously (Yaksh et al., 1976). Briefly, rats were mounted in a sterotaxic instrument. An incision beginning at a line joining the ears and extending about 2 cm in a caudal direction was made in the midline and the fascia was refracted from the skull. The initial incision of skin exposed a superficial layer of neck muscles which were then separated by a midline ally about 2 cm. Next, a scraping tool was used to free the muscles from their point of origin on the occipital bone for about 0.5 cm on either side of the midline. At this point, the atlanto-occipital membrane can be seen. A small slit (1-2mm long) beginning at the base of skull was made along the midline of the membrane. If the incision has been performed correctly, clear cerebrospinal fluid should immediately well up through the slit. The stretched end of the catheter can be inserted in the subarachnoid space and the free end of the catheter is threaded through the occipital opening and out the top of the skull via the interparietal

opening. Finally, the muscle and skin incision was closed and the exposed portion of the

catheter was cut to the desired length.

2.4 Behavioral testing

2.4.1 Von Frey test for tactile hypersensitivity

Animals were placed in a suspended plastic chamber with a wire mesh platform

and allowed to habituate for 30 min. Tactile hypersensitivity was determined by

measuring paw withdrawal threshold in response to probing the plantar surface of the

ligated hind paw with a series of eight calibrated von Frey filaments (0.40, 0.70, 1.2, 2.0,

3.63, 5.5, 8.5, and 15 g) (Stoelting, Wood Dale, IL). Measurements were taken before surgery, then before and after administration of drug or vehicle. Withdrawal threshold was determined by sequentially increasing and decreasing stimulus intensity ("up and down" method), analyzed using a Dixon non-parametric test (Chaplan et al., 1994) and expressed as the paw withdrawal threshold in gram force values. The paw withdrawal thresholds of mice were determined in the same manner but by using von Frey filaments over a range of 0.02 to 2.34 g.

2.4.2 Radiant heat and hot plate test for thermal hypersensitivity

Nociceptive responses to noxious heat were evaluated against noxious radiant heat and on the 52 oC hot-plate. Animals were placed in clear plastic chambers on a glass surface and were habituated for 30 min prior to testing. Thermal sensitivity was measured using paw withdrawal latency to a radiant heat stimulus according to the procedure as previously described (Hargreaves et al., 1998). A radiant heat source (infrared) was activated with a timer and focused onto the plantar surface of the left hind paw of a rat

and the latency to paw withdrawal was measured. A motion detector that halted both

lamp and timer when the paw was withdrawn determined paw withdrawal latency. A

maximum cut-off of 33 sec was employed to prevent tissue damage. The hot-plate test

was performed by placing the animal in a glass cylinder on a temperature-controlled

heated plate maintained at 52 oC and determining the latency to hindpaw licking or

jumping. A cutoff time was set at 40 sec for 52 oC hot plate to prevent injury. The latencies were measured before surgery, before and after drug or vehicle administration.

2.5 Quantitative RT-PCR

Total RNA was isolated from the ipsilateral lumbar dorsal spinal cord, and the ipsilateral L 5 dorsal root ganglia using Aurumä total RNA mini kit (Bio-Rad, Hercules,

CA). Quantitative RT-PCR was performed using the iCycler iQ Multicolor Real-Time

PCR Detection System with iScript cDNA Synthesis Kit and iQ SYBR Green Supermix

(Bio-Rad, Hercules, CA). Samples were run in triplicate using an annealing temperature of 60 oC. Primers for the amplification were:

B1-R/forward primer: 5’- GCATCTTCCTGGTGGTGG -3’(nuc. 401~418);

B1-R/reverse primer: 5’- CAGAGCGTAGAAGGAATGTG -3’(nuc. 543~562);

B2-R/forward primer: 5’- CTTTGTCCTCAGCGTGTTC -3’(nuc. 242~260);

B2-R/reverse primer: 5’- CAGCACCTCTCCGAACAG -3’(nuc. 385~402);

Kininogen/forward primer: 5’- CATGAGACCTTGGGAGAAC -3’(nuc. 1068~1086);

Kininogen/reverse primer: 5’- GCACCCTGGCAATGTAGG -3’(nuc. 1214~1231);

Prodynorphin/forward primer: 5’- GCAAATACCCCAAGAGGAG -3’(nuc. 512~530);

Prodynorphin/reverse primer: 5’- CGCAGAAAACCACCATAGC -3’(nuc. 659~677).

Primers for GAPDH were:

forward primer: 5’-ATCATCCCTGCATCCACTG-3’ (nuc. 610~628);

reverse primer: 5’-GCCTGCTTCACCACCTTC -3’ (nuc. 771-788).

The primers were synthesized by the Midland Certified Reagent Company. PCR

efficiency for these gene targets was between 97% and 100%. Expression of these target

genes was normalized to expression of glyceraldehyde-3-phosphate dehydrogenase

(GAPDH). The differences of target mRNA expression between treatments were

analyzed using the Comparative C T Method (ABI Prism 7700 Sequence Detection

System User Bulletin #2, p11-15, 2001). The threshold cycle (C T) is defined as the cycle at which the amount of amplified PCR product from the target cDNA reaches a fixed threshold. In each treatment, DC T = C T for the target – C T for the endogenous reference,

-DDCT GAPDH. DDC T = DC T,treatment - DC T,control . The equation, 2 , denotes the ratio of the

level of target transcripts in the treated group and that of the control group. The

expression level of each target gene is converted to the copy number of the target relative

to 500,000 copies of GAPDH where the amount has been generated after 30 cycles of

PCR amplification. Unpaired t-test was used for group comparisons.

2.6 Data analysis

The results are presented as the means and SEM. Student’s t test, one-way

ANOVA, two-factor ANOVA for independent variables followed by Fisher’s Least

Significant Difference post hoc test were used where appropriate. In all statistical

comparisons, p < 0.05 was used as the criterion for statistical significance.

CHAPTER THREE

RESULTS

3.1 Intrathecal administration of bradykinin to rats.

Bradykinin (0.15, 2 and 10 g) or saline was injected intrathecally (i.th.) to male,

Sprague Dawley rats. The i.th. bradykinin injections elicited immediate but highly transient (< 30 sec) bouts of hyperactivity and escape behaviors but normal behavior returned within 1 min. I.th. bradykinin did not alter behavioral responses to tactile stimuli or to noxious thermal stimuli (Fig. 1.1). Paw withdrawal thresholds to probing with von

Frey filaments ranged from a high of 15 ± 0 g to a low of 13.0 ± 1.3 g over the entire testing period (Fig. 1.1A). There were no significant differences in responses among the treatment groups. The paw withdrawal latencies in response to noxious radiant heat ranged between 19.8 ± 0.8 sec and 24.9 ± 0.6 sec over the testing period and there were no significant differences in responses among the 3 dosing groups (Fig. 1.1B). Likewise, hot-plate latencies did not differ across time for all treatment groups receiving i.th.

Bradykinin (Fig. 1.1C). I.th. injection with saline had no significant behavioral effects at any time point (data not shown).

3.2 Intrathecal administration of dynorphin A (2-13) to rats.

The i.th. administration of dynorphin A(2-13) (3 nmol) produced a time- dependent, reversible hypersensitivity to tactile and thermal stimuli (Fig. 1.2A, B). The paw withdrawal threshold to probing the hindpaw with von Frey filaments was

-8 significantly (F (10,119) = 7.08; p = 1.17 x 10 ) decreased from the 15 ± 0 baseline response

value to 7.9 ± 1.4 g within 30 min of administration, indicating tactile hypersensitivity,

and did not fully return to baseline values until the 3rd day after injection (Fig. 1.2A).

These observations are consistent with previous studies showing reversible tactile hyperesthesia induced by 1 and 2 nmoles of dynorphin A (1-13) (Kawaraguchi et al.,

2004). Paw withdrawal latencies were significantly (F (10,119) = 3.23; p = 0.010) decreased from a pre-dynorphin injection value of 22.3 ± 0.8 sec to 16.3 ± 1.9 sec within 30 min of injection, indicating thermal hyperalgesia (Fig. 1.2B). The mean paw withdrawal latency

120 min after injection was 19.4 ± 0.6 sec, which was not significantly different from the pre-treatment baseline value (Fig. 1.2B). The i.th. injection of the vehicle did not produce any changes in response to tactile or thermal stimuli (Fig. 1.2A, B).

3.3 Dynorphin-induced tactile and thermal hypersensitivities with bradykinin B2 receptor antagonist.

The i.th. administration of dynorphin A(2-13) resulted in a decrease in the paw withdrawal thresholds to non-noxious tactile stimuli, as well as to noxious thermal stimuli (Fig. 1.3). Within 30 min after dynorphin A(2-13) (3 nmol) injection, the pooled baseline paw-withdrawal thresholds were significantly (p = 6.75 x 10 -22 ) diminished from

15 ± 0.0 to 4.8 ± 0.3 g, indicating the presence of tactile hyperesthesia (Fig. 1.3A). In a second group of rats, the paw withdrawal latency to noxious radiant heat was significantly (p = 5.08 x 10 -11 ) decreased from a pre-dynorphin value of 21.7 ± 0.5 sec to

13.4 ± 0.6 sec, indicating the presence of thermal hypersensitivity (Fig. 1.3B). Separate groups of rats received dynorphin A(2-13) followed by one of several i.th. doses of HOE

140 (0.5-30 pmol) and the paw withdrawal thresholds to mechanical and paw withdrawal latencies to thermal stimuli were measured at 30 min after the single antagonist injection.

I.th. HOE 140 produced a significant dose-dependent reversal of tactile hyperesthesia

(F (4,45) = 4.783; p = 0.0029) (Fig. 1.3A) and of thermal hyperalgesia (F (4,45) = 2.93; p =

0.031) induced by dynorphin A(2-13) (Fig. 1.3B). At the highest dose tested (30 pmol), paw withdrawal thresholds increased to 9.9 ± 1.7 g (Fig. 1.3A) and paw withdrawal latencies to noxious radiant heat were increased to 18.4 ± 2.3 sec (Fig.1.3B).

3.4 Dynorphin-induced tactile and thermal hypersensitivities with bradykinin B1 antagonist.

The i.th. administration of dynorphin A(2-13) resulted in a decrease in the paw withdrawal thresholds to non-noxious tactile stimuli, as well as to noxious thermal stimuli (Fig. 1.4A). In contrast, the B1 antagonist DALBK did not significantly reverse tactile endpoints indicative of dynorphin-induced enhanced pain over the dose-range tested (F (2,19) = 2.72; p = 0.091) (Fig. 1.4A). Although the B1 antagonist DALBK reversed thermal hyperalgesia significantly at both doses (F (2,21) = 2.72; p = 0.021) , the effect for 50 nmol or 100 nmol of DALBK were not significantly different from each other (Fig. 1.4A,B).

3.5 Intrathecal dynorphin A(2-13) administered to bradykinin B2 receptor knock- out mice .

The contribution of the bradykinin B2 receptor subtype to dynorphin-induced

hypersensitivity was further investigated by using genetically altered B2 receptor knock-

out (KO) mice. The spinal injection of 3 nmol of dynorphin A(2-13) to the wild-type

mice produced a significant (p = 0.025) reduction in paw withdrawal thresholds from a

mean baseline value of 1.8 ± 0.2 g to 0.9 ± 0.3 g within 1 hr of injection (Fig. 1.5A). Paw

withdrawal latencies to noxious radiant heat were significantly (p = 0.016) reduced to 7.4

± 0.6 sec from a mean baseline value of 12.0 ± 0.8 sec (Fig. 1.5B). In contrast, spinal dynorphin injection did not produce significant (p = 0.28) decreases in the response thresholds of B2 KO mice to either von Frey filament or radiant heat stimulation (Fig.

1.5).

3.6 Intrathecal injection of bradykinin B2 receptor antagonist in rats with nerve injury .

To investigate the contribution of spinal bradykinin receptors to the expression of behavioral signs of neuropathic pain, receptor selective bradykinin antagonists were injected i.th. after SNL. Behavioral signs of neuropathic pain, manifested by tactile and thermal hypersensitivity, were well-established within two days after L5/L6 spinal nerve ligation and still present at the same level throughout the weeks following SNL (data not shown). The mean paw withdrawal threshold to probing with von Frey filaments in rats

-35 with SNL significantly (F (1,39) = 1959; p = 5.91 x 10 ) decreased from a pre-SNL baseline of 15 ± 0.0 g to 3.6 ± 0.4 g. The mean paw withdrawal latencies to noxious

-15 radiant heat was significantly (F (1,34) = 181; p = 3.53 x 10 ) decreased from a pre-SNL baseline of 20.3 ± 0.5 sec to 13.1 ± 0.4 sec (Fig. 1.6). The spinal administration of 0.5 pmol of the B2 antagonist HOE 140 2, 4, 7, 10 and 14 days after SNL produced a time- dependent, but incomplete, reversal of tactile hyperesthesia and a complete reversal of thermal hyperalgesia over a period of 14 days (Fig 1.6A,B). Response thresholds to

-8 tactile stimulation after HOE 140 injection significantly (F (5,61) =12.53; p = 2.23 x 10 ) and gradually increased after within 7 days and reached a maximum of 10.1 ± 1.3 g 14

days after SNL, whereas the withdrawal thresholds 2 and 4 days after SNL were not significantly affected (Fig. 1.6A). Similarly, the i.th. injection of HOE 140 caused a

-8 significant (F (5,30) = 17.1; p = 5.48 x 10 ) increase in paw withdrawal latencies to 18.05 ±

0.37 sec within 7 days and to 18.8 ± 0.4 sec 10 days after SNL. Paw withdrawal latencies

2 and 4 days after SNL were not significantly different from the pre-injection values after

SNL (Fig. 1.6B). Administration of HOE 140 did not alter behavioral responses to tactile and thermal stimuli of sham operated rats (data not shown).

3.7 Intrathecal injection of bradykinin B1 receptor antagonist in rats with nerve injury.

Similar studies were performed with the bradykinin B1 antagonist DALBK. Rats with SNL received i.th. injections of 50 nmol of DALBK 2 and 14 days after SNL whereupon behavioral responses to tactile and thermal stimuli were determined (Fig.

1.7A,B). The B1 receptor antagonist produced a slight reversal of tactile hyperesthesia 14 days after SNL. The mean paw withdrawal threshold to probing with von Frey filaments was significantly (F (2,24) = 3.51; p = 0.046) increased from the post-SNL baseline 3.2 ±

0.2 g to 6.2 ± 1.5 g (Fig. 1.7A). In contrast, DALBK administration abolished thermal hyperalgesia when given 14 days after SNL (Fig. 1.7B), as indicated by the significant

(F (2,21) = 12.53; p = 0.031) increase in paw withdrawal latency from a post-SNL baseline value of 13.5 ± 0.5 sec to 20.2 ± 3.2 sec. Neither tactile or thermal hypersensitivity were altered by DALBK when given 2 days after SNL (Fig. 1.7).

3.8 Intrathecal co-administration of bradykinin B1 and B2 receptor antagonists in rats with nerve injury .

To determine if the concurrent administration of bradykinin B1 and B2 receptor antagonists might produce superior reversal of SNL-induced hypersensitivity, HOE 140

(0.5 pmol) and DALBK (50 nmol) were injected i.th. in the same solution. Co- administration of the B1 and B2 receptor antagonist had no effect on SNL-induced tactile or thermal hypersensitivity at day 2 (Fig. 1.8). In contrast, the mixture produced a significant reversal of both tactile and thermal hypersensitivity when evaluated at day 14 after SNL injury (Fig. 1.8). However, the effects of co-administration of the B1 and B2 receptor antagonist did not produce an effect against tactile hypersensitivity which was significantly different from that seen with the B2 receptor antagonist alone (P = 0.21,

N.S.) suggesting a minimal contribution of the B1 receptor to the tactile endpoint.

Administration of either the B1 or B2 receptor antagonist produced full reversal of SNL-induced thermal hypersensitivity and co-administration of the B1/B2 antagonist mixture did not produce an anti-hyperalgesic effect different from either antagonist alone, or antinociception, in this endpoint (Fig. 1.8).

3.9 Intrathecal infusion of bradykinin B1 and B2 receptor antagonists in rats with nerve injury .

To investigate the contribution of spinal bradykinin receptors to the expression of behavioral signs of neuropathic pain, selective bradykinin B1 and B2 antagonists were administered by continuous i.th. infusion with osmotic minipumps for 14 days after SNL.

The spinal infusion of 100 pmole per day of the B2 antagonist HOE 140 produced a time- dependent reversal of tactile hyperesthesia and thermal hyperalgesia over a period of 14 days after SNL (Fig. 1.9 and Fig. 1.10). The response thresholds to tactile stimulation of

the group receiving i.th. infusion of HOE 140 were significantly (F (1,120) = 53.71; p = 2.95 x 10 -11 ) greater than those of the vehicle-treated group (Fig. 1.9A). Paw withdrawal threshold gradually increased after 7 days and reached a maximum of 9.69 ± 1.26 g 14 days after SNL (Fig. 1.9A). When comparing area under the time-effect curves for the early (1 to 4 days) and late (5 to 14 days) phases after SNL, it was found that i.th.

-5 infusion of HOE 140 produced a significant (F (2, 32) = 13.62; p = 6.19 x 10 ) reversal of tactile hyperesthesia in the late phase but not in the early phase after SNL (Fig. 1.9 B).

Similarly, the i.th. infusion of HOE 140 caused a significant (F (1,120) = 54.56; p = 2.19 x

10 -11 ) difference in paw withdrawal latencies compared to vehicle treated animals after

SNL (Fig. 1.10 A). Paw withdrawal latencies gradually increased after 7 days and reached a maximum of 18.08 ± 0.55 sec 14 days after SNL (Fig.10 A). In addition, spinal

-9 infusion with HOE 140 produced a significant (F (2, 32) = 37.82; p = 6.31 x 10 ) increased paw withdrawal latencies in the late phase, but not the early phase, after SNL (Fig. 1.10

B). Administration of HOE 140 did not alter behavioral responses to tactile and thermal stimuli of sham-operated rats (data not shown).

Similar studies were performed with the bradykinin B1 antagonist DALBK. Rats with SNL received i.th. infusion of 100 nmole per day of DALBK for 14 days right after

SNL and behavioral responses to tactile and thermal stimuli were determined (Fig. 1.9 and Fig. 1.10). Intrathecal infusion of the B1 receptor antagonist produced a slight time- related reversal of tactile hyperesthesia over a period of 14 days after SNL. The mean paw withdrawal threshold to probing with von Frey filaments was significantly (F (2, 32) =

13.62; p = 6.19 x 10 -5) increased in the late, but not early, phase following nerve injury

(Fig. 1.9 B). In contrast, spinal infusion of DALBK completely reversed thermal

hyperalgesia by day 7 after SNL (Fig. 1.10 A), as indicated by the significant (F (2, 32) =

37.82; p = 6.31 x 10 -9) increase of area under the curve in the late phase compared to the

vehicle treated group (Fig. 1.10 B). Neither tactile nor thermal hypersensitivity were

significantly different from the vehicle treated group in the early phase after SNL (Fig.1.9

and Fig. 1.10).

3.10 Systemic infusion of bradykinin B1 and B2 receptor antagonists in rats with

nerve injury .

To investigate the possible contribution of peripheral bradykinin receptors to the

expression of behavioral signs of neuropathic pain, receptor selective bradykinin

antagonists were given systemically for 14 days after SNL through osmotic minipumps

implanted subcutaneously. The s.c. infusion of 150 nmol/kg per day of the B2 antagonist

HOE 140 produced a slight, but significant (F (2, 17) = 6.9; p = 0.0075) reversal of thermal but not tactile hypersensitivity in the early but not late phase after SNL (Fig.1.11 and

Fig.1.12). In contrast to spinal administration, systemic infusion of HOE 140 did not abolish tactile and thermal hypersensitivity in the late phase after SNL (Fig.1.11 and

Fig.1.12).

Similar studies were performed with the bradykinin B1 antagonist DALBK. Rats with SNL received s. c. infusion of 1500 nmol/kg per day of DALBK for 14 days after

SNL and behavioral responses to tactile and thermal stimuli were determined (Fig.1.11 and Fig.1.12). Neither tactile nor thermal hypersensitivity were significantly reversed by systemic infusion of DALBK over a period of 14 days after SNL (Fig.1.11 and Fig.1.12).

3.11 Local administration of bradykinin B1 and B2 receptor antagonists in rats with

nerve injury .

The possible role of peripheral bradykinin B 2 receptors on behavioral signs of neuropathic pain was further investigated by local administration of B 2 antagonists to the ipsilateral hindpaw 14 days after SNL. HOE 140 (1, 10,100 nmole) or vehicle was injected into the plantar surface of the paw (i. paw) to rats with SNL on day 14 after nerve injury (Fig.1.13). Behavioral signs of neuropathic pain, manifested by tactile and thermal hypersensitivity, were well established on day 14 after SNL. The mean paw withdrawal threshold to probing with von Frey filaments in rats with SNL significantly (p

< 0.05) decreased from a pre-SNL baseline ranging from a low of 14.50 ± 0.50 g to a high of 15 ± 0.0 g values to post-SNL value ranging from 1.71 ± 0.20 g to 3.12 ± 0.36 g

(Fig.1.13 A). The mean paw withdrawal latencies to noxious radiant heat was significantly (p < 0.05) decreased from a pre-SNL baseline ranging from 20.63 ± 0.80 sec to 20.55 ± 0.83 sec to post-SNL values rangng from 13.03 ± 0.94 g to 13.85 ± 0.58 sec

(Fig.1.13 B.). I. paw injection of HOE 140 did not alter either tactile or thermal hypersensitivity induced by nerve-injury when given 14 days after SNL (Fig.1.13).

3.12 Bradykinin B1 and B2 receptors’ mRNA expression in dorsal root ganglia and spinal cord after spinal nerve injury.

Rats with SNL and with confirmed behavioral signs of neuropathic pain were sacrificed 2 or 14 days after the surgery. Dorsal root ganglia and dorsal horn spinal cord sections at the lumbar level ipsilateral to SNL were taken from rats with SNL or sham surgery for quantitative RT-PCR analysis of B1 receptor and B2 receptor mRNA

expression (Fig. 1.14). Expression of mRNA for the B1 receptor in the DRG of rats with

SNL compared with DRGs obtained from sham-operated rats was significantly (p =

0.0497) increased at day 14, but not day 2 following SNL (Fig. 1.14), whereas B2

receptor expression was significantly elevated at both day 2 (p= 0.021) and day 14 (p =

0.038) post-nerve injury compared to sham animals (Fig. 1.14A). These results are consistent with previous studies in nerve injured rats showing an increase in mRNA expression for the B2, but not the B1, receptor 2 days after injury as well as an increased expression of mRNA for both receptors 14 days after injury (Levy and Zochodney,

2000). Basal levels of both bradykinin B1 receptor mRNA and B2 receptor mRNA expression was found in the dorsal spinal cord taken from sham-operated animals (Fig.

1.14B). SNL did not induce any significant changes in mRNA expression for either the bradykinin B1 or the B2 receptor in the spinal cord at either time point (Fig. 1.14).

3.13 Increased prodynorphin, but not kininogen, mRNA in the lumbar spinal cord after spinal nerve injury.

Since bradykinin is an endogenous ligand for bradykinin receptors, the expression of mRNA for both kininogen and prodynorphin in the spinal cord of nerve-injured rats was detected by quantitative RT-PCR. Lumbar spinal cords ipsilateral to SNL or sham surgery were taken from rats for RT-PCR analysis. The mRNA for prodynorphin in the spinal cord of rats with SNL was markedly increased 2 days (p = 0.0011) and 14 days (p=

0.0267) after SNL when compared to spinal cord tissue obtained from sham-operated rats

(Fig.1.15). In contrast, mRNA for kininogen was almost undetectable at either of these time points (Fig.1.15). These observations are consistent with previous studies that

demonstrate an upregulation of spinal dynorphin content in response to peripheral nerve

injury (Kajander et al., 1990; Porreca et al., 1999; Malan et al., 2000).

3.14 Intrathecal administration of bradykinin antiserum in rats with nerve injury .

The possible role of endogenous bradykinin acting at spinal sites to mediate the behavioral signs of neuropathic pain in the maintenance phase was investigated by i.th. administration of bradykinin anti-serum on day 14 after SNL. The ability of the bradykinin antiserum to abolish the effect of bradykinin was verified by inhibition of flinching behavior induced by intraplantar bradykinin injection (data not shown).

Behavioral signs of neuropathic pain, manifested by tactile and thermal hypersensitivity, were well established on day 14 after SNL. The spinal administration of 5 g of the

bradykinin antiserum 14 days after SNL did not produce reversal of either tactile or

thermal hypersensitivity induced by SNL (Fig.1.16 A, B). The i.th. injection of vehicle

did not produce any changes in response to tactile or thermal stimuli (Fig.1.16 A, B).

Figure 1.1 A. Acute effects of intrathecal (i.th.) administration of bradykinin on the response threshold to innocuous mechanical stimulation (von Frey filaments) in male Sprague Dawley rats. I.th. administration of bradykinin did not produce measurable hypersensitivity in response to tactile stimuli over the dose range administered.

Figure 1.1 B. Acute effects of intrathecal (i.th.) administration of bradykinin on the response threshold to noxious thermal stimulation detected by radiant heat applied to the paw in male Sprague Dawley rats. I.th. administration of bradykinin did not produce measurable hypersensitivity in response to thermal stimuli over the dose range administered.

Figure 1.1 C. Acute effects of intrathecal (i.th.) administration of bradykinin on the response threshold to the noxious thermal stimulation of a 52 oC hot-plate in male Sprague Dawley rats. I.th. administration of bradykinin did not produce measurable hypersensitivity in response to thermal stimuli over the dose range administered.

Figure 1.2 Acute effects of i.th. dynorphin A(2-13) on the response threshold to innocuous mechanical stimulation (von Frey filaments) (A) or noxious thermal stimulation (radiant heat applied to the paw) (B). Animals treated with dynorphin A (2- 13) showed decreased, reversible tactile (A) and thermal (B) thresholds compared to vehicle treated animals. (*p < 0.05)

Figure 1.3 Effects of graded doses of i.th. HOE 140 on tactile hypersensitivity (A) and thermal hyperalgesia (B) induced by dynorphin A(2-13). Decreased tactile and thermal thresholds are shown in animals 60 min after treatment with i.th. dynorphin A(2-13) (3 nmol). Intrathecal administration of HOE 140 (0.05- 30 pmol) produced a dose- dependent reversal of dynorphin-induced tactile (A) and thermal (B) hypersensitivity. (*p < 0.05).

Figure 1.4 Effects of graded doses of i.th. DALBK on tactile hypersensitivity (A) and thermal hyperalgesia (B) induced by dynorphin A (2-13). Decreased tactile and thermal thresholds are shown in animals 60 min after treatment with i.th. dynorphin A (2-13) (3 nmol). Intrathecal administration of DALBK (50, 100 nmol) showed significant reversal of thermal (A) but not tactile hypersensitivity (B). (*p < 0.05).

Figure 1.5 Response thresholds to innocuous mechanical (von Frey filaments) (A) and noxious thermal (radiant heat applied to the paw) (B) stimuli in control and B2-R knock- out mice after intrathecal dynorphin A (2-13). Dynorphin A(2-13) (i.t., 3nmol) produced significant tactile (A) and thermal (B) hypersensitivities in B2-R control mice at 1 hour after administration. However, in the B2-R knock-out mice, dynorphin A(2-13) did not produce significant different changes to von Frey or thermal stimuli. (*p < 0.05)

Figure 1.6 Effects of intrathecal administration of HOE 140 (A and B) on the tactile and thermal hypersensitivities induced by nerve injury at day 2, 4, 7, 10, and 14 after L5/L6 SNL. The intrathecal administration of Hoe 140 (0.5 pmol) significantly reversed the tactile (A) and thermal (B) hypersensitivity by post-injury day 7. The reversal effect of HOE 140 is progressive, reaching a maximum at 10 days for tactile hypersensitivity (A) and at 14 days for thermal hypersensitivity (B) after nerve injury. (*p < 0.05)

Figure 1.7 Effects of intrathecal administration of [Des-Arg9-Leu8]-Bradykinin (A and B) on the tactile and thermal hypersensitivities induced by nerve injury at day 2 and 14 after L5/L6 SNL. Intrathecal administration of 50 nmol of [Des-Arg9-Leu8]-Bradykinin produced a partial reversal of tactile hypersensitivity (C) and full reversal of thermal hypersensitivity (D) at day 14 but not at day 2 after SNL. (*p < 0.05).

A *

B *

Figure 1.8 Effects of intrathecal administration of a mixture of HOE 140 and DALBK on the tactile and thermal hypersensitivities induced by nerve injury at days 2 and 14 after L5/L6 SNL. The intrathecal administration of a mixture of HOE 140 (0.5 pmol) and DALBK (50 nmole) significantly reversed the tactile (A) and thermal (B) hypersensitivity at day 14 but not at day 2 after SNL. (*p < 0.05)

A 15 HOE 140 (100 pmole/day) DALBK (100 nmole/day) 12 Vehicle-SNL

6 SNL + Infusion 3 (i.t.) Paw Withdrawal Threshold (g) Paw Withdrawal Threshold 0 0 3 6 9 12 15 Time after SNL (days)

Figure 1.9 Effects of intrathecal infusion of HOE 140 and DALBK (A and B) for 14 days after L5/L6 SNL on the tactile hypersensitivity induced by nerve injury. The intrathecal infusion of HOE 140 (100 pmol/day) significantly reversed the tactile (A and B) hypersensitivity at the early phase but not late phase after SNL. Intrathecal infusion of 100 nmol of [Des-Arg9-Leu8]-Bradykinin produced a partial reversal of tactile hypersensitivity (A) and (B) after SNL. (*p < 0.05)

HOE 140 (100pmole/day) A 24 DALBK (100nmole/day) Vehicle-SNL 20

SNL + 8 Infusion (i.t.) 4 Paw Withdrawal Latency (sec) 0 0 3 6 9 12 15 Time after SNL (days)

B 150 * * 120 Vehicle HOE140 90 DALBK

AUC 60

0 Early phase Late phase

Figure 1.10 Effects of intrathecal infusion of HOE 140 and DALBK (A and B) for 14 days after L5/L6 SNL on the thermal hypersensitivities induced by nerve injury. The intrathecal infusion of Hoe 140 (100 pmol/day) reversed thermal (A and B) hypersensitivity in the early phase but not late phase afte SNL. Intrathecal infusion of 100 nmol of [Des-Arg9-Leu8]-Bradykinin produced a full reversal of thermal hypersensitivity (A) and (B) after SNL. (*p < 0.05)

B 50

40 Vehicle HOE 140 30 DALBK

AUC 20

0 Early phase Late Phase

Figure 1.11 Effects of systemic infusion of HOE 140 and DALBK (A and B) on the tactile hypersensitivity induced by nerve injury after L5/L6 SNL. The systemic infusion (s.c.) of HOE 140 (150 nmol/kg/day) and DALBK (1500 nmol/kg/day) did not produce any significant reversal of tactile hypersensitivity over a period of 14 days after SNL.

B 120

90 Vehicle HOE 140 60 DALBK AUC * 30

0 Early phase Late Phase

Figure 1.12 Effects of systemic infusion of HOE 140 and DALBK (A and B) on the thermal hypersensitivities induced by nerve injury after L5/L6 SNL. The systemic infusion (s.c.) of HOE 140 (150 nmol/kg/day) produced a slight, but significant reversal of thermal hypersensitivity in the early phase but not late phase after SNL (B). DALBK did not produce any significant reversal of thermal hypersensitivity over a period of 14 days after SNL. (*p < 0.05)

Figure 1.13 Effects of intraplantar administration of HOE 140 (A and B) on the tactile and thermal hypersensitivities induced by nerve injury at day 14 after L5/L6 SNL. The intraplantar administration of HOE 140 did not produce significant changes to von Frey or thermal stimuli. (*p < 0.05)

Figure 1.14 RT-PCR analysis of B1-R and B2-R mRNA expression in the lumbar DRG (A) and spinal cord (B) at day 2 and day 14 after sham-surgeries or L5/L6 SNL. A, In the DRG taken ipsilateral to the surgery, L5/L6 SNL induced increases in B1-R mRNA expression at day 2 but not day 14 compared to those taken from control sham animals (*P<0.05). In contrast, spinal nerve injury induced increased mRNA expression of B2-R in the DRG at day 2 and day 14 after SNL. B, in the spinal cord ipsilateral to the surgery, there was a basal level of m RNA expression for B1-R and B2-R. SNL did not induce any change in mRNA expression for either B1-R or B2-R. (*p < 0.05)

Figure 1.15 RT-PCR analysis of spinal prodynorphin and kininogen mRNA expression at day 2 and day 14 after sham-surgery or L5/L6 SNL. There was a higher basal level of prodynorphin mRNA in the spinal cord in sham control animals, however, mRNA of kininogen in the spinal cord was almost undetectable. At day 2 and day 14, animals with SNL demonstrated a 2.2-fold increase in prodynorphin mRNA expression in the spinal cord compared with the sham-operated animals, but SNL did not alter the mRNA expression of kininogen. (*p < 0.05)

Figure 1.16 Effects of i.th. bradykinin anti-serum on tactile hypersensitivity (A) and thermal hyperalgesia (B) on day 14 after SNL. Intrathecal administration of bradykinin anti-serum (5 g) did not significantly reverse of tactile and thermal hypersensitivity

CHAPTER FOUR

DISCUSSION

These results advance our previous observations that nerve injury-induced behavioral hypersensitivity is sustained by upregulated pathological levels of spinal dynorphin. Here, we provide evidence for a novel mechanism of pronociceptive actions of dynorphin through activation of bradykinin receptors. Such interaction is consistent with a pronociceptive role of bradykinin receptors in the manifestation of enhanced pain and central sensitization. The results presented indicate that (a) spinal administration of bradykinin produced highly transient behavioral hypersensitivity which could not be evaluated in the measures of sensory thresholds employed in these studies, (b) dynorphin

A(2-13) induced behavioral hypersensitivity was reversed by administration of B2, and to a lesser extent, B1 receptor antagonists; (c) dynorphin-induced hypersensitivity was not observed in bradykinin B2 receptor knockout mice; (d) antagonists at spinal B2, and to some extent, B1, bradykinin receptors abolished behavioral hypersensitivity induced by nerve injury at late, but not early postinjury time points; (e) systemic infusion of B2 and

B1 antagonists or local administration of B2 antagonist did not block behavioral hypersensitivity induced by nerve injury in the late phase after SNL; (f) nerve injury induced significant increases in mRNA of B1 and B2 receptors in the DRG and (g) of prodynorphin mRNA, but not of kininogen mRNA, in the lumbar spinal cord; (h) intrathecal administration of brdykinin antiserum did not have any effect on nerve injury- induced abnormal pain behaviors. Significantly, the effects of intrathecal infusion of the bradykinin antagonists were observed only at those time points when spinal dynorphin

was upregulated by injury. The data show that pharmacological dynorphin, unlike

bradykinin, produces sustained behavioral signs of hyperalgesia. Moreover, the

intrathecal bradykinin antagonists show a delayed, time-related reversal of behavioral

signs of neuropathic pain, whereas the intrathecal administration of bradykinin anti-

serum is inactive. These observations suggest strongly that upregulation of spinal

dynorphin, and not of bradykinin, activate bradykinin receptors to maintain the enhanced

abnormal pain induced by peripheral nerve injury.

Peripheral nerve injury, inflammatory injury and spinal trauma have been consistently demonstrated to result in elevated spinal dynorphin content (Faden et al.,

1985; Millan et al., 1988; Kajander et al., 1990; Dubner and Ruda, 1992; Wagner et al.,

1993; Malan et al., 2000; Lai et al., 2001; Wang et al., 2001). Upregulated spinal dynorphin is important in the maintenance of pathological pain states through a pronociceptive, non-opioid receptor mediated mechanism (Kajander et al., 1990;

Vanderah et al., 1996; Malan et al., 2000; Tang et al., 2000; Wang et al., 2001; Burgess et al., 2002). Our recent work has demonstrated that dynorphin and its non-opioid fragments increase intracellular calcium concentration through direct interaction with the bradykinin receptor, which can be blocked by the bradykinin receptor antagonist HOE 140, revealing a novel mechanism for endogenous dynorphin to promote pain through its agonist action at bradykinin receptors (Lai et al., 2006).

Pharmacologically, exogenous spinal dynorphin A(1-17), or its des-Tyr-fragments which do not bind to opioid receptors (Chavkin and Goldstein, 1981; Walker et al.,

1982), produce long-lasting, and dose-dependent signs of enhanced pain that progress, at

high doses, to neurological dysfunctions and hindlimb paralysis (Faden and Jacobs, 1984;

Vanderah et al., 1996; Laughlin et al., 1997; Wang et al., 2001). To avoid these long-term neurotoxic effects, a lower dose of only 3 nmol of spinal dynorphin A(2-13) was used in the present studies which produced reversible thermal hyperalgesia and tactile hyperesthesia in rats. The reversibility of these effects indicates that these behavioral signs are not due to excitotoxicity, but result from activation of pronociceptive receptor systems (Kawaraguchi et al., 2004). In contrast to the effects of dynorphin, spinal injection of a wide range of doses of bradykinin did not elicit behavioral hypersensitivity.

The dynorphin-induced behavioral hypersensitivity was reversed by spinal administration of antagonists acting predominately at the B2 bradykinin receptor. The B1 receptor antagonist was inactive against tactile hypersensitivity and showed significant reversal only against dynorphin-induced thermal hypersensitivity, a profile consistent with the low levels of expression of the B1 receptor and the effects of selective B1 receptor antagonists in nerve-injured animals (see below and Porreca et al., 2006). The dose- dependency reversal of dynorphin-induced hyperesthesias by the B2 receptor antagonist

HOE 140 suggests a specific interaction of dynorphin with this receptor. This interpretation is further supported by the observation that spinal dynorphin produced hyperalgesia in wild-type but not B2-receptor knock-out mice. The effects of spinal dynorphin in B1 receptor knock-out mice could not be evaluated in this study due to the current lack of availability of these mice to our laboratory.

Our present study shows that spinal administration and infusion of bradykinin antagonists induced the reversal of behavioral signs of tactile hyperesthesia and thermal

hyperalgesia induced by nerve injury only in the maintenance phase but not initiation phase after SNL, which is consistent with the time-course of the upregulation of spinal dynorphin content (Malan et al., 2000; Burgess et al., 2002; Gardell et al., 2003). This time-course is coincident with the dynorphin-dependent maintenance phase of neuropathic pain previously described in our laboratory (Wang et al., 2001). Levels of spinal dynorphin increase after nerve-injury with the peak levels seen approximately at day 10 post-injury and lasting for many weeks (Malan et al., 2000; Gardell et al., 2003).

Moreover, although prodynorphin ‘knock-out’ mice developed tactile and thermal hypersensitivity within 2 to 3 days after SNL, these neuropathic pain behaviors were not sustained and resolved within 7 to 10 days after the nerve injury, i.e., in the absence of maintenance by endogenous dynorphin (Wang et al., 2001). In addition, spinal administration of dynorphin antiserum abolished behavioral signs of neuropathic pain 10, but not 2, days after SNL (Wang et al., 2001). Surgical and pharmacologic manipulations that abolish injury-induced upregulation of spinal dynorphin also abolish behavioral signs of neuropathic pain, but in a time-dependent manner, where hypersensitivities to tactile and thermal stimuli are present during the initial phase and gradually resolve within 7 days (Burgess et al., 2002; Gardell et al., 2003). These observations led to the postulation of a dynorphin-independent initiation phase, followed by a dynorphin-dependent maintenance phase of neuropathic pain, which is associated central sensitization maintained, in part, by descending pain facilitatory systems (Burgess et al., 2002; Gardell et al., 2003; Ossipov and Porreca, 2005; Vera-Portocarrero et al., 2006). Accordingly, blockade of behavioral signs of neuropathic pain by bradykinin receptor antagonists only

during the maintenance, and not during the initiation, phase is consistent with a disruption of the pronociceptive action of dynorphin and rule out a role for endogenous bradykinin in mediation of these effects. These findings strongly indicate that pathological elevations in spinal dynorphin levels after nerve injury may result in an interaction between dynorphin and the bradykinin receptors to contribute to pain hypersensitivity at the spinal cord level.

The B1 bradykinin antagonist DALBK produced a partial reversal of tactile hyperesthesia in the maintenance phase after SNL, although thermal hyperalgesia was completely abolished. It may be possible that the dose of antagonist was insufficient to achieve a full effect on tactile hypersensitivity; higher doses were not studied due to the likelihood of non-selective interactions of DALBK with the B2 receptor (MacNeil et al.,

1995). The lack of effect of the B1 receptor antagonist on tactile hypersensitivity is consistent, however, with our previous report that a selective, non-peptidic bradykinin receptor antagonist reverses thermal, but not tactile, hypersensitivity associated with SNL injury (Porreca et al., 2006) and that bradykinin B1 knock-out mice developed tactile hypersensitivity normally after SNL injury (Porreca et al., 2006). Moreover, it should be noted that one report indicated that the B1 receptor knock-out mice failed to develop either tactile or thermal hypersensitivity after nerve injury (Ferreira et al., 2005).

Nevertheless, our findings are also consistent with the predominant activity of the B2 receptor antagonist in reversing the hypersensitivity elicited by pharmacological administration of dynorphin A (2-13). Furthermore, our data showed a marked upregulation of the B2 receptor by day 2 after SNL. In spite of upregulation of the B2

receptor, however, spinal administration of the bradykinin receptor antagonists did not

block behavioral signs of neuropathic pain until time points consistent with the

upregulation of spinal dynorphin. Moreover, the mRNA for the B1 receptor was markedly increased in the DRG, but not the spinal cord, at day 14 after SNL.

Collectively, these observations suggest that the B2 bradykinin receptor, which is associated with a much greater level of injury-induced mRNA expression in the DRG, represents the prominent site of pronociceptive action of spinal dynorphin, though the B1 receptor clearly participates if expressed.

Unlike dynorphin, i.th. bradykinin did not elicit measurable behavioral hypersensitivity. A recent report suggests that bradykinin induces pain hypersensitivity in the spinal cord by potentiating spinal glutamatergic synaptic transmission and reported bradykinin-induced hypersensitivity, which persisted for more than 75 min after injection

(Wang et al., 2005). Given the rapid degradation of bradykinin (McCarthy et al., 1965;

Marceau et al., 1981; Bhoola et al., 1992; Vellani et al., 2004) this extended time course of hypersensitivity is surprising. Our experiments were performed with the same doses and assays but we could not detect bradykinin-induced hypersensitivity beyond extremely

transient behaviors lasting less than 1 min. Our findings were similar to those reported by

others in which spinal bradykinin caused immediate hyperactive and escape behaviors

that lasted less than 1 min (Laneuville et al., 1988), but did not increase sensitivity to

mechanical and thermal stimuli, a finding which was attributed to the likely rapid

metabolism of bradykinin (Saameli and Eskes, 1962; Ferreira and Vane, 1967; Marceau

et al., 1981; McCarthy and Lawson, 1989).

Consistent with the lack of sustained activity of spinally administered pharmacological bradykinin, our results showed that there is an undetectable mRNA for kininogen under basal conditions or after nerve injury. Although all of the components of the kallikrein-kinin system exist within the spinal cord, the site of kinin production has yet to be identified. The absence of the mRNA for the bradykinin precursor, kininogen, in the spinal cord under uninjured and especially in injured conditions argues against a prominent role for central bradykinin in neuropathic pain. This point is further reinforced by the observation that the intrathecal bradykinin anti-serum was unable to reverse nerve injury-induced hypersensitivity when given at day 14 post injury. It is noted that several reports demonstrated activity of systemically applied bradykinin receptor antagonists in neuropathic pain states, but the source of activation of the bradykinin receptors was not identified (Levy and Zochodne, 2000; Yamaguchi-Sase et al., 2003; Gougat et al., 2004).

In present study, however, systemic infusion of B1 and B2 antagonists did not produce any reversal of behavioral signs of enhanced abnormal pain after SNL. A possible reason for the difference between the results of the present study and those reported previously may be related to the different neuropathic pain models employed. In the previous investigations (Levy and Zochodne, 2000; Yamaguchi-Sase et al., 2003;

Gougat et al., 2004), chronic constriction injury of the sciatic nerve (CCI) was used, and this model may be associated with a significant inflammatory component. Our results, presented here, also showed that systemic infusion of a B2 antagonist produced significant reversal of thermal hypersensitivity in the early phase following nerve injury.

This effect of a B2 antagonist in the early phase may due to the anti-inflammatory effect

of HOE 140 after surgery. In addition, local administration of bradykinin B2 antagonist directly to the ipsilateral hindpaw did not produce any significant reversal of pain hypersensitivity induced by nerve injury, arguing against the possibility of a localized pronociceptive effect of bradykinin.

Importantly, the bradykinin receptor antagonists given spinally abolished signs of enhanced pain only at the time period during which endogenous dynorphin is upregulated sfter SNL (Malan et al., 2000; Gardell et al., 2003), arguing for the possibility of a central site of action. Critically, message for kininogen in the spinal cord was not present, even after SNL, whereas there was a significant increase in mRNA for the dynorphin precursor prodynorphin after SNL. In agreement with previous reports from several laboratories, including ours (Kajander et al., 1990; Draisci et al., 1991; Malan et al., 2000; Gardell et al., 2003) nerve injury produces increased immunoreactivity for the dynorphin or mRNA for prodynorphin in the spinal cord. More importantly, the increase of spinal dynorphin has been shown to play an essential role in the expression of nerve injury-induced pain.

Taken together, these results indicate that activation of bradykinin receptors at spinal, and not peripheral, sites contribute to the maintenance of SNL-induced signs of enhanced abnormal pain. In addition, the absences of pronociceptive activity of spinal bradykinin or of antihyperalgesic effect of spinal antiserum to bradykinin suggest that spinal bradykinin does not act as the endogenous ligand at these receptors to promote nociception. In contrast, the observations that bradykinin antagonists or antiserum to dynorphin exhibit antihyperalgesic effects only when spinal dynorphin is upregulated, along with the existence of nanomolar binding affinity of dynorphin at the bradykinin

receptors (Lai et al., 2006) suggest that increased concentrations of endogenous dynorphin may be sufficient to activate these pronociceptive receptors and maintain an enhanced pain state. The present findings reveal the interaction of dynorphin with a novel receptor system and indicate that dynorphin acts at bradykinin receptors to produce persistent pain after injury. These findings represent a novel pronociceptive mechanism which offers new approaches to the development of therapy for pathological pain states.

PART TWO

ATTENUATION OF EXPERIMENTAL PANCRATITIS PAIN BY A BRADYKININ B2 RECEPTOR ANTAGONIST

ABSTRACT

The role of bradykinin receptors in activating and sensitizing nociceptors in the periphery is well known. Recently, our studies have suggested that the pronociceptive actions of dynorphin in the central nervous system are the result of a novel interaction with bradykinin receptors. Blockade of bradykinin receptors reversed nerve injury- induced tactile and thermal hyperalgesia only when spinal levels of dynorphin were elevated. The present study explored the role of bradykinin receptors in visceral pain using a model of chronic pancreatitis induced by intravenous injection of dibutyltin dichloride (DBTC) in rats. DBTC produced sustained abdominal hypersensitivity over the course of several days. Following DBTC, RT-PCR analysis revealed up-regulation of bradykinin B2, but not B1, receptors in the pancreas, increased levels of both B1 and B2 receptors in the thoracic DRG, but no changes in bradykinin receptor expression in the spinal cord. Intraperitoneal administration of HOE 140, a B2 antagonist, produced dose- dependent reversal of abdominal hypersensitivity in rats with pancreatitis on day 7 post

DBTC; Des-Arg 9-Leu 8-bradykinin, a B1 receptor antagonist, had no effect. Intrathecal

HOE 140 injection at the thoracic spinal level also elicited a dose-related inhibition of pancreatitis pain while the B1 antagonist had no effect. DBTC produced an upregulation of spinal dynorphin and spinal administration of antiserum to dynorphin also produced a reversal of pancreatitis pain. These results suggest a functional role for bradykinin B2 receptor expressed in the periphery. Additionally, the data suggest a role for spinal dynorphin in maintaining pancreatitis pain through actions at bradykinin B2 receptors.

Selective B2 antagonists which penetrate the CNS may therefore have therapeutic

potential against pancreatitis pain through both peripheral and central sites and mechanisms of action.

CHAPTER ONE

INTRODUCTION

1.1 Visceral pain

Visceral pain is defined as pain originating from the internal organs in the thorax, abdomen or pelvis and is generally perceived as a deep, dull and vague sensation. Pain arising from the viscera differs from somatic pain that originates from skin, muscle and joints. Crushing, cutting and burning generally have no algogenic effect in the viscera whereas mechanical stimulation, ischemia and chemical stimulation, separately or in combination, may cause pain. Although visceral pain has traditionally been less investigated than somatic pain, in the last two decades a great number of studies focusing on visceral pain have uncover some important clinical characteristics of visceral pain. (1)

Pain per se does not arise from all viscera (liver, kidney, most solid viscera, and lung parenchyma are not sensitive to pain). (2) Visceral pain is diffuse and poorly localized. (3)

Tissue injury may not be required or necessary for production of visceral pain. (4) It is referred to other locations. (5) It is accompanied with motor and autonomic reflexes, such as nausea, vomiting, and low-back muscle tension that occurs in renal colic

(Cervero and Laird, 1999).

1.2 Transmission of visceral pain

There are two recognized classes of nociceptive sensory receptors that innervate internal organs (Cervero, 1994). The first class of receptors has a high mechanical threshold for activation, responds only to apparently noxious intensities of stimulation and encodes the stimulus intensity within the noxious range (Cervero et al., 1992). The

second class of receptors has a low threshold to natural stimuli (mostly mechanical) and encodes the intensity of stimulation throughout the non-noxious and noxious ranges of stimulation (Blumberg and Janig, 1983; Haupt et al., 1983). In addition, it appears that a large component of the afferent innervations of visceral organs is normally inactive and becomes sensitive to stimuli only in the presence of inflammation (Cervero and Janig,

1992). During inflammation, locally acting agents in a visceral organ result in the sensitization of certain receptors. Once sensitized, these receptors will begin to response to the innocuous stimuli that normally occur in internal organs. Furthermore, persistent damage and inflammation in an internal organ produces dramatic changes in the environment that surrounds the nociceptor endings which further increases the excitation of sensitized nociceptors. Therefore, in a disease state in which irritating and/or inflammatory conditions are common, visceral nociceptors are likely active.

It has been assumed that nociceptive signal arising from the viscera reached the brain via the spinothalamic tract, which is the primary ascending somatosensory pathway in the ventrolateral white matter of the spinal cord (Milne et al., 1981). Recently, experimental evidence and clinical studies showed that the dorsal column pathway plays an important role in transmission of visceral nociceptive signals. Neurosurgical interruption of the midline of the dorsal column pathway has been shown to be an effective treatment for relief of pelvic cancer pain (Hirshberg et al., 1996; Nauta et al.,

1997). A series of experimental studies has elucidated an important visceral pain pathway which arises from the post-synaptic dorsal column neuron (PSDC) around the spinal cord central canal and ascends in the DC to synapse in the dorsal column nuclei (Cliffer and

Giesler, 1989; Cliffer and Willis, 1994; Hirshberg et al., 1996; Nauta et al., 1997; Willis et al., 1999). All this evidence suggests that the DC plays an important role in the perception of visceral pain. Thus, nociceptive transmission from the viscera reaches levels of consciousness, and is interpreted as pain, through a distinct pain pathway.

1.3 Pancreatitis

Pancreatitis is an inflammation of the pancreas. There are two types of the pancreatitis: acute and chronic pancreatitis. Acute pancreatitis is defined as an acute condition typically presenting with abdominal pain, and usually associated with elevated pancreatic enzymes in the blood, due to the inflammation of the pancreas. Patients with acute pancreatitis present acute and severe abdominal pain, nausea and vomiting.

Although it can be a severe, life-threatening illness with many complications, usually it is self-imiting. Biliary tract disease and alcohol abuse are associated with about 80% of acute pancreatitis attacks. Chronic pancreatitis is defined as a continuing inflammatory disease of the pancreas characterized by irreversible morphological change and typically causing pain and/or permanent loss of function of pancreas. In developed countries, alcoholism is the cause of chronic pancreatitis in more than 70% of cases. The pathological hallmarks of chronic paincreatitis are inflammation, glandular atrophy, ductal changes, and fibrosis (Petersen and Forsmark, 2002). The leading symptom of chronic pancreatitis is abdominal pain. At least 85% of patients with CP will develop pain at some time during the course of their disease.

1.4 Pancreatitis pain

Pain is the only sensation that can be elicited from the pancreas (Cervero, 1994).

Abdominal pain is the major presenting complaint of nearly all patients with acute and chronic pancreatitis. The pain of pancreatitis is steady and agonizing and is felt in the epigastrium, sometimes in the left upper quadrant with radiation to the back between T

12 and L2 or to the left shoulder. It’s often described as deep, penetrating and debilitating and it may increase after a meal. Pain is considered the most important factor affecting the quality of life of chronic pancreatitis patients (Pezzilli et al., 2005), and is responsible for the majority of the hospitalizations related to this illness.

Abdominal pain is not only the most important symptom of chronic pancreatitis, but also the most difficult complaint to treat. Currently, besides pancreatic enzymes supplementation, cessation of alcohol and a low-fat diet, the first step is to try nonopioid analgesics, such as acetaminophen, salicylates and nonsteriodal anti-inflammatory drugs

(NSAIDS). However, most patients need opioid analgesics for symptomatic relief, but the initial doses should be low and administered infrequently. If a potent narcotic is needed to offer pain relief, surgery should be considered as early as possible before the development of narcotic addiction. Despite the wide variety of approaches used to treat pancreatitis pain, no consensus has emerged and no single form of treatment can be considered satisfactory at this time.

1.5 Pathogenesis of pain in chronic pancreatitis

The pathophysiology of pain in CP is incompletely understood and perhaps multifactorial. Several hypotheses have been advanced including both pancreatic and extrapancreatic causes.

Increased pressure within the ductal system and/or the parenchyma has been suggested to be one of the causes of pain. Intrapancreatic pressure may be related to the pancreatic secretion in the presence of an obstruction in the pancreatic duct (Manes et al.,

1992). Altering obstruction and secretion are able to modulate pain intensity and frequency in patients with chronic pancreatitis (Bradley, 1982; Ebbehoj, 1992). Many investigators have related the origin of pain to increased pressure in the pancreatic ducts and tissue (Ebbehoj et al., 1990b; Ebbehoj et al., 1990a). However, many chronic pancreatitis patients continue to experience unchanged pain after drainage of pancreatitic ducts suggesting that additional mechanisms are also involved in the pathogenesis of pancreatitis pain.

Recent studies have shown the inflammatory involvement of intrapancreatic nerve fibers in a so called "neuroimmune interaction". In fact, infiltration of inflammatory cells around the nerves together with an increase in the number of nerve fibers in the fibrotic pancreatic tissue has been proposed as a possible cause of pain in chronic pancreatitis (Keith et al., 1985; Bockman et al., 1988). Moreover, immunohistological studies have shown that the amount of neurotransmitters, such as substance P and calcitonin gene related peptide, is increased in afferent pancreatic nerves and a close interrelationship between pain and immune cell infiltration of the nerves has been reported in CP (Buchler et al., 1992).

In addition to pancreatic causes, extrapancreatic causes such as common bile duct obstruction and duodenal stenosis are not infrequent and may also contribute to the pain of chronic pancreatitis.

1.6 DBTC-induced persistent pancreatitis model

Organo-tin substances such as DBTC are strongly lipophilic and were excreted, therefore, by bile. Organo-tin compounds are of strong toxicologic relevance because of their high toxicity and widespread use in large quantities as stabilizers in polyvinylchloride production and as biocides in agriculture or antifouling paints. The organotin substance such as dibutyltin dichloride (DBTC) at a concentration of about half the lethal dosage of 6 mg/kg body weight intravenously is able to induce an acute and later a chronic pancreatitis in rats. DBTC has direct cytotoxic effect on bilio-pancreatic duct epithelium and on acinar cells (Merkord et al., 1997). Hematologically, the pancreatic acinar cells are directly injured by organotin, which is dissolved in the blood.

DBTC-induced pancreatitis resembles the human form of edematous pancreatitis in some aspects (interstitial edema, intracellular activation of enzymes, necrosis of distinct acinar cells, increased levels of pancreatic digestive enzymes in the blood (Merkord et al., 1998).

When the biliopancreatic duct is occluded permanently, the acute phase of DBTC pancreatitis is transduced into a chronic phase (Sparmann et al., 1997; Merkord et al.,

1999). Therefore, this animal model is very useful for studying the pathogenesis of acute and chronic pancreatitis of humans.

1.7 Role of kinin-kallikerin system in pancreatitis

The endogenous kinins, bradykinin (Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg) and kallidin (Lys-bradykinin) are among the most potent autacoids involved in inflammatory, vascular and pain processes. Kinins are released from larger precursor peptides, high molecular weight kininogen (HK) and low molecular weight kininogen (LK) by specific

enzymes, the kallikreins both in plasma and peripheral tissue (Bhoola et al., 1992). The

major effects of kinins are mediated by constitutively and widely expressed bradykinin

B2 receptors or, especially after tissue damage, by the inducible B1 receptors (Regoli et

al., 1993). Whereas bradykinin and kallidin present high affinity for B2 receptors, B1

receptors are preferentially and selectively activated by the active metabolites des-Arg-

bradykinin and des-Arg-kallidin (Fig 0.1). Activation of bradykinin receptors by kinins

induces an increase of intracellular calcium through the activation of PLCβ and production of inositol 1, 4, 5-triphosphate. It has also been shown that kinin actions are also associated with secondary production of other mediators such as prostanoids, cytokines, nitic oxide and mast cell-derived products (Marceau and Bachvarov, 1998). As a result of their actions, the release of kinins has been implicated in the development and maintenance of inflammatory and nociceptive processes.

The pancreas is one of the organs with the highest expression of tissue kallikrein

(Chao and Chao, 1995). Consequently, the roles of the kinin-kallikrein system in acute pancreatitis have been extensively investigated since the 1960s (Ryan et al., 1964). It has been demonstrated that kallikrein-like activities and kininogen levels in the pancreatic tissue are significant increased during acute pancreatitis (Griesbacher et al., 2003).

Clinical evidence suggested that some symptoms of acute pancreaitis have been attributed to the activation of the kallikrein-kinin system (Ruud et al., 1985), since serum bradykinin and kallikrein levels in ascites are increased during the course of the disease

(Satake et al., 1973a; Satake et al., 1973b). In addition, the use of bradykinin receptor antagonists provided experimental evidence for the involvement of the kallikrein-kinin

system in pancreatitis. Treatment with a few bradykinin receptor antagonists has been shown to be effective in several different acute pancreatitis models (Griesbacher and

Lembeck, 1992; Griesbacher et al., 1993; Kanbe et al., 1996; Bloechle et al., 1998).

Previous investigations have found that edema formation in caerulein-induced pancreatitis is almost entirely due to the release of endogenous kinins, which activate kinin B2 receptors (Griesbacher and Lembeck, 1992). All investigations mentioned so far indicate that blockade of kinin action with B2 receptor antagonists reduced edema formation in the pancreas and other associated phenomena.

Peripheral mechanisms of increased pain due to noxious (hyperalgesia) and innocuous (allodynia) stimulation during persistent inflammatory conditions are explained as the sensitization of primary afferent neurons supplying the tissue. Kinins as one of most potent endogenous inflammatory and pain-inducing mediators are responsible for activation and sensitization of primary afferent neurons (Kumazawa and

Mizumura, 1980; Kanaka et al., 1985; Neugebauer et al., 1989; Lang et al., 1990;

Kumazawa et al., 1991; Manning et al., 1991; Koltzenburg et al., 1992). Application of bradykinin directly to the surface of the pancreas of rats has been shown to activate nociceptive afferent neurons via B2 receptors (Holzer-Petsche, 1992). Further studies are needed to show whether the endogenous release of kinins is sufficient to account for the severe abdominal pain observed in pancreatitis. Provided that kinins are confirmed as a major cause of the activation of nociceptors in pancreatitis, B2 receptor antagonists can be expected to be effective in reducing not only edema but also pain in pancreatitis.

1.8 Role of spinal dynorphin in pancreatitis pain

Dynorphin is an endogenous opioid that may produce an inhibitory effect at opioid receptors. However, more recently, observations from many laboratories have suggested that dynorphin is pronociceptive in chronic pain states (Bian et al., 1999;

Malan et al., 2000; Gardell et al., 2004). Spinal dynorphin is up regulated after nerve injury and inflammation (Wang et al., 2001; Burgess et al., 2002; Ma and Eisenach, 2003;

Gardell et al., 2004; Zhang et al., 2004). Dynorphin also is up regulated after abdominal inflammation produced by carrageenan (Nakamura, 1994). Dynorphin anti-serum blocks pain behaviors induced by nerve injury (Cox et al., 1985; Faden et al., 1985).

Additionally, prodynorphin knockout mice develop, but do not sustain, nerve injury induced pain (Wang et al., 2001) suggesting that nerve injury-induced pathological levels of spinal dynorphin are critical in maintaining, but not initiating, neuropathic pain

(Burgess et al., 2002). The pronociceptive mechanisms of dynorphin are unknown, but do not involve opioid receptors (Vanderah et al., 1996; Tang et al., 2000; Burgess et al.,

2002). Our recent studies indicated that dynorphin A (2-13) interacts with bradykinin receptors to produce increased intracellular calcium (Lai et al., 2006). Radio-ligand binding studies also show the direct interaction of dynorphin with bradykinin receptors in

F-11 cell and mouse brain cells (Lai et al., 2006). Furthermore, spinal administration of bradykinin receptor antagonists reverses tactile and thermal hypersensitivity in the nerve injury model. All the evidence suggests that dynorphin could interact with bradykinin receptors at the spinal level and produce pronociceptive action in the neuropathic pain state (Lai et al., 2006). One recent study demonstrated that dynorphin is upregulated in the thoracic cord of rats with pancreatitis, which corresponds with referred abdominal

100

mechanical hypersensitivity. Furthermore, pancreatitis pain was abolished by spinal administration of dynorphin antiserum, suggesting a prominent pronociceptive role in visceral pain (Vera-Portocarrero et al., 2006).

1.9 Summary of research goals

Previous investigations showed that persistent pain associated with inflammation and peripheral tissue injuries resulting from long-term changes in nociceptive processing involve both peripheral and central mechanisms. In the periphery, many inflammatory chemical mediators such as kinins, prostaglandins (PG s), protons and others which are responsible for activation and sensitization of primary afferent neurons in somatic pain are likely to cause sensitization of pancreatic nociceptors in pancreatitis. Kinins have been of particular interest since they are probably the most potent endogenous pain- producing mediator (Juan and Lembeck, 1974). Acute systemic administration of bradykinin receptor antagonist has been shown to be effective in models of chronic inflammatory and neuropathic pain. In contrast, pharmacological information on the bradykinin antagonists in the models of pancreatitis pain is sparse. In addition, our recent studies have demonstrated that spinal bradykinin receptors have significant contributions to pain hypersensitivity in animal models of nerve injury. Increased spinal dynorphin due to nerve-injury may interact with bradykinin receptors at the spinal level to produce pronociceptive effects in neuropathic pain state. Intrathecal bradykinin receptor antagonists reversed nerve injury-induced pain suggesting a blockage of the pronociceptive actions of dynorphin mediated through spinal bradykinin receptors.

Furthermore, one recent study demonstrated that pancreatitis-induced abdominal

101

hypersensitivity corresponds with up-regulation of dynorphin in the thoracic spinal cord.

Pancreatitis pain was abolished by spinal administration of dynorphin antiserum, suggesting a prominent pronociceptive role in this type of visceral pain. Therefore, in the present work, the involvement of peripheral and spinal bradykinin receptors in pancreatitis pain will be examined in DBTC-induced pancreatitis model using bradykinin receptor antagonists.

102

constitutive The Kinin-Kallikrein System B2 receptor

Plasma Kallikrein

HMW-Kininogen Bradykinin Des-Arg 9-bradykinin

Amino Kininase I Peptidases LMW-Kininogen Kallidin Des-Arg 9-Kallidin

Tissue Kallikrein

inducible

B1 receptor

Figure 0.1 Simplified scheme of the kinin-kallikrein system.

103

2000

* Pancreatitis Vehicle 1500

1000

500

Dynorphin content (pg/mg) content Dynorphin

0 Cervical Thoracic Lumbar

(Vera-Portocarrero et al., 2006)

Figure 0.2 Dynorphin levels in the spinal cord dorsal horn on day 6 after DBTC-induced pancreatitis and control vehicle rats. Dynorphin levels were increased significantly in rats with DBTC-induced pancreatitis only in the thoracic spinal cord dorsal horn. *p<0.05 vs vehicle group.

104

CHAPTER TWO

MATERIALS AND METHODS

2.1 Animals

Male Sprague-Dawley rats (Harlan, Indianapolis, IN) weighing 175-200g were used for all experiments. Rats were maintained three to a cage in a climate-controlled room on a 12-h light/dark cycle (lights on at 06:00h) with food and water were available ad libitum. All experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Arizona. This study was also performed in accordance with the policies and recommendations of the International

Association for the Study of Pain (IASP).

2.2 Induction of pancreatitis

The experimental model of pancreatitis was induced according to a protocol reported by Sparmann et al. The dibutyltin dichloride (DBTC, Aldrich, Milwaukee, WI) was dissolved in two parts of 100% ethanol and three parts of glycerol. The DBTC was injected into the tail vein at a dose of 6 mg/kg under isofluorane anesthesia (2-3 L/min,

4.0%/vol until anesthetized, and then 2.5%/vol throughout the procedure). For the control group, the animals were injected with vehicle (ethanol: glycerol, 2:3). Seven days after

DBTC injection, these rats were randomly divided into groups and animals then received an antagonist, antiserum or their respective vehicle solutions.

2.3 Intrathecal catheter implantation

Animals were anesthetized with ketamine/xylazine (100mg/kg). Rats were placed in a stereotaxic headholder and a midline incision was made at the back of the skull to

105

expose the atlanto-occipital membrane. A PE-10 intrathecal catheter (polyethylene-10

tubing; 4.5-5.0 cm) was carefully inserted into the subarachnoid space and advanced to

the midthoracic level of the spinal cord. Following the surgery, each animal was housed

individually and allowed to recover for 3 days, and then the rats were injected with

DBTC through the tail vein to produce pancreatitis. On day 7 after DBTC injection, drugs or vehicle were injected through the intrathecal catheter in a volume of 5 l followed by a

9l saline flush.

2.4 Drugs and injection

Rats were randomized to experimental groups receiving a B2 antagonist (HOE

140, American Peptide Company, Inc, Sunnyvale, CA), B1 antagonist ([Des-Arg9-Leu8]-

Bradykinin, Bachem Inc, Torrance, CA), vehicle (dH2O-treated bradykinin receptor antagonist control), dynorphin anti-serum (Peninsula Laboratories Inc., San Carlos, CA), or the control serum. For systemic administration, HOE 140 (0.1, 0.3, 1, 3 mol/kg) and

[Des-Arg9-Leu8]-bradykinin (1, 10, 100 mol/kg) were given intraperitoneally. For intrathecal administration, drugs were dissolved in a 5-µl volume of the vehicle containing the desired dose of the agents.

2.5 Quantitative Real-Time PCR

Total RNA was isolated from the pancreas, the thoracic spinal cord and the thoracic dorsal root ganglia (T8-T12) by the TRIzol method (Invitrogen, CA, USA). Two step reverse transcription (RT) was performed using 1 µg total RNA and the Retro script kit (Ambion, Austin, TX). Real-Time PCR analysis was performed on an iCycler MyiQ

Single Color Real-Time PCR detection system (Bio-Rad, CA, USA). The sequences of

106

the genes of interest were taken from the GeneBank: access number; B1 receptor NM-

030851, B2 receptor X69681, and prodynorphin NM-019374. Gene-specific primers for

the amplification were obtained from the Midland Certified Reagent Company. Real-

Time Polymerase Chain Reaction primers sequences for the amplification were:

B1 receptor/forward primer: 5' GCATCTTCCTGGTGGTGG 3' (nucleotides: 540~557)

B1 receptor/reverse primer: 5' CAGAGCGTAGAAGGAATGTG 3' (nucleotides:

682~701)

B2 receptor/forward primer: 5' CTTTGTCCTCAGCGTGTTC 3' (nucleotides: 364~382)

B2 receptor/reverse primer: 5' CAGCACCTCTCCGAACAG 3' (nucleotides: 506~523)

prodynorphin/forward primer: 5' GCAAATACCCCAAGAGGAG 3' (nucleotides:

670~688)

prodynorphin/reverse primer: 5' CGCAGAQAAACCACCATAGC 3'' (nucleotides:

817~835)

β-actin/forward primer: 5' CACCATGTACCCAGGCATTG 3' (nucleotides: 990~1009)

β-actin/reverse primer: 5' CCACATCTGCTGGAAGGTG 3' (nucleotides: 1131~1149)

The Real-Time PCR reactions were carried out in a total reaction volume of 20µL

containing the final concentration of: 1x SYBR Green Master Mix (Bio-Rad, Hercules,

CA), 300 nM of forward and reverse primers, and 200ng of cDNA from the RT step. All

samples from different animals were run in triplicate using an annealing temperature of

60ºC. The expression of target genes was normalized to that of β-actin. The differences of target mRNA expression between treatment and control were analyzed using the

Comparative CT Method. The threshold cycle (CT) is defined as the cycle at which the

107

fluorescence generated from a certain amount of amplified PCR product reaches a fixed

threshold. For each sample, the CT value for the control gene ( β-actin) was subtracted

from the CT value for the gene of interest (B1 receptor, B2 receptor and prodynorphin) to

obtain a CT value. The control sample CT value was then subtracted from the treated

animal CT value to obtain the CT. The relative fold change from our control was

expressed by a calculation of 2- CT for each sample. The level of expression of each target gene is converted to the copy number of that same target gene which is relative to

500,000 copies of β-actin.

2.6 Visceral pain behavioral measurements

Von Frey Filament testing is an established behavioral pain assay used to determine mechanical pain threshold in somatic pain. More recently, von Frey Filament testing has been used to measure visceral pain hypersensitivity (Laird et al., 2001; Vera-

Portocarrero et al., 2003; Winston et al., 2003). The procedures for the behavioral measurement in this model have been described previously (Vera-Portocarrero et al.,

2006).

Animals were placed in a suspended plastic chamber with a wire mesh platform and allowed to habituate to the environment for 30 to 60 min. Measurements were taken before and after DBTC injection and after administration of drug or vehicle. A 4.0 gram filament was applied from underneath, through the mesh floor, to different points of the mid-abdomen. Each trial consisted of 10 applications of the filament applied with a 10 second interval. A positive response was defined as either abdominal withdrawal from the filaments, immediate licking or scratching of the tested site, or jumping. The mean

108

occurrence of withdrawal events in each of the trials was defined as the total number of responses out of 10 applications to the abdomen.

2.7 Pancreatic histology

Animals treated with DBTC or vehicle were sacrificed using a CO2 chamber, and pancreatic tissue was collected for confirmation of pancreatitis. Fresh specimens of the rat pancreas were fixed in 4% paraformaldehyde overnight and then in 30% phosphate- buffered saline/sucrose. Tissues were then embedded in O.C.T. compound (Tissue-Tek

Optimal Cutting Temperature Compound; Sahura, Torrance, CA) and sections were cut at 10 µm with a cryostat maintained at -20 oC. Sections of pancreatic tissue were stained with hematoxyline and eosin to visualize pancreatic inflammation.

2.8 Data analysis:

The results are presented as the means and SEM. One-way ANOVA was used to assess behavioral changes followed by post hoc comparisons. All treatment groups with pancreatitis were compared to vehicle treated rats with pancreatitis. In all statistical comparisons, p < 0.05 was used as the criterion for statistical significance.

109

CHAPTER THREE

RESULTS

3.1 Pancreatic morphology analysis

On day 7 after injection of DBTC, the pancreas was harvested and the morphology changes in the pancreas were examined using H&E staining. In the DBTC- treated rats, signs of inflammation including edema formation, inflammatory cell infiltration, and acinar cell atrophy were observed in pancreatic sections (Fig.1.1A). No significant morphological changes were observed in control rats (Fig.1.1B).

3.2 Systemic B2 but not B1 receptor antagonist reverses the abdominal hypersensitivity induced by DBTC

To investigate the contribution of bradykinin receptors in the pancreas to abdominal hypersensitivity of DBTC-induced pancreatitis, receptor-selective bradykinin antagonists were injected i.p. on day 7 after DBTC injection. Behavioral signs of DBTC- induced pancreatitis pain, manifested by abdominal mechanical hypersensitivity, were well established and predominant on day 7 after DBTC injection.

On day 7 after DBTC injection, the mean frequency of abdominal withdrawal to probing with von Frey filaments in rats significantly increased (p = 4.38 x 10 -24 ) from a pre-DBTC baseline of 0.26 ± 0.09 to 8.0 ± 0.31, indicating abdominal hypersensitivity

(Fig.1.2A). Systemic administration (i.p.) of the B2 antagonist HOE 140 produced a dose dependent reversal of the abdominal mechanical hypersensitivity (p = 2.98 x 10 -8). The peak effect was produced at 15 minutes after B2 antagonist treatment. The most effective dose was 3 µmole/kg (Fig.1.2A).

110

In contrast, injection of the B1 antagonist, DALBK, at a systemic level (i.p.) did not significantly reverse the referred abdominal hypersensitivity which is indicative of

DBTC-induced pancreatic pain over the dose-range tested (p = 0.2041) (Fig. 1.2B). The distilled H 2O vehicle did not have any effects on the presence of mechanical hypersensitivity (Fig. 1.2B).

3.3 mRNA expressions of B1 and B2 receptors in pancreas after DBTC injection

Rats with DBTC and with confirmed behavioral signs of pancreatitis pain were sacrificed on day 7 after DBTC injection. Pancreatic tissue was taken from rats treated with DBTC or vehicle for quantitative RT-PCR analysis of B1-R and B2-R mRNA expression. B2-R mRNA expression in the pancreas of rats with DBTC compared with pancreatic tissue obtained from vehicle treated rats was significantly (p<0.05) increased on day 7 after DBTC, whereas B1-R expression at the same time point did not change compared to the vehicle treated group (Fig.1.3).

3.4 Spinal B2 but not B1 receptor antagonist reverses the abdominal hypersensitivity induced by BDTC

Rats with pancreatitis showed significantly increased abdominal withdrawal to mechanical stimulation (Fig.1. 4 A, B). On day 7 after intravenous DBTC injection, the pooled baseline abdominal withdrawal frequency was significantly (p = 2.39 x 10 -4) increased from 0.26 ± 0.09 to 8.0 ± 0.31, indicating the presence of abdominal hypersensitivity. Randomly assigned groups of rats then received one of several i. th. doses of HOE 140 (3-30 pmols) (Fig.1.4A) and abdominal withdrawal frequency to mechanical stimulation was measured. I.th. HOE 140 produced significant dose-

111

dependent reversal of abdominal hypersensitivity (p = 5.19 x 10 -23 ). At the highest dose tested (30pmol) withdrawal frequency decreased to 0.26 ± 0.09 (Fig.1.4 A). In contrast, the B1 antagonist DALBK did not attenuate abdominal hypersensitivity indicative of

DBTC-induced pancreatitis pain over the dose-range tested (p = 0.9689) (Fig.1. 4B).

3.5 Spinal dynorphin antiserum reverses the abdominal hypersensitivity induced by

DBTC

DBTC treated rats with pancreatitis showed significantly increased abdominal withdrawal to mechanical stimulation (Fig.1. 5). On day 7 after intravenous DBTC injection, abdominal withdrawal frequency was significantly increased from a pre-DBTC value of 0.33 ± 0.33 to 8.5± 0.43, indicating the presence of abdominal hypersensitivity.

Randomly assigned groups of rats then received either i.th. dynorphin anti-serum or control serum and abdominal withdrawal frequency to mechanical stimulation was measured. I.th. dynorphin anti-serum (200 g) produced significant reversal of abdominal hypersensitivity (p = 8.14 x 10 -4) (Fig.1.5). In contrast, control serum did not attenuate abdominal hypersensitivity indicative of DBTC-induced pancreatitis pain (Fig.1. 5).

3.6 Bradykinin B1 and B2 receptor mRNA expression in dorsal root ganglia and spinal cord after DBTC injection

Rats treated with DBTC or vehicle were sacrificed at day 7 after DBTC injection.

Dorsal root ganglia and dorsal horn spinal cord at the thoracic level were taken from rats treated with DBTC or vehicle for quantitative RT-PCR analysis of B1 receptor and B2 receptor mRNA expression (Fig. 1.6A). Expression of mRNA for the B1 and B2

112

receptors in the DRG of rats with DBTC compared with DRGs obtained form vehicle treated was significantly (p<0.05) increased.

Basal levels of both bradykinin B1 receptor and B2 receptor mRNA expression were found in the dorsal spinal cord taken from vehicle-treated animals (Fig.1.6B).

DBTC–induced pancreatitis did not induce any significant changes in mRNA expression for either the bradykinin B1 or the B2 receptor in the spinal cord at this time point

(Fig.1.6B)

113

Figure 1.1 Histological sections of pancreas stained with hematoxylin and eosin from rats injected either with vehicle (A) or DBTC (B). The pancreas from DBTC-treated rats showed signs of inflammation including edema (arrowhead), inflammatory cell infiltration (star), and acinar cell atrophy (arrow) (B). There were no significant morphological changes observed in vehicle treated rats (A).

114

A 10

6 *

4 * *

(#) Frequency Withdrawal 0 P-BL BL Vehicle0.1 0.3 1 3

HOE140 ( mol/kg )

B 10

(#) Frequency Withdrawal 0 P-BL BL Vehicle 1 10 100 DALBK ( mol/kg )

Figure 1.2 Effects HOE 140 (A) and DALBK (B) on mechanical hypersensitivity 15 min after intraperitoneal administration. The experiments were performed on day 7 after induction of pancreatitis. Increased mechanical hypersensitivity is shown in animals after treatment with intravenous DBTC. (A) Systemic administration of HOE 140 (0.1-3 µmol/kg) produced a dose-dependent reversal of DBTC induced abdominal hypersensitivity. (B) In contrast, administration of DALBK (1-100µmol/kg) did not show significant reversal of abdominal hypersensitivity. (One-way ANOVA, *p<0.05, n=5-6). Data is expressed as S.E.M. AWE, average withdrawal events; DBTC, dibutyltin dichloride, used for induction of pancreatitis.

115

Figure 1.3 RT-PCR analysis of B1-R and B2-R mRNA expression in the pancreas at day 7 after DBTC injection. In the pancreas, DBTC-induced pancreatitis induced significant increase of B2-R but not B1-R mRNA expression compared to the pancreases taken from control vehicle treated animals (Student’s t test, *p< 0.05).

116

Figure 1.4. Effects of HOE 140 (A) and DALBK (B) on mechanical hypersensitivity 15 min after intrathecal administration. The experiments were performed on day 7 after induction of pancreatitis. Increased mechanical hypersensitivity is shown in animals after treatment with intravenous DBTC. (A) Systemic administration of HOE 140 (3-30 pmol) produced a dose-dependent reversal of DBTC induced abdominal hypersensitivity. (B) In contrast, administration of DALBK (30-100nmol) did not show significant reversal of abdominal hypersensitivity. (One-way ANOVA, *p<0.05, n=5-6). Data is expressed as S.E.M. ± AWE, average withdrawal events; DBTC, dibutyltin dichloride, used for induction of pancreatitis.

117

Figure 1.5 Effects of intrathecal administration of dynorphin anti-serum on abdominal hypersensitivity on day 7 after DBTC injection. Increased abdominal hypersensitivity is shown after DBTC injection. At 15 minute after i.th dynorphin anti-serum injection, the frequency withdrawal was significant decreased. The effect lasted at least 45 minutes after injection. Injection of control serum did not have any effects on abdominal withdrawal in DBTC treated rats. (One-way ANOVA, *P<0.05, n=5-6).

118

Figure 1.6 RT-PCR analysis of B1-R and B2-R mRNA expression in the thoracic DRG (A) and spinal cord (B) on day 7 after DBTC injection. (A) In the DRG, the DBTC- treated group with pancreatitis demonstrated an increased in both B1-R and B2-R mRNA expression compared to those taken from vehicle control animals (*p<0.05). (B) In the thoracic spinal cord, there was a basal level of mRNA expression of B1-R and B2-R. DBTC-induced pancreatitis did not induce any change in the mRNA expression for both B1-R and B2-R (Student’s t test, *p<0.05)

119

CHAPTER FOUR

DISCUSSION

The present study explored the role of bradykinin receptors in visceral pain using a model of experimental pancreatitis induced by intravenous injection of dibutyltin dichloride (DBTC) in rats. During the measurement of nociceptive behavior, rats with

DBTC-induced pancreatitis displayed an increased number of abdominal withdrawal events to von Frey filament stimulation, indicating the presence of abdominal hypersensitivity. Our findings here demonstrated that intraperitoneal administration of

HOE 140, a B2 antagonist, produced a dose-dependent reversal of abdominal hypersensitivity in rats with pancreatitis on day 7 post DBTC; the B1 receptor antagonist

Des-Arg9-Leu8-bradykinin had no effect. These findings suggest that activation of the

B2 receptor is another possible mechanism responsible for the pain behaviors seen in animals with pancreatitis. This hypothesis is further supported by the results obtained in our RT-PCR analysis study in which the bradykinin receptor B2, but not B1 receptor, is upregulated in the pancreas following DBTC injection. The effect of the B2 antagonist may be therefore due to blockade of B2 receptors present in the pancreas.

The peripheral mechanism of increased pain due to noxious (hyperalgesia) and innocuous (allodynia) stimulation during persistent inflammatory conditions can be explained by sensitization of primary afferent neurons supplying the tissue. Bradykinin generated during the inflammatory process and tissue injury, by activation of B2 receptors, is a most potent algogenic inflammatory mediator and regulator of peripheral nociceptors (Juan and Lembeck, 1974; Regoli and Barabe, 1980). Bradykinin is

120

responsible for activation and sensitization of primary afferent neurons (Kumazawa and

Mizumura, 1980; Kanaka et al., 1985; Neugebauer et al., 1989; Lang et al., 1990;

Kumazawa et al., 1991; Manning et al., 1991; Koltzenburg et al., 1992). Moreover, bradykinin sensitizes nociceptors to mechanical (Neugebauer et al., 1989). 1989) and heat

(Lang et al., 1990; Kumazawa et al., 1991; Koltzenburg et al., 1992) stimulation through interaction with most inflammatory mediators, such as prostaglandins, nitric oxide and neuropeptides such as CGRP (Dray and Perkins, 1993). Overall, previous work has established a good correlation between the inflammatory sensitization of nociceptors and

BK. Furthermore, the use of selective B2 receptor antagonists in pain behavioral studies further supports the critical role played by bradykinin in nociception, especially in inflammatory pain. A number of previous investigations demonstrated that pharmacological blockade of B2 receptors with selective antagonists alleviated hyperalgesia in acute and chronic inflammatory models (Perkins et al., 1993; Asano et al., 1997; Rupniak et al., 1997; Griesbacher et al., 1998; Burgess et al., 2000; Calixto et al., 2000).

There are many possible explanations how bradykinin contributes to a nociceptive state in pancreatitis. Previous studies suggest that the pancreas is one of the organs with the highest expression of tissue kallikrein (Chao and Chao, 1995), which liberates bradykinin from its precursor kininogen. Consequently, the role of the kinin-kallikrein system in acute pancreatitis has been extensively investigated since early 1960s (Ryan et al., 1964). It has been demonstrated that kallikrein-like activities and kininogen levels in the pancreatic tissue are significant increased during acute pancreatitis (Griesbacher et

121

al., 2003). Clinical evidence suggests that activation of the kallikrein-kinin system contributes to some symptoms of acute pancreatitis (Ruud et al., 1985), since serum bradykinin and kallikrein levels in ascites are increased during the course of the disease

(Satake et al., 1973a; Satake et al., 1973b). Furthermore, it has been shown that blockade of B2 receptors using a B2 receptor antagonist reduces the severity of experimental pancreatitis (Griesbacher and Lembeck, 1992; Griesbacher et al., 1993; Kanbe et al.,

1996; Bloechle et al., 1998). This evidence also emphasizes the important role that bradykinin, acting though the B2 receptor, plays in the maintenance of pancreatic inflammation. Application of bradykinin directly to the surface of the pancreas in rats has been shown to activate nociceptive afferent neurons via B2 receptors (Holzer-Petsche,

1992). Further studies will be needed to show whether the endogenous release of kinins is sufficient to account for the severe abdominal pain observed in pancreatitis. Together with the evidence in the present study, these data establish a link between the role of bradykinin and the pancreatic B2 receptor in the neurogenic inflammation and pain of pancreatitis. Provided that kinins are confirmed as a major cause of the activation of nociceptors in pancreatitis, B2 receptor antagonists can be expected to be effective in reducing not only edema but also pain in pancreatitis. Our demonstration of increased expression of B2 receptors and the behavioral consequences of application of the B2 antagonist provide additional evidence that the activation of the B2 receptors by bradykinin released during inflammation plays a role in the generation of increased nociceptive behaviors.

122

In the present study, intrathecal injection at the thoracic spinal level of HOE 140 also elicited a dose-related inhibition of pancreatitis pain while the B1 antagonist had no effect. DBTC-induced pancreatitis induced an increased level of both B1 and B2 receptors in the thoracic DRG but no changes in bradykinin receptor expression in the spinal cord. This data demonstrates that activation of B2 receptors at the spinal level also contributes to pain behavior in animals with pancreatitis. The role of bradykinin receptors in activating and sensitizing nociceptors in the periphery is well known. Recently, our studies have suggested that the pronociceptive actions of spinal dynorphin in the central nervous system are the result of a novel interaction with bradykinin receptors (Lai et al.,

2006). Dynorphin induced calcium influx via voltage-sensitive calcium channels in sensory neurons by activating bradykinin receptors. Radioligand binding studies also show the direct interaction of dynorphin A with bradykinin receptors; blockade of bradykinin receptors reversed nerve injury-induced tactile and thermal hyperalgesia only at times at which spinal levels of dynorphin were elevated (Lai et al., 2006). This evidence indicates that spinal dynorphin produces pronociceptive effects through the bradykinin receptor. Previous work from our lab showed that DBTC produced referred abdominal mechanical hypersensitivity which correlated with significant up-regulation of dynorphin in the thoracic spinal cord (Vera-Portocarrero et al., 2006). Our result here that dynorphin anti-serum produced a significant reversal of abdominal hypersensitivity in the

DBTC-induced pancreatitis model is in agreement with the previous findings from our lab (Vera-Portocarrero et al., 2006). These findings provide strong evidence for the pronociceptive effect of spinal dynorphin in DBTC-induced pancreatitis. It is noteworthy

123

that treatment with both a B2 antagonist and dynorphin anti-serum via spinal administration showed a significant antihypersensitivity effect. Therefore, together with the evidence in the present study, we propose that increased dynorphin in DBTC-induced pancreatitis may produce a pronociceptive effect through the B2 receptor in the spinal cord.

In conclusion, our findings suggest that both systemic and spinal administration of the bradykinin B2 receptor antagonist HOE140 is effective in attenuating pain behavior arising from pancreatic inflammation. Systemic effects of HOE140 could occur at peripheral sites and may due to blocking the interaction of bradykinin with the B2 receptor in the pancreas. The bradykinin B2 receptors in the pancreas have a role in the genesis of pancreatic pain as demonstrated by their increased expression on the same days we observed increased pain behaviors. Additionally, this blockade of pain hypersensitivity corresponded with a significant up-regulation of dynorphin in the thoracic spinal cord suggesting a block of the pronociceptive action of dynorphin mediated through spinal bradykinin receptors. Therefore, selective B2 antagonists which can penetrate the CNS may therefore have therapeutic potential against pancreatitis pain through both peripheral and central sites.

124

PART THREE

DYNORPHIN MAINTAINS CFA-INDUCED INFLAMMATORY PAIN VIA BRADYKININ RECEPTORS

125

ABSTRACT

Dynorphin A, an endogenous opioid, is upregulated in the spinal cord in several experimental models of abnormal pain. Our recent in vitro studies implicated a direct interaction of dynorphin, and its des-Tyrosyl fragments, with bradykinin receptors.

Recent findings indicated that the interaction of dynorphin with bradykinin receptors mediates the pronociceptive actions of this peptide in nerve injury-induced pain and

DBTC-induced pancreatitis pain in vivo. Here we examined a model of inflammatory pain by unilateral injection of Complete Freud’s Adjuvant (CFA) into the rat hind paw.

Inflamed rats exhibited tactile hypersensitivity and thermal hyperalgesia in the inflamed paw by 6 hr after CFA injection. A significant elevation of prodynorphin but not kininogen transcripts in the lumbar spinal cord was seen at 72 hours. Tactile hypersensitivity and thermal hyperalgesia at 72 hours was reversed by intrathecal administration of anti-dynorphin antiserum or by bradykinin receptor antagonists. In contrast, the tactile hypersensitivity and thermal hyperalgesia seen at 6 hr after CFA injection was not associated with a change in expression of spinal dynorphin, and was not blocked by anti-dynorphin antiserum or bradykinin antagonists. These data suggest that elevated spinal dynorphin upon peripheral inflammation promotes CFA-induced inflammatory pain. The antitactile and antithermal hypersensitivity effects of bradykinin receptor antagonists require the presence of upregulated spinal dynorphin but not of de novo production of bradykinin supporting the notion that pathological levels of dynorphin may act to activate spinal bradykinin receptors to promote CFA-induced inflammatory pain.

126

CHAPTER ONE

INTRODUCTION

Dynorphins, endogenous opioid neuropeptides derived from the prodynorphin gene, are involved in a variety of physiologic functions including antinociception and neuroendocrine signaling via their opioid receptors. [for review, see (Smith and Lee,

1988)]. However, under experimental or pathological conditions in which dynorphin levels are substantially elevated, these peptides are pronocieptive largely through actions at non-opioid receptors. Many experimental models of pathological pain, including inflammatory pain (Ruda et al., 1988; Noguchi et al., 1991), neuropathic pain (Kajander et al., 1990; Malan et al., 2000), sustained opioid induced pain (Vanderah et al., 2004), bone cancer pain (Peters et al., 2004), DBTC-induced pancreatitis pain (Vera-

Portocarrero et al., 2006), and spinal cord trauma (Faden et al., 1985; Tachibana et al.,

1998; Abraham et al., 2001) show a significant regional elevation of dynorphin A in the spinal cord. Elevated levels of dynorphin appear critical for the maintenances of pain under these conditions; approaches that inhibit dynorphin actions act to normalize the enhanced sensory responses including pain. Spinal administration of dynorphin A antiserum reduces neurological impairment after nerve injury (Faden, 1990), blocks the increased sensitivity to noxious thermal and innocuous tactile stimuli, but does not alter normal sensory thresholds in non-injured rats (Wagner and Deleo, 1996; Malan et al.,

2000) and attenuates trauma induced changes in the spinal cord (Winkler et al., 2002).

Transgenic mice that carry a null mutation in the prodynorphin gene develop, but not sustain, nerve injury induced pain (Wang et al., 2001). These findings support the

127

hypothesis that the upregulation of spinal dynorphin is pronociceptive and important in the maintenance of experimental neuropathic pain.

The underlying mechanisms for the non-opioid actions of elevated spinal dynorphin are likely complex. Recent findings suggest that the pronociceptive action of spinal dynorphin may mediated through bradykinin receptors (Lai et al., 2006).The in vitro studies have shown that non-opioid des-tyrosyl-dynorphin fragment, dynorphin

A(2-13), is capable of binding specifically to bradykinin receptors and stimulates an increase in intracellular calcium in secondary sensory neurons, F-11 (Lai et al., 2006).

This excitatory mechanism of dynorphin was further examined in vivo in a neuropathic pain animal model and DBTC-induced pancreatitis pain model. Nerve injury-induced pain and DBTC-induced abdominal hypersensitivity were blocked by intrathecal administration of dynorphin antiserum or bradykinin antagonists. These effects are associated with a time-related increase in spinal prodynorphin transcript or dynorphin level and an upregulation of bradykinin receptors in the dorsal root ganglia (DRGs) after nerve injury or DBTC-injection. However, the precursor of the endogenous bradykinin receptor ligand, kininogen, is undetectable in the spinal cord as well as in the DRG.

These findings demonstrated that the pronociceptive action of spinal dynorphin under certain pathological circumstances is mediated by bradykinin receptors to maintain chronic pain. Here, our objective is to determine whether upregulation of spinal dynorphin upon a peripheral inflammatory acts to promote inflammatory pain using a

CFA model, and if so, whether bradykinin receptors mediate the CFA-induced inflammatory pain by elevated spinal dynorphin.

128

CHAPTER TWO

MATERIALS AND METHODS

2.1 Animals

Male Sprague-Dawley rats (225-300g) were used. All procedures were approved

by the Institutional Animal Care and Use Committee and followed guidelines of the

International Association for the Study of Pain and the National Institutes of Health.

2.2 Intrathecal catherization and drug administration

For experiments with intrathecal injection, rats were implanted with intrathecal

catheters (polyethylene-10 tubing 7.5 cm long) as described previously (Yaksh and Rudy,

1976) and allowed 5 days to recover from surgery prior to further experiment. Animals

that showed signs of motor dysfunction or behavioral abnormality were euthanized. To

induce inflammation, rats received an intraplantar injection of 100 l complete Freund’s adjuvant (CFA, Sigma, St. Louis, MO) into the plantar surface of the left hind paw under brief isoflurane anesthesia. Baseline tactile response threshold and thermal response latency was determined prior to CFA injection and 72 h post-CFA injection before drug administration. Control serum (5 ml, Calbiochem, San Diego, CA), dynorphin antiserum

(200 mg in 5ml saline, Peninsula Laboratories Inc., San Carlos, CA), vehicle (Saline, 5 ml), DALBK (50 nmol in 5 ml saline, Bachem Inc., Torrance, CA), or HOE140 (10 pmol in 5 ml saline, American Peptide Company, Inc., Sunnyvale, CA) was delivered to the lumbar region of the spinal cord via intrathecal catheters followed by a 9 ml saline flush

72 h after CFA injection. Nociceptive testing was then carried out on the left hind paw as described below.

129

2.3 Behavioral Testing

Nociceptive testing – tactile hypersensitivity. Rats were placed in a suspended plastic chamber with a wire mesh platform and allowed to habituate for 15 minutes.

Tactile hypersensitivity was determined by measuring paw withdrawal threshold in response to probing the plantar surface of the left hind paw with a series of eight calibrated von Frey filaments (0.40, 0.70, 1.20, 2.00, 3.63, 5.50, 8.50, and 15.0g). Paw withdrawal threshold was determined by sequentially increasing and decreasing stimulus intensity ("up and down" method) and analyzed using a Dixon non-parametric test

(Chaplan et al., 1994).

Nociceptive testing – thermal hypersensitivity. Rats were placed in clear plastic chambers on a glass surface and were habituated for 15 minutes prior to testing. Thermal hypersensitivity was measured using paw withdrawal latency to a radiant heat stimulus according to the procedure as previously described (Hargreaves et al., 1988). A radiant heat source was activated with a timer and focused onto the plantar surface of the left hind paw of rats. Paw withdrawal exposed a photocell that halted both lamp and time. A maximum cutoff latency of 33 s was employed to prevent tissue damage. For statistical analysis, significance differences among paw withdrawal thresholds, and among paw withdrawal latencies at each time point were determined by ANOVA followed by the post hoc least significant difference test. Significance was set at p < 0.05.

2.4 Quantitative RT-PCR.

Total RNA was isolated from lumbar dorsal spinal cord of the rat using Aurumä total RNA mini kit (Bio-Rad, Hercules, CA). Quantitative RT-PCR was performed using

130

the iCycler iQ Multicolor Real-Time PCR Detection System with iScript cDNA

Synthesis Kit and iQ SYBR Green Supermix (Bio-Rad, Hercules, CA). Samples were run

in triplicate using an annealing temperature of 60 °C. Primers for the amplification were:

prodynorphin (PDYN) / forward: 5’-GCAAATACCCCAAGAGGAG -3’ (nuc. 512 ~

530); PDYN / reverse: 5’-CGCAGAAAACCACCATAGC -3’ (nuc. 659 ~ 677); kininogen / forward: 5’- CATGAGACCTTGGGAGAAC -3’ (nuc. 1068 ~ 1086); kininogen / reverse: 5’- GCACCCTGGCAATGTAGG -3’ (nuc. 1214 ~ 1231); B1 / forward: 5’- GCATCTTCCTGGTGGTGG -3’ (nuc. 401 ~ 418); B1 / reverse: 5’-

CAGAGCGTAGAAGGAATGTG -3’ (nuc. 543 ~562); B2 / forward: 5’-

CTTTGTCCTCAGCGTGTTC -3’ (nuc. 242 ~ 260); B2 / reverse: 5’-

CAGCACCTCTCCGAACAG -3’ (nuc. 385 ~ 402); GAPDH / forward: 5’-

ATCATCCCTGCATCCACTG -3’ (nuc. 610 ~ 628); GAPDH / reverse: 5’-

GCCTGCTTCACCACCTTC -3’ (nuc. 771 ~ 788). PCR efficiency for these gene targets was between 97 % and 100 %. The expression level of each target gene in rat lumbar spinal cord was normalized to the expression of GAPDH. The differences of target gene expression between treatments were analyzed using the Comparative CT Method (ABI

Prism 7700 Sequence Detection System User Bulletin #2, p11–15, 2001). The threshold cycle (CT) is defined as the cycle at which the amount of amplified PCR product from the target cDNA reaches a fixed threshold. In each treatment, DCT = CT for gene target –

CT for the endogenous reference, GAPDH. DDCT = DCT, treatment – DCT, control.

The equation, 2-DDCT, denotes the level of target transcripts in the treated group relative to that of the control group. The expression level of each target gene is converted to the

131

copy number of the target relative to 500,000 copies of GAPDH where the amount has been generated after 35 cycles of PCR amplification. Data are mean ± S.E.M. of three independent tissue samples. Unpaired t-test was used for between group comparisons.

132

CHAPTER THREE

RESULTS

3.1 Intraplantar CFA induces tactile and thermal hypersensitivities in rats

Unilateral intraplantar administration of complete Freund’s adjuvant (CFA, 100

µl) into the left hind paw of the rats induced significant hypersensitivities to touch (tactile allodynia) and to noxious heat (thermal hyperalgesia) in the inflamed hind paw throughout three days duration we investigated when compared with vehicle (saline) control group (Fig. 1.1 A, B). The baseline paw withdrawal threshold among groups to probing with von Frey filaments before injections was 15.00 ± 0.00 g (n = 18). Tactile hypersensitivities were indicated by a significant reduction in the paw withdrawal threshold to 8.80 ± 1.79 g (p = 0.0052) at 6 hour, 6.84 ± 1.06 g (p < 0.0001) at 24 hour,

5.32 ± 0.83 g (p < 0.0001) at 48 hour and 5.02 ± 0.65 g (p < 0.0001) at 72 h post-CFA, when compared with the saline control group (14.66 ± 0.34 g, 14.33 ± 0.44 g, 14.66 ±

0.34 g, 14.14 ± 0.59 g, respectively to each time point). The average baseline paw withdrawal latency to noxious radiant heat among groups before injections was 21.53 ±

1.45 s (n = 18). Thermal hypersensitivities were indicated by a significant reduction in the paw withdrawal latency to 6.77 ± 0.40 s (p < 0.0001), 6.02 ± 0.61 s (p < 0.0001), 9.24

± 1.09 s (p < 0.0001) and 10.37 ± 0.92 s (p < 0.0001) at 6 h, 24 h, 48 h, and 72 h post-

CFA, respectively, when compared with saline control (21.12 ± 0.79 s, 21.28 ± 0.73 s,

20.74 ± 0.80 s, 20.72 ± 0.74 s, respectively).

3.2 Intrathecal dynorphin antiserum reverses CFA-induced tactile and thermal hypersensitivities 72 h, but not 6 h, post-CFA

133

We then chose 6 h- and 72 h-post-CFA as representative time points for all experiments to investigate the early phase vs. late phase of CFA-induced inflammatory pain. To investigate the role of spinal dynorphin in inflammatory pain, dynorphin antiserum (200 µg) was injected intrathecally into the inflamed rats. Intrathecal administration of dynorphin antiserum significantly reversed both CFA-induced tactile and thermal hypersensitivities 72 h, but not 6 h, post-CFA administration (Fig.1. 2A, B).

Before intraplantar CFA injections, the baseline paw withdrawal threshold was 15.00 ±

0.00 g (n = 24) and the baseline paw withdrawal latency was 20.93 ± 0.56 s (n = 24).

After CFA injections, paw withdrawal thresholds dropped to 3.14 ± 0.33 g (p < 0.0001) at 6 h and 2.34 ± 0.30 g (p < 0.0001) at 72 h-post CFA, respectively, and tactile allodynia was produced in these inflamed rats. Thermal hypersensitivity developed at these two time points with paw withdrawal latencies decreasing to 7.38 ± 0.81 s (p < 0.0001) at 6 h and 11.51 ± 0.60 s (p < 0.0001) at 72 h post-CFA, respectively. Interestingly, intrathecal dynorphin antiserum significantly reversed both CFA-induced tactile and thermal hypersensitivities 72 h, but not 6 h, post-CFA administration. At 72 h post-CFA, paw withdrawal threshold for tactile hypersensitivity in dynorphin antiserum treated group was increased to 3.86 ± 0.66 g while CFA-induced tactile allodynia was reversed (p =

0.0274, compared to 72 h post-CFA baseline: 2.34 ± 0.30 g). In addition, paw withdrawal latency for thermal hypersensitivity at this time point in the dynorphin antiserum treated group rose to 16.98 ± 0.94 s as thermal hyperalgesia was also reversed (p = 0.0002, compared to 72 h post-CFA baseline: 11.51 ± 0.60 s). Notably, control serum treated

134

groups did not alter CFA-induced tactile or thermal hypersensitivities at either time points.

3.3 Intrathecal bradykinin antagonists reverse CFA-induced tactile and thermal hypersensitivities at 72 h, but not 6 h, post-CFA

Our data have shown that intrathecal dynorphin antiserum inhibits the late phase of CFA-induced inflammatory pain, represented by 72 h post-CFA. This suggests that spinal dynorphin plays a role in maintaining inflammatory pain. Our recent in vitro finding has explored the excitatory action of dynorphin direct interacting with bradykinin receptors (Lai et al., 2006). Furthermore, in our in vivo study the neuropathic pain animal model supports the evidence of the pronociceptive effect of dynorphin via bradykinin receptors to maintain neuropathic pain. Whether spinal dynorphin mediated neuropathic pain versus inflammatory pain is underling the same mechanism, we then examined bradykinin receptor antagonists on CFA-induced inflammatory pain.

Intrathecal administration of the bradykinin B1 receptor antagonist, DALBK (50 nmol) (Fig.1.4A), or the B2 receptor antagonist, HOE140 (10 pmol) (Fig. 1.3A), significantly reversed CFA-induced thermal hyperalgesia when given at the 72 hr time point. The same treatment at the 6 hr time point however had no effect on the thermal hyperalgesia. The baseline paw withdrawal latency prior to CFA was 21 ± 0.37 s

(Baseline, n = 36). Six hr after CFA, the paw withdrawal latency was 7.6 ± 0.81 s (CFA baseline, n = 18) (P < 0.0001 c.f. Baseline) and at 72 hr post CFA was 9.4 ± 0.46 s (CFA baseline, n = 18)(P < 0.0001 c.f. Baseline). Neither DALBK (Fig. 1.4A) nor HOE 140

(Fig. 1.3A) treatment at the 6 hr time point altered the thermal hyperalgesia seen after

135

CFA. At 72 hr, intrathecal DALBK reversed the thermal hyperalgesia to 16 ± 2.15 s, (P =

0.0231 c.f. CFA baseline at 72 hr) (Fig. 1.4A), while HOE 140 reversed the thermal hyperalgesia to 15 ± 1.27 s (P = 0.0024 c.f. CFA baseline at 72 hr) (Fig. 1.3A). Saline injection had no effect at either 6 hr or 72 hr after CFA.

Baseline paw withdrawal threshold to von Frey probing was 15 ± 0.24 g (n =

36, Baseline). Tactile hypersensitivity was seen 6 hr (3.5 ± 0.27 g (n = 18), P < 0.0001 c.f.

Baseline), and 72 hr (3.7 ± 0.19 g (n = 18), P < 0.0001 c.f. Baseline) post-CFA

(Fig.1.3.4B). Neither DALBK(Fig 1.4B) nor HOE 140(Fig.1.3B) given at the 6 hr time point altered the tactile hypersensitivity due to CFA. At 72 hr, both intrathecal DALBK

(Fig.1.4 B)and HOE 140 (Fig 1.3B)had a slight effect on the tactile hypersensitivity (4.92

± 0.60 g and 5.5 ± 0.32 g, respectively) that was significantly different (P = 0.0377 and P

= 0.0006, respectively, c.f. CFA baseline at 72 hr). Saline treatment did not alter CFA- induced tactile hypersensitivity at either time point post CFA.

3.4 Upregulation of spinal prodynorphin occurs 72 h, but not 6 h after intraplantar

CFA

To further differatiate the role of dynorphin from kininogen (the precursor of endogenous ligand for bradykinin receptors) interacting with bradykinin receptors for maintaining inflammatory pain, we quantified spinal prodynorphin (PDYN), kininogen and bradykinin B1 and B2 receptor transcripts in the inflamed rats by quantitative RT-

PCR. The result shown intraplantar CFA significantly upregulated prodynorphin (PDYN) synthesis in the lumbar spinal cord at 72 h, but not 6 h, post-CFA (p = 0.0042 compared to 72 h post-saline) (Fig. 1.5A). Notably, there was no detectable message of kininogen

136

mRNA in the lumbar spinal cord of the inflamed rats at the either time point (Fig.1. 5A).

Both bradykinin B1 and B2 receptors were expressed in the lumbar spinal cord at 6h and

72 h post-CFA administration (Fig.1. 5B). However, there were no significant changes in

B1 and B2 expression level when compared to vehicle (saline) control group at these time points.

137

Figure 1.1. Tactile (A) and thermal (B) hypersensitivities are produced after an intraplantar injection of complete Freund’s adjuvant (CFA) into the rat’s left paw. In (A) and (B), paw withdrawal thresholds or latencies were measured prior to CFA injection as well as 6 h, 24 h, 48 h and 72 h post CFA administration. Data are mean ± S.E.M. from nine rats per group. *P < 0.05.

138

Figure 1.2. Inhibitory effect of intrathecal dynorphin antiserum on CFA-induced tactile (A) and thermal (B) hypersensitivities in the inflamed rats. In (A) and (B), the baseline thresholds or latencies were obtained prior to CFA administration and the CFA baselines were obtained at 6 h or 72 h post CFA injection prior to intrathecal dynorphin antiserum administration. Both baselines represent pooled data from all treatment groups. Data are mean ± S.E.M. from six rats per group. *P < 0.05.

139

Figure 1.3. Inhibitory effect of intrathecal bradykinin receptor antagonist HOE140 on CFA-induced tactile (A) and thermal (B) hypersensitivities in the inflamed rats. In (A) and (B), the baselines were obtained prior to CFA administration and the CFA baselines were obtained at 6 h or 72 h post CFA injection prior to intrathecal antagonist administration. Both baselines represent pooled data from all treatment groups. Data are mean ± S.E.M. from six rats per group. *P < 0.05.

140

Figure1. 4. Inhibitory effect of intrathecal bradykinin receptor antagonist DALBK on CFA-induced tactile (A) and thermal (B) hypersensitivities in the inflamed rats. In (A) and (B), the baselines were obtained prior to CFA administration, and the CFA baselines were obtained at 6 h or 72 h post CFA injection prior to intrathecal antagonist administration. Both baselines represent pooled data from all treatment groups. Data are mean ± S.E.M. from six rats per group. *P < 0.05.

141

Figure 1.5. Quantitative RT-PCR of spinal prodynorphin, kininogen (A), and bradykinin B1 and B2 receptor (B) transcripts in the inflamed rats. In (A) and (B), lumbar spinal cord samples were obtained from 6 h and 72 h post saline or CFA treatment. Data are mean ± S.E.M. from six rats per group.

142

CHAPTER FOUR

DISCUSSION

Intraplantar CFA produced pain hypersensitivity (including allodynia and hyperalgesia) in the inflamed rat hind paw throughout the entire study period from 6 h to

72 h post-CFA. Our results suggest that spinal dynorphin mediates the late phase (72 h post-CFA), but not the early phase (6 h post-CFA) of CFA-induced inflammatory pain via bradykinin receptors. These results demonstrate 1) intrathecal dynorphin antiserum reverse CFA-induced pain hypersensitivities at 72 h after CFA injection; 2) intrathecal bradykinin B1 or B2 receptor antagonists reverse inflammatory pain at 72 h, but not 6 h post CFA-injection; 3) spinal prodynorphin was significantly upregulated 72 h, but not 6 h after intraplantar CFA; 4) spinal kininogen was undetectable at both 6 h and 72 h after

CFA administration.

The present study showed an increased prodynorphin in the spinal cord at 72 hour after CFA injection, which is consistent with what have been reported in the literature.

Detection of upregulation of spinal prodynorphin after peripheral inflammation has been observed at 12 h (Lee et al., 2004) and 24 h (Ji et al., 2002) after CFA injection and an increase in the number of prodynorphin peptide immunoreactive neurons is also found in the superficial and deep dorsal horn 48 h after the CFA-induced inflammation (Ji et al.,

2002). Peripheral inflammation induced a significant upregulation of prodynorphin mRNA and resultant dynorphin production in the spinal dorsal horn (Iadarola et al., 1988;

Ruda et al., 1988; Weihe et al., 1989) at 72 h post-CFA (Honore et al., 2000; Zhang et al.,

2003). Dynorphin plays an important role in the modulation of nociceptive events at the

143

spinal level (Wang et al., 2001; Dubner et al., 1992). It has been demonstrated that spinal dynorphin is pronociceptive and its up-regulation is required for the maintenance of persistent neuropathic pain (Wang et al., 2001; Dubner et al., 1992). Intrathecal administration of dynorphin A antiserum acutely blocked peripheral nerve injury induced pain (Wegert et al., 1997), sustained opioid induced paradoxical pain (Vanderah et al.,

2000) and DBTC-induced pancreatitis pain (Vera-Portocarrero et al., 2006), suggesting that the elevated level of spinal dynorphin in these models is necessary for maintaining chronic pain states. The pronociceptive role of dynorphin in these chronic pain states is further supported by the observation that transgenic mice with a null mutation in the prodynorphin gene did not exhibit persistent neuropathic pain after nerve injury (Wang et al., 2001). These studies provide strong evidence that dynorphin plays a non-opioid, pronociceptive role under certain pathological circumstances. It was proposed that functional plasticity in the spinal cord might play a significant role in the pathophysiology of inflammatory pain and an imbalance of descending controls could exacerbate the consequences of the central changes induced by inflammatory processes, and thus, result in increased and persistent pain (Danziger et al., 2001). Peripheral inflammation results in the transcriptional activation of many genes in dorsal horn neurons among which prodynorphin and the substance P receptor neurokinin-1 (NK-1) have been intensively studied (Iadarola et al., 1988; Ruda et al., 1988; Schafer et al., 1993;

McCarson and Krause, 1994; Abbadie et al., 1996). Increased prodynorphin expression after inflammation has been suggested to be involved in the inflammation-induced enhanced excitability and subsequent development of expanded dorsal horn neuronal

144

receptive fields (Hylden et al., 1991; Dubner and Ruda, 1992). Peripheral inflammation induced hyperalgesia accompanies a significant upregulation of prodynorphin mRNA and resultant dynorphin production in the spinal dorsal horn (Iadarola et al., 1988; Ruda et al.,

1988; Weihe et al., 1989) at 72 h post-CFA (Honore et al., 2000; Zhang et al., 2003). The rat strain showing greater hind paw hyperalgesia during CFA-induced inflammatory pain state was accompanied the higher spinal prodynorphin expression (Zhang et al., 2003).

Furthermore, aging rats (18-month-old) exhibited greater hyperalgesia than young adults

(3-month-old) post-CFA with a greater upregulation of dynorphin in aging than that in young adult rats (Zhang et al., 2004). These studies suggest spinal dynorphin induced by persistent inflammation may account for the behavioral hyperalgesia in inflammatory pain (Zhang et al., 2004). Our data show that there is a differential effect of the anti- dynorphin antiserum, which is anti-hyperalgesic at a later time (72 hr) when spinal dynorphin is upregulated, but has no effect at an early time (6 hr) when rats exhibit hyperalgesia with no sign of upregulation of spinal dynorphin. These findings suggest that the rapid onset of inflammatory hyperalgesia is independent of the basal level of spinal dynorphin, but the persistent hyperalgesic state is likely maintained by the elevated spinal dynorphin.

Our data show that the antihyperalgesic effect bradykinin antagonists, like the anti-dynorphin antiserum, also occurred at the 72 hr time point but not at the 6 hr time point. While bradykinin is well established as a peripheral inflammatory mediator, its action as a neurotransmitter / neuromodulator in the central nervous system is controversial. Although it has been reported most recently that bradykinin also plays a

145

role in central sensitization (Woolf, 1983) by enhancing synaptic transmission in dorsal

horn neurons in the spinal cord (Wang et al., 2005), we found no evidencefor de novo sythesis of kininogen production in the spinal cord after CFA injection, or after spinal nerve ligation described previously (Lai et al., 2006). Although all the components of the kallikerin-kinin system exist within the spinal cord, the site of kinin production has yet to be identified. To date, there is no supporting evidence for the localization of kininogen or bradykinin in presynaptic terminals.

In the absence of bradykinin in the spinal cord, the antihyperalgesic effect of intrathecal bradykinin receptor antagonists at 72 hr is not due to a blockade of bradykinin at its receptors. Recent findings explore a direct excitatory action of dynorphin A at bradykinin receptors (Lai at al., 2006). Dynorphin A (2-13), a non-opioid des-tyrosyl- dynorphin fragment, binds specifically to bradykinin receptors and stimulates an increase in intracellular calcium in secondary sensory neurons, F-11 (Lai at al., 2006). This excitatory mechanism of dynorphin was examined in vivo in a neuropathic pain animal model and DBTC-induced pancreatitis model previously in this dissertation. Spinal administrations of bradykinin receptor antagonists reverse behavioral signs of neuropathic pain induced by nerve injury and abdominal hypersensitivity induced by

DBTC. These phenomena are associated with a time-related increase in spinal prodynorphin transcript or dynorphin level and an upregulation of bradykinin receptors in the dorsal root ganglia (DRGs) after nerve injury or DBTC injection. However, the precursor of the endogenous bradykinin receptor ligand, kininogen, is undetectable in the spinal cord as well as in the DRG (Lai et al., 2006). These findings implicate dynorphin

146

acts at bradykinin receptors to produce persistent pain in vivo under these pathological circumstances (Lai et al., 2006). The temporal correlation between the antihyperalgesic effect of anti-dynorphin antiserum and that of bradykinin antagonists 72 hr, and the fact that the antagonists are only anti-hyperalgesic when spinal dynorphin is elevated support our hypothesis that elevated levels of spinal dynorphin may activate spinal bradykinin receptors to maintain inflammatory pain. The findings here further substantiate a likely pathophysiological role of spinal bradykinin receptors in the pronociceptive actions of spinal dynorphin.

In summary, the present findings in the CFA model suggest that upregulated spinal dynorphin induced by peripheral inflammation is pronociceptive and plays a significant role in maintaining CFA-induced inflammatory pain. The underlying mechanism for this pronociceptive action of spinal dynorphin is likely mediated by its activation of spinal bradykinin receptors that occurs only when the level of dynorphin is highly elevated.

147

CONCLUSIONS

In this dissertation we present data support our hypothesis that the pronociceptive actions of spinal dynorphin are mediated by interaction with bradykinin receptors in pathological pain states. Specifically, we tested our hypothesis using three experimental models of pathological pain, including neuropathic pain, inflammatory pain and pancreatitis pain, in which dynorphin levels are substantially elevated.

We showed that pharmacological dynorphin, unlike bradykinin, produced sustained behavioral signs of hyperalgesia, which was reversed by bradyninin B1 and especially B2 receptor antagonists. The pronociceptive effects of exogenous dynorphin were observed in the wild type mice but not the bradykinin B2 receptor knockout mice, indicating that bradykinin receptors in the spinal cord may mediate the pronociceptive action of spinal dynorphin.

The maintenance, but not initiation, of experimental neuropathic pain depends upon pronociceptive effects of elevated levels of spinal dynorphin (Wang et al., 2001).

Spinal administration and infusion of bradykinin antagonists induced the reversal of behavioral signs of tactile hyperesthesia and thermal hyperalgesia induced by nerve injury only in the maintenance phase but not initiation phase after SNL, which is consistent with the time-course of the upregulation of spinal dynorphin content (Malan et al., 2000; Burgess et al., 2002; Gardell et al., 2003). Consistent with the lack of sustained activity of spinally administered pharmacological bradykinin, we failed to detect mRNA for kininogen under basal conditions or after nerve injury. In addition, the absence of pronociceptive activity of spinal bradykinin or of antihyperalgesic effect of spinal

148

antiserum to bradykinin suggest that spinal bradykinin does not act as the endogenous ligand at these receptors to promote nociception. Along with the recent finding that dynorphin directly binds to bradykinin receptor to induce the increase of intracellular calcium concentration in vitro (Lai et al., 2006), the observations that bradykinin antagonists or antiserum to dynorphin exhibit antihyperalgesic effects only when spinal dynorphin is upregulated strongly suggesting that upregulation of spinal dynorphin, and not of bradykinin, activate bradykinin receptors to maintain the enhanced abnormal pain induced by peripheral nerve injury.

Recent study showed that persist inflammation in the pancreas produces significant increase of spinal dynorphin, which correlated with persistent abdominal pain in rats (Vera-Portocarrero et al., 2006). Our data in PART ONE revealed a novel mechanism for the endogenous dynrophin to promote pain through bradykinin receptors in the spinal cord. This novel mechanism of pronociceptive action of spinal dynorphin was further tested in PART TWO using a DBTC-induced persistent pancreatitis pain model. It is noteworthy that treatment with both a B2 antagonist and dynorphin antiserum via spinal administration produced a significant reversal of abdominal hypersensitivity induced by DBTC in rats. The temporal correlation between the antihypersensitivity effect of dynorphin antiserum and that of bradykinin antagonists, and the fact that the anti-hypersensitivity of bradykinin antagonist corresponded with elevation of spinal dynorphin further support our hypothesis that elevated levels of spinal dynorphin may activate spinal bradykinin receptors to maintain persistent pain in DBTC- induced pancreatitis.

149

Since an upregulation of spinal dynorphin and its precursor, prodynorphin, upon peripheral inflammation is well-documented (Iadarola et al., 1988; Ruda et al., 1988;

Weihe et al., 1989) (Honore et al., 2000; Zhang et al., 2003) the potential role of such interaction between spinal dynorphin and bradykinin receptor in inflammatory pain is also investigated using a model of inflammatory pain by unilateral injection of Complete

Freud’s Adjuvant (CFA) into the rat hind paw. Unilateral intraplantar injection of CFA produced significant tactile hypersensitivity and thermal hyperalgesia in the inflamed paw over three days. Data in PART THREE showed that bradykinin receptor antagonists, like the anti-dynorphin antiserum, produced antihyperalgesic effect at the 72 hr time point but not at the 6 hr time point. We showed that there is a differential effect of the anti-dynorphin antiserum or bradykinin receptor antagonists, which is anti-hyperalgesic at a later time (72 hr) when spinal dynorphin is upregulated, but has no effect at an early time (6 hr) when rats exhibit hyperalgesia with no sign of upregulation of spinal dynorphin. In contrast, mRNA level of kininogen in the spinal cord is undetectable either after intraplantar CFA, or after spinal nerve ligation described previously in the PART

ONE. In the absence of bradykinin in the spinal cord, the antihyperalgesic effect of intrathecal bradykinin receptor antagonists at 72 hr is not due to a blockade of bradykinin at its receptors. The findings in the PART THREE further substantiate a likely pathophysiological role of spinal bradykinin receptors in the pronociceptive actions of spinal dynorphin.

In summary, the results in this dissertation demonstrate that the underlying mechanism for the pronociceptive action of spinal dynorphin is likely mediated by its

150

activation of spinal bradykinin receptors that occurs only when the level of dynorphin is highly elevated. These findings represent a novel pronociceptive mechanism which offers new approaches to the development of therapy for the treatment of pathological pain.

151

REFERENCES

Abbadie C, Brown JL, Mantyh PW, Basbaum AI (1996) Spinal cord substance P receptor immunoreactivity increases in both inflammatory and nerve injury models of persistent pain. Neuroscience 70:201-209.

Abraham, K. E., J. F. McGinty and K. L. Brewer (2001) Spinal and supraspinal changes in opioid mRNA expression are related to the onset of pain behaviors following excitotoxic spinal cord injury. Pain 90: 181-90.

Baccei, M. L., J. D. Kocsis (2000) Voltage-gated calcium currents in axotomized adult rat cutaneous afferent neurons. J Neurophysiol 83(4): 2227-38.

Bakshi R, Faden AI (1990) Blockade of the glycine modulatory site of NMDA receptors modifies dynorphin induced behavioral effects. Neurosci Lett 110:113-117.

Bakshi R, Ni RX, Faden AI (1992) N-methyl-D-aspartate (NMDA) and opioid receptors mediate dynorphin induced spinal cord injury: behavioral and histological studies. Brain Res 580:255-264.

Bennett GJ, An animal model of neuropathic pain: a review. Muscle Nerve, 16 (1993) Aage R. Moller (2003) Sensory Systems, Elsevier Science (USA), P241-245.

Bennett GJ, Xie Y-K (1998) A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain 33: 33-107.

Bhoola KD, Figueroa CD, Worthy K (1992) Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol Rev 44:1-80.

Bian D, Ossipov MH, Ibrahim M, Raffa RB, Tallarida RJ, Malan TP, Jr., Lai J, Porreca F (1999) Loss of antiallodynic and antinociceptive spinal/supraspinal morphine synergy in nerve-injured rats: restoration by MK-801 or dynorphin antiserum. Brain Res 831:55-63.

Bloechle C, Kusterer K, Kuehn RM, Schneider C, Knoefel WT, Izbicki JR (1998) Inhibition of bradykinin B2 receptor preserves microcirculation in experimental pancreatitis in rats. Am J Physiol 274:G42-51.

Blumberg H, Janig W (1983) Changes of reflexes in vasoconstrictor neurons supplying the cat hindlimb following chronic nerve lesions: a model for studying mechanisms of reflex sympathetic dystrophy? J Auton Nerv Syst 7:399-411.

Bockman DE, Buchler M, Malfertheiner P, Beger HG (1988) Analysis of nerves in chronic pancreatitis. Gastroenterology 94:1459-1469.

152

Bradley EL, 3rd (1982) Pancreatic duct pressure in chronic pancreatitis. Am J Surg 144:313-316.

Bridges D, Thompson SWN and Rice ASC (2001), Mechanisms of neuropathic pain, British J. of Anaesthesia 87 (1):12-26.

Buchler M, Weihe E, Friess H, Malfertheiner P, Bockman E, Muller S, Nohr D, Beger HG (1992) Changes in peptidergic innervation in chronic pancreatitis. Pancreas 7:183- 192. Burchiel, K J. (1984) Spontaneous impulse generation in normal and denervated dorsal root ganglia: sensitivity to alpha-adrenergic stimulation and hypoxia. Exp Neurol 85(2): 257-72.

Burgess SE, Gardell LR, Ossipov MH, Malan TP, Jr., Vanderah TW, Lai J, Porreca F (2002) Time-dependent descending facilitation from the rostral ventromedial medulla maintains, but does not initiate, neuropathic pain. J Neurosci 22:5129-5136.

Burgess, GM, Mullaney, I., McNeill, M., Dunn, PM & Rang, HP (1989) Second messengers involved in the mechanism of action of bradykinin in sensory neurons in culture. J Neurosci 9, 3314-25.

Calixto JB, Cabrini DA, Ferreira J, Campos MM (2000) Kinins in pain and inflammation. Pain 87:1-5.

Cervero F (1994) Sensory innervation of the viscera: peripheral basis of visceral pain. Physiol Rev 74:95-138.

Cervero F, Janig W (1992) Visceral nociceptors: a new world order? Trends Neurosci 15:374-378.

Cervero F, Laird JM (1999) Visceral pain. Lancet 353:2145-2148.

Cervero F, Laird JM, Pozo MA (1992) Selective changes of receptive field properties of spinal nociceptive neurones induced by noxious visceral stimulation in the cat. Pain 51:335-342.

Chao J, Chao L (1995) Biochemistry, regulation and potential function of kallistatin. Biol Chem Hoppe Seyler 376:705-713.

Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL (1994) Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53:55-63.

Chaplan SR, Pogrel JW, Yaksh TL (1994) Role of voltage-dependent calcium channel subtypes in experimental tactile allodynia. J Pharmacol Exp Ther 269(3): 1117-23.

153

Chavkin C, Goldstein A (1981) Specific receptor for the opioid peptide dynorphin: structure—activity relationships. Proc Natl Acad Sci U S A 78:6543-6547.

Chavkin C, James IF, Goldstein A (1982). Dynorphin is a specific endogenous ligand of the kappa opioid receptor. Science 215(4531): 413-5.

Cliffer KD, Giesler GJ, Jr. (1989) Postsynaptic dorsal column pathway of the rat. III. Distribution of ascending afferent fibers. J Neurosci 9:3146-3168.

Cliffer KD, Willis WD (1994) Distribution of the postsynaptic dorsal column projection in the cuneate nucleus of monkeys. J Comp Neurol 345:84-93

Couture R, Harrisson M, Vianna RM, Cloutier F (2001) Kinin receptors in pain and inflammation. Eur J Pharmacol 429:161-176.

Cox BM, Molineaux CJ, Jacobs TP, Rosenberger JG, Faden AI (1985) Effects of traumatic injury on dynorphin immunoreactivity in spinal cord. Neuropeptides 5:571- 574.

Danziger N, Weil-Fugazza J, Le Bars D, Bouhassira D (2001) Stage-dependent changes in the modulation of spinal nociceptive neuronal activity during the course of inflammation. Eur J Neurosci 13:230-240.

Davar G, Hama A, Deykin A, Vos B, Maciewicz, R (1991). MK-801 blocks the development of thermal hyperalgesia in a rat model of experimental painful neuropathy. Brain Res 553(2): 327-30.

Day R and H Akil (1989). The posttranslational processing of prodynorphin in the rat anterior pituitary. Endocrinology 124(5): 2392-405.

Devor M, Keller C H, Deerinck T J, Levinson S R, Ellisman MH (1989). Na+ channel accumulation on axolemma of afferent endings in nerve end neuromas in Apteronotus. Neurosci Lett 102(2-3): 149-54.

Devor M. and Raber P (1983). Autotomy after nerve injury and its relation to spontaneous discharge originating in nerve-end neuromas. Behav Neural Biol 37(2): 276- 83.

Draisci G, Kajander KC, Dubner R, Bennett GJ, Iadarola MJ (1991) Up-regulation of opioid gene expression in spinal cord evoked by experimental nerve injuries and inflammation. Brain Res 560:186-192.

Dubner R, Ruda MA (1992) Activity-dependent neuronal plasticity following tissue injury and inflammation. Trends Neurosci 15:96-103.

154

Ebbehoj N (1992) Pancreatic tissue fluid pressure and pain in chronic pancreatitis. Dan Med Bull 39:128-133.

Ebbehoj N, Borly L, Madsen P, Matzen P (1990a) Pancreatic tissue fluid pressure during drainage operations for chronic pancreatitis. Scand J Gastroenterol 25:1041-1045.

Ebbehoj N, Borly L, Bulow J, Rasmussen SG, Madsen P, Matzen P, Owre A (1990b) Pancreatic tissue fluid pressure in chronic pancreatitis. Relation to pain, morphology, and function. Scand J Gastroenterol 25:1046-1051.

Faden AI (1990) Opioid and nonopioid mechanisms may contribute to dynorphin's pathophysiological actions in spinal cord injury. Ann Neurol 27:67-74.

Faden AI, Jacobs TP (1984) Dynorphin-related peptides cause motor dysfunction in the rat through a non-opiate action. Br J Pharmacol 81:271-276.

Faden AI, Molineaux CJ, Rosenberger JG, Jacobs TP, Cox BM (1985) Increased dynorphin immunoreactivity in spinal cord after traumatic injury. Regul Pept. 11: 35-41.

Falcone RC, Hubbs SJ, Vanderloo J D, Prosser JC, Little J, Gomes B, Aharony D, Krell RD (1993) Characterization of bradykinin receptors in guinea pig gall bladder. J Pharmacol Exp Ther 266, 1291-9.

Fallon J H and Leslie FM (1986) Distribution of dynorphin and enkephalin peptides in the rat brain. J Comp Neurol 249(3): 293-336.

Ferreira J, Beirith A, Mori MAS, Araujo RC, Bader M, Pesquero JB, Calixto JB (2005) Reduced nerve injury induced neuropathic pain in kinin B-1 receptor knock-out mice. Journal of Neuroscience 25:2405-2412.

Ferreira SH, Vane JR (1967) The disappearance of bradykinin and eledoisin in the circulation and vascular beds of the cat. Br J Pharmacol Chemother 30:417-424.

Fields HL, and Rowbotham M, (1994). Multiple mechanisms of neuropathic pain: a clinical perspective. In processing of the 7th World Congress on Pain, G. Gebhart, D. Hammond and T. Jensen, eds. (Seattle: IASP), pp.437-454

Fischli W, Goldstein A, Hunkapiller MW, Hood LE (1982) Isolation and amino acid sequence analysis of a 4,000-dalton dynorphin from porcine pituitary. Proc Natl Acad Sci USA 79(17): 5435-7.

Friedrich AE and Gebhart GF (2003) Modulation of visceral hyperalgesia by morphine and cholecystokinin from the rat rostroventral medial medulla. Pain 104(1-2): 93-101.

155

Gardell LR, Vanderah TW, Gardell SE, Wang R, Ossipov MH, Lai J, Porreca F (2003) Enhanced evoked excitatory transmitter release in experimental neuropathy requires descending facilitation. J Neurosci 23:8370-8379.

Gardell LR,Wang R,Burgess SE,Ossipov MH,Vanderah TW,Malan TP, Jr., Lai J, Porreca F (2002) Sustained morphine exposure induces a spinal dynorphin-dependent enhancement of excitatory transmitter release from primary afferent fibers. J Neurosci 22, 6747-55.

Gardell LR, Ibrahim M, Wang R, Wang Z, Ossipov MH, Malan TP, Jr., Porreca F, Lai J (2004) Mouse strains that lack spinal dynorphin upregulation after peripheral nerve injury do not develop neuropathic pain. Neuroscience 123:43-52.

Gold MS, Weinreich D, Kim CS, Wang R, Treanor J, Porreca F., Lai J. (2003) Redistribution of Na(V)1.8 in uninjured axons enables neuropathic pain. J Neurosci 23(1): 158-66.

Gougat J, Ferrari B, Sarran L, Planchenault C, Poncelet M, Maruani J, Alonso R, Cudennec A, Croci T, Guagnini F, Urban-Szabo K, Martinolle JP, Soubrie P, Finance O, Le Fur G (2004) SSR240612 [(2R)-2-[((3R)-3-(1,3-benzodioxol-5-yl)-3-[[(6-methoxy-2- naphthyl)sulfonyl]amino]propanoyl)amino]-3-(4-[[2R,6S)-2,6- dimethylpiperidinyl]methyl]pheny-l)-N-isopropyl-Nmethylpropanamide hydrochloride], a new nonpeptide antagonist of the bradykinin B1 receptor: biochemical and pharmacological characterization. J Pharmacol Exp Ther 309:661-669.

Griesbacher T, Lembeck F (1992) Effects of the bradykinin antagonist, HOE140, in experimental acute pancreatitis. Br J Pharmacol 107:356-360.

Griesbacher T, Tiran B, Lembeck F (1993) Pathological events in experimental acute pancreatitis prevented by the bradykinin antagonist, HOE140. Br J Pharmacol 108:405- 411.

Griesbacher T, Rainer I, Tiran B, Fink E, Lembeck F, Peskar BA (2003) Mechanism of kinin release during experimental acute pancreatitis in rats: evidence for pro- as well as anti-inflammatory roles of edema formation. Br J Pharmacol 139:299-308.

Han HC, Lee DH, Chung JM (2000) Characteristics of ectopic discharges in a rat neuropathic pain model. Pain 84(2-3): 253-61.

Hargreaves K, Dubner R, Brown F, Flores C, Joris J (1988) A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32:77-88.

156

Haupt P, Janig W, Kohler W (1983) Response pattern of visceral afferent fibres, supplying the colon, upon chemical and mechanical stimuli. Pflugers Arch 398:41-47. Hirshberg RM, Al-Chaer ED, Lawand NB, Westlund KN, Willis WD (1996) Is there a pathway in the posterior funiculus that signals visceral pain? Pain 67:291-305.

Hauser KF, Foldes JK, Turbek CS (1999) Dynorphin A (1-13) neurotoxicity in vitro: opioid and non-opioid mechanisms in mouse spinal cord neurons. Exp Neurol 160:361- 375.

Honore P, Rogers SD, Schwei MJ, Salak-Johnson JL, Luger NM, Sabino MC, Clohisy DR, Mantyh PW (2000) Murine models of inflammatory, neuropathic and cancer pain each generates a unique set of neurochemical changes in the spinal cord and sensory neurons. Neuroscience 98:585-598.

Holzer-Petsche U (1992) Blood pressure and gastric motor responses to bradykinin and hydrochloric acid injected into somatic or visceral tissues. Naunyn Schmiedebergs Arch Pharmacol 346:219-225

Hwang JH and Yaksh TL (1997) The effect of spinal GABA receptor agonists on tactile allodynia in a surgically-induced neuropathic pain model in the rat. Pain 70(1): 15-22.

Hylden JL, Nahin RL, Traub RJ, Dubner R (1991) Effects of spinal kappa opioid receptor agonists on the responsiveness of nociceptive superficial dorsal horn neurons. Pain 44:187-193.

Hylden JL, Wilcox GL (1980) Intrathecal morphine in mice: a new technique. Eur J Pharmacol 67:313-316.

Iadarola MJ, Brady LS, Draisci G, Dubner R (1988) Enhancement of dynorphin gene expression in spinal cord following experimental inflammation: stimulus specificity, behavioral parameters and opioid receptor binding. Pain 35:313-326.

Jensen TS, Mechanisms of neuropathic pain, In Campbell JN (ed) Pain 1996- An updated Review, IASP Press, Seattle, P.77-86

Ji RR, Befort K, Brenner GJ, Woolf CJ (2002) ERK MAP kinase activation in superficial spinal cord neurons induces prodynorphin and NK-1 upregulation and contributes to persistent inflammatory pain hypersensitivity. J Neurosci 22:478-485.

Juan H, Lembeck F (1974) Proceedings: Influence of prostaglandin E1, indomethacin, calcium and potassium on the action of nociceptive substances. Naunyn Schmiedebergs Arch Pharmacol 282:suppl 282:R242.

157

Kajander KC, Sahara Y, Iadarola MJ, Bennett GJ (1990) Dynorphin increases in the dorsal spinal cord in rats with a painful peripheral neuropathy. Peptides 11:719-728.

Kanaka R, Schaible HG, Schmidt RF (1985) Activation of fine articular afferent units by bradykinin. Brain Res 327:81-90.

Kanbe T, Naruse S, Kitagawa M, Nakae Y, Hayakawa T (1996) Effects of a bradykinin receptor antagonist (HOE140) on taurocholate-induced acute pancreatitis in rats. Pancreas 13:283-288.

Kawaraguchi Y, Kawaguchi M, Takahashi M, Horiuchi T, Sakamoto T, Furuya H (2004) Delta-opioid agonist SNC80 can attenuate the development of dynorphin A-induced tactile allodynia in rats. Anesthesiology 101:546-549.

Kawamata, M and Omote K (1996) Involvement of increased excitatory amino acids and intracellular Ca2+ concentration in the spinal dorsal horn in an animal model of neuropathic pain. Pain 68(1): 85-96.

Keith RG, Keshavjee SH, Kerenyi NR (1985) Neuropathology of chronic pancreatitis in humans. Can J Surg 28:207-211.

Khachaturian H, Watson SJ, Lewis ME, Coy D, Goldstein A, Akil H (1982) Dynorphin immunocytochemistry in the rat central nervous system. Peptides 3(6): 941-54.

Kim SH, Chung JM (1992) An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 50:355-363.

Koerber HR, Mirnics K, Brown PB, Mendell LM (1994) Central sprouting and functional plasticity of regenerated primary afferents. J Neurosci 14(6): 3655-71.

Koltzenburg M, Kress M, Reeh PW (1992) The nociceptor sensitization by bradykinin does not depend on sympathetic neurons. Neuroscience 46:465-473.

Kovelowski CJ, Ossipov MH, Sun H, Lai J, Malan T P, Porreca F (2000) Supraspinal cholecystokinin may drive tonic descending facilitation mechanisms to maintain neuropathic pain in the rat. Pain 87(3): 265-73.

Kumazawa T, Mizumura K (1980) Chemical responses of polymodal receptors of the scrotal contents in dogs. J Physiol 299:219-231.

Kumazawa T, Mizumura K, Minagawa M, Tsujii Y (1991) Sensitizing effects of bradykinin on the heat responses of the visceral nociceptor. J Neurophysiol 66:1819- 1824.

158

Lai J, Luo MC, Chen Q, Ma S, Gardell LR, Ossipov MH, Porreca F (2006) Dynorphin A activates bradykinin receptors to maintain neuropathic pain. Nat Neurosci 9:1534-1540.

Lai J, Ossipov MH, Vanderah TW, Malan TP, Jr., Porreca F (2001) Neuropathic pain: the paradox of dynorphin. Mol Interv 1:160-167.

Laneuville O, Dorais J, Couture R (1988) Characterization of the effects produced by neurokinins and three agonists selective for neurokinin receptor subtypes in a spinal nociceptive reflex of the rat. Life Sci 42:1295-1305.

Lang E, Novak A, Reeh PW, Handwerker HO (1990) Chemosensitivity of fine afferents from rat skin in vitro. J Neurophysiol 63:887-901.

Laughlin TM, Vanderah TW, Lashbrook J, Nichols ML, Ossipov M, Porreca F, Wilcox GL (1997) Spinally administered dynorphin A produces long-lasting allodynia: involvement of NMDA but not opioid receptors. Pain 72:253-260.

Lee KM, Kang BS, Lee HL, Son SJ, Hwang SH, Kim DS, Park JS, Cho HJ (2004) Spinal NF-kB activation induces COX-2 upregulation and contributes to inflammatory pain hypersensitivity. Eur J Neurosci 19:3375-3381.

Lekan HA, Carlton SM, Coggeshall RE (1996) Sprouting of A beta fibers into lamina II of the rat dorsal horn in peripheral neuropathy. Neurosci Lett 208(3): 147-50.

Levy D, Zochodne DW (2000) Increased mRNA expression of the B1 and B2 bradykinin receptors and antinociceptive effects of their antagonists in an animal model of neuropathic pain. Pain 86:265-271.

Liebmann C, Graness A, Ludwig B, Adomeit A, Boehmer A, Boehmer FD, Nurnberg B, Wetzker R (1996) Dual bradykinin B2 receptor signalling in A431 human epidermoid carcinoma cells: activation of the protein kinase C is counteracted by a GS-mediated stimulation of the cyclic AMP pathways. Biochem. J. 313, 109-118. ` Ma QP, Heavens R (2001) Basal expression of bradykinin B(1) receptor in the spinal cord in humans and rats. Neuroreport 12:2311-2314.

Ma W, Eisenach JC (2003) Intraplantar injection of a cyclooxygenase inhibitor ketorolac reduces immunoreactivities of substance P, calcitonin gene-related peptide, and dynorphin in the dorsal horn of rats with nerve injury or inflammation. Neuroscience 121:681-690.

MacNeil T, Bierilo KK, Menke JG, Hess JF (1995) Cloning and pharmacological characterization of a rabbit bradykinin B1 receptor. Biochim Biophys Acta 1264:223- 228.

159

Malan TP, Ossipov MH, Gardell LR, Ibrahim M, Bian D, Lai J, Porreca F (2000) Extraterritorial neuropathic pain correlates with multisegmental elevation of spinal dynorphin in nerve-injured rats. Pain 86:185- 194.

Manes G, Pieramico O, Uomo G (1992) [Pain in chronic pancreatitis: recent pathogenetic findings]. Minerva Gastroenterol Dietol 38:137-143.

Manning DC, Raja SN, Meyer RA, Campbell JN (1991) Pain and hyperalgesia after intradermal injection of bradykinin in humans. Clin Pharmacol Ther 50:721-729.

Malcangio M. Tomlinson DR (1998) A pharmacologic analysis of mechanical hyperalgesia in streptozotocin/diabetic rats, Pain, 76: 151-7.

Mansour A, Fox CA, Burke S, Meng F, Thompson RC, Akil H, Watson SJ (1994) Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study. J Comp Neurol 350(3): 412-38.

Mao J, Price DD, Mayer DJ, Lu J, Hayes RL (1992) Intrathecal MK-801 and local nerve anesthesia synergistically reduce nociceptive behaviors in rats with experimental peripheral mononeuropathy. Brain Res 576(2): 254-62.

Marceau F, Bachvarov DR (1998) Kinin receptors. Clin Rev Allergy Immunol 16:385- 401.

Marceau F, Gendreau M, Barabe J, St-Pierre S, Regoli D (1981) The degradation of bradykinin (BK) and of des-Arg9-BK in plasma. Can J Physiol Pharmacol 59:131-138.

Matzner O and Devor M (1994) Hyperexcitability at sites of nerve injury depends on voltage-sensitive Na+ channels. J Neurophysiol 72(1): 349-59.

McCarson KE, Krause JE (1994) NK-1 and NK-3 type tachykinin receptor mRNA expression in the rat spinal cord dorsal horn is increased during adjuvant or formalin- induced nociception. J Neurosci 14:712-720.

McCarthy DA, Potter DE, Nicolaides ED (1965) An in Vivo Estimation of the Potencies and Half-Lives of Synthetic Bradykinin and Kallidin. J Pharmacol Exp Ther 148:117- 122.

McQuay HJ, Tramer M, Nye BA, Carroll D, Wiffen PJ, Moore RA (1996) A systematic review of antidepressants in neuropathic pain. Pain, 68: 217-27.

McCarthy PW, Lawson SN (1989) Cell type and conduction velocity of rat primary sensory neurons with substance P-like immunoreactivity. Neuroscience 28:745-753.

160

Merkord J, Weber H, Jonas L, Nizze H, Hennighausen G (1998) The influence of ethanol on long-term effects of dibutyltin dichloride (DBTC) in pancreas and liver of rats. Hum Exp Toxicol 17:144-150.

Merkord J, Weber H, Sparmann G, Jonas L, Hennighausen G (1999) The course of pancreatic fibrosis induced by dibutyltin dichloride (DBTC). Ann N Y Acad Sci 880:231- 237.

Merkord J, Jonas L, Weber H, Kroning G, Nizze H, Hennighausen G (1997) Acute interstitial pancreatitis in rats induced by dibutyltin dichloride (DBTC): pathogenesis and natural course of lesions. Pancreas 15:392-401.

Merskey H, & Bogduk N (1984). Classification of chronic pain: Descriptions of chronic pain syndromes and definitions of pain terms (2nd ed.) Seattle: IASP Press.

Millan MJ, Czlonkowski A, Morris B, Stein C, Arendt R, Huber A, Hollt V, Herz A (1988) Inflammation of the hind limb as a model of unilateral, localized pain: influence on multiple opioid systems in the spinal cord of the rat. Pain 35:299-312.

Milne RJ, Foreman RD, Giesler GJ, Jr., Willis WD (1981) Convergence of cutaneous and pelvic visceral nociceptive inputs onto primate spinothalamic neurons. Pain 11:163-183.

Nakamura F (1994) [Expression of preprodynorphin mRNA in the spinal cord after inflammatory abdominal stimulation in rats]. Hokkaido Igaku Zasshi 69:95-103.

Nauta HJ, Hewitt E, Westlund KN, Willis WD, Jr. (1997) Surgical interruption of a midline dorsal column visceral pain pathway. Case report and review of the literature. J Neurosurg 86:538-542.

Neugebauer V, Schaible HG, Schmidt RF (1989) Sensitization of articular afferents to mechanical stimuli by bradykinin. Pflugers Arch 415:330-335.

Noguchi, K., K. Kowalski, R. Traub, A. Solodkin, M. J. Iadarola and M. A. Ruda (1991). Dynorphin expression and Fos-like immunoreactivity following inflammation induced hyperalgesia are colocalized in spinal cord neurons. Brain Res Mol Brain Res 10: 227- 33.

Novakovic SD, Tzoumaka E, McGivern JG, Haraguchi M, Sangameswaran L,Gogas KR, Eglen RM, Hunter JC (1998) Distribution of the tetrodotoxin-resistant sodium channel PN3 in rat sensory neurons in normal and neuropathic conditions. J Neurosci 18(6): 2174-87.

161

Ossipov MH, Hong Sun, T, Malan P Jr., Lai J, Porreca F (2000) Mediation of spinal nerve injury induced tactile allodynia by descending facilitatory pathways in the dorsolateral funiculus in rats. Neurosci Lett 290(2): 129-32.

Ossipov MH, Porreca F (2005) Challenges in the development of novel treatment strategies for neuropathic pain. NeuroRx 2:650-661.

Ossipov MH, Lai J, Porreca F (2005) Mechanisms of Experimental Neuropathic Pain: Integration from Animal Models. In: Wall and Melzack's Textbook of Pain, 5th Edition Edition (McMahon SB, Koltzenburg M, eds), pp 929-946. London: Elsevier.

Peters, C. M., T. H. Lindsay, J. D. Pomonis, N. M. Luger, J. R. Ghilardi, M. A. Sevcik and P. W. Mantyh (2004). Endothelin and the tumorigenic component of bone cancer pain. Neuroscience 126(4): 1043-52.

Pertovaara A, Wei H, Hamalainen MM (1996) Lidocaine in the rostroventromedial medulla and the periaqueductal gray attenuates allodynia in neuropathic rats. Neurosci Lett 218(2): 127-30.

Pesquero JB, Araujo RC, Heppenstall PA, Stucky CL, Silva JA, Walther T, Oliveira SM, Pesquero JL, Paiva ACM, Calixto JB, Lewin GR, Bader M (2000) Hypoalgesia and altered inflammatory responses in mice lacking kinin B1 receptors. Proceedings of the National Academy of Sciences of the United States of America 97:8140-8145.

Petersen JM, Forsmark CE (2002) Chronic pancreatitis and maldigestion. Semin Gastrointest Dis 13:191-199.

Pezzilli R, Morselli Labate AM, Ceciliato R, Frulloni L, Cavestro GM, Comparato G, Ferri B, Corinaldesi R, Gullo L (2005) Quality of life in patients with chronic pancreatitis. Dig Liver Dis 37:181-189.

Porreca F, Vanderah TW, Guo W, Barth M, Dodey P, Peyrou V, Luccarini JM, Junien JL, Pruneau D (2006) Antinociceptive Pharmacology of LF22-0542, A Novel Non- Peptidic Bradykinin B1 Receptor Antagonist. J Pharmacol Exp Ther.

Pierce JP, Kurucz OS, Milner TA (1999) Morphometry of a peptidergic transmitter system: dynorphin B-like immunoreactivity in the rat hippocampal mossy fiber pathway before and after seizures. Hippocampus 9(3): 255-76.

Porreca F, Lai J, Bian D, Wegert S, Ossipov MH, Eglen RM, Kassotakis L, Novakovic S, Rabert DK, Sangameswaran L, Hunter JC (1999) A comparison of the potential role of the tetrodotoxin-insensitive sodium channels, PN3/SNS and NaN/SNS2, in rat models of chronic pain. Proc Natl Acad Sci U S A 96:7640-7644.

162

Regoli D, Jukic D, Gobeil F, Rhaleb NE (1993) Receptors for bradykinin and related kinins: a critical analysis. Can J Physiol Pharmacol 71:556-567.

Ruda MA, Iadarola MJ, Cohen LV, Young WS, 3rd (1988) In situ hybridization histochemistry and immunocytochemistry reveal an increase in spinal dynorphin biosynthesis in a rat model of peripheral inflammation and hyperalgesia. Proc Natl Acad Sci U S A 85:622-626.

Ruud TE, Aasen AO, Kierulf P, Stadaas J, Aune S (1985) Studies on the plasma kallikrein-kinin system in peritoneal exudate and plasma during experimental acute pancreatitis in pigs. Scand J Gastroenterol 20:877-882.

Ryan JW, Moffat JG, Thompson AG (1964) Role of bradykinin in the development of acute pancreatitis. Nature 204:1212-1213.

Saameli K, Eskes TK (1962) Bradykinin and cardiovascular system: estimation of half- life. Am J Physiol 203:261-265.

Sah DW, Ossipo MH, Porreca F (2003) Neurotrophic factors as novel therapeutics for neuropathic pain. Nat Rev Drug Discov 2(6): 460-72.

Satake K, Rozmanith JS, Appert H, Howard JM (1973a) Hemodynamic change and bradykinin levels in plasma and lymph during experimental acute pancreatitis in dogs. Ann Surg 178:659-662.

Satake K, Rozmanith JS, Appert HE, Carballo J, Howard JM (1973b) Hypotension and release of kinin-forming enzyme into ascitic fluid exudate during experimental pancreatitis in dogs. Ann Surg 177:497-502.

Schafer MK, Nohr D, Krause JE, Weihe E (1993) Inflammation-induced upregulation of NK1 receptor mRNA in dorsal horn neurons. Neuroreport 4:1007-1010.

Seltzerb Z, Dubner R, Shir Y(1990) A novel behavioral model of neuropathic pain disorders produced in rats by partial sciatic nerve injury, Pain 43: 205-218.

Seltzer Z. and Devor M (1979) Ephaptic transmission in chronically damaged peripheral nerves. Neurology 29(7): 1061-4.

Sheen K and Chung JM (1993) Signs of neuropathic pain depend on signals from injured nerve fibers in a rat model. Brain Res 610(1): 62-8.

Shukla VK, Lemaire S (1994) Non-opioid effects of dynorphins: possible role of the NMDA receptor. Trends Pharmacol Sci 15:420-424.

163

Sindrup SH, Jensen TS (1999) Efficacy of pharmacological treatments of neuropathic pain: an update and effect related to mechanism of drug action, Pain, 83: 389-400

Sivilotti L. and Woolf CJ(1994) The contribution of GABA and glycine receptors to central sensitization: disinhibition and touch-evoked allodynia in the spinal cord. J Neurophysiol 72(1): 169-79.

Skilling SR, Sun X, Kurtz HJ, Larson AA (1992) Selective potentiation of NMDA- induced activity and release of excitatory amino acids by dynorphin: possible roles in paralysis and neurotoxicity. Brain Res 575:272-278.

Smith, A. P. and N. M. Lee.1988Smith, A. P. and N. M. Lee (1988) Pharmacology of dynorphin. Annu Rev Pharmacol Toxicol 28: 123-40.

Sot U, Misterek K, Gumulka SW, Dorociak A (2002) Intrathecal bradykinin administration: opposite effects on nociceptive transmission. Pharmacology 66:76-80.

Sotgiu ML and Biella G (2000) Differential effects of MK-801, a N-methyl-D-aspartate non-competitive antagonist, on the dorsal horn neuron hyperactivity and hyperexcitability in neuropathic rats. Neurosci Lett 283(2): 153-6.

Sparmann G, Merkord J, Jaschke A, Nizze H, Jonas L, Lohr M, Liebe S, Emmrich J (1997) Pancreatic fibrosis in experimental pancreatitis induced by dibutyltin dichloride. Gastroenterology 112:1664-1672.

Steranka LR, Manning DC, Dehaas CJ, Ferkany JW, Borosky SA, Connor JR, Vavrek RJ, Stewart JM, Snyder SH (1988) Bradykinin as a Pain Mediator - Receptors Are Localized to Sensory Neurons, and Antagonists Have Analgesic Actions. Proceedings of the National Academy of Sciences of the United States of America 85:3245-3249.

Stiller CO, Cui JG, O'Connor WT, Brodin E, Meyerson BA, Linderoth B (1996) Release of gamma-aminobutyric acid in the dorsal horn and suppression of tactile allodynia by spinal cord stimulation in mononeuropathic rats. Neurosurgery 39(2): 367-74; discussion 374-5.

Study RE and Kral MG (1996) Spontaneous action potential activity in isolated dorsal root ganglion neurons from rats with a painful neuropathy. Pain 65(2-3): 235-42.

Tachibana, T., K. Miki, T. Fukuoka, A. Arakawa, M. Taniguchi, S. Maruo and K. Noguchi (1998) Dynorphin mRNA expression in dorsal horn neurons after traumatic spinal cord injury: temporal and spatial analysis using in situ hybridization. J Neurotrauma 15: 485-94

164

Tal M and Devor M (1992) Ectopic discharge in injured nerves: comparison of trigeminal and somatic afferents. Brain Res 579(1): 148-51.

Tandrup T, Woolf CJ, Coggeshall RE (2000) Delayed loss of small dorsal root ganglion cells after transection of the rat sciatic nerve. J Comp Neurol 26;422(2):172-80.

Tang Q, Lynch RM, Porreca F, Lai J (2000) Dynorphin A elicits an increase in intracellular calcium in cultured neurons via a non-opioid, non-NMDA mechanism. J Neurophysiol 83:2610-2615.

Tan-No K, Takahashi H, Nakagawasai O, Niijima F, Sato T, Satoh S, Sakurada S, Marinova Z, Yakovleva T, Bakalkin G, Terenius L, Tadano T (2005) Pronociceptive role of dynorphins in uninjured animals: N-ethylmaleimide-induced nociceptive behavior mediated through inhibition of dynorphin degradation. Pain 113(3): 301-9.

Tong YG, Wang H F, Ju G, Grant G, Hokfelt T, Zhang X. (1999) Increased uptake and transport of cholera toxin B-subunit in dorsal root ganglion neurons after peripheral axotomy: possible implications for sensory sprouting. J Comp Neurol 404(2): 143-58.

Trujillo KA and Akil H (1991) Opiate tolerance and dependence: recent findings and synthesis. New Biol 3(10): 915-23.

Van Bockstaele E J, Sesack SR and Pickel VM (1994) Dynorphin-immunoreactive terminals in the rat nucleus accumbens: cellular sites for modulation of target neurons and interactions with catecholamine afferents. J Comp Neurol 341(1): 1-15.

Vanderah TW, Laughlin T, Lashbrook JM, Nichols ML, Wilcox GL, Ossipov MH, Malan TP, Jr. and Porreca F (1996) Single intrathecal injections of dynorphin A or des- Tyr-dynorphins produce long-lasting allodynia in rats: blockade by MK-801 but not naloxone. Pain 68:275-281.

Vasko MR, Campell WB and Waite KJ 1994) Prostaglandin E2 enhances bradykinin- stimulated release of neuropeptides from rat sensory neurons in culture. J. neurosci. 14. 4987-4997.

Vellani V, Zachrisson O and McNaughton PA (2004) Functional bradykinin B1 receptors are expressed in nociceptive neurones and are upregulated by the neurotrophin GDNF. J Physiol 560:391-401.

Vera-Portocarrero LP, Zhang ET, Ossipov MH, Xie JY, King T, Lai J and Porreca F (2006) Descending facilitation from the rostral ventromedial medulla maintains nerve injury-induced central sensitization. Neuroscience, in press.

165

Wagner R, DeLeo JA, Coombs DW, Willenbring S, Fromm C (1993) Spinal dynorphin immunoreactivity increases bilaterally in a neuropathic pain model. Brain Res 629:323- 326.

Walker JM, Moises HC, Coy DH, Baldrighi G and Akil H (1982) Nonopiate effects of dynorphin and des-Tyr-dynorphin. Science 218:1136-1138.

Wall PD and Woolf CJ (1986) The brief and the prolonged facilitatory effects of unmyelinated afferent input on the rat spinal cord are independently influenced by peripheral nerve section. Neuroscience 17(4): 1199-205.

Wall PD, Gutnick M. (1974) Ongoing activity in peripheral nerves: The physiology and pharmacology of impulses originating from a neuroma. Exp. Neurol., 43 (1974) 580-93

Wang HB, Kohno T, Amaya F, Brenner GJ, Ito N, Allchorne A, Ji RR and Woolf CJ (2005) Bradykinin produces pain hypersensitivity by potentiating spinal cord glutamatergic synaptic transmission. Journal of Neuroscience 25:7986-7992.

Wang Z, Gardell LR, Ossipov MH, Vanderah TW, Brennan MB, Hochgeschwender U, Hruby VJ, Malan TP, Jr., Lai J and Porreca F (2001) Pronociceptive actions of dynorphin maintain chronic neuropathic pain. J Neurosci 21:1779-1786.

Werz MA and Macdonald RL (1985) Dynorphin and neoendorphin peptides decrease dorsal root ganglion neuron calcium-dependent action potential duration. J Pharmacol Exp Ther 234(1): 49-56.

Wetzel CH, Spehr M and Hatt H (2001). Phosphorylation of voltage-gated ion channels in rat olfactory receptor neurons. Eur. J. Neurosci. 14, 1056-1064.

White DM and Cousins MJ (1998) Effect of subcutaneous administration of calcium channel blockers on nerve injury-induced hyperalgesia. Brain Res 801(1-2): 50-8.

Willis WD, Al-Chaer ED, Quast MJ, Westlund KN (1999) A visceral pain pathway in the dorsal column of the spinal cord. Proc Natl Acad Sci U S A 96:7675-7679.

Woolf CJ, Shortland P, Coggeshall RE (1992) Peripheral nerve injury triggers central sprouting of myelinated afferents. Nature 355(6355): 75-8.

Woolf CJ, Shortland P, Reynolds M, Ridings J, Doubell T and Coggeshall RE (1995) Reorganization of central terminals of myelinated primary afferents in the rat dorsal horn following peripheral axotomy. J Comp Neurol 360(1): 121-34.

Wotherspoon G, Winter J (2000) Bradykinin B1 receptor is constitutively expressed in the rat sensory nervous system. Neuroscience Letters 294:175-178.

166

Xiao WH and Bennett GJ (1995) Synthetic omega-conopeptides applied to the site of nerve injury suppress neuropathic pains in rats. J Pharmacol Exp Ther 274(2): 666-72.

Xie GX and Goldstein A (1987) Characterization of big dynorphins from rat brain and spinal cord. J Neurosci 7(7): 2049-55.

Xu M, Petraschka M, McLaughlin JP, Westenbroek RE, Caron MG, Lefkowitz RJ, Czyzyk TA, Pintar JE, Terman GW and Chavkin C (2004) Neuropathic pain activates the endogenous kappa opioid system in mouse spinal cord and induces opioid receptor tolerance. J Neurosci 24(19): 4576-84.

Yamaguchi-Sase S, Hayashi I, Okamoto H, Nara Y, Matsuzaki S, Hoka S, Majima M (2003) Amelioration of hyperalgesia by kinin receptor antagonists or kininogen deficiency in chronic constriction nerve injuryin rats. Inflamm Res 52:164-169.

Yaksh TL and Rudy TA (1976) Chronic catheterization of the spinal subarachnoid space. Physiol Behav 17:1031-1036.

Zhang L, Peoples RW, Oz M, Harvey-White J, Weight FF and Brauneis U (1997) Potentiation of NMDA receptor-mediated responses by dynorphin at low extracellular glycine concentrations. J Neurophysiol 78:582-590 .

Zhang S, Tong Y, Tian M, Dehaven RN, Cortesburgos L, Mansson E, Simonin F, Kieffer B and Yu L (1998) Dynorphin A as a potential endogenous ligand for four members of the opioid receptor gene family. J Pharmacol Exp Ther 286(1): 136-41.

Zhang L, Zhang X, Westlund KN (2004) Restoration of spontaneous exploratory behaviors with an intrathecal NMDA receptor antagonist or a PKC inhibitor in rats with acute pancreatitis. Pharmacol Biochem Behav 77:145-153.