Bradykinin Ligands and Receptors Involved in Neuropathic Pain

Item Type text; Electronic Dissertation

Authors Hall, Sara M.

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 26/09/2021 05:03:50

Link to Item http://hdl.handle.net/10150/578606

BRADYKININ LIGANDS AND RECEPTORS INVOLVED IN NEUROPATHIC PAIN

Sara M. Hall

______

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF CHEMISTRY AND BIOCHEMISTRY

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

WITH A MAJOR IN BIOCHEMISTRY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2015

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Sara M. Hall titled Bradykinin Ligands and Receptors Involved in Neuropathic Pain and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy

______Date: 8/5/15 Prof. Victor J. Hruby

______Date: 8/5/15 Prof. Josephine Lai

______Date: 8/5/15 Prof. Nancy Horton

______Date: 8/5/15 Prof. John Jewett

Final approval and acceptance of this dissertation is contingent upon the candidate's submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

______Date: 8/5/15 Dissertation Director: Prof. Victor J. Hruby

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.

SIGNED: __Sara M. Hall____

ACKNOWLEDGMENTS

First and foremost I would like to express my sincere gratitude to my advisor, Dr.

Victor J. Hruby for his immense amount of support the past years. I greatly admire his knowledge, work ethic and guidance. I'm very appreciative of not only the chemistry knowledge he taught me, but also the life lessons.

I also owe a great amount of gratitude to Dr. Josephine Lai, who spent 100s of hours teaching me pharmacology. She also was instrumental in teaching me how to analyze and interpret the data. Thanks for all the years of patience, sharing your knowledge (in science and life), and support. Thanks to David Rankin for teaching me pharmacology techinques.

Gratitude also goes to Dr. Frank Porreca and Dr. Todd Vanderah for allowing me to do many of the biological assays in their labaratories and the support of their members.

Thanks to my committee members, Dr. Vahe Bandarian, Dr. Nancy Horton, and

Dr. John Jewett for all their valuable comments and suggestions.

I also like to thank all the Hruby group members but especially Dr. Yeon Sun Lee for being a chemistry genius and being a great editor. Also, Dr. Scott Cowell for his advice the past years. Thank you to Lindsay LeBaron, an undergraduate under my supervision, for all her hard work the past years.

I give many thanks to some fellow graduate students; Dr. Christine Kaiser, Dr.

Bethany Remeniuk, and Cyf Nadine Ramos-Colon for the many laughs and stories that have made graduate school bearable. Lastly, I thank my boyfriend for putting up with me and the stress of graduate school.

Dedicated to my loving parents, Raymond and Charlotte Hall,

grandparents Jerry and Sandra Bolt

and brothers Brian and Joe Hall

Even with many miles in between they gave unending love and support

TABLE OF CONTENTS

LIST OF TABLES...... 13

LIST OF FIGURES...... 15

ABSTRACT...... 20

ABRREVIATIONS...... 22

INTRODUCTION...... 25

Chronic pain...... 25

Therapeutics for neuropathic pain...... 26

Dyn A, an extraordinary opioid peptide...... 28

Dyn A, an endogenous ligand for the kappa opioid receptor (KOR)...... 29

Structure activity relationship (SAR) of Dyn A at the KOR...... 30

KOR antagonists for the treatment of pain...... 33

Future directions for Dyn A based KOR ligands...... 35

Non-opioid effects of Dyn A...... 35

N-methyl D-aspartate receptor (NMDAR) as the target for non-opioid effects...... 37

Bradykinin receptors (BRs) as the target for non-opioid effects...... 38

GPCRs as a target for drug design...... 41

Signaling of GPCRs...... 43

Aims...... 44

PART I: DESIGN AND SYNTHESIS OF DYNORPHIN A ANALOGUES

INTERACTING AT THE BRADYKININ 2 RECEPTOR WITH EVALUATION OF

BINDING, STABILITY, AND TOXICITY...... 45

INTRODUCTION...... 46

TABLE OF CONTENTS-Continued

Model of BK bound to the B2R...... 46

Strategies in designing analogues...... 47

Peptides as therapeutics...... 48

Rational...... 50

CHAPTER I: MATERIALS AND METHODS...... 51

1.1 Reagents for Fmoc Solid Phase Peptide Synthesis (SPPS)...... 51

1.2 SPPS...... 51

1.3 Peptide purification and analysis...... 53

1.4 Materials for membrane preparations and competition assays...... 53

1.5 Membranes preparations for; rat brain, hB2R-HEK, and hB1R-HEK

cells...... 54

1.6 Protein determination...... 54

1.7 Competitive radioligand binding assay...... 54

1.8 Rat and human plasma stability assays...... 55

1.8.1 Isolation and validation of a degraded fragment of LYS1044...... 55

1.8.2 Data analysis...... 55

1.9 Cell culture...... 56

1.10 XTT cytotoxicity assay...... 56

CHAPTER II: RESULTS...... 57

2.1 Establishment of Dyn A-(2-13) binding to the B2R...... 57

2.1.1 [3H] DALKD binding...... 57

2.1.2 High affinity of Dyn A-(2-13) at the B2R...... 58

TABLE OF CONTENTS-Continued

2.1.3 Selectivity of Dyn A-(2-13) for the B2R over the B1R...... 60

2.2 Design and synthesis of Dyn A analogues...... 62

2.2.1 Peptide synthesis...... 62

2.2.2 SAR of Dyn A fragments...... 65

2.2.3 SAR of LYS1113 modifications...... 70

2.2.4 SAR of LYS1044 modifications...... 72

2.3 Stability assay of analogues...... 76

2.3.1 Stability assay in rat plasma...... 76

2.3.2 Stability assay in human plasma...... 80

2.3.3 Identification of the degradation site for LYS1044...... 81

2.3.4 Comparison of the stability of LYS1044 in rat plasma

with/without protease inhibitors...... 82

2.4 Cytotoxicity of analogues...... 83

CHAPTER III: DISCUSSION AND FUTURE PRESPECTIVES...... 89

PART II: STUDY ON THE SIGNALING OF DYNORPIN A-(2-13) AT THE

BRADYKININ 2 RECEPTOR...... 92

INTRODUCTION...... 93

Signaling of GPCRS...... 93

BRs signaling...... 94

Rational...... 95

CHAPTER I: MATERIALS AND METHODS...... 97

1.1 Reagents...... 97

TABLE OF CONTENTS-Continued

1.2 PI assay...... 97

1.3 pERK ELISA assay...... 97

1.4 Western blot analysis...... 98

1.4.1 Reagents...... 98

1.4.2 Cell dosing and lysates...... 98

1.4.3 BCA assay...... 99

1.4.4 10% SDS-PAGE gel ...... 99

1.4.5 Blot transfer...... 99

1.4.6 Primary antibody...... 99

1.4.7 Secondary antibody...... 100

1.4.8 Stripping blot...... 100

1.4.9 Imaging and analysis of blots...... 100

CHAPTER II: RESULTS...... 102

2.1 Dyn A-(2-13) does not activate the classical B2R signaling...... 102

2.1.1 Dyn A-(2-13) does not stimulate PI...... 102

2.1.2 Dyn A-(2-13) does not mobilize intracellular Ca2+...... 103

2.2 ELISA pERK signaling...... 104

2.3 Western blots to determine the signaling of Dyn A-(2-13) at the B2R...... 106

2.3.1 ERK...... 107

2.3.2 Protein Kinase C (PKC)...... 110

2.3.3 Protein Kinase A(PKA)...... 115

2.3.4 AKT...... 117

TABLE OF CONTENTS-Continued

2.3.5 Signal Transducer and Activator of Transcription (STAT)...... 119

CHAPTER III: DISCUSSION AND FUTURE PRESPECTIVES...... 121

PART III: STUDY OF A NOVEL BRADYKININ 2 RECEPTOR IN THE CENTRAL

NERVOUS SYSTEM...... 126

INTRODUCTION...... 127

Bradykinin receptors...... 127

Endogenous kinins...... 127

B2R antagonists...... 128

Rational...... 130

CHAPTER I: MATERIALS AND METHODS...... 132

1.1 Reagents...... 132

1.2 Membranes preps for; rat brain, rat spinal cord, rat uterus, rat spleen, rat heart, guinea

pig brain, guinea pig ileum, hB2-HEK cells, and hB1-HEK cells ...... 132

1.3 Competitive radioligand binding assay...... 132

1.4 Cloning...... 133

1.4.1 Primers for PCR cloning of sB2R...... 133

1.4.2 Polymerase Chain Reaction (PCR)...... 133

1.4.3 Restriction enzyme analysis...... 133

1.4.4 Agarose gel...... 133

1.4.5 Freeze N' Squeeze...... 134

1.4.6 DNA/RNA concentration and purity...... 134

1.4.7 Ligation...... 134

TABLE OF CONTENTS-Continued

1.4.8 Transformation into E. coli...... 134

1.4.9 Purification with midi prep kit...... 135

1.5 Transient and stable transfection...... 135

1.5.1 Transient transfection...... 135

1.5.1.1 TF protocol...... 136

1.5.2 Stable transfection...... 136

1.5.2.1 CaPO4 protocol...... 136

1.6 RNA extraction...... 137

1.7 Reverse transcriptase-polymerase chain reaction (RT-PCR)...... 137

1.8 PCR with long and short form B2R primers...... 137

CHAPTER II: RESULTS...... 139

2.1 Discrepancy in binding of HOE140...... 139

2.2 Heterogeneity of the B2R in the literature...... 140

2.3 Binding results of tissues from different species...... 142

2.4 Alternate splice variant...... 143

2.5 Cloning of the short form B2R (sB2R)...... 145

2.6 Transfection of HEK-293 cells with short form B2R...... 150

2.6.1 Transient transfection...... 150

2.6.2 Stable transfection...... 151

2.7 Confirmation of sB2R in HEK cells...... 152

2.8 Binding of sB2R...... 154

CHAPTER III: DISCUSSION AND FUTURE PRESPECTIVES...... 155

TABLE OF CONTENTS-Continued

APPENDIX A: LYS1044 DEGRADATION PROFILE...... 158

APPENDIX B: BLOCKADE OF NON-OPIOID EXCITATORY EFFECTS OF SPINAL

DYNORPHIN A AT BRADYKININ RECEPTORS...... 160

APPENDIX C: MODIFICATION OF AMPHIPATHIC NON-OPIOID DYNORPHIN A

ANALOGUES FOR RAT BRAIN BRADYKININ RECEPTORS...... 165

APPENDIX D: STRUCTURE-ACTIVITY RELATIONSHIPS OF NON-OPIOID [DES-

ARG7] DYNORPHIN A ANALOGUES FOR BRADYKININ

RECEPTORS...... 170

APPENDIX E: DISCOVERY OF AMPHIPHATIC DYNORPHIN A ANALOGUES TO

INHIBIT THE NEUROEXCITATORY EFFECTS OF DYNORPHIN A

THROUGH BRADYKININ RECEPTORS IN THE SPINAL

CORD...... 175

APPENDIX F: STRUCTURE ACTIVITY RELATIONSHIP OF DYNORPHIN A(2-13)

ANALOGS AT THE BRADYKININ-2 RECEPTOR...... 185

APPENDIX G: [DES-ARG7] DYNORPHIN A ANALOGUES AT THE BRADYKININ-

2 RECEPTOR...... 188

APPENDIX H: DEVELOPMENT OF POTENT DYNORPHIN A ANALOGS AS

KAPPA OPIOID RECEPTOR ANTAGONISTS...... 191

REFERENCES...... 194

LIST OF TABLES

INTRODUCTION

Table 0.1 Commonly prescribed drugs for chronic neuropathic pain...... 27

Table 0.2 Binding and function of Dyn A at the opioid receptors...... 30

Table 0.3 Common Dyn A agonists at the KOR...... 32

Table 0.4 Common Dyn A antagonists at the KOR...... 34

PART I

Table 1.1 Radioligand competition analysis of BK, KD, and DALKD in

transfected HEK 293 cells expressing the hB1R or hB2R...... 57

Table 1.2 Competitive binding analysis of Dyn A-(2-13) against [3H]DALKD in

rat brain membranes at different pH buffer conditions...... 59

Table 1.3 Competitive binding analysis of Dyn A-(1-17) and Dyn A-(2-13)

against [3H] DALKD in membranes from rat brain or transfected HEK

293 cells expressing the hB2R...... 61

Table 1.4 Competitive binding analysis of Dyn A-(1-17) and Dyn A-(2-13)

against [3H]DALKD in membranes from transfected HEK 293 cells

expressing the hB1R...... 62

Table 1.5 Analytical data of Dyn A analogues...... 63

Table 1.6 SAR of Dyn A-(4-13) and Dyn A-(4-11) modifications...... 67

Table 1.7 Dyn A-(5-11), Dyn A-(5-13), Dyn A-(6-13) and Dyn A-(8-13)

modifications...... 69

Table 1.8 Pro10 substitutions for design of antagonists...... 70

Table 1.9 Dyn A-(9-13) modifications...... 71

LIST OF TABLES-continued

Table 1.10 Modifications of LYS1044 for stability...... 75

Table 1.11 Structure-stability relationship of Dyn A analogues in rat plasma...... 79

Table 1.12 Structure-stability relationship of Dyn A analogues in human

plasma...... 81

Table 1.13 Rat plasma stability of LYS1044 with inhibitors...... 83

PART II

Table 2.1 Summary of Western blot analysis...... 122

PART III

Table 3.1 Structures and potency of B2R antagonists...... 130

Table 3.2 Summary of HOE140 and BK affinities in rat brain, hB2-HEK, and GPI

membranes...... 140

Table 3.3 Binding results of tissues from different species...... 143

Table 3.4 Hypothesis of long and short form B2R...... 146

Table 3.5 Concentration and purity of DNA of sB2R clones...... 149

LIST OF FIGURES

INTRODUCTION

Figure 0.1 Estimates of the number of people suffering from the most common

diseases in the US and estimates of funding from the NIH...... 25

Figure 0.2 Cleavage of prodynorphin into the active peptides Dyn A, Dyn B, and

Leu-enkephalin...... 29

Figure 0.3 Dyn A in the spinal cord during nerve injury or chronic pain state...... 40

Figure 0.4 Structural characteristics of the rhodopsin-like GPCR family...... 43

Figure 0.5 Signaling of the four types of G-proteins of GPCRs...... 44

.PART I

Figure 1.1 Dyn A effects...... 46

Figure 1.2A Model of BK bound to B2R from NMR and mutagenic studies...... 47

Figure 1.2B Model of the important hydrophobic contacts of the receptor and

BK...... 47

Figure 1.3 Drug discovery cycle...... 50

Figure 1.4 Structure of Fmoc-Lys(Boc) Wang resin...... 52

Figure 1.5 Structures of the coupling reagents HOBt and HBTU used to

synthesize Dyn A analogues...... 52

Figure 1.6 Scheme for the synthesis of Dyn A analogues...... 53

Figure 1.7 Competitive binding of Dyn A-(2-13) against [3H]DALKD in crude

membranes prepared from adult rat brain, carried out under different

buffer pH...... 58

Figure 1.8 Competitive binding of Dyn A-(2-13) against [3H] DALKD in crude

LIST OF FIGURES-continued

membranes prepared from transfected HEK 293 cells expressing the

hB1R or hB2R...... 61

Figure 1.9 Pharmacophore of Dyn A at the BRs...... 69

Figure 1.10 In vitro stability of Dyn A analogues in rat plasma...... 78

Figure 1.11 In vitro stability of selected Dyn A analogues in human plasma...... 81

Figure 1.12 Optimization for XTT assay determining number of cells/well and

incubation times...... 84

Figure 1.13 XTT assay of select analogues in hB2R-HEK 24 hr incubation...... 85

Figure 1.14 XTT cell proliferation study of LYS1044 in A. hB2R-HEK cells B.

HEK cells C. F11 cells...... 86

Figure 1.15 XTT cell proliferation study of SH145 in A. hB2R-HEK cells B. HEK

cells C. F11 cells...... 87

Figure 1.16 XTT cell proliferation study of SH146 in A. hB2R-HEK cells B.

HEK cells C. F11 cells...... 88

Figure 1.17 XTT cell proliferation study of SH147 in A. hB2R-HEK cells B.

HEK cells C. F11 cells...... 88

PART II

Figure 2.1 Representation of an endogenous ligand binding to a GPCR...... 94

Figure 2.2 The canonical signaling for the BRs, which signal through PLC...... 96

Figure 2.3 The effect of BK and Dyn A(2-13) on the hydrolysis of [3H] PI phosphates

in transfected HEK 293 cells expressing hB2R...... 102

Figure 2.4 Summary of Ca2+ mobilization using a fluorescent dye indicator...... 103

LIST OF FIGURES-continued

Figure 2.5 Results from the FLIPR Ca2+ Assay...... 104

Figure 2.6 Summary of the MAP/ERK pathway...... 105

Figure 2.7 Results from pERK ELISA assay...... 106

Figure 2.8 A. Direct detection using fluorescence...... 107

Figure 2.8 B. Indirect detection using enzyme detection...... 107

Figure 2.9 pERK Western blot with 1 μM BK...... 108

Figure 2.10 Total ERK Western blot with 1 μM BK...... 109

Figure 2.11 pERK Western blot with 1 μM Dyn A-(2-13)...... 110

Figure 2.12 Total ERK Western blot with 1 μM Dyn A-(2-13)...... 110

Figure 2.13 Summary of the effects of activation of PKC isoforms...... 111

Figure 2.14 pPKC α/β II Western blot with 1 μM BK or Dyn A-(2-13)...... 112

Figure 2.15 pPKC pan Western blot with 1 μM BK or Dyn A-(2-13)...... 113

Figure 2.16 pPKC ζ/λ Western blot with 1 μM BK or Dyn A-(2-13)...... 113

Figure 2.17 pPKC δ/θ Western blot with 1 μM BK or Dyn A-(2-13)...... 114

Figure 2.18 pPKC δ and pPKC θ with 1 μM BK or Dyn A-(2-13)...... 114

Figure 2.19 pPKD/PKCμ Western blot with 1 μM BK or Dyn A-(2-13)...... 115

Figure 2.20 Summary of the cAMP pathway that involves PKA activation...... 117

Figure 2.21 pPKA Western blot with 1 μM BK or Dyn A-(2-13)...... 117

Figure 2.22 Signaling pathway of protein kinase B/AKT...... 118

Figure 2.23 pAKT Western blot with 1 μM BK...... 119

Figure 2.24 Summary of JAK-STAT pathway...... 119

Figure 2.25 pSTAT Western blot with 1 μM BK...... 120

LIST OF FIGURES-continued

PART III

Figure 3.1 Structures of the B1R and B2R...... 127

Figure 3.2 The kallikrein-kinin systems including the primary structures of the

four biologically active agents...... 128

Figure 3.3 Competitive binding analysis with 1 nM [3H]BK of (A.) HOE140

(B.) and BK in 3 membrane preparations...... 140

Figure 3.4 A. Splice variant of the hB2R translating the long form...... 145

Figure 3.4 B. Splice variant of the hB2R translating the short form...... 145

Figure 3.5 BLAST of the rat and human B2R...... 146

Figure 3.6 Strategy for obtaining short form B2R...... 147

Figure 3.7 Plasmid used for cloning of sB2R from long form that was cloned

using EcoRI and XhoI...... 148

Figure 3.8 1 % Agarose gel after single digest with XhoI or double digest with

NotI and XhoI...... 148

Figure 3.9 Restriction map of sB2R plasmid...... 149

Figure 3.10 1% agarose gel after triple digest of sB2R plasmid...... 150

Figure 3.11 1.2% Agarose gel testing conditions (incubation time, and TF:DNA

ratios) of the transient transfection ...... 151

Figure 3.12 1% agarose gel of clones #27 and #28 of sB2R with B2R primers

towards the C-terminus...... 152

Figure 3.13 1.5% agarose gel of long form B2R and clones #27 and #28 primers

for the long and short form B2R...... 153

LIST OF FIGURES-continued

Figure 3.14 1% agarose gel of long form B2R and clones #27 and #28 with

primers for the long and short form B2R and the C-terminal...... 154

ABSTRACT

Neuropathic pain is a prevalent disease with no effective, safe treatments and limited knowledge on the mechanisms involved. One target for neuropathic pain treatment may be the blockade of Dynorphin A (Dyn A). Dyn A is a unique endogenous ligand that possesses well-known neuroinhibitory effects via opioid receptors and neuroexcitatory effects that are mediated through the bradykinin 2 receptors (B2Rs).

Extensive SAR was carried out to develop a ligand for the blockade of the excitatory actions of Dyn A at the B2R. A lead ligand was able to block Dyn A-induced hyperalgesia in naïve animals and was effective in a neuropathic pain model. However, the ligand was susceptible to enzymatic degradation. In an effort to increase the stability, modifications of the ligand using non-natural amino acids were performed. Analogues substituted at or near the N-terminus with a D-isomer retained binding at the receptor as well as provided a large increase in stability. These ligands were also found to be non- toxic in a cell toxicity assay.

Dyn A has been found to not activate the classical signaling of the B2R, PI hydrolysis or Ca2+ mobilization. In an effort to determine Dyn A's signaling, a study was done examining up-regulation of phosphorylated proteins. It was found that Dyn A did not activate; pERK, 7 PKC isoforms or PKA.

A well known B2R antagonist, HOE140, was found to have low affinity at rat and guinea pig brain B2Rs but high affinity in the guinea pig ileum. Further examination revealed that this discrepancy in binding may arise from a different isoform of the B2R that has not been previously examined.

To date, we have discovered Dyn A analogues that have high affinity for the B2R, are very stable, and have low toxicity. The signaling pathway is still not fully understood, but further studies are underway. Also, there is evidence that the B2R in which the analogues are interacting at may be a different form than what has previously been described. Targeting this different isoform of the B2R with our current stable ligands may provide beneficial therapeutics for the treatment of neuropathic pain without the cardiovascular liabilities.

ABBREVIATIONS

AC Adenyly Cyclase

B1R Bradykinin 1 Receptor

B2R Bradykinin 2 Receptor

BBB Blood Brain Barrier

BK Bradykinin

BRs Bradykinin Receptors

BSA Bovine Serum Albumin cAMP Cyclic Adenosine Monophosphate

CFA Complete Freund's Adjuvant

CKA Chlorokynurenic Acid

CNS Central Nervous System

DAG Diacylglycerol

DALKD [des-Arg9, Leu8] Kallidin

DCM Dichloromethane

Dhp Dihydro-2H-pyran-2-methanol

DIPEA Diisopropylethylamine

DMF N,N-Dimethylformamide

DOR Delta Opioid Receptor

DTT Dithiolthreitol

Dyn A Dynorphin A

ELISA Enzyme Linked Immunosorbent Assay

ERK Extracellular Signal-Regulated Kinase

ESI Electrospray Ionization

EtOH Ethanol

FBS Fetal Bovine Serum

FLIPR Fluorescence Imaging Plate Reader

Fmoc Fluorenylmethyloxycarbonyl

GPCR G-protein Coupled Receptor

HBTU 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethylaminium

hexafluorophosphate

HEK Human Embryonic Kidney

HOBt Hydroxybenzotriazole

HPLC High-Performace Liquid Chromatography hr Hour

HRP Horseradish Peroxidase

IR Infrared

KD Kallidin

KOR Kappa Opioid Receptor

MAPK Mitogen-Activated Protein Kinase

Mdp (2S)-2-methyl-3-(2',6'-dimethyl-4'-hydroxyphenyl)-propionic acid min. Minutes

MOR Mu Opioid Receptor

NMDAR N-methyl D-aspartate receptor

NSAID Non Steroidal Anti-Inflammatory Drug

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

PEI Polyethyleneimine

PI Phosphoinositol Hydrolysis Assay

PKC Protein Kinase C

PKA Protein Kinase A

PMSF Phenylmethylsulfonylfluoride

RP-HPLC Reverse Phase High Performance Liquid Chromatography rt Room temperature

RT Retention Time

RT-PCR Reverse-Transcriptase Polymerase Chain Reaction sB2R Short Form of Bradykinin 2 Receptor

SNL Spinal Nerve Ligation

SNRI Serotonin Norepinephrine Reuptake Inhibitors

SSRI Selective Serotonin Reuptake Inhibitors

STAT Signal Transducer and Activator of Transcription

TFA Trifluoroacetic Acid

TIS Triisopropylsilane

TF Turbofect

TM Transmembrane

INTRODUCTION

Chronic pain

Pain is an unpleasant feeling that has been categorized as acute (lasting a few weeks) or chronic (lasting months/years).1 Acute pain arises from tissue injury and usually dissipates once the injury is healed, and this pain is useful in alerting the body of damage.1 On the other hand, chronic pain has no purpose and exists in the absence of tissue injury. Although chronic pain is one of the most prevalent diseases, affecting 100 million Americans1 (more than heart disease, cancer and diabetes combined), funding from the National Institutes of Health (NIH) is miniscule when compared to the other diseases due to rare fatality (Figure 0.1). Chronic pain greatly limits the patient's quality of life and costs an estimated $61 billion/year in lost productive time.2 Neuropathic pain, a type of chronic pain, results from the dysfunction of the central nervous system (CNS) or the peripheral nervous system (PNS) that can occur in the presence or absence of an initial injury. The hallmarks of this type of pain are hyperalgesia, increased sensitivity to painful stimuli, and allodynia, increased sensitivity to non-painful stimuli.3

Figure 0.1: Estimates of the number of people suffering from the most common diseases in the US and estimates of funding from the NIH. Data compiled from 1, American

Diabetes Association, American Cancer Society, and the American Heart Association.

Therapeutics for neuropathic pain

There are currently many therapeutics for inflammatory acute pain, but unfortunately, there are not many effective treatments for chronic neuropathic pain. Even with quite different mechanisms, acute and chronic pain symptoms are treated by the same therapeutics. Acetaminophen and non steroidal anti-inflammatory drugs (NSAIDs) are generally prescribed for mild to moderate pain states with relatively little side effects and work well for post-operative pain but not for neuropathic pain. For severe pain, opioids are often prescribed and are useful in acute pain states but are not effective in chronic pain states because of serious side effects caused by long-term administration.1

Anti-convulsants such as pregablin and gabapentin are often prescribed and are effective for patients with postherpetic neuralgia, fibromyalgia, and diabetic peripheral neuropathy.4 For over 40 years, antidepressants such as tricycles, selective serotonin reuptake inhibitors (SSRI), and serotonin norepinephrine reuptake inhibitors (SNRI) have been used for the treatment of neuropathic pain and show efficacy for some patients.5

Steroids are generally used as an adjunct therapy with opioids and are beneficial to patients with metastatic bone pain, visceral pain, and neuropathic pain.6 Ziconotide, a natural peptide from snail venom, is approved for the treatment of intractable chronic pain.7 8 Ziconotide administration is limited to intrathecal (i.th.) because of cardiovascular liabilities caused by the intravenous (i.v.) route.9 There appears to be many treatments for neuropathic pain, but most of them are not effective in some patients

(high numbers needed to treat, NNT) and/or development of serious side effects (Table

0.1). Therefore, there is still a pressing need for novel therapeutics for the management of chronic neuropathic pain.

Table 0.1: Commonly prescribed drugs for chronic neuropathic pain

Class of Mechanism of Structure Side Effectsa NNT Drug/Ex. Action

Non-selective Ulcers, stomach NSAIDs inhibitors for bleeding, high blood 2b /Ibuprofen

COX pressure.

Inhibition of

prostaglandin Nausea, loss of appetite, Acetaminophen 4.6b synthesis. jaundice, stomach pain.

Unknown

Addiction, tolerance, Opioids/Oxycod Opioid receptors constipation, respiratory 2.6c one (mainly MOR) depression.

2+ Anticonvulsants Ca channel α2-δ Dizziness, somnolence, 4.5c / Pregablin subunit ataxia, tremor.

Antidepressants Drowsiness, dry mouth, Selective SNRI 5.0c / Duloxetine nausea, constipation.

Inhibits Upset stomach, Steroids prostaglandin vomiting, headache, n.d. /Dexamethasone synthesis increased hair growth.

Toxin/ N-type Ca2+ Dizziness, drowsiness, 2d Ziconotide blocker headache, nausea.

a Side effects found from http://www.nlm.nih.gov/medlineplus/druginfo/meds b Calculated for post-operation pain 10

c11 d12 n.d: not determined

Dynorphin A (Dyn A), an extraordinary opioid peptide

In 1979, Goldstein et al., discovered a peptide from the porcine pituitary that was termed Dyn A, from the greek work dynamis (power).13 The peptide was found to contain the Leu-enkephalin structure and was 730-fold and 3-fold more potent than Leu- enkephalin in the guinea pig ileum (GPI) and mouse vas deferens (MVD) contractility assays, respectively. The effects of the peptide in tissues were blocked by an opioid antagonist, naloxone, suggesting the opioid receptors as a target.13 A few years later, the full structure of this peptide was determined to be a heptadecapeptide, H-Tyr-Gly-Gly-

Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln-OH, with the Dyn A-(1-

13) fragment crucial for its potency.14 Later studies found that Dyn A is derived from prodynorphin (pDYN).15 After processing, the inactive precursor protein, pDYN, consists

of α-neoendorphin and Big

Dyn. Cleavage via prohormone convertase 2

(PC2) affords the bioactive peptides Leu-enkephalin (5 residues) from α- neoendorphin and Dyn A

(17 residues) and Dyn B (13 residues) from Big Dyn (Figure 0.2).15

Dyn A, an endogenous ligand for the kappa opioid receptor (KOR)

Although Dyn A has affinity for all three opioid receptors (Table 0.2), mu opioid receptor (MOR), KOR, delta opioid receptor (DOR), there is evidence that it acts primarily at the KOR, mainly because it behaves similarly to the KOR agonist,

16 ethylketocyclazocine. The KOR is a Gi/o coupled GPCR, in which agonists inhibit adenylate cyclase (AC). There has been some publications suggesting different subtypes of the KOR (subtype 1 and 3), but to date only the KOR1 has been cloned.17 The receptor is widely expressed in the brain, spinal cord, and peripheral tissues18, and the expression of the receptor is found in areas related to pain circuitry; dorsal root ganglia (DRG), dorsal spinal cord, rostral ventromedial medulla (RVM), and periaqueductal gray

(PAG).19 Studies have shown that Dyn A interacting with the KOR has inhibitory effects on the brain reward circuit by inhibiting dopamine in brain regions that are associated with drug dependence.20 In terms of pain, there has been some evidence that activation of

KOR antagonizes the analgesic effects of the MOR.21 Other studies have shown that selective KOR agonists have antinociceptive effects as well as being free of the adverse

side effects (constipation, respiratory depression, tolerance, addiction) that are mediated by the MOR.22 These selective KOR agonists have been found to be effective analgesics in visceral and inflammatory pain models.23 Although KOR agonists are free of the side effects from MOR agonists, they have been found to have dysphoria and psychotomimetic effects that limit their use in the clinic.24

Table 0.2: Binding and function of Dyn A at the opioid receptors

hMOR hDOR hKOR

Ki 1.60 ± 0.18 1.25 ± 0.12 0.05 ± 0.01

EC50 30 ± 5 84 ± 11 0.43 ± 0.08

Table generated from Zhang et al 1998. 25

Structure activity relationship (SAR) of Dyn A at KOR

An early SAR study by Chavkin and Goldstein examined truncations of Dyn (1-

13), since this fragment was found to have the same inhibitory effects as Dyn A.26

Truncations of the N-terminal tyrosine residue abolished opioid activity in the GPI assay, and therefore, the studies focused on truncations at the C-terminus. From these studies, it was found that a C-terminal modification to an amide retained high affinity.26 It was also found that Lys13, Lys11, and Arg7 residues were important for the biological activity at the

KOR, with Arg7 being the most important residue.26 From this work, it was suggested that the first 4 residues of Dyn A contain the message region, whereas residues 5-13 are the address region which is responsible for the potency and specificity at the KOR.

Further studies have been performed in many laboratories to discover key residues that imparted selectivity for the KOR over MOR and DOR. Substitution of Gly2 with DAla in

Dyn A-(1-11)NH2 to prevent aminopeptidase activity was found to not be a viable option,

as this substitution decreased biological activity. Instead, N-terminal methylation, another strategy to prevent aminopeptidase activity, was well tolerated resulting in similar

26 potency (IC50 = 0.42 nM) as parent ligand (IC50 = 0.23 nM). Our previous studies found

3 that when Gly of Dyn-(1-11)NH2 was replaced with DAla, this led to greater selectivity at the KOR over the MOR (350-fold) and DOR (1300-fold).27 Our group extensively

5 11 studied the effects of cyclization between Leu and Lys in Dyn-(1-11)NH2 and

5 11 identified a selective KOR ligand [Pen , Cys ] Dyn-(1-11)NH2 (KOR/MOR/DOR ratios= 1/2.4/165) in binding assays but was inactive in the GPI and MVD assays.28

Similar results were seen with substitutions of Tyr1 with Nα-AcTyr1, DTyr1, Phe1, or

Phe(p-Br)1, and Ile8 with DAla8. All the previous compounds were found to be up to 576- fold more selective at KOR than DOR but all had no activity in GPI or MVD assays so were not pursued any further.29 An enhancement of KOR selectivity was also seen with substitution of DPro in position 10 of Dyn (1-11)NH2 (KOR/MOR/DOR = 1/8/70, Table

0.3).30 Aldrich and colleagues used [DPro10] Dyn A-(1-11) as a template to investigate N- monoalkylated and N,N-dialkylated tyrosine derivatives. They found that all of the N- monoalkylated analogues had greater KOR selectivity when compared to the N,N- dialkylated analogues, with the greatest KOR selectivity shown by N-allyl substitution

(KOR/MOR/DOR = 1/220/9200, Table 0.3).31 Many of these analogues did not show efficacy in in vivo models of pain, and one reason may be because of low stability of the analogues. It has been found that degradation of Dyn A occurs at Tyr1-Gly2, Arg6-Arg7, and Pro10-Lys11.32 In an effort to increase the stability of the analogues as well as their blood-brain barrier (BBB) penetration, E-2078, was synthesized (H-MeTyr-Gly-Gly-Phe-

Leu-Arg-NMeArg-DLeuNHEt). This analogue was found to have a half-life (t1/2) of 4 hr

(cf, Dyn A t1/2 = 0.5 hr), and had binding affinities at the opioid receptors comparable to

Dyn A (KOR/MOR/DOR = 1/2.4/14, Table 0.3).33 E-2078 was found to be analgesic

following subcutaneous (s.c.) administration in the formalin and tail flick tests in mice

and crossed the BBB.32, 34 Another analogue that was designed for an increase in stability

was, SK-9709 (H-Tyr-DAla-Phe-Leu-ArgΨ(CH2NH)-Arg-NH2), in which the peptide

bond was replaced by a Ψ (CH2NH) bond. SK-9709 showed antinociceptive effects in the

acetic acid-induced writhing test after s.c, intracerebroventricular (i.c.v.) and i.th.

injections and was able to cross the BBB.35

Table 0.3: Common Dyn A agonists at the KOR Selectivity Compound Structure GPI (nM) (KOR/MOR/DOR)

Dyn A- (1-13) H-Y-G-G-F-L-R-R-I-R-P-K-L-K-OH 1/17/n.d.a 0.63b

c c Dyn A-(1-11)NH2 H-Y-G-G-F-L-R-R-I-R-P-K-NH2 1/17/44 1.1 ± 0.3

3 c c [DAla ] DynA-(1-11) NH2 H-Y-G-a-F-L-R-R-I-R-P-K-NH2 1/350/1300 8.1 ± 2.3

[DPro] DynA-(1-11) H-Y-G-G-F-L-R-R-I-R-p-K-OH 1/8/70d 0.22d

N-allyl [DPro10] DynA-(1-11) N-allyl,Y-G-G-F-L-R-R-I-R-p-K-OH 1/220/920d 18d

E-2078 H-MeY-G-G-F-L-R-NMeR-l-NHEt 1/2.4/14e 0.3 ± 0.03e

a SK-9709 H-Y-a-F-L-RΨ(CH2NH)-Arg-NH2 1/15/350 n.d.

a35 b13 c27 d31 e33b n.d.: not determined

Although the gold standard for relief of severe pain is MOR agonists, there are

serious side effects caused by long term administration. KOR agonists were pursued as a

pain therapeutic that would not have the adverse side effects as MOR agonists.

Unfortunately, it was found that while centrally acting KOR agonists did not have

addictive properties, they had unpleasant side effects such as dysphoria, sedation, and

diuresis.24 These side effects are mediated through the CNS and limit the use of KOR

agonists for treatment of pain at the CNS but may be beneficial in pain at the PNS. Since

KOR agonists have effects on mood, they are being examined as a treatment of the manic phase in bipolar disorder.36 KOR agonists have been found to decrease dopamine levels and are also being examined as a treatment for drug abuse, particular cocaine.37

KOR antagonists for the treatment of pain

Since Dyn A and the KOR are known to be involved in the body's response to stress, KOR antagonists could have some benefit in anxiety and depression. KOR antagonists have been found to be anxiolytic38, prevent stress-induced reinstatement of cocaine-seeking behavior39, and be beneficial in the treatment of opiate addiction.40 KOR antagonists are also being investigated as a combination therapy with MOR/DOR agonist for the treatment of pain. In an effort to develop KOR antagonists, 1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid (Tic) was replaced for Gly2 in Dyn A-(1-

11)NH2 since it is known from dermorphin and Leu-enkephalin that this substitution can convert agonists to antagonists.41 This substitution did cause antagonism at all three opioid receptors, but the selectivity for KOR was reduced (KOR/MOR/DOR =

1/0.5/0.14, Table 0.4).41 The Schiller group designed [2',6'-dimethyltyrosine (Dmt)1] Dyn

A-(1-11)NH2 analogues with the N-terminal amino group deleted or replaced with a methyl group using, 3,4-Dihydro-2H-pyran-2-methanol (Dhp) or (2S)-2-methyl-3-(2',6'- dimethyl-4'-hydroxyphenyl)-propionic acid (Mdp) to test for KOR antagonism. All of the analogues were potent KOR antagonists with weak MOR and DOR activity, with

1 dynantin ([(2S)-Mdp ] Dyn A-(1-11)NH2) being the most selective for KOR, with

42 3 subnanomolar binding affinity and antagonist activity. [Pro ] Dyn A-(1-11)NH2 is one

of the most selective KOR analogues (KOR/MOR/DOR =1/2100/3330, Table 0.4) but is a weak antagonist in both the GPI assay as well as the [35S] GTPγS assay.43

Table 0.4: Common Dyn A antagonists at the KOR

Compound Structure Selectivity Ke (nM)

(KOR/MOR/DOR)

2 a a [Tic ] DynA-(1-11)NH2 H-Y-Tic-G-F-L-R-R-I-R-P-K-NH2 1/0.5/0.14 460

b b Dynantin (2S)-Mdp-G-G-F-L-R-R-I-R-P-K-NH2 1/260/200 3.9 ± 0.7

3 c c [Pro ] DynA-(1-11)NH2 H-Y-G-P-F-L-R-R-I-R-P-K-NH2 1/2100/3300 240 ± 51

d Arodyn Ac-F-F-F-R-L-R-R-a-R-P-K-NH2 1/170/580 n.d.

e Cyclodyn c[Y-G-W-W-E]-R-R-I-R-P-K-NH2 1/12/330 n.d.

f f Zyklophin Bz-Y-G-G-F-c[d-R-R-Dap]-R-P-K-NH2 1/190/330 *84

a41 b42 c43 d44 e45 f46 Ke calculated from GPI assay, see specific citation for further details.

* Kb calculated from cAMP assay.

Aldrich and colleagues identified aromatic dynorphin (arodyn) starting from a novel chimeric peptide, extacet (a MOR selective analogue), substituted at the N- terminus in the message region. Arodyn was found to be selective for KOR

(KOR/MOR/DOR = 1/170/580, Table 0.4) and was able to completely reverse the

44 agonist activity of Dyn A-(1-11)NH2 in the cAMP assay. Aldrich and colleagues also

N,5 3 4 5 synthesized, cyclodyn, (cyclo [Trp , Trp , Glu ] Dyn A-(1-11)NH2) by connecting the

N-terminus to the side chain of the Glu5 residue. Cyclodyn was found to be selective for

KOR (KOR/MOR/DOR = 1/12/330, Table 0.4) and was able to block the agonist activity

45 of Dyn A-(1-11)NH2 in the cAMP assay. Another cyclic Dyn A analogue is zyklophin,

α 1 5 8 [N -benzyl]Tyr cyclo(DAsp , Dap ) DynA-(1-11)NH2 , which was selective for KOR

(KOR/MOR/DOR = 1/190/330, Table 0.4).46 In the cAMP assay, zyklophin antagonized

Dyn A-(1-11)NH2 with Kb= 84 nM, and also antagonized the antinocicpetive actions

induced by U50,488 in the warm water tail withdrawal assay following s.c. injection.46-47

Zyklophin was found to be more metabolically stable than other analogues, was able to cross the BBB and had a shorter duration of action (12 hrs) when compared to other KOR antagonists (ex. JDTic several weeks) (for a complete review on KOR ligands see 48).

Future directions for Dyn A based KOR ligands

KOR agonists have serious side effects (dysphoria and psychotomimetic effects) that limit their therapeutic use for pain, but have potential to treat bipolar disorder.36

Since the psychotomimetic side effects are mediated by the CNS, peripherally acting

KOR agonists may not have the these side effects and thus are currently being investigated as well as mixed MOR/KOR agonists. It has been suggested that the dysphoric effects of KOR agonists occurs through the recruitment of β-arrestin, whereas the analgesic properties do not.49 Therefore, analogues that are biased and do not recruit

β-arrestin may not have the dysphoric effects and this may be another avenue for pain management.

Another potential therapeutic for pain states that has recently been explored in our laboratory is the development of mixed MOR/DOR agonists with KOR antagonism that can be analgesics with limited side effects. One disadvantage of KOR antagonism is the long duration of action (lasting more than 21 days in vivo).50 Work is currently being carried out to develop ligands that do not have a long duration of action at the KOR.

Non-opioid effects of Dyn A

Although Dyn A has well documented opioid effects that cause analgesia there are also some effects of Dyn A that cannot be explained by the opioid receptors (see 51 for review on non-opioid effects). Walker and colleagues were one of the first to

document the non-opioid effects of the [des-Tyr1]-Dyn A fragments.52 They observed that when Dyn A-(1-13) was injected into the brain, it produced dramatic motor and behavioral effects that were different than those produced by enkephalin-containing endorphins and these effects could not be blocked by naloxone.53 These effects of Dyn-

(1-13) were similar to the effects of the [des-Tyr1]Dyn A fragment, Dyn A-(2-13), which was found not to interact with the opioid receptors. It has been found that upon release in the synapse, aminopeptidase rapidly degrade Dyn A to the des-tyrosyl fragments.54 It is well established that Dyn A has serious motor effects when injected into rats, as i.c.v. injection into the brain (either Dyn A-(1-17) or Dyn A-(1-13)) induced a barrel rotation in rats 55 and i.th. injection at high doses caused paralysis.56 All of these motor effects were not blocked by the opioid antagonist naloxone and are therefore non opioid in nature.

Levels of Dyn A have been shown to increase in the response to stressors, including neuropathic pain57, and inflammatory pain.58 An increase in Dyn A was seen in the anterior pituitary, thalamus, and spinal cord in a chronic arthritic pain model.59 Dyn A may also play a role in the inflammatory response, as evident in that Dyn A induced the release of histamine from rat mast cells60 and induced plasma extravasation.61 Both of these inflammatory responses were not blocked by naloxone, providing further evidence for the non-opioid effect. An increase in Dyn A has also been found in other pathological pain states such as chronic pancreatitis62, opioid overuse induced hyperalgesia63, bone cancer pain64, and spinal cord trauma.65

It has been demonstrated that Dyn A is not required for the initiation of pain but instead for the maintenance of pain, which was shown in prodynorphin knockout (KO) mice that had spinal nerve ligation (SNL). These KO mice had similar paw withdrawal

latency and thresholds when compared to wild type (WT) littermates days 2-6 after injury.66 After day 10 post surgery, the KO mice latency and thresholds were reduced to baseline while their WT littermates stayed below baseline.66 Neuropathic pain is characterized by hyperalgesia and allodynia, and it has been demonstrated that i.th. injection of Dyn A produced long-lasting allodynia (> 60 days) that resembled a neuropathic pain state.67 The administration of a Dyn A antiserum to nerve-injured rats reversed the neuropathic pain state.57 Similar results were seen in an inflammatory pain model, thus giving more evidence that the higher levels of Dyn A contribute to different pain states.68 All of this data has led to the hypothesis that during chronic pain states there is an up-regulation of Dyn A which results in pronociceptive effects through a non-opioid mechanism to maintain the pain state.

N-methyl D-aspartate receptor (NMDAR) as the target for non-opioid effects

The NMDAR is a channel that consists of a tetrameric structure of seven subunits.69 Upon binding of its endogenous agonists, glutamate and glycine, the channel opens and allows the influx of positive ions Na+ and Ca2+. Many studies have found that

NMDAR antagonists can prevent Dyn A-induced neurological dysfunctions such as loss of tail-flick reflex70, hindlimb paralysis, and mortality.70b, 71 Pretreatment of the NMDAR antagonist, MK-801, prevented Dyn A-induced allodynia whereas naloxone did not.67

Further evidence for the NMDAR as the non-opioid target is that after spinal infusion of

Dyn A-(2-13) an increase in prostaglandin E (PGE2) and excitatory amino acids were measured and were blocked by the NMDAR antagonist, amino-5-phosphonovalerate,

AP5.72 The release of excitatory amino acids was also seen after the addition of Dyn A to the rat hippocampus.73

Direct evidence for Dyn A interacting at the NMDAR was obtained from competitive binding assays, showing that Dyn A-(1-13) could displace part but not all of

[3H] glutamate in rat brain membranes.74 Further competitive binding of Dyn A with

NMDAR antagonists, [3H] MK-801 and [3H] CGP39, 653, showed moderate to low affinity.75 Dyn A's affinity at the NMDAR was directly measured using [125I] Dyn A-(2-

76 17) with Kd = 10 nM. In the same study, it was also found that NMDAR antagonists that occupy the closed state of the channel (AP-5, ifenprodil, and 7-chlorokynurenic acid (CKA)) potentiated the affinity of [125I] Dyn A-(2-17).76 This suggests that Dyn A prefers the closed inactive state of the receptor and may behave as an antagonist. An inhibitory action of Dyn A at the NMDAR does not explain the excitatory effects of Dyn

A shown in vivo. Also, it was found that in cortical neurons, Dyn A-(2-17) induced an increase in Ca2+ which cannot be blocked by MK-801, and therefore, suggests a different mechanism.77 These data argue against the NMDAR as a direct target for the non-opioid effects of Dyn A. It is well established that the neurotoxic effects (paralysis, and neuronal loss) of Dyn A are blocked by MK-801, which suggests that these effects may be mediated in part by the NMDAR.

Bradykinin receptors (BRs) as the target for non-opioid effects

It was found that in cultured neurons of neonatal rat cortex, Dyn A-(2-17) induced an increase in Ca2+ that was not blocked by naloxone or MK-801.77 The Lai group later discovered that the non-opioid excitatory effects of Dyn A were mediated by the BRs.78

In their study, Dyn A-(2-13) was shown to induce a transient increase in Ca2+ in rat DRG as well as the F11 cell line (hybridoma of rat DRG and mouse neuroblastoma cells). By using Ca2+ channel blockers, they found that this effect was mediated by P/Q and L type

Ca2+ channels.78 In an effort to determine what receptor Dyn A-(2-13) was interacting with to cause the Ca2+ influx, antagonists for each receptor known to be present in the

F11 cell line were tested. The bradykinin 2 receptor (B2R) antagonist, HOE140, was the only antagonist that had an ability to abolish Dyn A-(2-13) induced Ca2+ influx, whereas, the other antagonists including MK-801, an NMDAR antagonist, had no effect.78

Competitive radioligand binding assays showed that Dyn A-(2-13) displaced [3H]

78 Bradykinin (BK) with moderate affinity (IC50 = 4 μM). Recently, we have found that

Dyn A-(2-13) binds with high affinity to BRs in rat brain membranes (IC50 = 170 nM), and an underestimation of the affinity was caused by changes in pH.79 H89, a protein kinase A (PKA) inhibitor, was able to abolish Dyn A-(2-13)'s neuroexcitatory effects. On the basis of this, it was proposed that the pronociceptive effects of Dyn A arise from activation of the BRs that couples a PKA pathway to activate L and P/Q type Ca2+ channels.78 Further study showed that HOE140 was able to block Dyn A-(2-13)'s neuroexcitatory effects in rats78, supporting the notion that Dyn A's pronociceptive effects are mediated through the BRs.

The mRNA for the B2R was measured in the DRG, and a higher expression of transcript was measured after nerve-injury. In the spinal cord of nerve-injured rats, low levels of the precursor to BK, kininogen, was measured. In contrast, high levels of transcript for the precursor of Dyn A, prodynorphin, was measured.78 Since the BRs are present in the spinal cord but the endogenous ligand, BK, or its precursor are not, it is hypothesized that Dyn A may be the endogenous ligand for the BRs in the spinal cord under pathological pain conditions. Taken together, it is now believed that the

development of BRs antagonists to block Dyn A's pronociceptive actions can be an avenue for the treatment of chronic neuropathic pain (Figure 0.3).

Figure 0.3: Dyn A in the spinal cord during nerve injury or chronic pain state.

80 The BRs are Gq coupled GPCRs, and signal through phospholipase C. The endogenous ligands for the BRs, BK and kallidin (KD), have been found to be mediators of inflammation, and therefore, antagonists have been designed to block the hyperalgesic effects caused by activation of the BRs (in particular the B2R).81 In addition to the inflammatory response of BK, the ligand has also been found to be cardioprotective and a regulator of blood pressure.82 Early studies aimed to develop B2R antagonists based on

BK for the treatment of pain had undesirable cardiovascular side effects (see 83 for review on BR antagonists). However, considering the cardiovascular effects are limited to the

peripheral B2Rs, centrally acting B2R antagonists can avoid these serious side effects.

Since Dyn A's non-opioid effects are mediated through CNS BRs, the inhibition by BR antagonists in the CNS will result in anti-hyperalgesic effects without cardiovascular liabilities.

GPCRs as a target for drug design

G-protein coupled receptors (GPCRs) are important signal transduction proteins and much of the cell-cell communication is mediated through them. It is estimated that more than 2% of the 30,000 human genes code for GPCRs.84 GPCRs as a class have physiological importance because they encompass a broad variety of ligands such as; hormones, ions, amino acids, and neurotransmitters. They also contain a high level of complexity that leads to their role in many pathophysiological processes.84 For these reasons, GPCRs are the target for many therapeutics and 30% of the top selling pharmaceuticals target this superfamily.84

All GPCRs discovered to date consist of 7 hydrophobic segments that fold to form a 7 transmembrane (7TM) protein. These 7TM proteins are connected by three intracellular and three extracellular loops (ECL).85 Even though there is low amino acid sequence homology between different GPCRs, and the endogenous ligands for the receptors are structurally very different, the global structure of the 7TM is conserved.85

Since GPCRs are transmembrane proteins, and large quantities of the purified receptor is difficult to obtain, the NMR and x-ray crystal structures have not been solved (recently the x-ray structure of rhodopsin, and the opioid receptors were solved and it correlated well with previous structural models). Even though most GPCR structures have not been determined by NMR or x-ray, electron density maps have been constructed using

cryoelectron microscopic analysis.86 Through these electron density maps and other evidence, it is believed that transmembrane III is the central helix and that the other helices are placed counterclockwise as viewed from outside the cell.86 In the rhodopsin- like family (of which the BRs belong), ArgIII:26, which is located in TM-III, is the only residue conserved in this class, and this residue is believed to be involved with the signaling to the G-protein.86 It is suggested that intracellular loops 2 and 3 and part of the

C-terminal tail are also important for the G-protein interaction.87 Another highly conserved feature is a disulfide bridge between the Cys at the top of TM-III and a Cys located in the middle of the second extracellular loop, which makes two extra loops.88 On the amino-terminal segment, there are several Asn-X-Thr/Ser recognition sites for glycosylation.89 Although glycosylation does not appear to be important for ligand binding, it is a posttranslational modification that ensures that the protein is folded correctly and for intracellular transport.89 There are also conserved proline residues in

TMV, VI, and VII which are suspected to create weak areas in these helices.90 It is hypothesized that these proline residues may be involved in dynamics and allow the helices to wobble for ligand and/or g-proteins to associate/dissociate.90 Upon activation of the receptor, Thr and Ser residues on intracellular loop 3 and the C-terminal tail are phosphorylated.91 This phosphorylation leads to desensitization and down regulation of the receptor. Figure 0.4 summarizes the structural characteristics of this family of

GPCRs.

Figure 0.4: Structural characteristics of the rhodopsin-like GPCR family. Key conserved residues are shown, and in dark gray are residues that have been found to interact with the g-protein.

Signaling of GPCRs

GPCRs are involved in many cellular processes and active various second messengers. Upon binding of the agonist, there is a conformational change that occurs and the exchange of GTP for GDP on the α subunit causes the βγ subunits to dissociate from the α subunit.92 The α subunit can than activate second messengers depending on what type of g-protein was recruited. Gs-coupled GPCRs activate adenyly cylcase (AC) that leads to production of cAMP which further leads to the production of protein kinase

92 A (PKA). Gi-coupled GPCRs inhibits AC so there is no production of cAMP or PKA.

Upon activation of Gq-coupled GPCRs, phospholipase C (PLC) is activated which leads

92 to the activation of diacylglycerol (DAG) and IP3. The Go-coupled, and particularly the

93 G12/13 coupled GPCRs couple the monomeric GTPase RhoA.

Figure 0.5: Signaling of the four types of G-proteins of GPCRs.

Aims

As previously discussed the treatments for neuropathic pain are ineffective.

Ligands that target the interaction of Dyn A at the B2R may be beneficial therapeutics with limited side effects. In this thesis we will describe the design and synthesis of Dyn A analogues and analyze their SAR, stability and toxicity. We will also study the downstream signaling of Dyn A at the B2R. Examination of a different isoform of the

B2R that may be present in the CNS can be a novel target for the treatment of neuropathic pain and will be presented.

PART I:

DESIGN AND SYNTHESIS OF DYNORPHIN A ANALOGUES INTERACTING

AT THE BRADYKININ 2 RECEPTOR WITH EVALUATION OF BINDING,

STABILITY, AND TOXICITY

INTRODUCTION

It is well documented that an up-regulation of Dyn A occurs under chronic pain conditions and can have neuroexcitatory and neuroinhibitory effects (Figure 1.1). The neuroexcitatory effects are hyperalgesic and are thought to be mediated by interaction with the B2Rs. Therefore, B2R antagonists based on Dyn A's structure that can inhibit the neuroexcitatory effects are desired.

Figure 1.1: Dyn A effects

Model of BK bound to the B2R

To develop antagonists, a SAR study to determine a minimum pharmacophore is needed. In most SAR studies, knowledge of the receptor's structure is important to develop analogues that can interact with key residues on the receptor. Since the B2R is a

GPCR, which is a membrane bound receptor, structural determinations are difficult and to date there is no crystal structure of the B2R. Although there is no crystal structure, mutagenic, molecular dynamics, NMR, and modeling studies have been used to develop a model of BK bound to the peripheral B2R. In mutagenic studies of the rat B2R, residues Asp175, Glu178, Glu179, Asp268, Glu282and Asp286 were found to be important in binding BK and were hypothesized to be interacting with either the N or C-terminal Arg of BK (Figure 1.2A).94 NMR studies of the B2R in micelles have predicted that BK adopts a twisted S structure with a C-terminal β-turn that is proposed to be buried in the

receptor.95 It has been further proposed that the amino group on the N-terminus along with the guanidinium group of Arg1 interacts with the negatively charged Asp268 and

Asp286 residues found on TM-VI and ECL3 respectively.96 Similar studies and results have also been seen at the human B2R.97 Modeling also discovered a hydrophobic core consisting of Phe261, Leu104, Val108, and Ile112 located near Pro7 in BK (Figure 1.2B).96 In previous studies, a mutation of Phe261-Ala261 resulted in a loss of affinity, which points to the importance of this residue in the core.98

Figure 1.2A: Model of BK bound to the B2R from NMR and mutagenic studies.

Receptor is shown in blue, BK in yellow, important residues in red and non-important residues in green. Figure 1.2B: Model of the important hydrophobic contacts of the receptor (blue) and BK (yellow). Reprinted with permission from 96. Copyright 1994

American Chemical Society.

Strategies in designing analogues

Since BK and Dyn A are very different in structure, they may not be interacting with the same residues of the receptor. Also, there is evidence that the B2R in the brain is

different than the B2R previously characterized (see Part III). This would make the above structural data of little use. Therefore, to look at the SAR of Dyn A analogues at the B2R, truncations of one residue at a time at the N and C-termini can be synthesized, and tested to determine how the truncations affect affinity.99 Deletion of residues can also be made within the sequence to test which residues are important. In addition, to determine which functional groups are important, scans (alanine, glycine or D-amino acid) can be carried out and the gain or loss of affinity/function can indicate the importance of certain side chains.99 In order to examine the binding pocket of the analogues to the receptor, residues can be substituted for one another to test the steric, basic, hydrophobic, and/or hydrophilic properties.99 Since linear peptide are very flexible and have limited 3D information, the backbone can be restricted by N-methylations or amide-bond replacements.99 Cyclizations of the peptide can also be employed as a constraint to limit flexibility. Once a minimum pharmacophore has been found, analogues can be tested in in vitro functional assays and modifications to individual residues can be done to change the function to an antagonist.

Peptides as therapeutics

Peptides have recently become more prevalent as therapeutics, in part due to their greater efficacy, selectivity and specificity over small molecules.100 The degradation products of peptides are less toxic and have a lower accumulation in tissues.101 One of the major obstacles in developing peptide therapeutics is their short half-lives because of their susceptibility to degradation by peptidases. Peptidases from the plasma of blood, lumen of the small intestine, and brush border membrane of epithelial cells rapidly degrade peptides.102 Therefore, in order to increase the stability, various kinds of

chemical modifications similar to above; cyclizations, N or C-terminal modifications, unnatural amino acid substitutions, and peptide backbone modifications have been successfully applied to peptides.

Another drawback of peptides as therapeutics that limit their use is their lack of oral bioavailability and low permeability across membranes. In particular, therapeutics for pain management will need to cross the blood brain barrier (BBB) and interact with the CNS. To test for permeability at the BBB, caco-2 cells, a human epithelial colorectal adenocarcinoma cell line that resembles the lining of the small intestine, is commonly used as a test for membrane permeability. One option for increasing permeability is glycosylation of the peptide using β-D-glucose that is transported via the GLUT-1 transporter at the BBB.103 Figure 1.3 summarizes our approach to the drug discovery process. At any point in the cycle if an analogue does not meet an minimum criteria (i.e.

IC50 ≤ 300 nM, t1/2 ≥ 5 h, etc) further design and synthesis of analogues can be done.

Figure 1.3: Drug discovery cycle

Rational

The blockade of Dyn A-(2-13) interacting at the B2R may be a therapeutic for neuropathic pain. In order to develop a ligand that will antagonize Dyn A-(2-13), a structure activity relationship (SAR) was carried out. Analogues of Dyn A-(2-13) were designed and synthesized by truncations at the N and/or C-terminus as well as deletions of amino acids within the sequence. These analogues were tested in a competitive binding assay to determine their affinity at the B2Rs present in rat brain membranes. This allowed a minimum pharmacophore for recognition at the B2R to be determined. We hypothesize that we will discover a lead analogue that will have high affinity for the B2R (100 nM), be able to block Dyn A's neuroexcitatory effects, effective in a neuropathic pain model, high stability and non-toxic.

CHAPTER I: MATERIALS AND METHODS

1.1 Reagents for Fmoc Solid Phase Peptide Synthesis (SPPS)

Amino acids and reagents were purchased from Advanced Chem Tech (Louisville, KY),

Chem-Impex International (Wood Dale, IL) and AAPPTec (Louisville, KY). Resins were purchased from Chem-Impex International (Wood Dale, IL) and NovaBiochem

(Darmstadt, Germany). Solvents used were purchased from Aldrich (St. Louis, MO) and

EMD (Darmstadt, Germany). Glassware used was from Kimble USA Incorporated

(Vineland, NJ) and Pyrex (Lowell, MA). All other materials were purchased from VWR

(West Chester, PA).

1.2 SPPS

All Dyn A analogues were synthesized by standard solid phase peptide synthesis (SPPS) using fluorenylmethyloxycarbonyl (Fmoc) chemistry on preloaded (Lys, DLys, Phe,

DPhe, Orn, His, or Arg) Wang Resin (Figure 1.4 shows an example of the Fmoc-

Lys(Boc)Wang resin). The resin was swelled for approximately 3 hrs in dichloromethane

(DCM), and deprotection was carried out using 20% piperidine. Between deprotection and coupling, washing steps (3x DMF, 3x DCM, 3x DMF) were used for removing side products and excess reagents. To detect free amines after deprotection, a Kaiser test was carried out. The Kaiser test consists of the following solutions; a 5% (w/v) ninhydrin solution in ethanol, 80% (w/v) phenol in ethanol, and 200 nM potassium cyanide (KCN) in pyridine. A positive test (blue beads) indicates a free amine whereas a negative test

(clear beads) ensures coupling. For coupling, 3 eq. of the next amino acid, 3 eq. of both coupling reagents N-hydroxybenzotriazole (HOBt) and 2-(1H-benzotriazole-1-yl)-

1,1,3,3-tetramethylaminium hexafluorophosphate (HBTU) and 6 eq. of the base DIPEA

(diisopropylethylamine) were used. HOBt was used to reduce racemization while HBTU was used to increase the yield as well as reduce racemization. For cleavage of the peptide from the resin and for deprotection of side chain protecting groups, a solution of 95% trifluoroacetic acid (TFA), 2.5% triisopropylsilane (TIS), and 2.5% water was used

(Figure 1.6 shows scheme for SPPS).

Figure 1.4: Structure of Fmoc-Lys(Boc) Wang resin. Shown in blue is the Wang resin, green the Boc protecting group, black the lysine amino acid, and red is the Fmoc protecting group.

Figure 1.5: Structures of the coupling reagents HOBt and HBTU used to synthesize Dyn

A analogues.

Figure 1.6: Scheme for the synthesis of Dyn A analogues

1.3 Peptide purification and analysis

The peptides were purified by reverse phase high performance liquid chromatography

(RP-HPLC) (Agilent 1100 with Vydac 218TP510 C-18 column) using a gradient system

(10-40% acetonitrile in 15 mins). Peptides were analyzed by high resolution mass spectrometry and were ≥ 95% pure as determined by RP-HPLC.

1.4 Materials for membrane preparations and competition assays

Bovine Serum Albumin (BSA), Phenylmethylsulfonylfluoride (PMSF), captopril,

+ + bacitracin, Tris-HCl, K Na tartrate:CuSO4:Na2CO3 , NaOH were purchased from Sigma

Aldrich. Male Sprague Dawley rats (250-300g) were obtained from Harlan (Indianapolis,

IN). [3H]Bradykinin (BK) and [3H] Des-Arg Leu9 Kallidin (DALKD) were obtained from

Perkin Elmer. Minimum Essential Media (MEM), fetal bovine serum (FBS), amphotericin penicillin streptomycin (APS), and trypsin were obtained from Gibco. Rat

plasma was obtained from Pel-Freez Biologicals (Lot 07230) and human plasma

(Lithium Heparin) was bought from Innovative Research (Lot 13787).

1.5 Membranes preparations for; rat brain, hB2R-HEK cells, and hB1-HEK cells

Crude membranes were prepared from fresh whole tissues isolated from male Sprague

Dawley rats, or cultures of transfected HEK 293 cells. Tissues/cell pellets were homogenized with a Polytron PT 2100 homogenizer (Pittsburgh, PA) in ice-cold buffer

(50 mM Tris-HCl, pH 7.4 and 100 µM PMSF) followed by centrifugation at 4,000 rpm in a Beckman JA-18 rotor for 15 min at 4 °C with the supernatants collected. The procedure was repeated, and the supernatants were then centrifuged at 17,500 rpm in a Beckamn

JA-18 rotor for 30 min at 4 °C. Crude membrane pellets were resuspended in the same ice-cold buffer as above for storage at -80 ºC until use. Protein concentration was determined by the Lowry method.104

1.6 Protein determination

For the Lowry assay, NaOH was first added and heated to 50 ºC for 30 minutes. Next,

+ + 0.1:0.1:10 K Na tartrate:CuSO4:Na2CO3 [AKA Ellman's Reagent] was added to each sample and sat at rt for 10 mins. Lastly, 1 N Folin's Reagent was added and sat for 30 minutes at rt and absorbance was read at 700 nm. Bovine serum albumin (BSA) was used as a standard.

1.7 Competitive radioligand binding assay

Crude membranes were pelleted and resuspended in assay buffer [50 mM Tris, pH 6.8, containing 50 g/mL bacitracin, 10 M captopril, 100 M PMSF, 5 mg/mL BSA]. For competition assays, 10 concentrations of a test compound were each incubated with 50

g of membranes and 1 nM [3H]BK. Non-specific binding was defined by that in the

presence of 10 M Kallidin (KD) in all assays. Incubations were carried out in a shaking water bath at 25 °C for 120 min. Reactions were terminated by rapid filtration through

Whatman GF/B filters (Gaithersburg, MD) presoaked in 1% polyethyleneimine (PEI), followed with four washes of 2 mL cold saline.

1.8 Rat and human plasma stability assay

Stock solutions of compounds (50 mg/mL in water) were diluted 5-fold into rat plasma

(Pel-Freez Biologicals Lot 07230) or Human Plasma (Lithium Heparin Innovative

Research Lot 13787 ) and incubated at 37 °C. After the following timepoints; 1h, 2h, 4h,

6h, 12h, 24h, 100 uL of sample was added to 150 uL EtOH, stopping the reaction.

Samples were spun down at 10,000 rpm for 15 mins and 100 uL of the supernatant was analyzed by RP-HPLC (Agilent 1100 autosampler with YMC AA12S05-2546WT C-18 analytical column).

1.8.1 Isolation and validation of a degraded fragment of LYS1044

10 mg/mL of LYS1044 was added to rat plasma and the reaction was stopped by

EtOH after 30 min. After the sample was spun down, the supernatant was put on

an HPLC and the fractions before the main peak corresponding to the intact

peptide were collected. The collected fractions were analyzed on a LCQ classic

with ESI (Finnigan, Thermoelectron).

1.8.2 Data Analysis

In binding assays, data were analyzed by non-linear least squares analysis using

GraphPad Prism (Version 6). For the stability assay, the half-life was calculated

by the following equation; t1/2=0.693/b, where b is the slope found in the linear fit

of the natural logarithm of the fraction remaining of the parent compound vs.

incubation time.105 The samples were tested in 3 independent experiments (n=3).

Statistical significance was determined by a one way ANOVA followed by a

Tukey's analysis using Graphpad Prism 6.

1.9 Cell culture

Human Embryonic Kidney (HEK) cells were maintained in Minimum Essential Medium

(MEM) supplemented with 10% FBS, 100 UmL-1 penicillin and 100 μg/mL streptomycin in a 37 ºC, 95% air/5% CO2 humidified atmosphere. Cells were washed in

Phosphate Buffered Saline (PBS) and when ~90% confluent were passaged using 0.25% trypsin.

1.10 XTT cytotoxicity assay

Cells were seeded in a 96 well plate at a density of 10,000 cells/well. Nine concentrations of test compound were added to cells and incubated for 2 h, 12h, or 24 h. After the incubation, 50 uL of Activated-XTT Solution (ATCC Cat. No. 30-1011K) was added to the wells. Three hours after incubation with the XTT solution, absorbance on a Biotek

Synergy 2 was measured at 475 nm (specific absorbance) and 660 nm (non-specific absorbance). Data was collected from 3 independent experiments with assays done in triplicate.

CHAPTER II: RESULTS

2.1 Establishment of Dyn A-(2-13) binding at the B2R

2.1.1[3H] DALKD binding

We first carried out pilot experiments to establish our radioligand binding

assay conditions. We conducted a series of competitive binding assays with

[3H]DALKD using BK, which is selective for the B2R; KD, which has high

affinity for both B1R and B2R; and DALKD, which has been shown to be

selective for the B1R.106 Results from these assays are shown in Table 1.1.

Table 1.1: Radioligand competition analysis of BK, KD, and DALKD in

transfected HEK 293 cells expressing the hB1R or hB2R.

hB2-HEK Cells hB1-HEK Cells

[3H]DALKD [3H]BK [3H]DALKD Ligand IC50 ± s.e.m. IC50 ± s.e.m. IC50 ± s.e.m.

(nM)a n (nM)a n (nM)a n

BK 45 ± 1 4 68 ± 23 4 2800 ± 310 3

DALKD 28 2 89 2 n.d.

KD 33 2 40 2 5 2

All assays were carried out at pH 6.8, and the concentration of both radioligands

a used was 1 nM. IC50 values were obtained by non-linear least squares analysis of

at least 2 independent experiments (n) and expressed as mean + s.e.m for those

conditions of 3 or more independent experiments. n.d.: not determined.

Unexpectedly, we found that [3H]DALKD binds specifically to both

transfected hB1R and hB2R in our competition assays, indicating that this

radioligand is not selective for the B1R. Labeling the hB2R with either

3 3 [ H]DALKD or [ H]BK yielded similar IC50 values for BK and DALKD in the competitive binding assays, suggesting that [3H]DALKD labeled the same receptors as [3H]BK (Table 1.1). The data also confirm the pharmacological characteristics of the hB1R and hB2R, as BK showed a selectivity of 60 fold for

B2Rs, whereas KD binds both hB1R and hB2R with high affinity (Table 1.1). It is interesting to note that the IC50 value for BK at the hB2R is an order of magnitude greater than its KD value (2.3 nM). The reason for that is not known, but we postulate that if the hB2R exists predominantly in a lower affinity state for BK in the cell membrane preparations, this population would be apparent in the competition assay but not in the saturation analysis. Based on these findings, we conducted all the subsequent binding analyses using [3H]DALKD or [3H] BK as our principle radioligands.

2.1.2 High affinity of Dyn A-(2-13) at the B2R

Competitive binding analysis of Dyn A-(2-13) against [3H]DALKD in rat brain membranes showed that, under low ionic strength buffer conditions of 50

mM Tris, the affinity of

) )

d d n

n Dyn A-(2-13) at the B2R

u u o

o 100

B B

c pH 6.8

i i f

f varied significantly within i

i 75 c

c pH 7.4

e e p

p pH 8.0

S S

50 pH 8.5 a relatively narrow pH

% %

( (

D 25

K K L

L range of 6.8 to 8.5 (Table

A A

D D

] ] H

H -13 -12 -11 -10 -9 -8 -7 -6 -5 -4

3 3 [ [ 1.2). The apparent affinity Log[Dyn A-(2-13), M] of Dyn A-(2-13) is the

highest at pH 6.8, with an

IC50 value of 22 + 2 nM. The binding of the peptide assumed a one-site fit; as the

Hill slope was -0.88 (Table 1.2, Figure 1.7). At higher pH, the peptide's affinity for the B2R had shifted by almost two orders of magnitude, to 1700 + 330 nM at pH 8.5 (Table 1.2). At the intermediate range of pH 7.4 and pH 8.0, the transition of the binding of Dyn A-(2-13) from high affinity to moderate affinity was apparent. At this intermediate range of pH, the Hill slopes deviated from -1 (Table

1.2, Figure 1.7), suggesting that under these conditions, Dyn A-(2-13) interacted with both a high and a low affinity site of the receptor.

Table 1.2: Competitive binding analysis of Dyn A-(2-13) against

[3H]DALKD in rat brain membranes at different pH buffer conditions.

a b pH IC50 (nM) ± s.e.m nH N

6.8 22 ± 2 -0.88 5

7.4 48 ± 27 -0.53 3

8.0 140 ± 6 -0.66 3

8.5 1700 ± 330 -0.87 3

3 a Concentration of [ H] DALKD was 1 nM. IC50 ± s.e.m. was calculated by non- linear regression analysis from at least 3 independent experiments. bHill coefficient obtained by non-linear regression analysis from pooled data shown in

Figure 1.7.

We have previously reported that the affinity of Dyn A-(2-13) at the B2R

78 was moderate, with Ki values around 1 μM. The present findings suggest that the affinity of Dyn A-(2-13) was underestimated in the earlier study, and could have been, at least in part, a result of inadvertent shifts of the buffer to a more basic pH.

It should be noted that the affinity of BK for the B2R is also sensitive to pH 107,

and that the optimal assay condition for BK binding and function at the B2R is commonly carried out at pH 6.8. The similar optimal binding conditions between

Dyn A-(2-13) and BK to the B2R suggests that the two peptides may interact with the same conformational state of the B2R assumed at pH 6.8. The high affinity binding of Dyn A-(2-13) to the B2R, its sensitivity to pH, and similar optimal binding conditions as that observed for BK, substantiate our hypothesis that Dyn

A is a ligand of the B2R. This high affinity interaction occurs within a fairly narrow range close to neutral pH, and thus is likely to be physiologically relevant.

2.1.3 Selectivity of Dyn A-(2-13) for the B2R over B1R

Dyn A-(2-13)'s specificity at the B2R, was also tested using the hB2R in stably transfected HEK 293 cells. Dyn A-(2-13) showed similar affinities in competitive binding assays against [3H]DALKD at the hB2R when compared with that for the BRs in adult rat brain (Table 1.3). These data confirm the high affinity interaction of Dyn A-(2-13) at the B2R, and that the [3H]DALKD-labeled sites in rat brain membranes are predominantly of the B2 type. The ability of Dyn

A to interact with the B2R was also supported by the observation that Dyn A-(1-

17) competed against the binding of [3H]DALKD at both rat and human B2R, albeit with lower affinity than that of Dyn A-(2-13) (Table 1.3). The difference in the IC50 values for the two peptides was smaller for the hB2R-HEK, by only about 2 fold, but by 10 fold in rat B2R (Table 1.3). Thus, the B2R can interact with both opioid and non-opioid fragments of Dyn A. The differences in affinity implicates a structure activity relationship (SAR) in Dyn A's interaction with the

B2R. We postulate that the non-opioid actions of Dyn A could override its opioid activity as proteolytic fragments of Dyn A remain biologically active.

Table 1.3: Competitive binding analysis of Dyn A-(1-17) and Dyn A-(2-13) against [3H] DALKD in membranes from rat brain or transfected HEK 293 cells expressing the hB2R.

Rat Brain Membranes pH Dyn A(2-13) Dyn A(1-17) a b a b IC50 (nM) ± s.e.m nH N IC50 (nM) ± s.e.m nH N 6.8 22 ± 2 -0.88 5 220 ± 61 -0.79 3 7.4 143 ± 22 -0.58 15 426 ± 92 -0.85 3 hB2-HEK Membranes pH Dyn A(2-13) Dyn A(1-17) a b a b IC50 (nM) ± s.e.m nH N IC50 (nM) ± s.e.m nH N 6.8 62 ± 21 -0.99 3 123 ± 27 -0.79 3 7.4 78 ± 17 -0.63 3 127 ± 3 -0.59 3 3 a Concentration of [ H] DALKD was 1 nM. IC50 ± s.e.m was calculated by non- linear regression analysis from at least 3 independent experiments bHill coefficient obtained by non-linear regression analysis of pooled data from above experiments.

We also examined

)

n u

the affinity of Dyn A-(2- o 100

i f

i hB2R-HEK

c 75 e hB1R-HEK

13) at the hB1R by p

% 50

(

similar competitive K

L 25

]

H 0

binding assays against 3

[ -13 -12 -11 -10 -9 -8 -7 -6 -5 -4 Log[Dyn-A(2-13), M] [3H]DALKD in transfected

HEK 293 cells expressing the hB1R (Figure 1.8).

Contrary to our observations at the B2R, Dyn A-(2-13) exhibited much lower

affinity (IC50 > 10 μM) at the hB1R at pH 6.8 (Figure 1.8, Table 1.4). Similar

affinity was observed at pH 7.4 (Table 1.4). The affinity of Dyn A-(1-17) at the

hB1R was also in the micromolar range under the same conditions (Table 1.4).

Thus, within a narrow range around neutral pH, Dyn A is selective for the B2R.

This apparent selectivity further substantiates the specific interaction between

Dyn A and the B2R.

Table 1.4: Competitive binding analysis of Dyn A-(1-17) and Dyn A-(2-13)

against [3H]DALKD in membranes from transfected HEK 293 cells expressing t

he hB1R.

pH Dyn A-(2-13) Dyn A-(1-17)

a a IC50 (nM) ± s.e.m n I50 (nM) ± s.e.m N

6.8 >10,000 5 >10,000 3

7.4 >10,000 4 6000 ± 2700 4

3 a Concentration of [ H] DALKD was 1 nM. IC50 ± s.e.m was calculated by non-

linear regression analysis from at least 3 independent experiments.

2.2 Design and synthesis of Dyn A analogues

2.2.1 Peptide synthesis

The Dyn A analogues were synthesized by standard Fmoc-chemistry with

~50-80% crude purity. Purification was simple and fast in part to the analogues

short retention times (RT), owing to their hydrophilic nature. The peptides'

identities were confirmed by high resolution mass spectrometry (HR-MS) and the

final purity of all analogues was ≥ 95%. Low yields were obtained (< 20%) for

some analogues and were attributed to loses during purification as the injection

port was leaking (Table 1.5).

Table 1.5: Analytical data of Dyn A analogues LowMS a HRMS b HPLCc molecular Cpd aLogPsd formula error tR % Observed Observed calcd. (ppm) (min) Yield

e e S1F C50H89N19O8 1084.7 362.2456 362.2453 -0.8 9.7 -0.78 ND

f f S1Nal C54H91N19O8 1134.7 567.8714 567.8722 1.4 12.1 -0.21 ND

f f S2F C50H88N20O9 1113.6 557.3576 557.3594 3.4 9.4 -2.04 ND

SH110 C50H89N17O9 1072.8 1072.7094 1072.7102 0.8 8.1 -1.81 13%

SH111 C50H88N16O9 1057.7 1057.6986 1057.6993 0.6 10.2 -1.61 17%

f f SH112 C45H82N16O8 975.7 488.3314 488.3324 2.0 4.2 -2.00 12%

SH113 C41H79N17O8 938.7 938.6356 938.6370 1.5 7.5 -2.30 31%

f f SH114 C56H100N22O10 1241.8 621.4070 621.4062 -0.2 8.5 -1.92 10%

SH116 C44H76N14O8 929.7 929.6040 929.6043 0.3 14.5 -1.63 18%

f f SH118 C35H67N9O7 726.4 363.7654 363.7655 -0.1 7.9 -1.42 20%

SH119 C44H77N11O8 888.5 888.6016 888.6029 1.6 8.9 -1.22 11%

SH120 C47H90N12O9 967.7 967.7014 967.7026 1.3 7.8 -1.23 41%

f f SH121 C56H100N14O10 1167.8 565.3939 565.3946 1.2 10.6 -1.10 7%

f f SH122 C44H76N14O8 929.6 465.3058 465.3058 -0.1 11.1 -1.62 44%

SH123 C44H76N10O8 873.5 873.5914 873.5920 0.8 9.0 -1.00 12%

SH124 C35H67N9O7 726.3 726.5251 726.5236 -2.0 7.9 -1.53 11%

SH125 C35H67N13O7 782.5 782.5353 782.5359 0.8 8.2 -2.09 26%

SH126 C29H56N8O6 613.5 613.4385 613.4396 1.7 6.4 -1.87 15%

SH127 C41H79N11O8 854.5 854.6189 854.6186 -0.4 7.9 -1.51 28%

SH128 C47H90N12O9 967.7 967.7028 967.7026 -0.2 9.8 -1.27 11%

SH129 C29H56N10O6 641.4 641.4454 641.4457 0.4 6.6 -2.16 22%

SH130 C29H56N10O6 641.4 641.4454 641.4457 0.4 6.6 -2.16 23%

f f SH132 C29H51N11O6 650.4 325.7085 325.7085 0.0 6.5 -2.16 3%

SH133 C29H56N10O6 641.5 641.4450 641.4457 1.0 6.1 -1.91 19%

SH134 C28H54N10O6 627.5 627.4297 627.4301 0.6 5.8 -2.30 42%

SH135 C29H56N10O6 641.5 641.4474 641.4457 2.6 6.4 -2.16 31%

SH136 C29H56N10O6 641.6 641.4461 641.4457 -0.6 6.3 -2.16 41%

SH137 C44H76N14O8 929.6 929.6041 929.6043 0.3 10.5 -1.62 12%

SH138 C49H78N14O8 991.6 991.6209 991.6200 0.9 12.5 -1.26 17%

SH139 C49H78N14O8 991.5 991.6209 991.6200 0.9 12.5 -1.26 4%

SH140 C46H76N14O8S 985.6 985.5804 985.5764 4 12.4 -1.34 9%

SH141 C48H82N14O8S 983.7 983.6525 983.6513 1.2 11.8 -1.38 26%

SH142 C44H76N14O8 929.7 929.6040 929.6043 -0.3 10.1 -1.62 33%

SH143 C44H76N14O8 929.5 929.6023 929.6043 2.2 10.5 -1.62 10%

f f f SH144 C44H76N14O8 465.3 465.3055 465.3058 0.3 10.0 -1.62 23%

SH145 C44H76N14O8 929.6 929.6057 929.6043 -1.5 9.9 -1.62 11%

SH146 C44H76N14O8 929.7 929.6040 929.6043 0.4 12.1 -1.62 19%

SH147 C44H76N14O8 929.6 929.6034 929.6043 -1.0 12.4 -1.62 19%

f SH150 C44H76N14O8 465.3 929.6042 929.6043 -0.1 11.3 -1.62 34%

LL100 C28H54N10O6 627.3 627.4300 627.4300 0.2 9.8 -2.31 32%

LL101 C28H49N11O6 636.4 636.3942 636.3940 < 3 9.4 -2.43 9%

LL103 C41H70N10O8 831.5 831.5450 831.5451 0.1 9.3 -2.43 40%

f f LL106 C41H79N15O8 910.6 455.8187 455.8191 0.9 8.2 -2.04 25%

LL108 C70H119N23O13 1490.6 1490.9433 1490.9430 0.2 11.7 -1.36 27%

LL109 C39H69N11O7 804.5 804.5470 804.5454 1.8 8.7 -1.53 34%

LL110 C45H81N15O8 960.6 960.6462 960.6465 -0.3 8.5 -1.80 66%

e LL114 C44H76N14O8 465.3 929.6042 929.6043 0.2 9.7 -1.62 59%

AA101 C45H78N14O8 943.6 943.6168 943.6200 3.4 10.6 -1.23 78%

AA102 C45H79N14O8 943.7 943.6200 943.6200 0.0 12.0 -1.38 62%

a (M+H)+, ESI (Finnigan, Thermoelectron, LCQ classic) b (M+H)+, FAB-MS (JEOL HX110 sector instrument), or MALDI-TOF (Bruker Ultraflex III). c Hewlett Packard 1100 (C-18, Microsorb-MVTM, 4.6 mm x 250 mm, 5 μm) using a gradient system (10-90% acetonitrile containing 0.1% TFA within 40 mins, 1 mL/min). Peptides ≥ 95% purity. d http://www.vcclab.org/lab/alogps. e (M+3H)3+ f (M+2H)2+ 2.2.2 SAR of Dyn A fragments The key step in the rational design of BR antagonists is to identify the

pharmacophore of Dyn A that directly interacts with the BRs as an agonist and

then to modify the structure for the binding site by examining the effects of

different substituents to obtain an antagonist. Truncations of each amino acid at

the N and C termini were performed and the resulting fragments were tested for

their binding to BRs against [3H] DALKD or [3H] BK in rat brain membranes.

Truncations at the C-terminus revealed that the BR recognition predominately

depends on the basicity of the C-terminal amino acid residue. Dyn A fragments

that had a C-terminal basic amino acid such as Lys or Arg, showed higher binding

affinities than those fragments with a C-terminal hydrophobic amino acid such as

Ile, Pro, or Leu. At the N-terminus, consecutive truncations of amino acid

residues to position 4 did not affect the affinities of the fragments to the BRs.

These results suggest that the N-terminal part of Dyn A is remote and thus not involved in the binding to the BRs. The importance of a basic amino acid at the

C-terminus suggests that perhaps Dyn A and BK are binding to a similar binding site as the Arg at either termini in BK are in contact with key Asp and Glu on the receptor.

With this distinct SAR in mind, Dyn A analogues were designed and synthesized to examine more of the SAR starting with the fragment Dyn A-(4-

13). Amidation of the C-terminus is a useful modification to increase the peptide's stability, and therefore, S1F was designed with a C-terminal amidation. This modified ligand had greatly reduced binding affinity (IC50 = 3500 nM) when compared to its parent ligand, LYS1026 (IC50 = 150 nM) (Table 1.6). S1Nal had a C-terminal amidation but was also modified at the N-terminus with the non- natural amino acid, napthalene, which is similar in structure to Phe but is much bulkier and can be used for an increase in stability. This ligand resulted in even lower affinity (IC50 = 5700 nM) (Table 1.6). All other C-terminal amidated ligands exhibited very low binding affinities in the μM range, which confirms the role of the C-terminal acid in the recognition at the BRs. A 4-amino(Phe) substitution at the N-terminus was designed for an increase in stability as well as affinity, and this substitution resulted in a small increase in affinity (SH110 IC50 =

100 nM and SH121 IC50 = 210 nM cf to LYS1041 IC50 = 390 nM) (Table 1.6).

Table 1.6: SAR of Dyn A-(4-13) and Dyn A-(4-11) modifications

B2Ra, [3H]BK Cpd Structure b Log[IC50] IC50 (nM)

[des-Arg7]-Dyn A-(4-13) Analogues

LYS1041 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH -6.42 + 0.32 390

SH111 H-Phe-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH -7.08 + 0.15 83

SH110 H-Phe(p-NH2)-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH -6.99 + 0.05 100

SH121 H-Phe(p-NH2)-Nle-Lys-Ile-Lys-Pro-Lys-Leu-Lys-OH -6.68 + 0.10 210

Dyn A-(4-11) Analogues

LYS1026 H-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-OH -6.83 + 0.12 150

S1F H-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-NH2 -5.46 + 0.07 3500

S1Nal H-Nal-Leu-Arg-Arg-Ile-Arg-Pro-Lys-NH2 -5.25 + 0.08 5700

S2F H-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Arg-OH -7.11 + 0.07 78

SH114 H-Phe-Leu-Arg-Arg-Ile-Arg-Arg-Pro-Lys-OH -7.13 + 0.04 75

[des-Arg7]-Dyn A-(4-11) Analogues

LYS1044 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.74 + 0.11 180

SH113 H-Arg-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.89 + 0.23 130

SH116 H-Lys-Pro-Arg-Ile-Arg-Leu-Phe-OH -7.30 + 0.09 51

SH119 H-Phe (p-NH2)-Nle-Lys-Ile-Lys-Pro-Lys-OH -5.88 + 0.33 1300

SH123 H-Phe-Nle-Lys-Nle-Lys-Pro-Lys-OH -5.99 + 0.25 1030 aCompetition assays were carried out at pH 6.8 in rat brain membranes using 1 nM

[3H]DALKD to label the receptor. bLogarithmic values determined from the nonlinear regression analysis of data collected from at least two independent experiments in duplicate.

For binding of Dyn A at the opioid receptors Arg7 is a key residue. To test

the role of Arg6-Arg7 at the BRs, we made a series of [des-Arg7] Dyn A analogues

and found that all of the analogues retained affinity at the receptor, in particular,

LYS1044 (IC50 = 180 nM) had similar affinity to the parent ligand LYS1026

(IC50 = 150 nM) (Table 1.6). Similarly, when another Arg was added as in

SH114, this did not lead to any change in affinity (IC50 = 75 nM). Therefore, two neighboring basic amino acid residues are not necessary for BR recognition.108

Arg was substituted for Phe4 in SH113 which resulted in the same affinity and further points to a limited role of the N-terminus (IC50 = 130 nM cf 180 nM).

Although substitution of Nle for Leu/Ile, Lys for Arg, and 4 amino (Phe4) were tolerated, when all three of these substitutions are employed in the same analogue there was a 10 fold decrease in affinity (SH119 IC50 = 1300 nM, SH123 IC50 =

1030 nM cf to LYS1044 IC50 = 180 nM).

It was previously determined that a Lys or Arg at the C-terminal was necessary for recognition at the BRs.79 A series of analogues were designed to test if the basic amino acids residues at positions Arg6, Arg9, or Lys11 could be substituted with the other basic amino acid, along with substitution of Nle for

Leu/Ile. These resulting analogues, SH120 and SH128 (cf. LYS1040), SH127 (cf.

LL106), and SH124, SH125 (cf. LYS1039) had similar affinities compared to the parent compound (IC50 = 65-90 nM) (Table 1.7).

All of this SAR data taken together provides much insight into the minimum pharmacophore for the rat BRs; a basic amino acid residue such as Lys or Arg at the C-terminus, combinations of basic amino acid residues and hydrophobic residues, and a Pro residue to make a turn structure. The pharmacophore can be simplified as a amphipathic structure with alternating hydrophobic residue, basic residue (Figure 1.9).

Table 1.7: Dyn A-(5-11), Dyn A-(5-13), Dyn A-(6-13) and Dyn A-(8-13) modifications

B2Ra, [3H]DALKD Cpd Structure b Log[IC50] IC50 (nM) [des-Arg7]-Dyn A-(5-13) Analogues

LYS1040 H-Leu-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH -7.19 + 0.10 65 SH120 H-Nle-Lys-Ile-Lys-Pro-Lys-Nle-Lys-OH -7.09 + 0.13 82 SH128 H-Nle-Lys-Nle-Lys-Pro-Lys-Nle-Lys-OH -7.04 + 0.10 90

[des-Arg7]-Dyn A-(5-11) Analogues

LYS1043 H-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.74 + 0.09 180 SH118 H-Nle-Lys-Ile-Lys-Pro-Lys-OH -6.34 + 0.09 460 [des-Arg7]-Dyn A-(6-13) Analogues

LL106 H-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH n.d. SH127 H-Lys-Nle-Lys-Pro-Lys-Leu-Lys-OH -7.07 + 0.16 86 Dyn A-(8-13) Analogues

LYS1039 H-Ile-Arg-Pro-Lys-Leu-Lys-OH -7.31 + 0.09 50 SH124 H-Nle-Lys-Pro-Lys-Nle-Lys-OH -7.11 + 0.14 78 SH125 H-Nle-Arg-Pro-Arg-Nle-Lys-OH -7.08 + 0.08 84 aCompetition assays were carried out at pH 6.8 using rat brain membranes using 1 nM

[3H] DALKD to label the receptor. bLogarithmic values determined from the nonlinear regression analysis of data collected from at least two independent experiments in duplicate.

Figure 1.9: Pharmacophore of Dyn A at the BRs

When B2R antagonists based on BK's structure were designed, it was found that a substitution of Pro7 for DPhe is a key residue to convert from an agonist to an antagonist.109 Dyn A contains a Pro in position 10 and therefore,

LL108-LL110 were designed and synthesized to test if the substitution of Pro10 to

DPhe would result in an antagonist (Table 1.8). These analogues are still awaiting binding data.

Table 1.8: Pro10 substitutions for design of antagonists

Cpd Structure

LL108 H-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-DPhe-Lys-Leu-Lys-OH

LL110 H-Arg-Ile-Arg-DPhe-Lys-Leu-Lys-OH

LL09 H-Ile-Arg-DPhe-Lys-Leu-Lys-OH

2.2.3 SAR of LYS1113 modifications

LYS1113 (Dyn A-(9-13), which retained high binding affinity (IC50 = 58 nM) after truncations at the N-terminus, is considered as a minimum pharmacophore to fulfill the structural requirement (1 = 0, m = 2, one Pro).

Therefore, analogues were designed based on the structure of this compound in order to increase stability. The first modifications done were substitution with the

D-isomer and since the C-terminus is important for binding, substitutions were not done at the C-terminus. Analogues SH136, SH129, SH130, SH133, and SH135 were all substituted with a D-amino acid residue (Table 1.9)

Table 1.9: Dyn A-(9-13) modifications B2Ra, [3H]DALKD Cpd Structure b Log[IC50] IC50 (nM) LYS1113 H-Arg-Pro-Lys-Leu-Lys-OH -7.24 + 0.12 58

SH136 H-Arg-Pro-Lys-DLeu-Lys-OH n.d.

SH129 H-Arg-Pro-DLys-Leu-Lys-OH -5.54 + 0.19 2900

SH130 H-Arg-Pro-DLys-Nle-Lys-OH -5.19 + 0.13 6400

SH133 H-Arg-DPro-Lys-Leu-Lys-OH NC

SH135 H-DArg-Pro-Lys-Leu-Lys-OH -6.92 + 0.17 191 SH126 H-Lys-Pro-Lys-Nle-Lys-OH -6.64 + 0.13 230 SH132 H-Arg-Pro-Lys-Leu-His-OH -6.30 + 0.14 510 LL102 H-Arg-Pro-Lys-Leu-Orn-OH -6.37 + 0.22 430c SH134 H-Orn-Leu-Lys-Pro-Arg-OH -5.39 + 0.15 4100 LL100.1 H-Arg-Pro-Orn-Leu-Lys-OH n.d. LL101.1 H-Arg-Pro-Orn-Leu-His-OH n.d. aCompetition assays were carried out at pH 6.8 using rat brain membranes using 1 nM

[3H]DALKD to label the receptor. bLogarithmic values determined from the nonlinear regression analysis of data collected from at least two independent experiments in duplicate. c1 nM [3H] BK n.d.: not determined, NC: no competition

The only analogue that retained affinity at the receptor was SH135 (IC50 =

190 nM Table 1.9) which was substituted with D-Arg as the N-terminal amino

10 11 acid residue. Substitution of Pro (SH133) or Lys (SH129, SH130) with the D-

isomer resulted in a large loss in affinity (IC50 = μM range Table 1.9). In SH126,

Arg9 was substituted with Lys and Leu12 was substituted with Nle, which led to a

4-fold loss in affinity (IC50 = 230 nM). Since Lys and Arg can be substituted for

each other, the effects of other basic amino acids such as His and the non-natural amino acid residue were tested. His was substituted for Lys at the C-terminus

(SH132) which led to ~10 fold decrease in affinity. A similar decrease in affinity was seen when Orn was substituted as the C-terminal amino acid (LL102, Table

1.9). Analogue LL100.1 was designed to examine if Orn could be substituted for

Lys11 and LL101 combined Orn11 and His13. These analogues are still awaiting binding results as there are issues with the binding assay that need to be fixed (see

Part III).

2.2.4 SAR of LYS1044 modifications

From the above and additional SAR studies, we discovered compound

LYS1044, ([Des-Arg7]-Dyn A-(4-11)), as a good pharmacophore for the BRs.

Intrathecal administration of compound LYS1044 was able to block Dyn A- induced hyperalgesic effects and motor impairments in naïve animals.79 The compound was also found to reverse thermal hyperalgesia and mechanical hypersensitivity when administered intrathecally in nerve-injured animals (L5/L6 spinal nerve ligation) in a dose-dependent manner.79 While LYS1044 is efficacious in a neuropathic pain model, this compound is susceptible to enzymatic degradation because of its composition of natural amino acids. In an effort to increase the stability, analogues substituted with non-natural amino acids were designed and synthesized. Substitution of Leu5 and Ile8 with a Nle residue was examined in AN102 and AN101 respectively, both of which maintained the same range of good binding affinity (Table 1.10) at the receptor (IC50 = 160 nM for AN102, 190 nM for AN101). The double substitution with Nle of both Leu5

8 and Ile in AN107 also maintained good binding affinity (IC50 = 86 nM).

Acetylation of the N-terminus in AN107 did not alter the binding affinity (IC50 =

140 nM) in AN108-1 and the same trend was observed in other acetylated peptides (data not shown). Similarly to the modifications of hydrophobic amino acids, we also substituted three basic amino acid residues (Arg6, Lys9, and Lys11) in LYS1044 with three ornithine residues, which resulted in ligand LL103

showing decreased binding affinity (IC50 = 510 nM). The triple substitution with the ornithine residue in ligand LL103 might cause less exposure of the important basic amino group due to the lack of one carbon chain and thus resulted in the decrease of binding to the receptor.

Pro is an important amino acid residue that can make a turn structure due to the imide nature lacking an amide proton. The Pro10 residue in ligand LYS1044 was shown to be involved in the formation of a distorted type 1 β-turn structure at the C-terminus by a NMR study.79 To confirm the role of Pro10, unnatural Pro analogues such as Tic, DTic, Oic, and Thi were replaced and the resulting ligands

SH138-SH141 (Table 1.10) lost their binding affinities by 3 to 75 fold, suggesting that the constrained Pro10 residue plays an important role in making a topographical structure for recognition at the BRs.

A retro-inverso modification, in which the peptide sequence is reversed and there is an inversion of chirality, is frequently used for developing peptide ligands with good bioavailability because the D-isomer is not recognized by proteases.110 A retro-inversion of AN107 (SH117) resulted in a complete loss of affinity (IC50 > 10,000 cf 86 nM). This loss of affinity could be contributed to the

absence of a basic amino acid residue at the C-terminus which we know to be important. Therefore, an inverso peptide (SH122), was synthesized with a Lys at the C-terminus, but this also resulted in a complete loss of affinity (IC50 >10,000 nM). Since a complete inversion of chirality is not tolerated, a D-amino acid scan was performed to investigate which amino acid residues could be replaced with minimal loss in affinity (Table 1.10, SH137, SH142-SH147). It was found that substitutions in the middle of the sequence and at the C-terminus led to a loss of affinity (SH137, SH142-SH144), while those substituted at the N-terminus retained high affinity at the receptor (SH145-SH147). This data correlates well with our previous SAR results, in that substitutions at the N-terminus were well tolerated while the C-terminus cannot be modified due to its important role in the

BRs recognition.79, 108, 111 Although a single D-amino acid substitution at the N- terminus was tolerated, a double substitution with the D isomer at Phe4 and Arg6

(SH150) or Phe4 and Leu5 (LL114) completely abolished affinity at the BRs

(Table 1.10).

N-Methylation of the peptide backbone is known to be a good tool to increase peptide stability, oral bioavailability, affinity and selectivity.112 For these reasons, NMePhe4 or NMeLeu5 were substituted in two ligands and both of the ligands (AA101, AA102 Table 1.10) lost their binding affinities.

Table 1.10: Modifications of LYS1044 for stability

B2Ra, [3H]BK Cpd Structure b Log[IC50] IC50 (nM)

[Des-Arg7]-Dyn A-(4-11) Analogues

LYS1044 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.83 + 0.09 150

AN102 H-Phe-Nle-Arg-Ile-Arg-Pro-Lys-OH -6.79 + 0.10 160

AN101 H-Phe-Leu-Arg-Nle-Arg-Pro-Lys-OH -7.05 + 0.09 90

SH138 H-Phe-Leu-Arg-Ile-Arg-Tic-Lys-OH -5.15 + 0.09 510

SH139 H-Phe-Leu-Arg-Ile-Arg-DTic-Lys-OH >10,000

SH140 H-Phe-Leu-Arg-Ile-Arg-Thi-Lys-OH -5.99 + 0.20 1000

SH141 H-Phe-Leu-Arg-Ile-Arg-Oic-Lys-OH -5.82 + 0.10 1500

LL103 H-Phe-Leu-Orn-Ile-Orn-Pro-Orn-OH -6.29 + 0.12 510

AN107 H-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH -7.06 + 0.10 86c

AN108-1 Ac-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH -7.17 + 0.10 140c

SH117 H-DArg-DPro-DArg-DNle-DArg-DNle-DPhe-OH >10,000

SH122 H-DPhe-DNle-DArg-DNle-DArg-DPro-DLys-OH >10,000

SH137 H-Phe-Leu-Arg-Ile-Arg-Pro-DLys-OH -6.03 + 0.14 830

SH142 H-Phe-Leu-Arg-Ile-Arg-DPro-Lys-OH > 10,000

SH143 H-Phe-Leu-Arg-Ile-DArg-Pro-Lys-OH -5.23 + 0.12 5900

SH144 H-Phe-Leu-Arg-DIle-Arg-Pro-Lys-OH >10,000

SH145 H-Phe-Leu-DArg-Ile-Arg-Pro-Lys-OH -6.51 + 0.19 310

SH146 H-Phe-DLeu-Arg-Ile-Arg-Pro-Lys-OH -6.90 + 0.23 130

SH147 H-DPhe-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.60 + 0.14 250

SH150 H-DPhe-Leu-DArg-Ile-Arg-Pro-Lys-OH >10,000

LL114 H-DPhe-DLeu-Arg-Ile-Arg-Pro-Lys-OH >10,000

AA101 H-NMePhe-Leu-Arg-Ile-Arg-Pro-Lys-OH -6.06 + 0.14 870

AA102 H-Phe-NMeLeu-Arg-Ile-Arg-Pro-Lys-OH -6.78 + 0.15 1500 aCompetition assays were carried out at pH 6.8 using rat brain membranes using 1 nM

[3H]BK to label the receptor. bLogarithmic values determined from the nonlinear

regression analysis of data collected from at least two independent experiments in duplicate. cCompetition using 1 nM [3H] DALKD. NC: no competition

2.3 Stability assay of analogues

2.3.1 Stability assay in rat plasma

Drugs that are bioavailable and taken orally are degraded mainly by the

small intestine and/or liver.102 Most peptides are not orally bioavailable and

instead, the route of administration is intravenous or intrathecal injection.

Therefore, their degradation is mainly by proteolytic enzymes in the plasma. For

these reasons, our ligands were tested in rat plasma. As suspected, the lead ligand

LYS1044 was found to be very unstable in the rat plasma and was completely

degraded within 4 h of incubation and had a calculated half-life (t1/2) of 0.7 h

(Figure 1.10A, Table 1.11). To study structure-stability relationship and thus to

identify potent Dyn A analogues with enhanced stability, diverse modifications

were performed and the resulting peptides were selected for the stability test in rat

plasma and/or human plasma with/or without peptidase inhibitors. Considering

the high affinity (IC50 = 86 nM) and the possible increase in stability from Nle

substitution, ligand AN107 was selected first for the test. This ligand led to a

small increase in stability with a t1/2 = 1.2 h which is to be expected considering

the structural similarities between Nle and Leu/Ile. A further increase in stability,

albeit small, was seen in the N-terminal acetylation of AN107, in ligand AN108-1

with a t1/2 = 3.4 h. Next, the effects on stability of D-amino acid substitutions were

examined. As shown in Figure 1.10B, all of the D-amino acid substitutions near

the N-terminus (ligands SH145, SH146, and SH147) resulted in a large increase

in stability (t1/2: 0.7 h vs 31 h, 160 h, and 19 h). In particular, the substitution of

5 DLeu enhanced the stability dramatically from t1/2 = 0.7 to 240 h (cf. 160 h from

5 day study) with 99% intact after 24 h. It has been suggested by Varshasky that the N-terminal amino acid residue determines the stability of a peptide: N-end

113 9 rule. The same low stability (t1/2 = 0.7 h) of ligand SH137 (DLys ) as LYS1044 is a good example of the N-end rule (Figure 1.10C). On the basis of the N-end rule, the N-terminal modification by an unnatural amino acid residue is considered to be an efficient way to optimize peptide stability by reducing susceptibility to enzymatic degradation. A D-amino acid scan was performed at all positions of ligand LYS1044 (ligands SH137, SH142 - SH147) resulting in very distinct SAR results. The D-amino acid substitution near the region of the C- terminus was not tolerated and thus lost binding affinity for BRs (SH137, SH142-

SH144). Even the low affinity ligand SH144, which includes DLeu8 in the middle of the sequence, was tested for the stability to gain a key insight into the degradation of the Dyn A fragments and found to be more stable (t1/2 = 3.3 h) but not as stable as other ligands (SH145-SH147).

All of the D-amino acid substitutions in ligands SH137, SH142-SH147 showed an interesting pattern of stability shown in Table 1.11: the stability increase depends on the location of a D-amino acid. Now it is clear that the C- terminal region, which is very important for BRs recognition, does not play an important role in the rat plasma stability but the N-terminus does. Further support was obtained from AA101 and AA102, which contain NMePhe4 and NMeLeu5, respectively (Figure 1.10D). These ligands do not retain high affinity at the BRs

but were found to be stable similarly to the D-amino acid residue contained

ligands SH147 and SH146. Interestingly, when Leu5 was methylated, AA102 was

extremely stable and was 100% intact after a 24 h incubation. The stability data of

ligand SH146 and AA102 both indicate that position 5 is the main site for the

degradation of Dyn A analogues in rat plasma. Taken together, these results

suggest that it will be very promising to develop a highly potent Dyn A ligand

with an enhanced stability simply by modifying the N-terminal region.

100

] 125

] LYS1044

[

AN107

e 100 e

75 d

d i

AN108-1 t

p p

e 75

n n

i 50 i

n LYS1044

i a a 25 SH145

m 25

m SH146

e R R SH147 0 0 0 6 12 18 24 0 6 12 18 24 Incubation Time (h) Incubation Time (h)

100 ]

% ] LYS1044 [

100

% e

[ SH137

i e

75 SH144 t

d i

p 75

P g

50 50

i n

i LYS1044 a a 25 25

m AA101

m e

e AA102

R R 0 0 0 6 12 18 24 0 6 12 18 24 Incubation Time (h) Incubation Time (h) Figure 1.10: In vitro stability of Dyn A analogues in rat plasma. The samples

were tested in three independent experiments. Statistical significance was

determined by a one way ANOVA followed by a Tukey's analysis and are

compared to parent ligand, 1, unless otherwise noted. Asterisks denote

significance and for ease of view in B. are only shown from 6 h on (* p < 0.05; **

p < 0.01; *** p < 0.001, **** p < 0.0001). Half-life (t1/2) was determined as

0.693/b, where b is the slope found in the linear fit of the natural logarithm of the

fraction remaining of the parent compound vs. incubation time.105

Table 1.11: Structure-stability relationship of Dyn A analogues in rat plasmaa

Cpd. Structure IC50 t1/2 Intact (nM)a (h)b (%)c

Dyn A-(2-13) H-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH 21d 1.5 0

LYS 1026 H-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-OH 150 0.7 0

LYS1044 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-OH 150 0.7 0

AN107 H-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH 86 1.2 0

AN108-1 Ac-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH 140 3.4 0

SH137 H-Phe-Leu-Arg-Ile-Arg-Pro-DLys-OH 830 0.7 0

SH144 H-Phe-Leu-Arg-DIle-Arg-Pro-Lys-OH >10,000 3.3 0

SH145 H-Phe-Leu-DArg-Ile-Arg-Pro-Lys-OH 310 31 62 ± 25

SH146 H-Phe-DLeu-Arg-Ile-Arg-Pro-Lys-OH 130 160e 99 ± 9

SH147 H-DPhe-Leu-Arg-Ile-Arg-Pro-Lys-OH 250 19 44 ± 12

AA101 H-NMePhe-Leu-Arg-Ile-Arg-Pro-Lys-OH 870 15 31 ± 11

AA102 H-Phe-NMeLeu-Arg-Ile-Arg-Pro-Lys-OH 1500 65d 100 ±16 aDetails described in Table 1.10. bDetails described in Figure 1.10. cAfter a 24 h incubation. dCompetition assay with 1nM [3H] DALKD eCalculated from a 5 day stability test.

In the 24 h rat plasma study, SH146 and AA102 were both very stable

without any trace of degradation. Since there was little degradation in 24 h the

calculated half-life may not be meaningful (t1/2 for AA102 > 4000 h). In order to

obtain a more accurate half-life, a 5 day study was done for SH146 and AA102 in

which time points were taken every 24 h. In this study, SH146 was found to have

a t1/2= 160 h and at the last time point, 120 h, 66% of the peptide still remained.

On the other hand, AA102, which had the same high stability as SH146 in the 24

study, showed lower stability than SH146 (t1/2= 65 h and at 120 h only 31% of the

peptide remained). With the more precisely calculated half-lives these compounds are still the most stable of the series. Both have modifications at the Leu5, which points to the importance of this amino acid for stability.

2.3.2 Stability assay in human plasma

Human and rat plasma are similar but may contain different peptidases, therefore, the analogues may have different stability in the two conditions. To investigate the potential differences, the most stable ligands in the rat plasma assay were tested (SH146, AA102) as well as LYS1044 as a control (Figure 1.11,

Table 1.12). It was found that LYS1044 was more stable in human plasma than rat plasma (2.4 h vs 0.7 h). SH146 and AA102 had similar stability in both rat and human plasma with more than 95% intact at 24 h. Although there are slight changes of exact half-lives in rat and human plasma, the trend is the same in both plasmas. LYS1044 is quickly degraded and modifications at position 5 by a D- amino acid residue or a NMeLeu residue (SH146, AA102) resulted in a large increase in plasma stability. Rat plasma may contain more peptidases or a higher concentration of peptidases that cleave LYS1044, which may account for the lower stability of the peptide when compared to its stability in human plasma.

]

] 125 125

% %

[ [

e e d

d 100 100

i i

t t

p p e

e 75 75

P P

g g

n n i

i 50 50

n n i

i LYS1044 (Rat) SH146 (Rat)

a a m

m 25 LYS1044 (Human) 25 SH146 (Human)

e e

R R 0 0 0 6 12 18 24 0 6 12 18 24 Incubation Time (hr) Incubation Time (hr)

] 125

[

d 100

t p

e 75

g n i 50

n AA102 (Rat) i a AA102 (Human)

m 25

e R 0 0 6 12 18 24 Incubation Time (hr)

Figure 1.11: In vitro stability of selected Dyn A analogues in human plasma. The

samples were tested in three independent experiments. Statistical significance was

determined by a one way ANOVA followed by a Tukey's analysis and are

compared to the compound's degradation in rat plasma. Asterisks denote

significance (* p < 0.05).

Table 1.12: Structure-stability relationship of Dyn A analogues in human plasmaa

No. Structure t1/2 Intact t1/2 (h) (%)b (h)c

LYS104 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-OH 2.4 0 0.7 4 SH146 H-Phe-DLeu-Arg-Ile-Arg-Pro-Lys-OH 150 99 ± 10 160 AA102 H-Phe-NMeLeu-Arg-Ile-Arg-Pro-Lys-OH 190 96 ± 5 65

aDetails described in Figure 1.11. bAfter a 24 h incubation. cIn rat plasma. 2.3.3 Identification of the degradation site for LYS1044

From the rat and human plasma stability assays, it is known that LYS1044

is not stable and quickly degraded within 4 h of incubation. Based on the

structure-stability relationship results, it was suggested that the degradation of

LYS1044 mainly occurs at the Leu5 site since ligands SH146 and AA102, which are modified at this residue, show the most enhanced stability in the rat and human plasma. To identify a site for the degradation, a major peak after 30 min. incubation in rat plasma was isolated by RP-HPLC. LC-MS of the peak showed

782.6 m/z (MH+) which indicated the existence of a [des-Arg7]-Dyn A-(5-11) fragment, which confirms that LYS1044 is mainly degraded by the cleavage of the Phe4-Leu5 bond at the N-terminal region (Appendix A).

2.3.4 Comparison of the stability of LYS1044 in rat plasma with/without protease inhibitors

The LC-MS data confirmed that the degradation of LYS1044 occurs at the

Phe4-Leu5 bond. To investigate which proteases are responsible for the cleavage, various protease inhibitors were incubated with LYS1044 in the rat plasma stability assay. Since LYS1044 is degraded at the N-terminal peptide bond, it suggests that an aminopeptidase may be responsible for the degradation. Bestatin is a common aminopeptidase inhibitor of leucine aminopeptidase, aminopeptidase

B, and aminopeptidase N.114 Chymotrypsin is a serine protease that cleaves after aromatic amino acids such as; Tyr, Phe, and Trp.115 Chymostatin is a known inhibitor of chymotrypsin, as well as cathepsin B, and cathepsin D, a cysteine protease that cleaves after a Phe residue.116 Phenylmethanesulfonylfluoride

(PMSF) is another serine protease inhibitor which also targets chymotrypsin but will also inhibit papain and thrombin.117 Captopril is an ACE inhibitor and bradykinin (BK), the endogenous ligand for the BRs, is known to be degraded by

ACE.118 Even though BK and Dyn A are very different in structure, captopril was

used to make sure ACE did not degrade it as well. Ethylenediaminetetraacetic

acid (EDTA) is a metal chelator and many metalloproteases that could cleave

Xaa-Leu, such as; neprilysin, enkephalinase and neutral endopeptidase, use metals

in their active site.102 All inhibitors were added to the test solution in an effective

concentration but there was no stability increase observed in all cases (Table

1.13). To examine if multiple inhibitors would prevent the degradation better, all

five inhibitors were added to the test sample but were not successful in increasing

the half-life. This result is similar to Dyn A, in which inhibition with protease

inhibitors did not improve stability.119

Table 1.13: Rat Plasma Stability of LYS1044 with inhibitors

a b Inhibitor t1/2 (h) None 0.7 60 nM Bestatin 0.8 100 μM Chymostatin 1.0 1 mM PMSF 0.8 10 μM Captopril 0.6 1 mM EDTA 0.8 All 5 inhibitors 0.9

aUsed effective concentration of inhibitors to inhibit protease. bCalculated after 4 h incubation. 2.4 Cytotoxicity of analogues

The XTT assay is a colorimetric assay that tests for cell viability and proliferation.

Dehydrogenase enzymes of metabolically active cells cleave the tetrazolium salt, XTT, which yields a colored formazan product.120 This assay has advantages over the previous

MTT assay such as reduced assay time and no need for crystal solublization. This assay is normally used in cancer studies to test the effects a drug has on cancer cells vs. normal cells. Before testing the Dyn A analogues, an optimization assay was carried out in which various amount of cells were plated as well as different incubation times for the XTT

Optimization Assay reagent. By looking at the linear 3

1 hr portion of the curve (Figure e

c 2 hr n

a 2

b 3 hr 1.12) it was found that 10,000

o s

b 1 A

cells/ well and a 3 h incubation

f i

c 0 e with XTT reagent was optimal.

p 1.010 3 1.010 4 1.010 5 1.010 6 1.010 7 S Cells/well -1 After the optimization assay, a

full DRC (10-3 M- 10-11 M) of

LYS1044, and SH145-SH147 were incubated in hB2R-HEK cells for 24 h before addition of the XTT reagent (similar to what is done in cancer therapeutic studies).

SH145-SH147 were found to be non-toxic and had ~100% survival except for the 1 mM dose of SH145 (Figure 1.13, only showing 3 doses for ease of view). Unexpectedly, at the highest dose of LYS1044 (1 mM) instead of no change or a decrease in survival, there was a significant increase (510%) in cell survival (Figure 1.13). This large increase in proliferation was only seen at the highest dose (1 mM) as a 10-fold lower dose (0.1 mM) showed 160% cell survival. Since LYS1044 is not stable and was shown to be completely degraded by 24 h in plasma, it was hypothesized that this increase in cell survival occurred from the high amount of individual amino acid residues from LYS1044 that were in the media that could be used as food by the cells. To test this hypothesis,

Dyn A-(2-13), which has a similar half-life as LYS1044 and is completely degraded by

24 h, was tested in the assay. Interestingly, it was discovered that Dyn A-(2-13), of which

LYS1044 is derived from, did not cause an increase in cell proliferation (Figure 1.13).

BK, which is different in structure than LYS1044 but has a similar low stability, caused a significant decrease, instead of increase, in cell survival at the highest dose (Figure 1.13).

Therefore, the proliferation seen at the high dose of LYS1044 is most likely not caused by degradation to individual amino acids residues that could then supplement cell growth.

In order to determine if the proliferation exhibited a dose response curve (and not just one data point) higher doses (5 mM and 10 mM) were tested. These higher doses precipitated out of solution and therefore, could not be tested.

7 0 0 **** D y n A (2 -1 3 ) 6 0 0 B ra d y k in in

l 5 0 0 L Y S 1 0 4 4

a v

i 4 0 0 S H 1 4 5

v r

u S H 1 4 6

3 0 0 S S H 1 4 7 % 2 0 0

1 0 0 * 0

M M M M M M M M M M M M M M M M M M n u n u n u n u n u n u m m m m m m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Figure 1.13: XTT assay of select analogues in hB2R-HEK 24 hr

incubation.

To determine if the increase in proliferation is mediated through the B2R, the

XTT assay was done in HEK cells that do not express the B2R. A 210% increase in proliferation was seen compared to the 510% in cells that expressed the B2R (Figure

1.14B). Therefore, some increase in cell proliferation can be accounted for by the HEK cell type but the majority of the proliferation is mediated through the B2R. F11 cells, which are a hybrid of rat embryonic DRG and the mouse neuroblastoma cell line

N18TG2, were used in our earlier studies and endogenously express the B2R.78 Although these cell lines endogenously express the B2R, the present line was reported to have lost the B2R as the cells stopped responding to Dyn A-(2-13). To confirm that the B2R was still expressed in this cell line, a binding assay was carried out testing BK and Dyn A-(2-

13) in this cell line. The preliminary data showed that the B2R was still present as BK had an IC50 = 43 nM and Dyn A-(2-13) IC50 = 46 nM. Therefore, this cell line was also used in the XTT assay and no proliferation or toxicity was seen following incubation of

LYS1044 (Figure 1.13C).

Next, shorter incubation times (2 h and 12 h) were tested in the XTT assay. It was found that 1 mM LYS1044 did not cause proliferation at 2 h or 12 h (Figure 1.13A).

Taking all this data into account, it can be concluded that the proliferation seen at 1 mM

LYS1044 is mediated through the hB2R and occurs after chronic dosing (24 h) whereas at lower doses, incubation times, and various cell lines there is little to no toxicity of

LYS1044.

Figure 1.14: XTT cell proliferation study of LYS1044 in A. hB2R-HEK cells B. HEK cells C. F11 cells

The other Dyn A analogues that showed good affinity and stability at the B2R were tested in the 3 cells lines at 2-3 incubation times. The results suggest that these analogues are non-toxic in the 3 cell lines and all incubation times at low and moderate doses are non-toxic whereas there is some toxicity at the highest dose, 1 mM (Figure

1.15-1.17).

Figure 1.15: XTT cell proliferation study of SH145 in A. hB2R-HEK cells B. HEK cells

C. F11 cells

Figure 1.16: XTT cell proliferation study of SH146 in A. hB2R-HEK cells B. HEK cells

C. F11 cells

Figure 1.17: XTT cell proliferation study of SH147 in A. hB2R-HEK cells B. HEK cells

C. F11 cells

CHAPTER III: DISCUSSION AND FUTURE PERSPECTIVES

We have previously reported that the affinity of Dyn A-(2-13) at the BRs was moderate, with Ki values around 1 μM. This moderate affinity of Dyn A-(2-13) at the

B2Rs led many to criticize that the high levels of Dyn A needed to interact with the BRs could not be achieved in vivo. We recently discovered that a shift in buffer pH may have accounted for the moderate affinities first seen. Recent tests have shown that Dyn A-(2-

13) binds with IC50 = 22 nM in rat brains (which are predominately B2R, as the B1R is expressed in low levels) and IC50 = 62 nM in cells that express the hB2R, both at pH 6.8.

The Hill slope of the Dyn A-(2-13) pH 6.8 curve suggests a one-site fit, whereas more basic pH (7.4 and 8.0) suggest a 2-site fit. This data suggests that pH 6.8 is the optimal pH for studying the interaction of Dyn A at the BRs, and is relevant since under tissue injury acidic levels in the range of pH 6.8 have been reported. Interestingly, the affinity for Dyn A-(2-13) at the B1R at either pH (6.8 or 7.4) remained in the μM range.

Therefore, we now have evidence that Dyn A-(2-13) binds with high affinity and selectivity to the B2R, and analogues can be designed as antagonists to block Dyn A's action.

Through extensive synthesis and binding analysis of many analogues (50 presented here and ~200 more) a clear SAR of Dyn A analogues at the BRs emerged. The following have been determined to be important; a basic amino acid residue such as Lys or Arg at the C-terminus, combinations of basic amino acid residues and hydrophobic residues, and a Pro residue to make a turn structure. The pharmacophore can be simplified as a amphipathic structure with alternating hydrophobic residue, basic residue.

Early in the study, LYS1044 [des-Arg7] Dyn A-(4-11), was discovered as a minimum

pharmacophore. This ligand was found to block Dyn A's neurotoxic effects in vivo as well as showed potent anti-hyperalgesic effects in a neuropathic pain animal model.

However, this ligand is highly susceptible to enzymatic degradation and thus is not stable. To optimize the stability, various kinds of modifications were performed. It was found that modifications at the C-terminus were not well tolerated, and actually did not improve the stability, whereas, modifications towards the N-terminus with a D-amino acid residue led to a large increase in stability with little effect on affinity. In particular, the stability data clearly indicated the effectiveness of those modifications at Leu5. LC-

MS data for the isolated peak confirmed that LYS1044 is quickly degraded by the main cleavage of the Phe4-Leu5 bond at the N-terminus, which cannot be prevented by the addition of inhibitors. By modifying the crucial position for enzymatic degradation, we were able to develop SH146 as a lead ligand that retains the same high affinity at the BRs with much increased stability in plasma (229-fold) comparing to LYS1044. More importantly, it is promising to develop a highly potent Dyn A ligand with an enhanced stability by simply modifying the N-terminal region.

The Dyn A analogues that were stable and retained affinity at the B2R were tested in a cell proliferation assay. In all timepoints (2 h, 12 h, and 24 h) and cell lines (hB2R-

HEK, HEK, F11) SH145-SH147 were found to only be toxic at high doses (1 mM) and were non toxic at 1 μM and lower. Interestingly, the lead ligand, LYS1044, demonstrated the same trend as the other analogues, accept for at the high dose at 24 h in hB2R-HEK cells. At this dose and time, LYS1044 caused a large proliferation with a ~500% increase. This increase in proliferation was time-dependent and was not seen in the 2 h or

12 h incubations and evidence points it is mediated through the hB2R. This phenomena needs to be examined further to determine what is mediating the proliferation.

Currently, we have a lead ligand that is effective in being an analgesic and also have modified analogues that are more stable and non-toxic. Although we have found a stable analogue in rat and human plasma, there is evidence that peptidases are present on red blood cells (RBCs) and may degrade the analogues differently. Therefore, stability assays using whole blood will be beneficial in the future. It is also important to test for permeability of analogues at the BBB by Caco-2 assays. Additionally, the stable ligand,

SH146, will need to be tested in in vivo assays testing its stability in vivo as well as assays testing its effectiveness as an analgesic. Also, there is some evidence that Dyn A-

(2-13) at the B2R binds to an allosteric site. In an effort to study this interaction, it would

125 be beneficial to label LYS1044 with [ I] so that a direct measure of its Kd could be done at the B2Rs.

LYS1113, Dyn A-(9-13), is another analogue that has high affinity at the B2Rs, and provides another structure that can be examined for affinity and efficacy. Work to develop more stable LYS1113 analogues was only successful with a D-Arg9 substitution.

Further work can focus on the design and development of more stable LYS1113 analogues as well as assays for its analgesic properties in vivo.

PART II

STUDY ON THE SIGNALING OF DYNORPIN A-(2-13) AT THE BRADYKININ

2 RECEPTOR

INTRODUCTION

Signaling of GPCRs

Signal transduction systems utilizing G-proteins involve amplification of the signal, and it has been found that the binding of BK to one BR can stimulate approximately 100 G-proteins.121 Ligand binding to the receptor causes a conformational change which activates the G-protein, a heterotrimeric subunit that couples receptors to their effectors. The G-protein consists of an α, β, and γ subunit with the α subunit containing a binding site for guanine nucleotides which also displays GTPase activity.121

The βγ subunits are tightly associated with each other, and when they are bound with the

α subunit the G-protein is in its inactive state. Under the inactive state, GDP is bound to the α subunit, and when an agonist binds to the receptor a conformation change occurs which leads to dissociation of GDP from the α subunit.121 GTP, which is in high concentrations in the cytosol, binds to the site that GDP left on the α subunit. This now activated α subunit with GTP bound no longer has high affinity for the βγ subunit, therefore another conformational change causes the α subunit to dissociate from the βγ subunit.121 This dissociation of the α subunit from the βγ subunits opens up a surface on the α subunit that can bind to the effector and cause it to become active.121 Different classes of GPCRs couple different G-proteins that activate different effectors that can then stimulate a cascade of reactions (Figure 2.1).

BRs signaling

The BRs are Gq-coupled which means they signal through the phospholipase-C β,

122 PLC pathway (Figure 2.2). A common substrate for PLC is phosphatidylinositol 4,5- bisphosphate (PI(4-5)P2) which is cleaved to create diacylglycerol (DAG) and inositol

123 1,4,5-triphosphate (IP3). IP3, can directly bind and active intracellular calcium channels. The activation of calcium channels leads to an influx of calcium which can activate many other pathways. One of these pathways is calmodulin-dependent protein kinases, which are involved in smooth muscle contraction.124 Similarly, calmodulin- dependent nitric oxide synthase is activated by the increase in Ca2+ and produces NO in endothelial cells.124 In these same cells, BK can promote tyrosine phosphorylation of

124 MAPK. IP3 can also be metabolized by two different pathways, the 3-kinase pathway leads to the formation of inositol 1,3,4,5-tetrakisphosphate (IP4) which can also activate calcium channels.122 The 5-phosphate pathway leads to inositol, which can replenish the

inositol phospholipid population. It has also been found that BK stimulates the synthesis of eicosanoids, particularly arachidonate. It has been hypothesized that the increase in

2+ 125 Ca from IP3 activates PLA2 which will release arachidonate from phospholipids.

Another hypothesis is that DAG, produced by PLC-β, is metabolized by DAG lipase which releases arachidonate. An increase in DAG concentrations also leads to activation of protein kinase C which can inhibit the PLC pathway, activate pain fibers, and stimulate arachidonic acid.126 Although the B1Rs and B2Rs have been found to work through similar signal transduction pathways, the patterns are different.122 For example, B2R stimulation in the vascular smooth muscle leads to a brief increase in phosphoinositol

(PI) hydrolysis and was found to be independent of extracellular Ca2+. With B1R stimulation in the same tissue, it was found that there was a longer lasting increase in PI hydrolysis and it was more dependent on Ca2+.122 The BRs are coupled to many biological pathways, and this could be the reason they are involved in many physiological and pathophysiological states.

Rational

Since antagonists are desired, the analogues designed in Part I that have high affinity for the B2R and good stability in plasma need to be tested in a functional assay.

The B2R is a Gq coupled GPCR and the two most common in vitro functional assays were carried out after incubation with Dyn A-(2-13). Other downstream pathways were examined as well to see if they were activated upon binding of Dyn A-(2-13) or BK. It was hypothesized that Dyn A-(2-13) would stimulate PI and Ca2+ mobilization, the classical signaling pathways of the B2R.

Figure 2.2: The canonical signaling for the BRs, which signal through PLC.

CHAPTER I: MATERIALS AND METHODS

1.1 Reagents

[3H]Inositol was purchased from Perkin Elmer. LiCl, choloroform, and methanol

(MeOH) were purchased from Sigma Aldrich. IMDM and FBS were purchased from Life

Technologies. All other materials are listed below.

1.2 PI assay

Assays were carried out as previously described.127 24-well titer plates were seeded with

150,000 cells/well. Cells were preloaded overnight with 0.2 M [3H]Inositol in Iscove's

Modified Dulbecco's Medium (IMDM ) buffer (pH 7.4) supplemented with 4% FBS. The next day, the cells were washed and pre-incubated with IMDM for 60 min, followed with

500 mM LiCl/IMDM for 60 min. The media was aspirated and replaced with test compounds in IMDM (LiCl) buffer for 60 min. After an hour, the media was aspirated, and the reaction was terminated with cold MeOH. The cells were then extracted with

3 ddH2O:chloroform (1:1 v/v). [ H]Inositol phosphates were isolated from the resulting aqueous phase by AG1-X8 (BioRad, Hercules, CA) anion exchange chromatography.

Radioactivity collected from the samples was determined by liquid scintillation counting.

1.3 pERK ELISA assay

HEK cells were seeded in a 96 well plate at a density of 25,000 cells/well. Once cells adhered to the plate, the cells were serum starved overnight. Cells were treated with 3 doses of compound for 30 minutes. After 30 minutes, cells were lysed using the lysis buffer from the kit (Abcam ab119659). The lysate was transferred to pre-coated wells and incubated with a capture and detection antibody mix at 25 °C for 1 hr at 300 rpm. The antibodies were washed off and the substrate, ADHP, was added to the wells and

incubated at 25 ºC for 10 minutes. Fluorescence was read using a Biotek Synergy 2 with excitation at 530-540 nm and an emission wavelength of 590-600 nm.

1.4 Western blot analysis

1.4.1 Reagents

BSA and β-mercaptoethanol (βME) were purchased from Sigma Aldrich.

Laemilli Buffer, 10% SDS-PAGE gels, precision plus protein kaleidoscope

markers, Tris/Glycine/SDS buffer, and tween were purchased from Bio-rad.

Protease inhibitor cocktail (PIC) (#11697498001) was purchased from Roche, and

RIPA buffer (#8990) was purchased from Thermo Scientific. Phosphatase

inhibitors (#58705), phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody

(#9101), p44/42 MAPK (Erk1/2) antibody (#4695), phospho-PKC antibody

sampler kit (#9921), phospho-PKA C (Thr197) antibody (#4781), NF-kB2

p100/p52 antibody (#4882), AKT (#9271), and pSTAT (#41135) were purchased

from Cell Signaling Technology. β-actin was purchased from Abcam (ab8229)

and α-tubulin was purchased from CalBiochem (#CP06). Secondary antibodies

were purchased from LiCor (#926-32211, #926-32210, #926-68072, #926-

68171). All other materials listed below.

1.4.2 Cell dosing and lysates

Cells were seeded at 500,000 cells/well in a 6-well plate. 1 μM of test compound

(BK or Dyn A-(2-13)) was incubated for 15 min, 30 min or 60 min. After

incubation the cells were washed with PBS (phosphate buffered saline) with 1X

PIC, and 1X Phosphatase Inhibitors. After removal of PBS, RIPA Buffer with 1X

PIC and 1X Phosphatase Inhibitors was added to the cells and incubated on ice for

10 min. Cells were scraped and transferred to a 1.5 mL centrifuge tube and homogenized 3X and centrifuged at 11,500 rpm for 5 min. at 4 °C. The resulting supernatants were aliquoted into centrifuge tubes.

1.4.3 BCA assay

BSA standards ranging in concentrations from 2000 -25 ug/mL were made in

PBS. 50 parts Reagent A was mixed with 1 part Reagent B and added to the samples and incubated on a shaker for 30 mins at 37 °C (kit #23225 from Thermo

Scientific). Plate was cooled to rt and absorbance was measured at 562 nm on the

Biotek Synergy 2.

1.4.4 10% SDS-PAGE gel

Protein sample was prepared by making a 1:1 dilution of sample buffer and protein sample. Sample buffer was made by adding 950 uL 2X Laemilli buffer and 50 uL βME and 20 μg/40 uL of protein sample based on BCA results.

Samples were heated at 95 °C for 10 min, vortexed, and spun at 11,500 rpm for 5 min. 10 μL of Protein Standards and 40 μL of sample were added to the wells of

10% precast gels. Gel was run for 60 minutes at 150V in 1X/Tris/Glycine/SDS running buffer.

1.4.5 Blot transfer

PVDF membrane (Millipore Immobion-Fl) was soaked in 100% MeOH for 5 min. and then in 10% MeOH transfer buffer (1X Tris/Glycine) for 20 min. Blot was transferred in 10% MeOH transfer buffer at 4 °C with run 1 at 6V for 30 min. and run 2 at 20V for 180 min. Blot was dried overnight.

1.4.6 Primary antibody

Blot was rehydrated in 100% MeOH for 5 min, then washed in 1X TBST (TBS +

10% Tween) for 5 min. Blot was blocked for 1 hr, rt, with 5% BSA and afterwards washed 2X (5 min. each) with 1X TBST. Blot was incubated at 4 °C on a rocker with primary antibody in 1% BSA overnight. 1:5000 dilutions were used for controls, α-tubulin or β-actin, and 1:1000 or 1:2000 used for proteins of interest.

1.4.7 Secondary antibody

After incubation with primary, the blot was washed 3X, 5 min. with 1X TBST.

Blot was incubated with secondary antibody in 1% BSA for 1 hr at rt protected from light. To detect the controls, 1:15000 dilution goat anti-rabbit 680 was used and a 1:15000 dilution of goat anti-mouse 800 was used to detect proteins of interest.

1.4.8 Stripping blot

Blots were stripped of the antibodies after probing for phosphorylated protein when looking for total protein (i.e. blot was probed with pERK, stripped than probed again with total ERK). The blot was first rehydrated in MeOH for 5 min. and incubated for 5 additional min. in 1X TBST. Stripping buffer (Thermo

Scientific # 46430) was added to the blot for 10 min., and washed with 1X TBST.

The blot was imaged to see if all the antibodies were stripped. If not, the process was repeated (normally 3X total).

1.4.9 Imaging and analysis of blots

Blots were imaged and analyzed on the Odyssey Fc LI-Cor Version 4.0. Blots were imaged at 600 nm, 700 nm, and 800 nm with a 1 min. exposure at each

100

wavelength. To analysis blots, a boundary was set fitting the perimeter of the blot, and the lanes were set so that they went through the middle of the bands. The protein marker was also set as LI-COR One-Color Protein Marker and ONE was chosen in the Marker Lanes group. The bands were found automatically or manually and the background was subtracted out. The signals were normalized to the channel that had the control (either β-actin or α-tubulin) which was normally channel 800 nm. The band in the other channel (usually 700 nm) showed the value of each band signal divided by the normalization factor of the band in the normalization channel in the same lane. The normalized signal was divided by the basal level to give a relative protein levels, therefore, basal levels are always 1.

101

CHAPTER II: RESULTS

2.1. Dyn A-(2-13) does not activate the classical B2R signaling

2.1.1 Dyn A-(2-13) does not stimulate PI

The B2R is a Gq coupled GPCR and signals through the PLC pathway

which generates inositol through hydrolysis that can be measured in the PI assay.

The PI assay is the most common in vitro functional assay for a Gq coupled

receptor and was therefore performed. Agonists at the B2R stimulate PI, whereas

antagonists at the B2R do not stimulate PI and block BK-induced PI response. As

expected BK (H-Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg-OH), the endogenous

ligand for the

60 B2Rs, showed

s e

t Bradykinin l

a agonist activity a

h EC50 = 4.0 nM s

p 40

a s

b Dynorphin A(2-13)

d p

e in the PI assay with

t 30

o i

t 20 an EC = 4 nM,

n 50

]

H 3 [ 10 which is similar to

0 -10 -9 -8 -7 -6 -5 the reported value Log[Drug, M] in the literature

(Figure 2.3). The in

vivo data of Dyn A-

(2-13) suggests an agonist action at the B2R. Surprisingly, Dyn A-(2-13) (H-

Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-OH) did not stimulate PI at

any doses tested (Figure 2.3). From the data, it appears that Dyn A-(2-13) is

acting as an antagonist, therefore, it should block the agonist, BK, but when tested

102

Dyn A-(2-13) did not block BK-induced PI response. This data suggests that Dyn

A-(2-13) is not binding to the orthosteric site and may be an allosteric binder at the B2R.

2.1.2 Dyn A-(2-13) does not mobilize intracellular Ca2+

It was previously found that Dyn A-(2-13) stimulated an influx of Ca2+ through L and P/Q type channels.78 The B2R-HEK cells do not express these type of Ca2+ channels. Many signaling events cause a mobilization of intracellular Ca2+ that can be detected using a Ca2+ sensitive dye and HEK cells can be used for this type of assay. A FluoForte Calcium Kit from Enzo (ENZ-51017), in which, a cell permeable dye such as Fluo-acteoxymethyl (AM) ester was used. Once inside the cell, the AM ester bond is hydrolyzed by esterases. Upon activation of the GPCR, the endoplasmic reticulum (ER) releases Ca2+ that the dye can bind to that can then be measured. Some cells express an anion transporter that can pump the dye out of the cell, and to prevent the loss of the dye, a dye flux inhibitor can be added (Figure 2.4).

Figure 2.4: Summary of Ca2+ mobilization using a fluorescent dye indicator (in this example FluoForte). Figure from Enzo Life Sciences.

103

Using this assay, BK was found to cause a mobilization of Ca2+, which is

as to be expected since accumulation of PI also causes the mobilization of Ca2+.

On the other hand, there was no mobilization of Ca2+ when cells were stimulated e

with Dyn A- l

c 50 i

h Bradykinin EC50 = 1.2 nM

e V

(2-13). Similar 40 Dynorphin A (2-13)

)

i O

results were M

t a

a 20

M (

seen in the u

m i

t 10

Fluorescent d l

o 0 F -11 -10 -9 -8 -7 -6 -5 -4 Imaging Plate Log[Compound], M

Reader

(FLIPR) Ca2+

assay that was done by our collaborator, Dr. John Streicher. BK was found to

2+ stimulate Ca mobilization and had an EC50 = 1.2 nM. Dyn A-(2-13) did not

stimulate Ca2+ mobilization up to 100 μM (Figure 2.5). These results were similar

to the PI assay and suggest that BK is an agonist and Dyn A-(2-13) is an

antagonist. Therefore, the antagonist mode of this assay was carried out, and Dyn

A-(2-13) did not block BK-induced Ca2+ mobilization and was therefore, not

acting as an antagonist. These results are in line with the PI assay data, in that

Dyn A-(2-13) is neither an agonist or antagonist in either of the in vitro signaling

assays normally used for a Gq-coupled GPCR. This data further supports the

notion that Dyn A-(2-13) is not acting through the classical signaling pathway of

a Gq-coupled GPCR.

2.2. ELISA pERK signaling

104

The mitogen-activated protein kinases (MAPKs) are involved in cell proliferation, differentiation, motility, and cell death and are part of the

MAPK/ERK pathway.128 When extracellular signal-regulated kinases

(ERK) are phosphorylated to pERK, they can phosphorylate enzymes and transcription factors that can lead to cell proliferation (Figure 2.6).129 The

MAP/ERK pathway is commonly activated with most cell and GPCR types and there is evidence that ERK is activated by the βγ subunits of

GPCRs.130 It has been reported that BK activates the ERK pathway, but Dyn A-(2-13) has not been tested.131

An ELISA based assay probing for pERK activation was used to test the effects of

BK and Dyn A-(2-13). Three concentrations of each compound were chosen based on the

IC50 values from the binding assays. It was found that BK showed about a 2-fold stimulation of pERK over cells only at 10 nM and a slight stimulation at 1 nM but no stimulation at the highest dose, 100 nM (Figure 2.7). Dyn A-(2-13) did not stimulate pERK at any of the three concentrations tested (Figure 2.7). This data is not consistent with the literature, in that BK showed a 3-fold increase in pERK after incubation with

105

100 nM BK.131 The data from the literature was shown with a different method, using

Western Blot analysis. Also, there may have been an incomplete lysis of the cells in the

ELISA assay. The kit provided a

2000 l

cell lysate that was used as a a n

g 1500

positive control, and as from e c

n 1000

e c

Figure 2.7 the fluorescence signal s

e r

o 500 u

is very high. This control only l F 0 tested if the antibodies and l l y 6 7 8 7 8 9 r o r o l ------t t n n n n K K K n n O y y y B B B o o l s D D D C C l e e e reagents were working properly, it v v C + - Sam ple and Concentration did not account for the lysis step of the cells. An incomplete lysis of the cells could result in incorrect results. Therefore, it was decided that analysis by

Western blot analysis would be more beneficial.

2.3. Western blots to determine the signaling of Dyn A-(2-13) at the B2R

Dyn A-(2-13) signaling at the B2R did not activate the canonical pathway and may suggest a biased signaling mechanism. Biased ligands (or functional selectivity) engage one signaling pathway and avoid or block another pathway mediated by the same receptor.132 To determine what pathway may be activated upon binding of Dyn A-(2-13) at the B2R, Western Blots of various downstream signaling proteins were carried out. A high concentration of BK or Dyn A-(2-13), 1 μM, was used and incubated with the cells for 15, 30 or 60 mins. The cell lysates were probed with antibodies specific for various signaling proteins. For detection of the primary antibodies, a direct detection system of secondaries imaged via fluorescence was used. These secondaries contain infrared (IR)

106

fluorescent dyes that generate the signal with no substrates needed (Figure 2.8). This method is superior to other methods such as chemiluminescence that use the horseradish peroxidase (HRP) enzyme. The use of the IR dyes saves time as the protein of interest

and the control can be detected within the

same blot (provided each are at a different

wavelength i.e. 680RD and 800 CW) and the

signal lasts for months-years, and uses digital

imaging. With chemiluminescence, the blot

has to be stripped and reprobed to measure

controls, the signal only lasts hours, and detection is through film exposure. The proteins of interest are derived from rabbit

(except pSTAT) and are detected by an anti-rabbit 680 RD, whereas, the controls (β-actin or α-tubulin) are derived from mouse and were detected by an anti-mouse 800 CW secondary. A 1:15000 ratio was used for all the secondaries and dilutions of primaries

(1:2000 or 1:1000) were tested for what dilutions would give the best detection.

2.3.1 ERK

Since the results of the pERK ELISA from section 2.2 may not have been

accurate due to incomplete lysis, pERK activation was examined using Western

Blot analysis. The results (Figure 2.9) show that BK caused an increase in pERK

activation, that peaked at 15 min. (10-fold higher than basal). It was also found

that this activation was mediated through the B2R, as HEK cells, which do not

express the B2R, did not show a large activation at 15 min (Figure 2.9).

107

To test for total ERK levels, the blot was stripped of the antibodies and reprobed with a total ERK antibody. It was found that the highest levels of total

ERK, 2-fold, were measured in the B2-HEK cells at 15 min (Figure 2.10). This result is similar to what was seen with pERK although there was much less activation with total ERK. When HEK cells were tested for total ERK activation, the highest number was obtained after 15 mins. incubation (1.5-fold) and since the

B2R-HEK cells showed only a 2-fold increase it cannot be concluded if the increase in total ERK is mediated through the B2R. In summary, after 15 mins. incubation of BK there was a large increase in pERK activation and a slight increase in total ERK, with the pERK activity being mediated through the B2R.

The other incubation times of 30 and 60 min. showed little to no increase in either pERK or total ERK.

Figure 2.9: pERK Western blot with 1 μM BK in B2-HEK or HEK cells. 20 μg protein/ lane and probed with 1:2000 pERK, 1:5000 α-tubulin. Normalized data to

α-tubulin and relative to basal levels shown in the bar graph.

108

Figure 2.10: Total ERK Western blot with 1 μM BK in B2-HEK or HEK cells.

Same blot as Figure 2.9, stripped and reprobed. 20 μg protein/ lane and probed with 1:2000 Total ERK, 1:5000 α-tubulin. Normalized data to α-tubulin and relative to basal levels shown in the bar graph.

When Dyn A-(2-13) was tested for pERK activation, a slight increase was seen at 15 mins. (2-fold), which was a lot less than the activation seen with BK at this same time point (Figure 2.11). This slight increase in pERK activation at 15 min. does not appear to be mediated through the B2R, as HEK cells have about the same increase in activation at both 15 and 30 mins (Figure 2.11). At the 30 and 60 min incubations there was a decrease in pERK activation (0.6-fold and

0.4-fold respectively). The levels of total ERK in both B2-HEK and HEK cells are about the same at all the time points (Figure 2.12). In conclusion, Dyn A-(2-

13) does not activate pERK to the same extent that BK does. There was a 2-fold increase in pERK activation in B2-HEK but there was about the same increase in activity seen with HEK cells, therefore the slight increase is most likely not mediated by the B2R.

109

Figure 2.11: pERK Western blot with 1 μM Dyn A-(2-13) B2-HEK or HEK cells. 20 μg protein/ lane and probed with 1:2000 pERK, 1:5000 α-tubulin.

Normalized data to α-tubulin and relative to basal levels shown in the bar graph.

Figure 2.12: Total ERK Western blot with 1 μM Dyn A-(2-13) B2-HEK or HEK cells. Same blot as Figure 2.11, stripped and reprobed. 20 μg protein/ lane and probed with 1:2000 Total ERK, 1:5000 α-tubulin. Normalized data to α-tubulin and relative to basal levels shown in the bar graph.

2.3.2 Protein Kinase C (PKC)

PKC is a family of serine/threonine proteases that are involved in many cellular process such as; apoptosis, cell proliferation, angiogenesis, and differentiation.133 Since PKC has a role in cell proliferation and a cell proliferation was seen in the XTT assay, it was believed that this protein may play

110

in role in the function of Dyn A-(2-13) (Part I Section). There are 11 PKC isoforms that are divided into three categories. The classical or conventional PKC isoforms are Ca2+ dependent and are activated by diacylglycerol (DAG) and phosphotidylserine (PS) and include; PKCα, PKCβI, PKXβII, and PKCγ.133 The novel PKCs are Ca2+ independent and are regulated by DAG and PS and include;

PKCσ, PKCδ, PKCε, PKCη, and PKCθ.133 The atypical PKC isoforms are Ca2+ independent and are not regulated by DAG and include; PKCζ and PKCλ.133

Figure 2.13 summarizes the effects of the PKC isoforms. Since Dyn-A(2-13) did not stimulate Ca2+ mobilization and PI hydrolysis, the classical isoforms are not expected to be activated since they are downstream of the same pathway that's activated by a Gq-coupled GPCR, but other isoforms may be activated. Since BK acts through PLC it should increase DAG levels and therefore activate PKC.

111

To test PKC activity, an antibody sampler kit from Cell Signaling was used (#9921), which contained 7 isoforms of PKC. One of the first PKC isoforms tested was the classical isoform, pPKC α/β. BK was hypothesized to activate

PKC, especially this isoform because BK is known to increase DAG by acting through PLC. However, this was not the case, if anything levels appear to decrease after incubation with BK (Figure 2.14). After incubation with Dyn A-(2-

13) there was a slight increase over basal, with the highest increase (1.6-fold) seen at 60 mins (Figure 2.14). Another classical isoform PKCpan, was tested. BK showed ~0.5-fold decrease in activity of this isoform at 30 and 60 mins, whereas,

Dyn A-(2-13) showed ~1.5-fold increase at all time points (Figure 2.15).

Interestingly, BK activated an atypical PKC isoform, pPKC ζ/λ, up to 2.5-fold at

60 mins (Figure 1.16). This was not expected as the atypical isoforms are Ca2+ independent and are not regulated by DAG. On the other hand, Dyn A-(2-13) had little to no effect on this isoform (Figure 1.16).

Figure 2.14: pPKC α/β II (classical) Western blot with 1 μM BK or Dyn A-(2-

13). 20 μg protein/ lane and probed with 1:1000 pPKC α/β II, 1:5000 β-actin.

112

Data normalized to β-actin and relative to basal levels shown in the bar graph.

Figure 2.15: pPKC pan (classical) Western blot with 1 μM BK or Dyn A-(2-13).

20 μg protein/ lane and probed with 1:1000 pPKC pan, 1:5000 β-actin. Data normalized to β-actin and relative to basal levels shown in the bar graph.

Figure 2.16: pPKC ζ/λ (atypical) Western blot with 1 μM BK or Dyn A-(2-13).

20 μg protein/ lane and probed with 1:1000 pPKC ζ/λ, 1:5000 β-actin. Data normalized to β-actin and relative to basal levels shown in the bar graph.

A few novel PKC isoforms, δ/θ, δ and θ were tested. BK showed little activation of pPKC δ/θ at 15 and 60 mins and a slight activation at 30 min. (1.5- fold increase) (Figure 2.17). Dyn A-(2-13) lead to a decrease in activation when compared to basal (0.7-0.2-fold decrease) (Figure 2.17). When pPKC δ or pPKC θ were probed, there were no bands that corresponded to the antibody (Figure 2.18).

Since no bands were detected, the relative protein levels could not be calculated.

In all the blots the control, β-actin, was present, therefore, the lack of the protein

113

of interest may be indicative that those isoforms are not activated. No detection of bands could also mean that the antibody may not be working properly.

Therefore, a control should be used for confirmation of a working antibody. 12-O-

Tetradecanoylphorbol-13-acetate (TPA) is known to activate PKC, and could be used as a control.134 A recent addition to the PKC superfamily is the isoform,

PKD/PKCμ (PKD), which is regulated by DAG.135 When this isoform was tested there was also no measurable levels with BK or Dyn A-(2-13) (Figure 2.19).

Similar to the above, TPA, should be used as a control to test for activity of the antibody.

Figure 2.17: pPKC δ/θ (novel) Western blot with 1 μM BK or Dyn A-(2-13). 20

μg protein/ lane and probed with 1:1000 pPKC δ/θ, 1:5000 β-actin. Data normalized to β-actin and relative to basal levels shown in the bar graph.

Figure 2.18: pPKC δ (novel) and pPKC θ (novel) with 1 μM BK or Dyn A-(2-

13). 20 μg protein/ lane and probed with 1:1000 pPKC δ/ pPKC θ, 1:5000 β-actin.

114

Figure 2.19: pPKD/PKCμ Western blot with 1 μM BK or Dyn A-(2-13). 20 μg protein/ lane and probed with 1:1000 pPKD/PKCμ, 1:5000 β-actin. Data normalized to β-actin and relative to basal levels shown in the bar graph.

Although there were some activation of different isoforms the highest was only a 2.5-fold increase. Considering that a high concentration of compound was used, 1 μM, there may not be any activation at a lower dose that is more biologically relevant. Surprisingly, BK did not activate the classical PKC isoforms which was hypothesized based on the PI and Ca2+ mobilization assays.

Also, a lot of the bands are very faint and are not very sharp, which may add some error. All of this data is preliminary and will need to be confirmed to make sure the small increases seen are real.

2.3.3 Protein Kinase A (PKA)

PKA or cyclic adenosine monophosphate (cAMP)-dependent protein kinase plays a role in regulation and cell growth and only becomes activated when

115

there is cAMP.136 cAMP is a second messenger that is synthesized by adenylyl cyclase (AC) using ATP (Figure 2.20). Gs-coupled GPCRs are known to activate

AC whereas Gi coupled GPCRs inhibit AC. Even though the BRs are Gq coupled, there is some evidence that BK can directly activate AC by coupling the BRs to

137 Gs. Although the majority of the literature suggests that BK causes an accumulation of cAMP but by an indirect manner. BK is known to activate the synthesis of prostaglandins, which in turn bind to their own receptors which activate AC.138 It was previously hypothesized that Dyn A-(2-13)'s actions at the

B2R were mediated through a PKA-dependent pathway. This was believed when

H89, an inhibitor of PKA, blocked the Dyn A-(2-13) induced Ca2+ influx.78 H89 is not a very specific inhibitor for PKA, and therefore, the pathway could be different than what was previously thought. For these reasons the PKA antibody was used to detect for activation.

A Western blot after incubation (15 min, 30 min, and 60 min) with BK or

Dyn A-(2-13) was done probing with a pPKA antibody. The results of the blot are shown in Figure 2.21, and there was no measurable amount of PKA detected in any of the conditions. As stated earlier, one study showed that BK directly actives AC whereas others had evidence for an indirect pathway in which BK stimulates the synthesis of prostaglandins. This current data does not support a direct or indirect activation of AC, as there was no PKA seen. Although it was suggested in a previous study that Dyn A-(2-13) activity was mediated through

PKA, there was no PKA activity in this assay. In the study the inhibitor H89 was used which is not entirely specific for PKA, so this may account for the

116

discrepancies seen. Also since there is no band detected the antibody may not be working properly. A control that is known to activate PKA should also be run.

Figure 2.20: Summary of the cAMP pathway that involves PKA activation.

Reprinted by permission from Nature Publishing Group: [Nature] (139), copyright

2005.

Figure 2.21: pPKA Western blot with 1 μM BK or Dyn A-(2-13). 20 μg protein/ lane and probed with 1:1000 pPKA C, 1:5000 β-actin.

2.3.4 AKT

117

Protein kinase B or AKT is a threonine/serine kinase that is involved in many cellular processes such as; cell migration, proliferation, glucose metabolism, apoptosis, and transcription.140 AKT is activated when a tyrosine kinase is phosphorylated which recruits and activates phosphatidylinositol 3-kinase

(PI3K). The activated PI3K can then phosphorlyate phosphatidylinositol-4,5- bisphosphate (PIP2) which in turn is phosphorylated to phosphatidylinositol-3,4,5- trisphosphate (PIP3). AKT binds to PIP3 and phosphorylates other proteins (Figure

2.22).140 In addition to tyrosine kinases, the signaling pathway can be activated by integrins, B and T cell receptors, and GPCRs.

Since BK activates PIP2 through the PI pathway, it was hypothesized that it may also activate the AKT pathway. When BK was tested for AKT activation,

118

there were no measurable amounts of AKT but there were measurable amounts of the control, β-actin (Figure 2.23). Although there were no bands detected and no control run, this antibody is known to work as the same stock was used by our collaborators for their studies and bands were seen. Dyn A-(2-13) has not yet been tested with AKT.

Figure 2.23: pAKT Western blot with 1 μM BK. 20 μg protein/ lane and probed with 1:1000 pAKT, 1:5000 β-actin.

2.3.5 Signal Transducer and Activator of Transcription (STAT)

STAT is a protein that is activated by Janus Kinase (JAK) and is involved in cell growth, survival, and differentiation.141 In this pathway, activation of the interferon receptor (IFN-receptor) leads to the activation of JAK kinases that phosphorylate STAT proteins.141 The phosphorylated STAT proteins move to the nucleus and can direct transcription (Figure 2.25).142 When BK was probed for pSTAT activation, there were no measurable levels of the protein, but the

119

control, β-actin was measureable (Figure 2.25). Although there were no bands detected and no control run, this antibody is known to work as the same stock was used by our collaborators for their studies and bands were seen. Dyn A-(2-13) has yet to be tested in this pathway.

Figure 2.25: pSTAT Western blot with 1 μM BK. 20 μg protein/lane and probed with 1:1000 pSTAT, 1:5000 β-actin.

120

CHAPTER III: DISCUSSION AND FUTURE PERSPECTIVES

Upon binding of BK to the B2R, PI hydrolysis and mobilization of Ca2+ occurs, typical actions of a Gq-coupled GPCR. Dyn A-(2-13) is known to bind to the B2R, but data shows that it does not activate the classical signaling pathway. In both the PI and

Ca2+ mobilization assays, Dyn A-(2-13) did not stimulate nor did it antagonize BK- induced PI or Ca2+ responses. Therefore, it was acting as neither an agonist or antagonist.

In order to determine the signaling pathway of Dyn A-(2-13) at the B2R, Western blot analysis was done to look at downstream proteins that may be activated. For the

Western blot analysis, a high dose, 1 μM was used at 3 timepoints (15, 30 and 60 min.) to screen different signaling proteins that may be activated by Dyn A-(2-13). If a protein was activated after incubation, the same assay could be run in HEK cells without the B2R to see if the results were specific to the receptor. Next, a dose-response curve (in B2-

HEK cells) could then be done to see if the effects were dose dependent. pERK showed a large increase in activation when stimulated with BK (10-fold) and a slight activation when stimulated with Dyn A-(2-13) (1.5-fold). However, the small increase in pERK activation with Dyn A-(2-13) was found to not be mediated through the B2R, whereas,

BK's increase in pERK activity was mediated through the B2R. The levels of total ERK did not really increase with either compound. Seven different isoforms of pPKC were tested, with at least one from each category; classical, novel and atypical. Most of these isoforms showed little to no activation over basal with the highest being 2.5-fold increase of pPKCζ/λ levels by BK. Some of the isoforms showed a decrease in activation such as

Dyn A-(2-13) with pPKCδ/θ which was 0.5-fold below basal levels. Three pPKC isoforms, δ, θ, and μ, showed no measurable amounts of the target protein. There was

121

also no measurable protein when probing both compounds for PKA, or AKT and STAT when incubating with BK. Table 2.1 summarizes the results obtained from the Western

Blots.

Table 2.1: Summary of Western blot analysis Bradykinin Dyn A-(2-13) Protein Protein Levels Time (min.) Protein Levels Time (min.) Relative to Relative to Basal Basal pERK 10 15 1.5 15 pERK in HEK 2 15 1.7 15 Total ERK 2 15 1.1 30 Total ERK in 1.4 15 1.3 30 HEK pPKC α/β II 0.9 30 1.6 60 pPKC pan 1.0 15 1.9 60 pPKC ζ/λ 2.5 60 1.4 60 pPKC δ/θ 1.6 30 0.4 30 pPKC δ ______pPKC θ ______pPKD/PKCμ ______pPKA ______pAKT ______n.d. n.d. pSTAT ______n.d. n.d.

After incubation with BK or Dyn A-(2-13) at 3 time points, blots were probed with protein of interest to test for activation. The highest protein levels of each protein of interest is shown along with the time. ---: no measurable amounts n.d.: not determined

In summary of the Western Blot analysis, BK was found to activate pERK which was mediated through the B2R. BK did not activate any other pathway to that extent but there was a slight increase of pPKC ζ/λ which was unexpected as this isoform is Ca2+ and

122

DAG independent. Dyn A-(2-13) was not found to greatly activate any of the proteins examined. There were a few isoforms of PKC (α/β II and pan) that Dyn A-(2-13) increased the protein levels 1.5-1.9 fold. Both of these isoforms are of the classical type

2+ which are dependent on Ca and DAG, and both occur upon activation of Gq-coupled

GPCRs. It is already known that Dyn A-(2-13) does not active the classical signaling pathways of Gq-coupled GPCRs, so these results will need to be further examined. Lastly,

Dyn A-(2-13) was found to decrease the levels of pPKC δ/θ, a novel isoform that is independent of Ca2+ but dependent on DAG. This effect will also need to further examined but it may provide the signaling pathway for Dyn A at the B2R.

All of the Westerns are preliminary data with only n=1. Further studies to increase the n will need to be carried out in order to be more confident in the data and to do statistics. Also, Dyn A-(2-13) has not yet been tested with AKT or STAT and will therefore, need to be tested. If the results are the same with a larger n, and Dyn A-(2-13) does not show any significant activation of any of the tested pathways, other assays can be carried out. In particular, a β-arrestin assay may be beneficial, which directly measures

GPCR activity and can be used for any G type GPCR. This assay can also be used to test for biased ligands, as some ligands may not recruit β-arrestin. Also, only one dose was examined, 1 μM, which is a relatively large dose and there can be differences in activation of proteins at low and middle range doses. Therefore, a middle and low dose should also be tested.

Lastly, the data from the PI and Ca2+ mobilization assays suggest that the HEK cells may not be the ideal cell type when looking at signaling of Dyn A-(2-13) at the

B2R. A neuronal cell type such as, F11 or NG-108-15 cells, would be more in line with

123

the binding data that is in rat brain tissue. Earlier studies found that Dyn A-(2-13) induced Ca2+ influx through L and P/Q type channels by activating B2Rs present in F11 cells.78 This was originally believed to be accomplished through a PKA mediated pathway, as a PKA inhibitor, H89, blocked the Ca2+ influx. From this study it was found that PKA was not activated by BK or Dyn A-(2-13). Another possible explanation for the

Ca2+ influx could be the activation of the βγ subunit of the G-protein. Upon activation of a GPCR by an agonist, the Gα subunit dissociates from the Gβγ subunits (see introduction for more details). The Gα subunit goes on to activate effector proteins and the Gβγ has been found to inhibit or activate other effectors such as; PLC, phospholipase

A, Ca2+ channels, G protein-gated inward rectifier channels (GIRK), Raf-1, and others.143

Voltage-dependent inhibition of Ca2+ channels have been found to be mediated by binding of the Gβγ subunit to the Ca2+ channel.144 Inhibition of the channels does not account for the Ca2+ influx that was seen in the F11 cells, but the role of the Gβγ subunit in F11 cells could be examined.

HEK cells do not express L or P/Q type Ca2+ channels, so an influx study of Ca2+ could not be examined. A transfection of L and P/Q type Ca2+ channels could be done in the hB2-HEK cells, and then Ca2+ influx studies could be used as a functional assay.

NG108-15 cells, a hybrid of a rat glioma and mouse neuroblastoma, endogenously express the B2R as well as Ca2+ channels and could be used for Ca2+ influx studies as well.

Another possible cell line is the PC12 cells, a rat pheochromocytoma cell line, that are closely related to sympathetic neurons and endogenously express the B2R.145

124

Upon activation of the B2R in these cells, noradrenaline is released which could be used as a functional assay.146

125

PART III

STUDY OF A NOVEL BRADYKININ 2 RECEPTOR IN THE CENTRAL

NERVOUS SYSTEM

126

INTRODUCTION

Bradykinin receptors

The BRs are in the rhodopsin-like family of GPCRs and contain an extracellular

N-terminus, an intracellular C-terminus, 3 extracellular loops and 3 intracellular loops.

There are two subtypes of the receptor, the bradykinin 1 receptor (B1R) and the bradykinin 2 receptor (B2R) that share 36% sequence identity (Figure 3.1).122 The BRs are present in peripheral and central tissues and are located on sensory neurons in the nociceptive pathway.147 The B1R is expressed in low levels in healthy tissue but found in higher levels following inflammation or injury, whereas the B2R is ubiquitous and constitutively expressed.122

Figure 3.1: Structures of the B1R and B2R. Reprinted with permission from.122

Endogenous kinins

Kinins, such as BK and KD, are a group of endogenous peptides that mediate many biological mechanisms that act through the BRs.148 They are derived from (high or

127

low molecular mass) kininogen found primarily in the liver. The protease action of plasma or tissue kallikreins on kininogen cleaves the peptide into BK or KD respectively.

Aminopeptidase can convert KD to BK and carboxypeptidases can release other metabolites (Figure 3.2). The kinins have been found to activate Aδ and C-fibers to cause pain149 as well as be involved in inflammatory processes.150 BK, a mediator of inflammation, preferentially binds with high affinity (Ki = 0.54 nM) to the human B2R

81 and with low affinity to the human B1R (Ki > 10,000). Since bradykinin binds preferentially to the B2R, the hyperalgesic effects of BK have been linked with the activation of the B2R.122 Therefore, B2R antagonists have been designed to block the hyperalgesic effects caused by the activation of the B2R.

B2R antagonists

Much work went into developing B2R antagonists that would be selective and able to block BK-induced inflammatory responses. One of the essential changes for converting BK from an agonist to antagonist was replacement of Pro7 with a DPhe.109

Although this modification was a weak antagonist, it was a start for further development.

128

It was discovered that when Phe5 and Phe8 were replaced with β-(2-thienyl)alanine (Thi) in addition to the DPhe7 modification, this led to an effective antagonist.109 Other modifications for potent antagonists included; replacement of one or both Pro2, Pro3 with trans-4-hydroxyproline (Hyp), and an extension of the amino terminus with Lys-Lys or

DArg.151 Many of these B2R antagonists have been shown in rats to block BK-induced vascular pain and BK-induced paw hyperalgesia.147 While there was much work on developing B2R antagonists, the potency of the resulting ligands (pA2: an antagonist's affinity at the receptor) did not exceed 7 (Table 3.1). Work by Henke and colleagues discovered HOE140 (approved name icatibant) by introducing into BK's structure unnatural amino acids that had been used in the development of ACE inhibitors.152

HOE140 was found to be 2-3 orders of magnitude more potent than previous B2R antagonists (Table 3.1). HOE140 is approved for the use of patients with hereditary angioedema (HAE), a disease in which there are episodes of swelling of the hands, feet, face, and airway. During an acute attack, HOE140 was found to significantly reduce the swelling in patients.153

There has been much work into designing and synthesizing B2R antagonists that are effective analgesics but serious side effects that limit their use were found. Hypotension is regulated by the agonist action of BK at the BRs, and by blocking the receptor with an antagonist, this can cause deleterious effects on the cardiovascular system.148 However, since the cardiovascular effects arise from antagonist action at the peripheral B2Rs, B2R antagonists that are only centrally acting can be effective analgesics by avoiding these serious side effects.

129

Table 3.1: Structures and potency of B2R antagonists

a Antagonist Antagonist potency, pA2

Name Sequence GPI Rat Uterus

n.a. [DPhe7]BK 5.0 1%

n.a. [Thi5,8, DPhe7]BK 6.3 6.4

NPC349c DArg-[Hyp3, Thi5,8, DPhe7]BK 6.0 6.9

NPC567 c DArg-[Hyp3, DPhe7]BK 5.9 6.5

NPC573 c DArg-[DNal1, Thi5,8, DPhe7]BK Inactive 5.6

NPC414 c Lys-Lys-[Hyp2,3, Thi5,8, DPhe7]BK 5.6 0.05%

NPC566 c DArg-[Hyp2, DPhe7]BK 6.3 2%

NPC722 c [Leu5,8, Gly6, DPhe7]BK 5.9 0.20%

HOE140 d DArg-[Hyp3, Thi5, DTic7, Oic8]BK 8.4 n.d.

aPotency determined in the presence of agonist BK. Compounds that produced agonist contraction of the tissue have the potencies expressed as %. bRef.109 cRef.147 d Ref.154 n.d: not determined n.a: not applicable

Rational

Much work went into the development of B2R antagonists to block BK's agonist actions. From these studies, HOE140, a very potent B2R antagonist, was developed.

Analogues of this compound were designed and synthesized in our laboratory. When these analogues were tested for their affinity at the B2R, they were found to not have any affinity at the B2R. Further studies examined the binding of HOE140 and found discrepancies in different tissues. An examination of the B2R gene was carried out to

130

determine the cause of the discrepancy. We hypothesize that the B2R present in the CNS is pharmacologically and structurally different than the B2R in the PNS.

131

CHAPTER I: MATERIALS AND METHODS

1.1 Reagents

Agarose, ampicillin, Hepes, CaCl2, Na2HPO4, glycerol, PMSF, captopril, bacitracin, and

DTT, were obtained from Sigma Aldrich. Geneticin was purchased from Gibco.

Turbofect was purchased from Life Technologies. Primers were purchased from Midland

Certified Reagent Company. All other items are listed below.

1.2 Membranes preps for; rat brain, rat spinal cord, rat uterus, rat spleen, rat heart, guinea pig brain, guinea pig ileum, hB2-HEK cells, and hB1-HEK cells

Crude membranes were prepared from fresh whole brains, spinal cord, uterus, spleen , or heart isolated from male Sprague Dawley rats, cultures of transfected HEK 293 cells, or brains and ileum from guinea pig. Tissues/cell pellets were homogenized with a Polytron

PT 2100 homogenizer (Pittsburgh, PA) in ice-cold buffer (50 mM Tris-HCl, pH 7.4 and

100 µM phenylmethylsulfonylfluoride (PMSF)) followed by centrifugation at 4,000 rpm in a Beckman JA-18 rotor for 15 min at 4 °C with the supernatants collected. The procedure was repeated, and the supernatants were then centrifuged at 17,500 rpm in a

Beckamn JA-18 rotor for 30 min at 4 °C. Crude membrane pellets were resuspended in the same ice-cold buffer as above for storage at -80 ºC until use. Protein concentration was determined by the Lowry method.104

1.3 Competitive radioligand binding assay

Crude membranes were pelleted and resuspended in assay buffer [50 mM Tris, pH 6.8, containing 50 g/mL bacitracin, 10 M captopril, 100 M PMSF, 5 mg/mL BSA, (1 mM

DTT used for GPI binding). For competition assays, 10 concentrations of a test compound were each incubated with 50 g of membranes and 1 nM [3H]BK. Non-

132

specific binding was defined by that in the presence of 10 M KD in all assays.

Incubations were carried out in a shaking water bath at 25 °C for 120 min. Reactions were terminated by rapid filtration through Whatman GF/B filters (Gaithersburg, MD) presoaked in 1% polyethyleneimine, followed with four washes of 2 mL cold saline.

1.4 Cloning

1.4.1 Primers for PCR cloning of sB2R

Forward: 5'-TAG CGG CCG CAC ATG CTC AAT GTC- 3' (Tm= 61 ºC)

Reverse: 5'-TCT AGA CTC GAG TCA CTG TCT GC-3' (Tm= 57 ºC)

The vector plasmid that was used was the Bradykinin receptor B2 (BDKRB2)

cloned into pcDNA 3.1+ with EcoRI (5') and XhoI (3').

1.4.2 Polymerase Chain Reaction (PCR)

Used Invitrogen Platinum PCR Supermix (#11306). Want 400 nM final

concentration of primers and 50 ng of DNA. The tubes were incubated in a

thermal cycler at 94 ºC for 2 mins. 25-35 cycles of PCR amplification were

carried out based on the following; 30 seconds at 94 ºC (denature), 30 seconds at

55 ºC (annealing), and 1 min. at 72 ºC (extension).

1.4.3 Restriction enzymes analysis

XhoI (#15231-012), SmaI (#15228-018), NotI (#15441-025), EcoRI (#15202-

013) were all purchased from Invitrogen. 1 μL of restrictions enzyme was added

to ≤ 1 μg DNA in 1X of the provided buffer and incubated 1 hr at 37 ºC. For

double or triple digests, the buffer used was determined from the invitrogen

website.

1.4.4 Agarose gel

133

Agarose gels (1-1.5%) were made in TBE buffer using GelStar (Lonza #50535) and ran at 95 mV for 1 hour. A 1kb Plus DNA ladder (Invitrogen # 10787-018) was used for comparison of bands. Gels were imaged at 300 nm on a Kodak

EDAS 290 imager.

1.4.5 Freeze N' Squeeze

To obtain the DNA from an agarose gel, Biorad Freeze N' Squeeze Spin columns

( 732-6165) were used. The band of interest was cut out by a razor and the excess agarose was trimmed off. The piece was then chopped up and placed in a spin column and placed in a -20 ºC for 5 minutes. The sample was then spun at 13,000 g for 3 minutes at rt.

1.4.6 DNA/RNA concentration and purity

1 μL of sample was analyzed on a ND-1000 Nanodrop. DNA and RNA absorb at

260 nm, and the absorbance of common contaminates are at 280 nm (protein) and

230 nm (EDTA, or organic contaminates). Concentration was given in ng/uL. For

RNA a 260/280 ratio of ~ 2.0 and 260/230 ratio ≥ 1.8 is pure. For DNA a 260/280 ratio of ~ 1.8 and 260/230 ratio ≥ 1.8 is pure.

1.4.7 Ligation

For ligation of insert to vector want a 3:1 ratio with the amount of DNA 0.01 μg -

0.1 μg. The 3:1 ratio of insert to vector was added to 0.1 units of T4 DNA ligase with the 5X provided buffer (Invitrogen, # 15224) and left overnight. A 1.2% agarose gel was done to ensure ligation.

1.4.8 Transformation into E. coli

134

The plasmid contains an ampicillan resistance gene so transformed E. coli cells

can be selected. For transformation, competent E. coli DH5α cells (Invitrogen)

and the plasmid were heat shocked and then incubated on ice. Afterwards, various

concentrations of the plasmid of interest was added to ampicillan plates. A single

colony from the plates was picked and inoculated in E. Coli to obtain the bacterial

stock, which was purified or frozen at -80 ºC in 15-40% glycerol.

1.4.9 Purification with midi prep kit

Biorad # 732-6120 purification kit was used in which 40 mL of the culture from

1.4.8 was spun at rt for 5 minutes at 3,000 g. The pellet was resuspended in Cell

Resuspension Solution and vortexed. Cell Lysis Solution was added and the tube

was inverted 6-8 times. Afterwards, Neutralization Solution was added and the

tube was inverted 6-8 times and centrifuged at rt for 10 minutes at 7,500 g. The

supernatant was kept and Quantum Prep Matrix was added to the lysate and

centrifuged at rt for 2 mins at 7,500 g. Wash Buffer was added to resuspend and

wash the pellet 2X. The washed matrix was added to a spin column and Wash

Buffer was added and centrifuged at rt for 30 seconds at 12-14,000 g. After 2

washes, water was added to the spin column to elute the DNA from the column.

1.5 Transient and stable transfection

1.5.1 Transient transfection

For transient transfection, Turbofect (solution of cationic polymers that coat

DNA)155 was chosen as the transfection agent (protocol below). Different ratios

of Turbofect (TF) : DNA were used, 2:1, 1.5:1, and 1:1. Cells were analyzed at 24

hrs, 48 hrs, or 72 hrs after tranfection to test for the highest level of transfection.

135

RNA extraction with PCR and binding assays were used as analysis of transfection efficiency.

1.5.1.1 TF protocol155

Performed transfections in 6-well plates when HEK cells were ~ 70%

confluent in serum-free media. 4 μg of DNA was added to 400 μL serum-

free media and added to 8 , 6 or 4 μL TF (amount depending on ratio 2:1,

1.5:1, or 1:1 desired). This mixture was incubated at rt for 15-20 minutes.

400 μL of the mixture was added to each well and the plate was gently

rocked to evenly distribute the mixture. The plate was incubated at 37 ºC

for at least 24 hrs.

1.5.2 Stable transfection

155 For stable transfection, both the TF protocol and the CaPO4 precipitation protocol156 were used. 48 hrs after transfection, the transfection mixture was removed and serum media was added to the flasks. After 72 hrs, the flasks were split in a 1:4 or 1: 8 dilution into 10 cm2 petri dishes and 600 μg/mL of the selection reagent, Geneticin, was added to each dish. Media was changed every 3 days for at least 15 days. Colonies were picked and transferred to 24-well plates.

When cells were confluent in 24-well plate, they were grown in flasks and frozen stocks and membrane preps were made.

156 1.5.2.1 CaPO4 protocol

The following was all done in serum-free media. In tube A added 15 μg

DNA with 31 μL 2M CaCl2 and water was added for a total of 250 μL. In

tube B 250 μL 2X HBS (solution of NaCl, Hepes, and Na2HPO4) was

136

added. Tube A was added dropwise to tube B and the whole solution was

added to each 25 cm2 flask of HEK cells. After a 4 hr incubation at 37 ºC,

media was aspirated and washed with PBS. 500 μL 15% glycerol/HBS

was added to each flask and incubated for 1 min. The solution was

aspirated and the cells were washed with PBS and complete media was

added and cells were incubated at 37 ºC until selection.

1.6 RNA extraction

Cells were lysed using 1 mL Purezol (Biorad). After lysis, 200 μL chloroform was added which separates into an aqueous phase, an interphase and a organic phase. The aqueous phase, which contains the RNA, was collected and purified using the Aurum Total Fatty and Fibrous Tissue Kit (Biorad 732-6830). Ethanol was added to the aqueous phase which was added to an RNA binding column. The columns were washed multiple times and treated with DNAse I. Finally, an elution solution was used to elute the RNA from the column. RNA concentration was determined by measuring absorbance at 280, 260 and 230 nm using a Nanodrop.

1. 7 Reverse transcriptase-polymerase chain reaction (RT-PCR)157

200 ng of RNA was added to RT-PCR Supermix (Biorad #170-8841). A no template and positive control were used. The reaction was incubated in a thermal cycler with the following protocol; 5 min. at 25 ºC (priming), 30 min. at 42 ºC (RT), and 5 min. at 85 ºC

(RT inactivation).

1.8 PCR with long and short form B2R primers hB2R Forward: 5'-TGCTGCTATTCATCATCTGC-3' hB2R Reverse: 5'-CTGAATGGGTTCTGACCTG-3'

137

N-terminal Long B2R Forward: 5'-GGAATTCACCATGTTCTCTCCC-3' (Tm= 55 ºC)

N-terminal Short B2R Forward: 5'- GCGGCCGCATGCTCAATG -3' (Tm= 55 ºC)

C-terminal B2R Reverse: 5'-CTCGAGTCACTGTCTGCTCC-3' (Tm= 56 ºC)

B2R 220 downstream: 5'-CAGCACGAACAGCACCCAGAG-3' (Tm= 58 ºC)

PCR was carried out like in 1.4.2

138

CHAPTER II: RESULTS

2.1 Discrepancy in binding of HOE140

Analogues based on HOE140's structure (H-DArg-Arg-Pro-Hyp-Gly-Thi-Ser-

DTic-Oic-Arg-OH)158 were designed and synthesized, but when these compounds were testing for affinity at the B2R in rat brain membranes there was no affinity. Further studies found that HOE140 binds with low affinity (IC50 = 1100 nM) to the B2Rs present in rat brain membranes (although the IC50 value suggest moderate affinity, when looking at the curve, Figure 3.3A, there is little competition). On the other hand, the endogenous ligand, BK, does bind with high affinity IC50 = 100 nM (Figure 3.3B, Table 3.2). When

HOE140 was first discovered, the standard tissue used for binding and functional assays was the guinea pig ileum (GPI) and therefore, HOE140 was tested in this tissue. In our hands we were able to replicate the literature as both HOE140 and BK bound with high affinity (Figure 3.3, Table 3.2) to the GPI. HOE140 was also tested in hB2R cells and was found to not bind whereas BK had similar affinity to rat brain (Figure 3.3, Table 3.2).

It has also been found that a Dyn A analogue does not block bradykinin-induced contraction in a GPI assay, but it does block hyperalgesic effects when given spinally.

These discrepancies between neuronal and peripheral tissues lead us to speculate that the neuronal B2R is pharmacologically and structurally distinct from the B2R in peripheral tissues (e.g., vascular smooth muscle, gut, immune cells). A difference in potency at neuronal and peripheral tissues is of significance because cardiovascular effects of B2R antagonists are regulated by peripheral B2R. Therefore, B2R antagonists that are centrally acting can be safe and effective analgesics not showing serious cardiovascular effects.

139

) )

d 125

u u

o 100 100

i f

Rat Brain c i 75 i

f 75

c Rat Brain

i e

hB2-HEK c p

50 e hB2-HEK p S 50

GPI S

GPI

% (

25 %

( 25

] 0

-13 -11 -9 -7 -5 -3 ] 0

3 [

H -13 -11 -9 -7 -5 -3 3 Log [HOE140],M [ Log [BK],M

Figure 3.3: Competitive binding analysis with 1 nM [3H]BK of (A.) HOE140 (B.)and

BK in 3 membrane preparations. Each curve is fitted from data pooled from at least 2 independent experiments.

Table 3.2: Summary of HOE140 and BK affinities in rat brain, hB2-HEK, and GPI membranes

Membranes HOE140 BK

a a IC50 (nM) ± s.e.m n I50 (nM) ± s.e.m n

Rat Brain 1100 ± 510 3 100 ± 12 3

hB2-HEK 9100 ± 1900 3 82 ± 26 4

GPI 0.55 2 14 ± 4 3

3 a Competitive binding analysis at pH 6.8 with 1 nM [ H]BK. IC50 values were obtained by non-linear least squares analysis of at least 2 independent experiments (n) and expressed as mean + s.e.m for those conditions of 3 or more independent experiments.

2.2 Heterogeneity of the B2R in the literature

Since the 1980s there has been evidence of heterogeneity of the B2R and even the hypothesis of another type of BR, termed B3R.159 The proposal of the heterogeneity arises because in some tissues, well known agonists and antagonists of the B2R show a very different biological profile. In particular, Farmer et al., has suggested a new BK

140

binding site because known B2R antagonists, NPC567 and NPC349, did not inhibit BK- induced bronchoconstriction or BK-induced airway smooth muscle contraction, which are well known effects of BK.159a The authors also found that in vitro, the B2R antagonists had low affinity for pulmonary B2Rs and high affinity for ileum B2Rs. Their data suggests that the pulmonary effects are not due to B1R or B2R and instead involve a new receptor, termed B3R.159a Braas and colleagues also found similar results in guinea pig ileum and N1E-115 cell membranes (a murine neuroblastoma cell line), with [Thi5,8,

D-Phe7]-BK showing antagonist activity in the ileum and agonist activity in N1E-115 cells.159b Many critics believe this heterogeneity arises from species differences and not

160 different receptors. Characterization of B2R subtypes, termed B2A and B2B, was proposed by Regoli and coworkers based on different potencies of B2R antagonists in different species.159e According to Regoli et al., the B2Rs in rat and guinea pig tissue belong to a similar entity and were labeled B2B. Alternatively, the rabbit and human

159c subtypes were similar and have been labeled B2A. Our results do not correlate with their data as we see that the human and rat B2R subtypes are similar, whereas the guinea pig B2R is a separate subtype. Interestingly, Regoli also reported that HOE140 has been shown to be a very potent antagonist in rat, guinea pig, rabbit and human tissues and does not discriminate between their proposed B2R subtypes.159c Again, our data does not support their results, because we do not see the same potency of HOE140 at the B2R from rat, human, and guinea pig. Therefore, our results may arise from something other than species differences. These differences may arise due to the type of tissue examined.

The work done by Regoli and colleagues was performed in peripheral tissue, whereas our work was performed in neuronal tissue. A difference in central versus peripheral tissue

141

may account for the different potencies of HOE140 we have seen. Braas et al.'s observation of differences in the biological profile of BK analogues in a neuroblastoma cell line, N1E-115, when compared to GPI, further supports the hypothesis.159b

2.3 Binding results of tissues from different species

Since one of the main criticisms of the heterogeneity of the B2R is that it may just be a species difference, determining the heterogeneity within one animal, the rat, was carried out. Rat spinal cord was tested to compare it to the brain and all three compounds

(HOE140, BK, and Dyn A-(2-13)) were found to behave similarly to the brain in terms of binding affinities (Table 3.3). Since HOE140 was found to bind with high affinity to the GPI, the rat ileum was tested but unfortunately since the rat is a smaller animal than the guinea pig, there was not enough B2R expression to generate a curve. Rat spleen was tried because it is a large peripheral organ and it was hypothesized that HOE140 would bind in the peripheral. Surprisingly, HOE140 did not bind at the rat spleen either (Table

3.3). When thinking about the GPI, it is a tissue that is used for contractility assays and therefore, organs in the rat that are more muscular, such as the heart and bladder were used. The bladder did not contain a high enough expression of the B2R for binding but the heart did. Unfortunately, HOE140 did not bind to the rat heart. In all the tissues tested for rat, HOE140, bound in the μM range, whereas, BK and Dyn A-(2-13) had affinities ~ 100 nM (Table 3.3). Similar affinities were seen in the HEK cells that express the human B2R, whereas neither of the 3 compounds had affinity at the human B1R, which is to be expected as BK and HOE140 have reported low affinity for the B1R

(Table 3.3). The data of HOE140 affinity in rat supports the notion that the heterogeneity

142

of the B2R arises from a species difference (i.e. HOE140 binds to the B2R in guinea pig but not rat B2R).

Table 3.3: Binding results of tissues from different species

Membranes HOE140 BK Dyn A-(2-13)

a IC50 (nM) n IC50 (nM) n IC50 (nM) n

Brain 1100 ± 510b 3 120 2 22 ± 3 5

Rat Spinal Cord 7,500 2 110 ± 13 4 59 2

Spleen >10,000 4 130 ± 69 3 130 ± 21 3

Heart >10,000 2 110 2 77 2

Human hB2R-HEK 9700 2 49 ± 4 6 62 ± 21 3

hB1R-HEK 5500 ± 1080 3 2800 ± 300 3 >10,000 3

Guinea Brain 8700b 2 67 b 1 n.d.

Pig Ileum 0.55 b 2 14 ± 4 b 3 69 2

3 a Competitive binding analysis at pH 6.8 with 1 nM [ H]DALKD IC50 values were obtained by non-linear least squares analysis of at least 2 independent experiments (n) and expressed as mean + s.e.m for those conditions of 3 or more independent experiments

(unless > 10,000 nM). b1 nM [3H] BK.

Since HOE140 did not bind in any rat tissues tested (Table 3.2), tissue from the guinea pig was examined for possible differences. It was found that HOE140 had high affinity for GPI (IC50 = 0.55 nM) and low affinity for the guinea pig brain (IC50 = 8700 nM). On the other hand, BK had similar affinity in both tissue (Table 3.3). Therefore, the discrepancy of affinity for HOE140 is not a species difference and arises from a difference of the B2R within the specific tissue.

2.4 Alternate splice variant

143

According to sequencing, the human B2R gene consists of three exons separated by two introns and contains an alternatively spliced variant (Figure 3.4).161 Through cloning it has also been found that there are three in frame AUG triplets that can be potential translational start sites. By using domain-specific anti-peptide antibodies, it was determined that the first in-frame AUG site (located on Exon 2) is used as the start site for translation.162 When splicing occurs as in Figure 3.4A, the canonical long isoform of the B2R is translated. When alternative splicing occurs, as in Figure 3.4B, the short isoform of the B2R is translated, containing 27 less amino acids at the N-terminus. These alternative splice variants and multiple AUG codons could account for the discrepancies found in the guinea pig brain and GPI as the N-terminus of other GPCRs have been found to be involved in binding and activation of the receptor.163 Interestingly, the hBR-HEK cells in Table 3.3 consist of the long form of the B2R, whereas the literature to date testing HOE140 in transfected cell line used the short form B2R because it contained a

Kozak sequence which is important for initiation of translation and was considered the start site. In the literature HOE140 binds to transfected cells that express the short form

B2R (sB2R), leading to the hypothesis that there are differences between the two isoforms.

144

Figure 3.4: A. Splice variant of the hB2R translating the long form. B. Splice variant of the hB2R translating the short form.

2.5 Cloning of the short form B2R (sB2R)

Once a discrepancy in binding of HOE140 was found in one species, it was important to examine the molecular difference between the B2Rs in the guinea pig brain versus the peripheral GPI. The current hypothesis is that the short form of the B2R is present in the GPI and HOE140 binds with high affinity, while the long form of the B2R is present in the brain and HOE140 binds with low affinity (Table 3.4). To test this

145

hypothesis, the short of the human B2R was transfected into HEK cells, and can directly be compared to the long form of the B2R that we currently have.

Table 3.4: Hypothesis of long and short form B2R.

Long Form Short Form

HOE140 binds with low affinity HOE140 binds with high affinity and is an antagonist

Present in rat and guinea pig brain Present in guinea pig ileum

Similar to the human B2R, the rat B2R also contains 3 exons and 2 introns.164

Using a Basic Local Alignment Search Tool (BLAST) the rat and human B2R genes have been aligned, and the two species have an 80% identity at their amino acid sequences.

More importantly, the two ATG start sites are conserved in both species (Figure 3.5).

Hence, an alternative splice variant is also plausible in rats. Based on binding, the data that was obtained suggests that the B2R in the rat brain and transfected human cells are the same form. Therefore, results obtained from the human short form of the receptor may be comparable to rat.

Rat …CTGAGTACAAATGCACTGTTCTTGGAAGCGACCCGTGCTCCTGTCCGTGCATGAGC--C || || || ||| ||| | | | | | || | || | | | | | |||| | || | ||| | | Human …CTGAGTCCAAATGTTCTCTCCCTGGAAGAT A TCAATGTTTCTGTCTGTTCGTGAGGACTC Rat CATGCCCACCACAGCCTCTCTGGGCATTGAAATGTTCAACATCACCACGCAAGCCCTGGG … | || |||||| ||| ||||||| | || || ||| || || |||||| |||||| | Human CGTGCCCACCACGGCCTCTTTCAGCGCCGACATGCTCAATGTCACCTTGCAAG ------G …

Figure 3.5: BLAST of the rat and human B2R. The species have 80% identity and the two ATG sites are conserved

146

Figure 3.6: Strategy for obtaining short form B2R.

147

Figure 3.6 shows the strategy for obtaining the short form of the B2R

(sB2R), in which PCR cloning was used.

To clone the sB2R, the plasmid pcDNA3.1+ (Figure 3.7) that had the long form of the B2R inserted in between

EcoRI and XhoI was used as a template.

Primers were designed that were specific for the sB2R and that introduced a NotI cut site at the N-terminus (See Methods for primer sequence). These primers were used in a PCR reaction to amplify the sB2R that had a NotI cut site at the N-terminus. After PCR, the sample was ran on a 1% agarose gel and the band corresponding to the PCR product was cut out and purified. A pcDNA3.1+ plasmid that did not have an insert and the PCR product were double digested with NotI and XhoI. The digested plasmid and PCR product made sticky ends that could be ligated overnight when mixed with DNA ligase.

After the ligation of the plasmid

with the sB2R insert, the plasmid

was transformed into E. coli and

plated on Agar + ampicillin

plates. Colonies were picked

from the agar plates and

innoculated into Luria Broth

(LB) for additional growth. After a midi prep to clean up the DNA, the concentrations

148

and purity of the 20 colonies picked were measured using a Nanodrop. All of the colonies had concentrations of 75 - 400 ng/μL and the 260/280 and 260/230 ratios were ≥ 1.8 which suggests the samples are pure and free of proteins and other contaminates (Table

3.5). To confirm the presence of the sB2R in these samples, a double digest with NotI and XhoI was carried out. If the sB2R insert was present in the sample, there should be a band at ~ 1200 on the agarose gel. From the gels it was found that clones 18-20 contained the sB2R (Figure 3.8). These three clones were sent to sequencing to confirm the sequence and were found to be indeed the sB2R.

Table 3.5: Concentration and purity of DNA of sB2R clones

Sample #1 #2 #3 #4 #5 #6 #7 #8 #9 #10 Concentration (ng/μL) 192.3 287.3 272.4 144 75.1 195 248.6 248.8 335 286.6 260/280 1.91 1.9 1.9 1.94 1.9 1.9 1.89 1.9 1.9 1.9 260/230 1.95 1.93 1.92 1.81 1.86 1.86 1.9 1.96 2.02 2.03 Sample #11 #12 #13 #14 #15 #16 #17 #18 #19 #20 Concentration (ng/μL) 173.2 392.9 284.7 147.5 236.1 156.3 183.7 180.2 247.3 289.6 260/280 1.92 1.89 1.91 1.91 1.9 1.91 1.92 1.93 1.92 1.9 260/230 1.8 2.02 2.04 1.85 1.9 1.87 1.97 1.98 2.03 2.06

A restriction map of the sB2R was made to further confirm the presence of the plasmid + insert. The 3 restriction enzymes (RE) listed in Figure 3.9 were used to digest the sB2R plasmid and the resulting gel of the triple digest is shown in

Figure 3.10. The presence of 3 bands at ~

2900 bp, 2500 bp, and 1100 bp confirm the plasmid is correct.

149

Figure 3.10: 1% agarose gel after triple digest of sB2R plasmid (4 separate preps). The bands correlate well with the restriction map of the plasmid.

2.6 Transfection of HEK-293 cells with short form B2R

2.6.1 Transient transfection

A transient transfection of the sB2R was first tried as it is much quicker

than a stable transfection. First a trial transfection was carried out in which the

ratio of TF : DNA were tested (2:1, 1.5:1, and 1:1) as well as incubation time (24,

48, or 72 h). After transfection, the RNA from the cells was extracted, RT-PCR

was performed and finally PCR with specific primers (hB2R forward and hB2R

reverse, which amplify 260 bp at the C-terminus) were used to see if the cells

expressed the receptor. Although it is difficult to accurately quantify amounts

from a gel, it can give a rough estimate of amount of receptor present if the same

concentrations of DNA are used. From Figure 3.11 the best time was 48 h, and

both 2:1 and 1:1 TF: DNA ratios showed about the same intensity of the band but

1:1 was used since it uses less material. Using these conditions, a transient

transfection was carried out. Unfortunately, this method did not produce a high

enough expression in the cells that could be used for binding (total bound= 1000

cpm and non-specific= 900 cpm). Generally for binding a low non-specific

150

number is desired with only ~20% of total bound being non-specific. With the transient transfection, non-specific binding was ~90%. Transient expression of a receptor is normally used in studying signaling pathways that naturally have amplification. In binding there is no amplification, so generally high expressing clones are needed. Therefore, a stable expression would be a better choice for this study.

Figure 3.11: 1.2% Agarose gel testing conditions (incubation time, and TF:DNA ratios) of the transient transfection.

2.6.2 Stable transfection

Since transient transfection of the sB2R did not achieve usable binding, a stable transfection was carried out. The conditions determined in the transient transfection were used as well as another method, CaPO4 precipitation. After transfection, cells were plated in dishes and a selection agent, geneticin, was added. Normal cells are not resistant to this agent and will die, whereas cells that have been transfected with the plasmid will survive because the plasmid contains a neomycin resistant gene. These cells that survive will grow in individual colonies that can then be picked and tested for expression. 24 clones were picked after the first round of transfection, but unfortunately, all but 3 of the colonies became contaminated with mold. After everything was cleaned and the solutions were filtered, a 2nd stable transfection was carried out. In the 2nd transfection there was still mold contamination and only 9 out of 24 clones survived. After

151

more cleaning and obtaining new supplies, a 3rd transfection was carried out with

still mold contamination. Since the source of the mold could not be identified, the

4th and 5th transfections were carried out in another laboratory. After changing

laboratories, there was no detection of mold and a total of 71 clones were able to

be grown into membrane preps and frozen stocks. All of the 71 clones were tested

in binding to see if they were high expressing. Many of the clones had low

expression of the sB2R as evident in the high non- specific binding (40-90%).

Clones #27 and #28 were the best with ~30% non-specific binding and were

further studied.

2.7 Confirmation of sB2R in HEK cells

Confirmation of the presence of a receptor in cells or tissue is normally confirmed by antibodies that are specific for the receptor. Unfortunately, there are no good antibodies for the B2R, let alone antibodies that could differentiate between the long and short form. Therefore, to confirm the existence of the sB2R in the newly transfected HEK cells, RNA was extracted from the cells and RT-PCR was used to convert the RNA to

DNA, and finally, specific primers were used in a PCR reaction and the results were run on a gel. The first primers used were the same primers used in Figure 3.11, which prime towards the C-terminus of the receptor and therefore do not distinguish between the long and short form. Figure 3.12 shows a gel using these primers in the 2 clones (#27, and 3 preps of clone #28). All of the clones express the B2R (or at least the C-terminus).

Figure 3.12: 1% agarose gel of clones #27 and #28 of sB2R with B2R primers

152

towards the C-terminus. All clones express the B2R.

Since the short and long form of the B2R differ by 81 bp at the N-terminus, specific primers to distinguish the two forms could be designed. Primers were designed that started near the first ATG start site and went 220 bp downstream (N-terminal long).

Another set of primers started near the second ATG start site and went 137 bp downstream (N-terminal short). These two sets of primers were used in a PCR reaction from DNA extracted from cells that express the long form B2R as well as the two sB2R clones (#27 and #28). The long form B2R should show bands under both conditions and the short form should only show a band with the N-terminus short form primers. Figure

3.13 shows the results and confirms the presence of the sB2R in clones #27 and #28.

Figure 3.13: 1.5% agarose gel of long form B2R and clones #27 and #28 (using #28-2) with primers for the long and short form B2R. Gel confirms presence of sB2R in clones

#27 and #28. NTC = no template control, used to detect contamination of primers.

Another set of primers were used to further confirm the sB2R expression in the clones. Primers for N-terminal long form (starts near 1st ATG site) and C-terminal were used which would make a 1190 bp band. Also, N-terminal short form (starts near 2nd

ATG site) and C-terminal which would make a 1106 bp band were used. The long form was expected to show bands under both primers, whereas, the sB2R was expected to show bands only when the N-terminal short form primers were used. The results are shown in Figure 3.14, and the bands are not very clear and are not at the correct place on the gel. This is possibly because a fragment of ~1100 bp is a very long fragment to obtain

153

from PCR (normally 500 bp is maximum). Nevertheless, the results show what was expected; B2R (which is long form) shows bands at both primers and the sB2R clones only show a band at N-terminal short.

Figure 3.14: 1% agarose gel of long form B2R and clones #27 and #28 (using #28-2) with primers for the long and short form B2R and the C-terminal (bands at 1190 bp and

1106 bp). Although bands are not at correct place and are smeared, it shows what was to be expected. NTC = no template control, used to detect contamination of primers.

2.8 Binding of sB2R

From the transfections, 2 clones were high expressing and were confirmed to have the sB2R. The next step was to test HOE140, BK, and Dyn A-(2-13) in these cells, with the hypothesis that HOE140 would have high affinity. Unfortunately, there were issues with binding, where the non specific binding for every membrane preparation was ≥

70%. Current work is being carried out to determine why the non-specific binding is so high and once that is fixed, the compounds can be tested at the sB2R.

154

CHAPTER III: DISCUSSION AND FUTURE PROSPECTIVES

A well known B2R antagonist, HOE140, was found to not bind in rat brain or

HEK cells that express the hB2R, but did bind with high affinity to the GPI which is the standard tissue used for binding. Heterogeneity of the B2R has been evident in the literature for many years, but was usually seen in different species and HOE140 was found to be an effective antagonist in all species. None of the literature examined CNS tissue so we hypothesized that the B2R in the CNS was different than the B2R in the peripheral. This is important as centrally acting B2R antagonists could be therapeutics for pain without the cardiovascular liabilities as peripherally acting B2R antagonists. To examine the heterogeneity in rat, different CNS and PNS tissues were tested (brain, spinal cord, spleen, and heart) but HOE140 did not bind to any of the tissues. Rat ileum and bladder were also tested but these tissues did not express a high enough level of the

B2R for binding. Since the heterogeneity could not be found in the rat, the guinea pig was the next species examined. HOE140 was found to bind with high affinity (IC50 = 0.55 nM) to the GPI and low affinity to the guinea pig brain (IC50 = 8700 nM), which provides evidence that this heterogeneity of the B2R is not a species difference.

After the heterogeneity was found in one species, the next step was to determine the difference of the B2R in the two tissues. The B2R is known to have a alternatively spliced variant that may contribute to the discrepancies seen in the binding of HOE140.

It is hypothesized that the short form of the B2R is present in the GPI and HOE140 binds with high affinity, whereas, the long form of the B2R is present in the guinea pig brain and HOE140 binds with low affinity. PCR cloning was used to obtain the sB2R, which was then transfected into HEK cells. The transfection afforded two high expressing

155

clones, and PCR with specific primers further confirmed the expression of the sB2R in these clones.

Even though clones with a high expression of the sB2R have been isolated, a binding analysis of HOE140 in this form has not been able to be tested due to problems in the radioligand assay (all membrane preparations, even controls, have very high non- specific binding). Once the problems with the radioligand binding assay are fixed,

HOE140, BK and Dyn A-(2-13) will be tested in this form of the receptor and compared to the tissue data. If HOE140 binds with high affinity to the sB2R, this will give further support to the notion that the two isoforms of the B2R results in different binding profiles. Next, an analysis of the amount of short and long form of the B2R present in the

GPI and guinea pig brain can be measured using qPCR. It is hypothesized that the GPI will have a high amount of sB2R, whereas, the guinea pig brain will have a high amount of long form B2R. If this holds true, analogues can be designed that target the long form of the receptor located in the CNS for analgesics. If these analogues are selective for the long form and not the short form, they also may not have the cardiovascular liabilities that HOE140 and other peripheral B2R antagonists have. The Dyn A analogues from part

I had high affinity at the rat brain, which is presumably the long form of the B2R. These analogues will need to be further tested in the short form of the B2R.

If the short form of the B2R does not show any difference when compared to the long form of the B2R, post-translational modifications of the B2R can be examined.

Phosphorylation of GPCRs normally occurs on the intracellular side and is used for signaling and the recruitment of β-arrestin that is involved in desensitization and internalization of the receptor.165 It has been observed that the rat B2R (short form) at

156

basal level (no activation with BK) was phosphorylated at Ser365, Ser371, Ser378, Ser380,

Thr374, Tyr161, Tyr362 with palmitoylation at Cys356, all located on the intracellular side of the membrane.166 Tyr161 is highly conserved in all known B2Rs and is involved in the G- protein coupling and therefore is most likely important in signaling.166 The other phosphorylation sites have been found to be important in the internalization of the

B2R.166 N-glycosylation at 2-3 sites of the hB2R (short form) has been observed and is thought to be involved in receptor dimerization.167 All of these post-translational modifications have been examined in the short form of the B2R and examination in the long form B2R could be carried out. The best way to detect phosphorylation or glycosylation of the B2R would be to isolate the receptor from specific tissues (such as guinea pig ileum and brain) and after purification submit it for a mass spectrometry analysis, a technique called mass fingerprinting. Increases in the mass can suggest sites of modification where an increase of 80 Da suggests a single phosphorylation site, 160 Da two phosphorylation sites, and 238 Da a palmitoylation site.

157

APPENDIX A: LYS1044 DEGRADATION PROFILE

158

159

APPENDIX B: BLOCKADE OF NON-OPIOID EXCITATORY EFFECTS OF

SPINAL DYNORPHIN A AT BRADYKININ RECEPTORS

Receptors and Clincal Investigations, 2015

160

161

162

163

164

APPENDIX C: MODIFICATION OF AMPHIPATHIC NON-OPIOID DYNORPHIN A

ANALOGUES FOR RAT BRAIN BRADYKININ RECEPTORS

Bioorganic and Medicinal Chemistry Letters, 2015

165

166

167

168

169

APPENDIX D: STRUCTURE-ACTIVITY RELATIONSHIPS OF NON-OPIOID [DES-

ARG7] DYNORPHIN A ANALOGUES FOR BRADYKININ RECEPTORS

Bioorganic and Medicinal Chemistry letters, 2014

170

171

172

173

174

APPENDIX E: DISCOVERY OF AMPHIPHATIC DYNORPHIN A ANALOGUES

TO INHIBIT THE NEUROEXCITATORY EFFECTS OF DYNORPHIN A THROUGH

BRADYKININ RECEPTORS IN THE SPINAL CORD

Journal of the American Chemical Society, 2014

175

176

177

178

179

180

181

182

183

184

APPENDIX F: STRUCTURE ACTIVITY RELATIONSHIP OF DYNORPHIN A(2-13)

ANALOGS AT THE BRADYKININ-2 RECEPTOR

Proceedings of the 23rd American Peptide Symposium, 2013

185

186

187

APPENDIX G: [DES-ARG7] DYNORPHIN A ANALOGUES AT THE

BRADYKININ-2 RECEPTOR

Proceedings of the 23rd American Peptide Symposium, 2013

188

189

190

APPENDIX H: DEVELOPMENT OF POTENT DYNORPHIN A ANALOGS AS

KAPPA OPIOID RECEPTOR ANTAGONISTS

Proceedings of the 23rd American Peptide Symposium, 2013

191

192

193

REFERENCES

1. In Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research, Washington (DC), 2011. 2. Stewart, W. F.; Ricci, J. A.; Chee, E.; Morganstein, D.; Lipton, R., Lost productive time and cost due to common pain conditions in the US workforce. Jama 2003, 290 (18), 2443-54. 3. Baron, R., Mechanisms of disease: neuropathic pain--a clinical perspective. Nature clinical practice. Neurology 2006, 2 (2), 95-106. 4. Moore, R. A.; Straube, S.; Wiffen, P. J.; Derry, S.; McQuay, H. J., Pregabalin for acute and chronic pain in adults. The Cochrane database of systematic reviews 2009, (3), CD007076. 5. Sindrup, S. H.; Otto, M.; Finnerup, N. B.; Jensen, T. S., Antidepressants in the treatment of neuropathic pain. Basic & clinical pharmacology & toxicology 2005, 96 (6), 399-409. 6. Watanabe, S.; Bruera, E., Corticosteroids as adjuvant analgesics. Journal of pain and symptom management 1994, 9 (7), 442-5. 7. McIntosh, M.; Cruz, L. J.; Hunkapiller, M. W.; Gray, W. R.; Olivera, B. M., Isolation and structure of a peptide toxin from the marine snail Conus magus. Archives of biochemistry and biophysics 1982, 218 (1), 329-34. 8. Lynch, S. S.; Cheng, C. M.; Yee, J. L., Intrathecal ziconotide for refractory chronic pain. The Annals of pharmacotherapy 2006, 40 (7-8), 1293-300. 9. McGivern, J. G., Ziconotide: a review of its pharmacology and use in the treatment of pain. Neuropsychiatric disease and treatment 2007, 3 (1), 69-85. 10. Sachs, C. J., Oral analgesics for acute nonspecific pain. American family physician 2005, 71 (5), 913-8. 11. Finnerup, N. B.; Sindrup, S. H.; Jensen, T. S., The evidence for pharmacological treatment of neuropathic pain. Pain 2010, 150 (3), 573-81. 12. Mohammed, S. I.; Eldabe, S.; Simpson, K. H.; Brookes, M.; Madzinga, G.; Gulve, A.; Baranidharan, G.; Radford, H.; Crowther, T.; Buchser, E.; Perruchoud, C.; Batterham, A. M., Bolus intrathecal injection of ziconotide (Prialt(R)) to evaluate the option of continuous administration via an implanted intrathecal drug delivery (ITDD) system: a pilot study. Neuromodulation : journal of the International Neuromodulation Society 2013, 16 (6), 576-81; discussion 582. 13. Goldstein, A.; Tachibana, S.; Lowney, L. I.; Hunkapiller, M.; Hood, L., Dynorphin-(1- 13), an extraordinarily potent opioid peptide. Proc Natl Acad Sci U S A 1979, 76 (12), 6666-70. 14. Goldstein, A.; Fischli, W.; Lowney, L. I.; Hunkapiller, M.; Hood, L., Porcine pituitary dynorphin: complete amino acid sequence of the biologically active heptadecapeptide. Proc Natl Acad Sci U S A 1981, 78 (11), 7219-23. 15. Schwarzer, V., 30 years of dynorphins- new insights on their functions in neuropsychiatric diseases. Pharmacology and Therapeutics 2009, 123, 353-370. 16. Chavkin, C. J., I.F.; Goldstein, A. , Dynorphin Is a Specific Endogenous Ligand of the K Opioid Receptor. Science 1982, 215 (22), 413-415. 17. (a) Zukin, R. S.; Eghbali, M.; Olive, D.; Unterwald, E. M.; Tempel, A., Characterization and visualization of rat and guinea pig brain kappa opioid receptors: evidence for kappa 1 and kappa 2 opioid receptors. Proc Natl Acad Sci U S A 1988, 85 (11), 4061-5; (b) Clark, J. A.; Liu, L.; Price, M.; Hersh, B.; Edelson, M.; Pasternak, G. W., Kappa opiate receptor multiplicity: evidence for two U50,488-sensitive kappa 1 subtypes and a novel kappa 3 subtype. J Pharmacol Exp Ther 1989, 251 (2), 461-8; (c) Simonin, F.; Gaveriaux-Ruff, C.; Befort, K.; Matthes, H.; Lannes, B.; Micheletti, G.; Mattei, M. G.; Charron, G.; Bloch, B.; Kieffer, B., kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system. Proc Natl Acad Sci U S A 1995, 92 (15), 7006-10.

194

18. Bruchas, M. R.; Land, B. B.; Chavkin, C., The dynorphin/kappa opioid system as a modulator of stress-induced and pro-addictive behaviors. Brain Res 2010, 1314, 44-55. 19. (a) Winkler, C. W.; Hermes, S. M.; Chavkin, C. I.; Drake, C. T.; Morrison, S. F.; Aicher, S. A., Kappa opioid receptor (KOR) and GAD67 immunoreactivity are found in OFF and NEUTRAL cells in the rostral ventromedial medulla. J Neurophysiol 2006, 96 (6), 3465-73; (b) Neugebauer, V.; Li, W.; Bird, G. C.; Han, J. S., The amygdala and persistent pain. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 2004, 10 (3), 221-34; (c) Gutstein, H. B.; Mansour, A.; Watson, S. J.; Akil, H.; Fields, H. L., Mu and kappa opioid receptors in periaqueductal gray and rostral ventromedial medulla. Neuroreport 1998, 9 (8), 1777-81. 20. (a) Bruijnzeel, A. W., kappa-Opioid receptor signaling and brain reward function. Brain research reviews 2009, 62 (1), 127-46; (b) Mysels, D.; Sullivan, M. A., The kappa-opiate receptor impacts the pathophysiology and behavior of substance use. The American journal on addictions / American Academy of Psychiatrists in Alcoholism and Addictions 2009, 18 (4), 272- 6. 21. Pan, Z. Z.; Tershner, S. A.; Fields, H. L., Cellular mechanism for anti-analgesic action of agonists of the kappa-opioid receptor. Nature 1997, 389 (6649), 382-5. 22. Millan, M. J., Kappa-opioid receptors and analgesia. Trends in pharmacological sciences 1990, 11 (2), 70-6. 23. (a) Ko, M. C.; Butelman, E. R.; Woods, J. H., Activation of peripheral kappa opioid receptors inhibits capsaicin-induced thermal nociception in rhesus monkeys. J Pharmacol Exp Ther 1999, 289 (1), 378-85; (b) Walker, J. S., Anti-inflammatory effects of opioids. Adv Exp Med Biol 2003, 521, 148-60. 24. Pfeiffer, A.; Brantl, V.; Herz, A.; Emrich, H. M., Psychotomimesis mediated by kappa opiate receptors. Science 1986, 233 (4765), 774-6. 25. Zhang, S.; Tong, Y.; Tian, M.; Dehaven, R. N.; Cortesburgos, L.; Mansson, E.; Simonin, F.; Kieffer, B.; Yu, L., Dynorphin A as a potential endogenous ligand for four members of the opioid receptor gene family. J Pharmacol Exp Ther 1998, 286 (1), 136-41. 26. Chavkin, C.; Goldstein, A., Specific receptor for the opioid peptide dynorphin: structure-- activity relationships. Proc Natl Acad Sci U S A 1981, 78 (10), 6543-7. 27. Lung, F. D.; Meyer, J. P.; Li, G.; Lou, B. S.; Stropova, D.; Davis, P.; Yamamura, H. I.; Porreca, F.; Hruby, V. J., Highly kappa receptor-selective dynorphin A analogues with modifications in position 3 of dynorphin A(1-11)-NH2. J Med Chem 1995, 38 (4), 585-6. 28. (a) Kawasaki, A. M.; Knapp, R. J.; Kramer, T. H.; Wire, W. S.; Vasquez, O. S.; Yamamura, H. I.; Burks, T. F.; Hruby, V. J., Design and synthesis of highly potent and selective cyclic dynorphin A analogues. J Med Chem 1990, 33 (7), 1874-9; (b) Kawasaki, A. M.; Knapp, R. J.; Kramer, T. H.; Walton, A.; Wire, W. S.; Hashimoto, S.; Yamamura, H. I.; Porreca, F.; Burks, T. F.; Hruby, V. J., Design and synthesis of highly potent and selective cyclic dynorphin A analogs. 2. New analogs. J Med Chem 1993, 36 (6), 750-7; (c) Meyer, J. P.; Collins, N.; Lung, F. D.; Davis, P.; Zalewska, T.; Porreca, F.; Yamamura, H. I.; Hruby, V. J., Design, synthesis, and biological properties of highly potent cyclic dynorphin A analogues. Analogues cyclized between positions 5 and 11. J Med Chem 1994, 37 (23), 3910-7. 29. Kawasaki, A. M.; Knapp, R. J.; Walton, A.; Wire, W. S.; Zalewska, T.; Yamamura, H. I.; Porreca, F.; Burks, T. F.; Hruby, V. J., Syntheses, opioid binding affinities, and potencies of dynorphin A analogues substituted in positions, 1, 6, 7, 8 and 10. International journal of peptide and protein research 1993, 42 (5), 411-9. 30. Gairin, J. E. G., C,; Mazarguil, H.; Alvinerie, P.; Cros, J. , [D-Pro10]Dynorphin-(1-11) is a highly potent and selective ligand for k opioid receptors. Eur J Pharmacol 1985, 106, 457-458. 31. Choi, H.; Murray, T. F.; DeLander, G. E.; Schmidt, W. K.; Aldrich, J. V., Synthesis and opioid activity of [D-Pro(10)]dynorphin A-(1-11) analogues with N-terminal alkyl substitution. J Med Chem 1997, 40 (17), 2733-2739.

195

32. Nakazawa, T.; Furuya, Y.; Kaneko, T.; Yamatsu, K.; Yoshino, H.; Tachibana, S., Analgesia produced by E-2078, a systemically active dynorphin analog, in mice. J Pharmacol Exp Ther 1990, 252 (3), 1247-54. 33. (a) Tachibana, S. Y., H.; Arakawa, Y.; Nakazawa, T.; Kaneko, T.; Yamatsu, K.; Miyagawa, H. , Biowarning Sytem in the Brain. University of Tokyo Press: Tokyo, 1988; (b) Yoshino, H.; Nakazawa, T.; Arakawa, Y.; Kaneko, T.; Tsuchiya, Y.; Matsunaga, M.; Araki, S.; Ikeda, M.; Yamatsu, K.; Tachibana, S., Synthesis and structure-activity relationships of dynorphin A-(1-8) amide analogues. J Med Chem 1990, 33 (1), 206-12. 34. Yu, J.; Butelman, E. R.; Woods, J. H.; Chait, B. T.; Kreek, M. J., Dynorphin A (1-8) analog, E-2078, crosses the blood-brain barrier in rhesus monkeys. J Pharmacol Exp Ther 1997, 282 (2), 633-8. 35. Hiramatsu, M.; Inoue, K.; Ambo, A.; Sasaki, Y.; Kameyama, T., Long-lasting antinociceptive effects of a novel dynorphin analogue, Tyr-D-Ala-Phe-Leu-Arg psi (CH(2)NH) Arg-NH(2), in mice. Br J Pharmacol 2001, 132 (8), 1948-56. 36. Cohen, B. M.; Murphy, B., The effects of pentazocine, a kappa agonist, in patients with mania. The international journal of neuropsychopharmacology / official scientific journal of the Collegium Internationale Neuropsychopharmacologicum 2008, 11 (2), 243-7. 37. (a) Shippenberg, T. S.; Zapata, A.; Chefer, V. I., Dynorphin and the pathophysiology of drug addiction. Pharmacology & therapeutics 2007, 116 (2), 306-21; (b) Mello, N. K.; Negus, S. S., Interactions between kappa opioid agonists and cocaine. Preclinical studies. Annals of the New York Academy of Sciences 2000, 909, 104-32. 38. Knoll, A. T.; Meloni, E. G.; Thomas, J. B.; Carroll, F. I.; Carlezon, W. A., Jr., Anxiolytic-like effects of kappa-opioid receptor antagonists in models of unlearned and learned fear in rats. J Pharmacol Exp Ther 2007, 323 (3), 838-45. 39. Carey, A. N.; Borozny, K.; Aldrich, J. V.; McLaughlin, J. P., Reinstatement of cocaine place-conditioning prevented by the peptide kappa-opioid receptor antagonist arodyn. Eur J Pharmacol 2007, 569 (1-2), 84-9. 40. Rothman, R. B.; Gorelick, D. A.; Heishman, S. J.; Eichmiller, P. R.; Hill, B. H.; Norbeck, J.; Liberto, J. G., An open-label study of a functional opioid kappa antagonist in the treatment of opioid dependence. Journal of substance abuse treatment 2000, 18 (3), 277-81. 41. Guerrini, R.; Capasso, A.; Marastoni, M.; Bryant, S. D.; Cooper, P. S.; Lazarus, L. H.; Temussi, P. A.; Salvadori, S., Rational design of dynorphin A analogues with delta-receptor selectivity and antagonism for delta- and kappa-receptors. Bioorg Med Chem 1998, 6 (1), 57-62. 42. Lu, Y.; Nguyen, T. M.; Weltrowska, G.; Berezowska, I.; Lemieux, C.; Chung, N. N.; Schiller, P. W., [2',6'-Dimethyltyrosine]dynorphin A(1-11)-NH2 analogues lacking an N-terminal amino group: potent and selective kappa opioid antagonists. J Med Chem 2001, 44 (19), 3048-53. 43. Schlechtingen, G.; Zhang, L.; Maycock, A.; DeHaven, R. N.; Daubert, J. D.; Cassel, J.; Chung, N. N.; Schiller, P. W.; Goodman, M., [Pro(3)]Dyn A(1-11)-NH(2): a dynorphin analogue with high selectivity for the kappa opioid receptor. J Med Chem 2000, 43 (14), 2698-702. 44. Bennett, M. A.; Murray, T. F.; Aldrich, J. V., Identification of arodyn, a novel acetylated dynorphin A-(1-11) analogue, as a kappa opioid receptor antagonist. J Med Chem 2002, 45 (26), 5617-9. 45. Vig, B. S.; Murray, T. F.; Aldrich, J. V., A novel N-terminal cyclic dynorphin A analogue cyclo(N,5)[Trp(3),Trp(4),Glu(5)] dynorphin A-(1-11)NH(2) that lacks the basic N- terminus. J Med Chem 2003, 46 (8), 1279-82. 46. Patkar, K. A.; Yan, X.; Murray, T. F.; Aldrich, J. V., [Nalpha-benzylTyr1,cyclo(D- Asp5,Dap8)]- dynorphin A-(1-11)NH2 cyclized in the "address" domain is a novel kappa-opioid receptor antagonist. J Med Chem 2005, 48 (14), 4500-3. 47. Aldrich, J. V.; Patkar, K. A.; McLaughlin, J. P., Zyklophin, a systemically active selective kappa opioid receptor peptide antagonist with short duration of action. Proc Natl Acad Sci U S A 2009, 106 (43), 18396-401.

196

48. Aldrich, J. V.; McLaughlin, J. P., Peptide kappa opioid receptor ligands: potential for drug development. Aaps J 2009, 11 (2), 312-22. 49. Bruchas, M. R.; Chavkin, C., Kinase cascades and ligand-directed signaling at the kappa opioid receptor. Psychopharmacology 2010, 210 (2), 137-47. 50. Carroll, I.; Thomas, J. B.; Dykstra, L. A.; Granger, A. L.; Allen, R. M.; Howard, J. L.; Pollard, G. T.; Aceto, M. D.; Harris, L. S., Pharmacological properties of JDTic: a novel kappa- opioid receptor antagonist. Eur J Pharmacol 2004, 501 (1-3), 111-9. 51. Wollemann, M.; Benyhe, S., Non-opioid actions of opioid peptides. Life Sci 2004, 75 (3), 257-70. 52. Walker, J. M.; Moises, H. C.; Coy, D. H.; Baldrighi, G.; Akil, H., Nonopiate effects of dynorphin and des-Tyr-dynorphin. Science 1982, 218 (4577), 1136-8. 53. Walker, J. M.; Katz, R. J.; Akil, H., Behavioral effects of dynorphin 1-13 in the mouse and rat: initial observations. Peptides 1980, 1 (4), 341-5. 54. Young, E. A.; Walker, J. M.; Houghten, R.; Akil, H., The degradation of dynorphin A in brain tissue in vivo and in vitro. Peptides 1987, 8 (4), 701-7. 55. (a) Walker, J. M.; Moises, H. C.; Coy, D. H.; Young, E. A.; Watson, S. J.; Akil, H., Dynorphin (1-17): lack of analgesia but evidence for non-opiate electrophysiological and motor effects. Life Sci 1982, 31 (16-17), 1821-4; (b) Kaneko, T.; Nakazawa, T.; Ikeda, M.; Yamatsu, K.; Iwama, T.; Wada, T.; Satoh, M.; Takagi, H., Sites of analgesic action of dynorphin. Life Sci 1983, 33 Suppl 1, 661-4; (c) Herrera-Marschitz, M.; Hokfelt, T.; Ungerstedt, U.; Terenius, L.; Goldstein, M., Effect of intranigral injections of dynorphin, dynorphin fragments and alpha- neoendorphin on rotational behaviour in the rat. Eur J Pharmacol 1984, 102 (2), 213-27. 56. (a) Faden, A. I.; Jacobs, T. P., Dynorphin-related peptides cause motor dysfunction in the rat through a non-opiate action. Br J Pharmacol 1984, 81 (2), 271-6; (b) Herman, B. H.; Goldstein, A., Antinociception and paralysis induced by intrathecal dynorphin A. J Pharmacol Exp Ther 1985, 232 (1), 27-32; (c) Przewlocki, R.; Shearman, G. T.; Herz, A., Mixed opioid/nonopioid effects of dynorphin and dynorphin related peptides after their intrathecal injection in rats. Neuropeptides 1983, 3 (3), 233-40. 57. Malan, T. P.; Ossipov, M. H.; Gardell, L. R.; Ibrahim, M.; Bian, D.; Lai, J.; Porreca, F., Extraterritorial neuropathic pain correlates with multisegmental elevation of spinal dynorphin in nerve-injured rats. Pain 2000, 86 (1-2), 185-194. 58. Dubner, R.; Ruda, M. A., Activity-dependent neuronal plasticity following tissue injury and inflammation. Trends in neurosciences 1992, 15 (3), 96-103. 59. Millan, M. J.; Millan, M. H.; Pilcher, C. W.; Colpaert, F. C.; Herz, A., Chronic pain in the rat: selective alterations in CNS and pituitary pools of dynorphin as compared to vasopressin. Neuropeptides 1985, 5 (4-6), 423-4. 60. Sydbom, A.; Terenius, L., The histamine-releasing effect of dynorphin and other peptides possessing Arg-Pro sequences. Agents and actions 1985, 16 (3-4), 269-72. 61. Chahl, L. A.; Chahl, J. S., Plasma extravasation induced by dynorphin-(1-13) in rat skin. Eur J Pharmacol 1986, 124 (3), 343-7. 62. Vera-Portocarrero, L. P.; Xie, J. Y.; Kowal, J.; Ossipov, M. H.; King, T.; Porreca, F., Descending facilitation from the rostral ventromedial medulla maintains visceral pain in rats with experimental pancreatitis. Gastroenterology 2006, 130 (7), 2155-64. 63. Vanderah, T. W.; Suenaga, N. M. H.; Ossipov, M. H.; Malan, T. P.; Lai, J.; Porreca, F., Tonic descending facilitation from the rostral ventromedial medulla mediates opioid-induced abnormal pain and antinociceptive tolerance. J Neurosci 2001, 21 (1), 279-286. 64. Peters, C. M.; Lindsay, T. H.; Pomonis, J. D.; Luger, N. M.; Ghilardi, J. R.; Sevcik, M. A.; Mantyh, P. W., Endothelin and the tumorigenic component of bone cancer pain. Neuroscience 2004, 126 (4), 1043-52. 65. Faden, A. I.; Molineaux, C. J.; Rosenberger, J. G.; Jacobs, T. P.; Cox, B. M., Increased dynorphin immunoreactivity in spinal cord after traumatic injury. Regul Pept 1985, 11 (1), 35-41.

197

66. Wang, Z. J.; Gardell, L. R.; Ossipov, M. H.; Vanderah, T. W.; Brennan, M. B.; Hochgeschwender, U.; Hruby, V. J.; Malan, T. P.; Lai, J.; Porreca, F., Pronociceptive actions of dynorphin maintain chronic neuropathic pain. J Neurosci 2001, 21 (5), 1779-1786. 67. Vanderah, T. W.; Laughlin, T.; Lashbrook, J. M.; Nichols, M. L.; Wilcox, G. L.; Ossipov, M. H.; Malan, T. P., Jr.; Porreca, F., Single intrathecal injections of dynorphin A or des- Tyr-dynorphins produce long-lasting allodynia in rats: blockade by MK-801 but not naloxone. Pain 1996, 68 (2-3), 275-81. 68. Luo, M. C.; Chen, Q. M.; Ossipov, M. H.; Rankin, D. R.; Porreca, F.; Lai, J., Spinal Dynorphin and Bradykinin Receptors Maintain Inflammatory Hyperalgesia. J Pain 2008, 9 (12), 1096-1105. 69. Ghasemi, M.; Schachter, S. C., The NMDA receptor complex as a therapeutic target in epilepsy: a review. Epilepsy & behavior : E&B 2011, 22 (4), 617-40. 70. (a) Caudle, R. M.; Isaac, L., A novel interaction between dynorphin(1-13) and an N- methyl-D-aspartate site. Brain Res 1988, 443 (1-2), 329-32; (b) Stewart, P.; Isaac, L., A strychnine-sensitive site is involved in dynorphin-induced paralysis and loss of the tail-flick reflex. Brain Res 1991, 543 (2), 322-6. 71. (a) Bakshi, R.; Faden, A. I., Blockade of the glycine modulatory site of NMDA receptors modifies dynorphin-induced behavioral effects. Neurosci Lett 1990, 110 (1-2), 113-7; (b) Long, J. B.; Rigamonti, D. D.; Oleshansky, M. A.; Wingfield, C. P.; Martinez-Arizala, A., Dynorphin A- induced rat spinal cord injury: evidence for excitatory amino acid involvement in a pharmacological model of ischemic spinal cord injury. J Pharmacol Exp Ther 1994, 269 (1), 358- 66. 72. Koetzner, L.; Hua, X. Y.; Lai, J.; Porreca, F.; Yaksh, T., Nonopioid actions of intrathecal dynorphin evoke spinal excitatory amino acid and prostaglandin E-2 release mediated by cyclooxygenase-1 and-2. J Neurosci 2004, 24 (6), 1451-1458. 73. Faden, A. I., Dynorphin increases extracellular levels of excitatory amino acids in the brain through a non-opioid mechanism. J Neurosci 1992, 12 (2), 425-9. 74. Massardier, D.; Hunt, P. F., A direct non-opiate interaction of dynorphin-(1-13) with the N-methyl-D-aspartate (NMDA) receptor. Eur J Pharmacol 1989, 170 (1-2), 125-6. 75. (a) Dumont, M.; Lemaire, S., Dynorphin potentiation of [3H]CGP-39653 binding to rat brain membranes. Eur J Pharmacol 1994, 271 (1), 241-4; (b) Shukla, V. K.; Bansinath, M.; Dumont, M.; Lemaire, S., Selective involvement of kappa opioid and phencyclidine receptors in the analgesic and motor effects of dynorphin-A-(1-13)-Tyr-Leu-Phe-Asn-Gly-Pro. Brain Res 1992, 591 (1), 176-80. 76. Tang, Q. B.; Gandhoke, R.; Burritt, A.; Hruby, V. J.; Porreca, F.; Lai, J., High-affinity interaction of (des-tyrosyl) dynorphin A(2-17) with NMDA receptors. J Pharmacol Exp Ther 1999, 291 (2), 760-765. 77. Tang, Q. B.; Lynch, R. M.; Porreca, F.; Lai, J., Dynorphin A elicits an increase in intracellular calcium in cultured neurons via a non-opioid, non-NMDA mechanism. J Neurophysiol 2000, 83 (5), 2610-2615. 78. Lai, J.; Luo, M. C.; Chen, Q. M.; Ma, S. W.; Gardell, L. R.; Ossipov, M. H.; Porreca, F., Dynorphin A activates bradykinin receptors to maintain neuropathic pain. Nat Neurosci 2006, 9 (12), 1534-1540. 79. Lee, Y. S.; Muthu, D.; Hall, S. M.; Ramos-Colon, C.; Rankin, D.; Hu, J.; Sandweiss, A. J.; De Felice, M.; Xie, J. Y.; Vanderah, T. W.; Porreca, F.; Lai, J.; Hruby, V. J., Discovery of amphipathic dynorphin A analogues to inhibit the neuroexcitatory effects of dynorphin A through bradykinin receptors in the spinal cord. J Am Chem Soc 2014, 136 (18), 6608-16. 80. Hess, J. F.; Borkowski, J. A.; Young, G. S.; Strader, C. D.; Ransom, R. W., Cloning and pharmacological characterization of a human bradykinin (BK-2) receptor. Biochemical and biophysical research communications 1992, 184 (1), 260-8.

198

81. Hess, J. F.; Borkowski, J. A.; Macneil, T.; Stonesifer, G. Y.; Fraher, J.; Strader, C. D.; Ransom, R. W., Differential pharmacology of cloned human and mouse B2 bradykinin receptors. Molecular pharmacology 1994, 45 (1), 1-8. 82. Lopes, P.; Regoli, D.; Couture, R., Cardiovascular effects of intrathecally administered bradykinin in the rat: characterization of receptors with antagonists. Br J Pharmacol 1993, 110 (4), 1369-74. 83. Bathon, J. M.; Proud, D., Bradykinin antagonists. Annu Rev Pharmacol Toxicol 1991, 31, 129-62. 84. Chalmers, D. T.; Behan, D. P., The use of constitutively active GPCRs in drug discovery and functional genomics. Nature reviews. Drug discovery 2002, 1 (8), 599-608. 85. Fredriksson, R.; Hoglund, P. J.; Gloriam, D. E.; Lagerstrom, M. C.; Schioth, H. B., Seven evolutionarily conserved human rhodopsin G protein-coupled receptors lacking close relatives. FEBS letters 2003, 554 (3), 381-8. 86. Schertler, G. F.; Villa, C.; Henderson, R., Projection structure of rhodopsin. Nature 1993, 362 (6422), 770-2. 87. Bockaert, J.; Marin, P.; Dumuis, A.; Fagni, L., The 'magic tail' of G protein-coupled receptors: an anchorage for functional protein networks. FEBS letters 2003, 546 (1), 65-72. 88. Cook, J. V.; Eidne, K. A., An intramolecular disulfide bond between conserved extracellular cysteines in the gonadotropin-releasing hormone receptor is essential for binding and activation. Endocrinology 1997, 138 (7), 2800-6. 89. Wheatley, M.; Hawtin, S. R., Glycosylation of G-protein-coupled receptors for hormones central to normal reproductive functioning: its occurrence and role. Human reproduction update 1999, 5 (4), 356-64. 90. Van Arnam, E. B.; Lester, H. A.; Dougherty, D. A., Dissecting the functions of conserved prolines within transmembrane helices of the D2 dopamine receptor. ACS chemical biology 2011, 6 (10), 1063-8. 91. Kelly, E.; Bailey, C. P.; Henderson, G., Agonist-selective mechanisms of GPCR desensitization. Br J Pharmacol 2008, 153 Suppl 1, S379-88. 92. Tuteja, N., Signaling through G protein coupled receptors. Plant signaling & behavior 2009, 4 (10), 942-7. 93. Siehler, S., G12/13-dependent signaling of G-protein-coupled receptors: disease context and impact on drug discovery. Expert opinion on drug discovery 2007, 2 (12), 1591-604. 94. Novotny, E. A.; Bednar, D. L.; Connolly, M. A.; Connor, J. R.; Stormann, T. M., Mutation of aspartate residues in the third extracellular loop of the rat B2 bradykinin receptor decreases affinity for bradykinin. Biochemical and biophysical research communications 1994, 201 (2), 523-30. 95. (a) Lopez, J. J.; Shukla, A. K.; Reinhart, C.; Schwalbe, H.; Michel, H.; Glaubitz, C., The structure of the neuropeptide bradykinin bound to the human G-protein coupled receptor bradykinin B2 as determined by solid-state NMR spectroscopy. Angewandte Chemie 2008, 47 (9), 1668-71; (b) Kyle, D. J.; Blake, P. R.; Smithwick, D.; Green, L. M.; Martin, J. A.; Sinsko, J. A.; Summers, M. F., NMR and computational evidence that high-affinity bradykinin receptor antagonists adopt C-terminal beta-turns. J Med Chem 1993, 36 (10), 1450-60. 96. Kyle, D. J.; Chakravarty, S.; Sinsko, J. A.; Stormann, T. M., A proposed model of bradykinin bound to the rat B2 receptor and its utility for drug design. J Med Chem 1994, 37 (9), 1347-54. 97. Bellucci, F.; Meini, S.; Cucchi, P.; Catalani, C.; Giuliani, S.; Zappitelli, S.; Rotondaro, L.; Quartara, L.; Giolitti, A.; Maggi, C. A., The N-terminal of icatibant and bradykinin interact with the same Asp residues in the human B2 receptor. Eur J Pharmacol 2004, 491 (2-3), 121-5. 98. Freedman, R.; Jarnagin, K., Cloning of a B2 bradykinin receptor: examination of the bradykinin binding site by site directed mutagenesis. Agents and actions. Supplements 1992, 38 ( Pt 1), 487-96.

199

99. Hruby, V. J., Designing peptide receptor agonists and antagonists. Nature reviews. Drug discovery 2002, 1 (11), 847-58. 100. Hummel, G.; Reineke, U.; Reimer, U., Translating peptides into small molecules. Molecular bioSystems 2006, 2 (10), 499-508. 101. Loffet, A., Peptides as drugs: is there a market? J Pept Sci 2002, 8 (1), 1-7. 102. Vlieghe, P.; Lisowski, V.; Martinez, J.; Khrestchatisky, M., Synthetic therapeutic peptides: science and market. Drug discovery today 2010, 15 (1-2), 40-56. 103. Polt, R.; Porreca, F.; Szabo, L. Z.; Bilsky, E. J.; Davis, P.; Abbruscato, T. J.; Davis, T. P.; Harvath, R.; Yamamura, H. I.; Hruby, V. J., Glycopeptide enkephalin analogues produce analgesia in mice: evidence for penetration of the blood-brain barrier. Proc Natl Acad Sci U S A 1994, 91 (15), 7114-8. 104. Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J., Protein measurement with the Folin phenol reagent. The Journal of biological chemistry 1951, 193 (1), 265-75. 105. Konsoula, R.; Jung, M., In vitro plasma stability, permeability and solubility of mercaptoacetamide histone deacetylase inhibitors. International journal of pharmaceutics 2008, 361 (1-2), 19-25. 106. Zhang, S. P.; Wang, H. Y.; Lovenberg, T. W.; Codd, E. E., Functional studies of bradykinin receptors in Chinese hamster ovary cells stably expressing the human B2 bradykinin receptor. International immunopharmacology 2001, 1 (5), 955-65. 107. Kiselev, V. I.; Kliucherev, S. V., [Effect of the pH of the medium and chemical modification of protein on the activity of bradykinin angioreceptors]. Farmakologiia i toksikologiia 1984, 47 (1), 26-30. 108. Lee, Y. S.; Rankin, D.; Hall, S. M.; Ramos-Colon, C.; Ortiz, J. J.; Kupp, R.; Porreca, F.; Lai, J.; Hruby, V. J., Structure-activity relationships of non-opioid [des-Arg(7)]-dynorphin A analogues for bradykinin receptors. Bioorg Med Chem Lett 2014, 24 (21), 4976-9. 109. Vavrek, R. J.; Stewart, J. M., Competitive antagonists of bradykinin. Peptides 1985, 6 (2), 161-4. 110. Guichard, G.; Benkirane, N.; Zeder-Lutz, G.; van Regenmortel, M. H.; Briand, J. P.; Muller, S., Antigenic mimicry of natural L-peptides with retro-inverso-peptidomimetics. Proc Natl Acad Sci U S A 1994, 91 (21), 9765-9. 111. Lee, Y. S.; Hall, S. M.; Ramos-Colon, C.; Remesic, M.; LeBaron, L.; Nguyen, A.; Rankin, D.; Porreca, F.; Lai, J.; Hruby, V. J., Modification of amphipathic non-opioid dynorphin A analogues for rat brain bradykinin receptors. Bioorg Med Chem Lett 2015, 25 (1), 30-3. 112. Chatterjee, J.; Gilon, C.; Hoffman, A.; Kessler, H., N-methylation of peptides: a new perspective in medicinal chemistry. Accounts of chemical research 2008, 41 (10), 1331-42. 113. Varshavsky, A., The N-end rule: functions, mysteries, uses. Proc Natl Acad Sci U S A 1996, 93 (22), 12142-9. 114. (a) Suda, H.; Aoyagi, T.; Takeuchi, T.; Umezawa, H., Inhibition of aminopeptidase B and leucine aminopeptidase by bestatin and its stereoisomer. Archives of biochemistry and biophysics 1976, 177 (1), 196-200; (b) Umezawa, H.; Aoyagi, T.; Suda, H.; Hamada, M.; Takeuchi, T., Bestatin, an inhibitor of aminopeptidase B, produced by actinomycetes. The Journal of antibiotics 1976, 29 (1), 97-9. 115. Kaufman, S.; Schwert, G. W.; Neurath, H., The specific peptidase and esterase activities of chymotrypsin. Archives of biochemistry 1948, 17 (1), 203-5. 116. Umezawa, H., Structures and activities of protease inhibitors of microbial origin. Methods in enzymology 1976, 45, 678-95. 117. Gold, A. M.; Fahrney, D. E., The mechanism of reactivation of phenylmethanesulfonyl alpha-chymotrypsin. Biochemical and biophysical research communications 1963, 10, 55-9. 118. Regoli, D.; Barabe, J., Pharmacology of bradykinin and related kinins. Pharmacological reviews 1980, 32 (1), 1-46.

200

119. Leslie, F. M.; Goldstein, A., Degradation of Dynorphin-(1-13) by Membrane-Bound Rat- Brain Enzymes. Neuropeptides 1982, 2 (3-4), 185-196. 120. Roehm, N. W.; Rodgers, G. H.; Hatfield, S. M.; Glasebrook, A. L., An improved colorimetric assay for cell proliferation and viability utilizing the tetrazolium salt XTT. Journal of immunological methods 1991, 142 (2), 257-65. 121. Casey, P. J.; Gilman, A. G., G protein involvement in receptor-effector coupling. The Journal of biological chemistry 1988, 263 (6), 2577-80. 122. Leeb-Lundberg, L. M.; Marceau, F.; Muller-Esterl, W.; Pettibone, D. J.; Zuraw, B. L., International union of pharmacology. XLV. Classification of the kinin receptor family: from molecular mechanisms to pathophysiological consequences. Pharmacological reviews 2005, 57 (1), 27-77. 123. Berridge, M. J.; Irvine, R. F., Inositol phosphates and cell signalling. Nature 1989, 341 (6239), 197-205. 124. Berridge, M. J., Inositol trisphosphate and calcium signalling. Nature 1993, 361 (6410), 315-25. 125. Irvine, R. F., How is the level of free arachidonic acid controlled in mammalian cells? The Biochemical journal 1982, 204 (1), 3-16. 126. Clark, M. A.; Bomalaski, J. S.; Conway, T. M.; Wartell, J.; Crooke, S. T., Differential effects of aspirin and dexamethasone on phospholipase A2 and C activities and arachidonic acid release from endothelial cells in response to bradykinin and leukotriene D4. Prostaglandins 1986, 32 (5), 703-8. 127. Berridge, M. J., Inositol trisphosphate and diacylglycerol as second messengers. The Biochemical journal 1984, 220 (2), 345-60. 128. Pearson, G.; Robinson, F.; Beers Gibson, T.; Xu, B. E.; Karandikar, M.; Berman, K.; Cobb, M. H., Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocrine reviews 2001, 22 (2), 153-83. 129. Davis, R. J., The mitogen-activated protein kinase signal transduction pathway. The Journal of biological chemistry 1993, 268 (20), 14553-6. 130. Crespo, P.; Xu, N.; Simonds, W. F.; Gutkind, J. S., Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits. Nature 1994, 369 (6479), 418-20. 131. Kramarenko, II; Morinelli, T. A.; Bunni, M. A.; Raymond, J. R., Sr.; Garnovskaya, M. N., The bradykinin B(2) receptor induces multiple cellular responses leading to the proliferation of human renal carcinoma cell lines. Cancer management and research 2012, 4, 195-205. 132. Kenakin, T., Functional selectivity and biased receptor signaling. J Pharmacol Exp Ther 2011, 336 (2), 296-302. 133. Mackay, H. J.; Twelves, C. J., Targeting the protein kinase C family: are we there yet? Nature reviews. Cancer 2007, 7 (7), 554-62. 134. Marquardt, B.; Frith, D.; Stabel, S., Signaling from Tpa to Map Kinase Requires Protein- Kinase-C, Raf and Mek - Reconstitution of the Signaling Pathway in-Vitro. Oncogene 1994, 9 (11), 3213-3218. 135. Moscat, J.; Diaz-Meco, M. T., The atypical protein kinase Cs. Functional specificity mediated by specific protein adapters. EMBO reports 2000, 1 (5), 399-403. 136. Taylor, S. S.; Buechler, J. A.; Yonemoto, W., cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes. Annual review of biochemistry 1990, 59, 971-1005. 137. Liebmann, C.; Reissmann, S., Bradykinin inhibits rat myometrial adenylate cyclase activity via a high-affinity receptor. Biomedica biochimica acta 1990, 49 (11), 1231-4. 138. (a) Stoner, J.; Manganiello, V. C.; Vaughan, M., Effects of bradykinin and indomethacin on cyclic GMP and cyclic AMP in lung slices. Proc Natl Acad Sci U S A 1973, 70 (12), 3830-3; (b) Brunton, L. L.; Wiklund, R. A.; Van Arsdale, P. M.; Gilman, A. G., Binding of

201

(3H)prostaglandin E1 to putative receptors linked to adenylate cyclase of cultured cell clones. The Journal of biological chemistry 1976, 251 (10), 3037-44. 139. Pourquie, O., Signal transduction: a new canon. Nature 2005, 433 (7023), 208-9. 140. Manning, B. D.; Cantley, L. C., AKT/PKB signaling: navigating downstream. Cell 2007, 129 (7), 1261-74. 141. Darnell, J. E., Jr.; Kerr, I. M.; Stark, G. R., Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994, 264 (5164), 1415-21. 142. Shuai, K.; Liu, B., Regulation of JAK-STAT signalling in the immune system. Nature reviews. Immunology 2003, 3 (11), 900-11. 143. Smrcka, A. V., G protein betagamma subunits: central mediators of G protein-coupled receptor signaling. Cellular and molecular life sciences : CMLS 2008, 65 (14), 2191-214. 144. Bean, B. P., Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence. Nature 1989, 340 (6229), 153-6. 145. Nardone, J.; Gerald, C.; Rimawi, L.; Song, L.; Hogan, P. G., Identification of a B2 bradykinin receptor expressed by PC12 pheochromocytoma cells. Proc Natl Acad Sci U S A 1994, 91 (10), 4412-6. 146. Dendorfer, A.; Dominiak, P., Characterization of bradykinin receptors mediating catecholamine release in PC12 cells. Naunyn-Schmiedeberg's archives of pharmacology 1995, 351 (3), 274-81. 147. Steranka, L. R.; Manning, D. C.; DeHaas, C. J.; Ferkany, J. W.; Borosky, S. A.; Connor, J. R.; Vavrek, R. J.; Stewart, J. M.; Snyder, S. H., Bradykinin as a pain mediator: receptors are localized to sensory neurons, and antagonists have analgesic actions. Proc Natl Acad Sci U S A 1988, 85 (9), 3245-9. 148. Rocha, E. S. M.; Beraldo, W. T.; Rosenfeld, G., Bradykinin, a hypotensive and smooth muscle stimulating factor released from plasma globulin by snake venoms and by trypsin. The American journal of physiology 1949, 156 (2), 261-73. 149. (a) Longhurst, J. C.; Kaufman, M. P.; Ordway, G. A.; Musch, T. I., Effects of bradykinin and capsaicin on endings of afferent fibers from abdominal visceral organs. The American journal of physiology 1984, 247 (3 Pt 2), R552-9; (b) Dray, A.; Bettaney, J.; Forster, P.; Perkins, M. N., Bradykinin-induced stimulation of afferent fibres is mediated through protein kinase C. Neurosci Lett 1988, 91 (3), 301-7. 150. Proud, D.; Kaplan, A. P., Kinin formation: mechanisms and role in inflammatory disorders. Annual review of immunology 1988, 6, 49-83. 151. (a) Vavrek, R. J.; Stewart, J. M., Development of bradykinin antagonists: structure- activity relationships for new categories of antagonist sequences. Adv Exp Med Biol 1989, 247B, 395-400; (b) Stewart, J. M.; Vavrek, R. J., Kinin antagonists: design and activities. Journal of cardiovascular pharmacology 1990, 15 Suppl 6, S69-74. 152. Knolle, J.; Breipohl, G.; Henke, S.; Wirth, K.; Scholkens, B., New and highly potent bradykinin antagonists. Agents and actions. Supplements 1992, 38 ( Pt 1), 559-64. 153. Cicardi, M.; Banerji, A.; Bracho, F.; Malbran, A.; Rosenkranz, B.; Riedl, M.; Bork, K.; Lumry, W.; Aberer, W.; Bier, H.; Bas, M.; Greve, J.; Hoffmann, T. K.; Farkas, H.; Reshef, A.; Ritchie, B.; Yang, W.; Grabbe, J.; Kivity, S.; Kreuz, W.; Levy, R. J.; Luger, T.; Obtulowicz, K.; Schmid-Grendelmeier, P.; Bull, C.; Sitkauskiene, B.; Smith, W. B.; Toubi, E.; Werner, S.; Anne, S.; Bjorkander, J.; Bouillet, L.; Cillari, E.; Hurewitz, D.; Jacobson, K. W.; Katelaris, C. H.; Maurer, M.; Merk, H.; Bernstein, J. A.; Feighery, C.; Floccard, B.; Gleich, G.; Hebert, J.; Kaatz, M.; Keith, P.; Kirkpatrick, C. H.; Langton, D.; Martin, L.; Pichler, C.; Resnick, D.; Wombolt, D.; Fernandez Romero, D. S.; Zanichelli, A.; Arcoleo, F.; Knolle, J.; Kravec, I.; Dong, L.; Zimmermann, J.; Rosen, K.; Fan, W. T., Icatibant, a new bradykinin-receptor antagonist, in hereditary angioedema. The New England journal of medicine 2010, 363 (6), 532-41.

202

154. Hock, F. J.; Wirth, K.; Albus, U.; Linz, W.; Gerhards, H. J.; Wiemer, G.; Henke, S.; Breipohl, G.; Konig, W.; Knolle, J.; et al., Hoe 140 a new potent and long acting bradykinin- antagonist: in vitro studies. Br J Pharmacol 1991, 102 (3), 769-73. 155. van der Gun, B. T.; Monami, A.; Laarmann, S.; Rasko, T.; Slaska-Kiss, K.; Weinhold, E.; Wasserkort, R.; de Leij, L. F.; Ruiters, M. H.; Kiss, A.; McLaughlin, P. M., Serum insensitive, intranuclear protein delivery by the multipurpose cationic lipid SAINT-2. Journal of controlled release : official journal of the Controlled Release Society 2007, 123 (3), 228-38. 156. Kingston, R. E.; Chen, C. A.; Okayama, H., Calcium phosphate transfection. Current protocols in cell biology / editorial board, Juan S. Bonifacino ... [et al.] 2003, Chapter 20, Unit 20 3. 157. Freeman, W. M.; Walker, S. J.; Vrana, K. E., Quantitative RT-PCR: pitfalls and potential. BioTechniques 1999, 26 (1), 112-22, 124-5. 158. Wirth, K.; Hock, F. J.; Albus, U.; Linz, W.; Alpermann, H. G.; Anagnostopoulos, H.; Henk, S.; Breipohl, G.; Konig, W.; Knolle, J.; et al., Hoe 140 a new potent and long acting bradykinin-antagonist: in vivo studies. Br J Pharmacol 1991, 102 (3), 774-7. 159. (a) Farmer, S. G.; Burch, R. M.; Meeker, S. A.; Wilkins, D. E., Evidence for a pulmonary B3 bradykinin receptor. Molecular pharmacology 1989, 36 (1), 1-8; (b) Braas, K. M.; Manning, D. C.; Perry, D. C.; Snyder, S. H., Bradykinin analogues: differential agonist and antagonist activities suggesting multiple receptors. Br J Pharmacol 1988, 94 (1), 3-5; (c) Regoli, D.; Gobeil, F.; Nguyen, Q. T.; Jukic, D.; Seoane, P. R.; Salvino, J. M.; Sawutz, D. G., Bradykinin receptor types and B2 subtypes. Life Sci 1994, 55 (10), 735-49; (d) Farmer, S. G.; Burch, R. M.; Kyle, D. J.; Martin, J. A.; Meeker, S. N.; Togo, J., D-Arg[Hyp3-Thi5-D-Tic7-Tic8]-bradykinin, a potent antagonist of smooth muscle BK2 receptors and BK3 receptors. Br J Pharmacol 1991, 102 (4), 785-7; (e) Regoli, D.; Jukic, D.; Tousignant, C.; Rhaleb, N. E., Kinin receptor classification. Agents and actions. Supplements 1992, 38 ( Pt 1), 475-86. 160. Regoli, D.; Rizzi, A.; Perron, S. I.; Gobeil, F., Jr., Classification of kinin receptors. Biological chemistry 2001, 382 (1), 31-5. 161. Cayla, C.; Merino, V. F.; Cabrini, D. A.; Silva, J. A., Jr.; Pesquero, J. B.; Bader, M., Structure of the mammalian kinin receptor gene locus. International immunopharmacology 2002, 2 (13-14), 1721-7. 162. AbdAlla, S.; Godovac-Zimmermann, J.; Braun, A.; Roscher, A. A.; Muller-Esterl, W.; Quitterer, U., Structure of the bradykinin B2 receptors' amino terminus. Biochemistry 1996, 35 (23), 7514-9. 163. Oppermann, M.; Raedt, U.; Hebell, T.; Schmidt, B.; Zimmermann, B.; Gotze, O., Probing the human receptor for C5a anaphylatoxin with site-directed antibodies. Identification of a potential ligand binding site on the NH2-terminal domain. Journal of immunology 1993, 151 (7), 3785-94. 164. Wang, D. Z.; Ma, J. X.; Chao, L.; Chao, J., Molecular cloning and sequence analysis of rat bradykinin B2 receptor gene. Biochimica et biophysica acta 1994, 1219 (1), 171-4. 165. Tobin, A. B., G-protein-coupled receptor phosphorylation: where, when and by whom. Br J Pharmacol 2008, 153 Suppl 1, S167-76. 166. Soskic, V.; Nyakatura, E.; Roos, M.; Muller-Esterl, W.; Godovac-Zimmermann, J., Correlations in palmitoylation and multiple phosphorylation of rat bradykinin B2 receptor in Chinese hamster ovary cells. The Journal of biological chemistry 1999, 274 (13), 8539-45. 167. Michineau, S.; Alhenc-Gelas, F.; Rajerison, R. M., Human bradykinin B2 receptor sialylation and N-glycosylation participate with disulfide bonding in surface receptor dimerization. Biochemistry 2006, 45 (8), 2699-707.

203