DOCSLIB.ORG

Tumor Cell–Derived MMP3 Orchestrates Rac1b and Tissue Alterations That Promote Pancreatic Adenocarcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tumor Cell–Derived MMP3 Orchestrates Rac1b and Tissue Alterations That Promote Pancreatic Adenocarcinoma Published OnlineFirst May 21, 2014; DOI: 10.1158/1541-7786.MCR-13-0557-T Molecular Cancer Genomics Research Tumor Cell–Derived MMP3 Orchestrates Rac1b and Tissue Alterations That Promote Pancreatic Adenocarcinoma Christine Mehner1, Erin Miller1, Davitte Khauv1, Aziza Nassar2, Ann L. Oberg3, William R. Bamlet3, Lizhi Zhang4, Jens Waldmann5, Evette S. Radisky1, Howard C. Crawford1, and Derek C. Radisky1 Abstract Pancreatic ductal adenocarcinoma (PDA) arises at the convergence of genetic alterations in KRAS with a fostering microenvironment shaped by immune cell influx and fibrotic changes; identification of the earliest tumorigenic molecular mediators evokes the proverbial chicken and egg problem. Matrix metalloproteinases (MMP) are key drivers of tumor progression that originate primarily from stromal cells activated by the developing tumor. Here, MMP3, known to be expressed in PDA, was found to be associated with expression of Rac1b, a tumorigenic splice isoform of Rac1, in all stages of pancreatic cancer. Using a large cohort of human PDA tissue biopsies specimens, both MMP3 and Rac1b are expressed in PDA cells, that the expression levels of the two markers are highly correlated, and that the subcellular distribution of Rac1b in PDA is significantly associated with patient outcome. Using transgenic mouse models, coexpression of MMP3 with activated KRAS in pancreatic acinar cells stimulates metaplasia and immune cell infiltration, priming the stromal microenvironment for early tumor development. Finally, exposure of cultured pancreatic cancer cells to recombinant MMP3 stimulates expression of Rac1b, increases cellular invasiveness, and activation of tumorigenic transcriptional profiles. Implications: MMP3 acts as a coconspirator of oncogenic KRAS in pancreatic cancer tumorigenesis and progression, both through Rac1b-mediated phenotypic control of pancreatic cancer cells themselves, and by giving rise to the tumorigenic microenvironment; these findings also point to inhibition of this pathway as a potential therapeutic strategy for pancreatic cancer. Mol Cancer Res; 12(10); 1430–9. Ó2014 AACR. Introduction As in other cancers, malignancies of the pancreas arise and Pancreatic cancer is one of the few cancers with rising progress via the interplay between genetic alterations within numbers in cancer-related death rates, and has one of the tumor cells and collateral alterations of the surrounding stroma that shape a facilitative tumor microenvironment. Mutations in worst prognoses of human cancers, with only 6% patient KRAS survival at 5 years after diagnosis (1). The patient rarely are found in more than 90% of pancreatic tumors as well displays symptoms until the disease has progressed to a as in many premalignant pancreatic intraepithelial neoplasias (3), implicating this oncogene as an early driver of pancreatic metastatic stage, and current standards of treatment are largely fl palliative (2). Despite extensive research efforts to dissect the cell malignant transformation. Microenvironmental in u- mediators that underlie pancreatic cancer initiation and ences are also critical from the earliest stages of tumorigenesis, often involving tissue inflammation, infiltration of a variety of progression, it remains one of the more poorly understood fi fi human cancers due to its phenotypic complexity (3). immune cell types, and activation of brosis and brotic responses (4, 5). To some extent, it can be difficult to untangle the sequence of cause and effect in the coevolution of tumor and microenvironment, particularly in a disease like pancreatic Authors' Affiliations: 1Department of Cancer Biology, Mayo Clinic, Jack- cancer that almost universally presents at an advanced stage. sonville, FL 32224 U S A; 2Department of Pathology, Mayo Clinic, Jack- sonville, Florida; 3Division of Biomedical Statistics and Informatics, Depart- Matrix metalloproteinases (MMP) have been implicated ment of Health Sciences Research; 4Department of Pathology, Mayo Clinic, in many stages of tumor progression and metastasis (4, 6). Rochester, Minnesota; and 5Department of Visceral-, Thoracic- and Vas- cular Surgery, Unikliniken Marburg Und Giessen, Marburg, Germany MMPs can facilitate tumor cell detachment and invasion through degradation of cell adhesion and extracellular matrix Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/). (ECM) molecules. They can directly induce genomic insta- bility through disruption of tissue homeostasis (6, 7). MMPs Corresponding Author: Derek C. Radisky, Department of Cancer Biology, Mayo Clinic Cancer Center, 4500 San Pablo Avenue, Jacksonville, FL can also directly activate cellular invasive characteristics by 32224. Phone: 904-953-6913; Fax: 904-953-0277; E-mail: induction of epithelial–mesenchymal transition (EMT), a [email protected] programed phenotypic transformation that is instrumental doi: 10.1158/1541-7786.MCR-13-0557-T in developmental processes. Several MMPs can even initiate Ó2014 American Association for Cancer Research. tumorigenesis in some circumstances; in particular, 1430 Mol Cancer Res; 12(10) October 2014 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst May 21, 2014; DOI: 10.1158/1541-7786.MCR-13-0557-T MMP3 and Rac1b in Pancreatic Adenocarcinoma transgenic expression of MMP3 is capable of stimulating showed apolar Rac1b stain, defined as accumulation of spontaneous tumor development in mammary gland and Rac1b stain in a manner that is unsystematically distributed lung (8–10). MMP3 has also been linked to tumor growth within the cytoplasm of the tumor cells. Investigators per- and metastasis in human breast, colon, cervical, and lung forming spot scoring and morphologic analysis were blinded cancers (8, 9, 11–13). to patient characteristics and disease outcome. Although many secreted MMPs are produced primarily by stromal cells in the tumor microenvironment in response to Cell culture paracrine cytokine signals (14), MMP3 is expressed directly PaTu8988T cells were a kind gift from Dr. Yaohe Wang, by pancreatic adenocarcinoma cells (15, 16). As MMP3 has Barts Cancer Institute, Queen Mary University of London, been found to drive tumorigenesis and tumor progression London, UK. Cells were cultured in DMEM with 5% FBS by directly stimulating the expression of Rac1b (7, 9), a and 5% horse serum (HS) at 37 Cin5%CO2 and grown tumorigenic splice isoform of Rac1, and as recent findings to 80% confluency. PancTu1 cells were a kind gift from indicate that pancreatic tumorigenesis is inhibited in mice Drs. Christian Roeder and Holger Kalthoff, Institute for with selective knockout of Rac1 (which would also block Experimental Cancer Research, University Hospital Schles- expression of Rac1b; ref. 17), we hypothesized that MMP3 wig-Holstein, Campus Kiel, Kiel, Germany. Cells were may play a role in pancreatic cancer tumorigenesis and pro- cultured in RPMI-1640 with 10% FCS and Glutamax. For gression via induction of Rac1b. We evaluated expression of treatment with MMP3, PaTu8988T cells were plated at a these molecules in a large panel of human pancreatic adeno- density of 5  105 cells in 6-well plates. Experimental setup carcinomas, finding evidence of the involvement of this path- included two controls (complete media and serum-free way throughout all stages of pancreatic cancer progression. media). The test cells were incubated with recombinant Using transgenic mouse models, we found evidence that pan- MMP3 (rMMP3) at concentrations 25 or 100 U in serum- creatic acinar cell MMP3 interacts with mutant KRAS to free media. Treatment with fresh rMMP3 was given on days initiate premalignant alterations in the surrounding stroma, 0 and 2; RNA was harvested for further analysis on day 4. For including infiltration of immune cells. Using cultured pan- knockdown of MMP3 in PancTu1 cells, we used Sigma creatic adenocarcinoma cells, we found that exposure to Mission shRNA, catalog NM_002422.Â-1512s1c1. Each MMP3 and activation of Rac1b lead to comprehensive tran- study was performed at least two times in triplicate. scriptional and phenotypic alterations consistent with a cen- tral role in driving motility and protumorigenic responses. Transcriptional analysis Our study identifies MMP3-induced Rac1b as a potential dri- Samples of PaTu8988T cells were cultured in growth ving force in multiple stages of pancreatic cancer development. media (control) or growth media supplemented with 100 U/ mL recombinant MMP3 for 3 days. Isolated total RNA was Materials and Methods assessed with Affymetrix U130A gene-expression chips that Tissue microarray were processed and normalized via GCRMA. Duplicate Patient formalin-fixed paraffin-embedded (FFPE) Bios- technical replicates were averaged and then analyzed using pecimen samples mounted as tissue microarrays (TMA) were Genespring GX via t tests using previously described meth- obtained through the Mayo Clinic Pancreatic Cancer ods (9, 19). Thus, results presented are averages of two SPORE. Each slide contains up to 432 spots (16 rows  separate experiments performed in duplicate. Transcription- 27 columns) consisting of 12 process controls and 3 cores al profiles have been deposited in Gene Expression Omnibus from each of the 140 unique patients. The slides were stained (GEO Archive #GSE50931). Nextbio (www.nextbio.com) with human MMP3 (ProteinTech; #17873-1-AP), human meta-analysis (20) was performed to identify similarities Rac1b (Millipore; #09-271),
Load more

Recommended publications
  • Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)
    pharmaceuticals Article Discovery and Optimization of Selective Inhibitors of Meprin α (Part II) Chao Wang 1,2, Juan Diez 3, Hajeung Park 1, Christoph Becker-Pauly 4 , Gregg B. Fields 5 , Timothy P. Spicer 1,6, Louis D. Scampavia 1,6, Dmitriy Minond 2,7 and Thomas D. Bannister 1,2,* 1 Department of Molecular Medicine, Scripps Research, Jupiter, FL 33458, USA; [email protected] (C.W.); [email protected] (H.P.); [email protected] (T.P.S.); [email protected] (L.D.S.) 2 Department of Chemistry, Scripps Research, Jupiter, FL 33458, USA; [email protected] 3 Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314, USA; [email protected] 4 The Scripps Research Molecular Screening Center, Scripps Research, Jupiter, FL 33458, USA; [email protected] 5 Unit for Degradomics of the Protease Web, Institute of Biochemistry, University of Kiel, Rudolf-Höber-Str.1, 24118 Kiel, Germany; fi[email protected] 6 Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458, USA 7 Dr. Kiran C. Patel College of Allopathic Medicine, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314, USA * Correspondence: [email protected] Abstract: Meprin α is a zinc metalloproteinase (metzincin) that has been implicated in multiple diseases, including fibrosis and cancers. It has proven difficult to find small molecules that are capable Citation: Wang, C.; Diez, J.; Park, H.; of selectively inhibiting meprin α, or its close relative meprin β, over numerous other metzincins Becker-Pauly, C.; Fields, G.B.; Spicer, which, if inhibited, would elicit unwanted effects.
    [Show full text]
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
    [Show full text]
  • ADAM10 (A-3): Sc-48400
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . ADAM10 (A-3): sc-48400 BACKGROUND APPLICATIONS ADAM (a disintegrin and metalloprotease) proteins are a family of over 30 ADAM10 (A-3) is recommended for detection of ADAM10 of mouse, rat and membrane-anchored, glycosylated, Zn 2+ -dependent proteases that are involved human origin by Western Blotting (starting dilution 1:200, dilution range in cell-cell, cell-matrix interface-related processes including fertilization, mus - 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein cl e fusion, secretion of TNF (tumor necrosis factor α) and modulation of the (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution neurogenic function of Notch and Delta. ADAM proteins possess a signal- range 1:50-1:500), immunohistochemistry (including paraffin-embedded domain, a pro-domain, a metalloprotease domain, a disintegrin domain (inte - sections) (starting dilution 1:50, dilution range 1:50-1:500) and solid phase grin ligand), a cysteine-rich region, an epidermal growth factor-like domain, ELISA (starting dilution 1:30, dilution range 1:30-1:3000). a transmembrane domain and a cytoplasmic tail. ADAMs are expressed in Suitable for use as control antibody for ADAM10 siRNA (h): sc-41410, brain, testis, epididymis, ovary, breast, placenta, liver, heart, lung, bone and ADAM10 siRNA (m): sc-41411, ADAM10 siRNA (r): sc-270165, ADAM10 muscle, and catalyze proteolysis, adhesion, fusion and intracellular signaling. shRNA Plasmid (h): sc-41410-SH, ADAM10 shRNA Plasmid (m): sc-41411- SH, ADAM10 is a TNF-processing enzyme that cleaves pro-TNF, a membrane- ADAM10 shRNA Plasmid (r): sc-270165-SH, ADAM10 shRNA (h) Lentiviral bound precusor protein, at Ala 76-Val 77, which causes membrane shedding Particles: sc-41410-V, ADAM10 shRNA (m) Lentiviral Particles: sc-41411-V of soluble TNF.
    [Show full text]
  • Prognostic Significance of MMP-1 and MMP-3 Functional Promoter Polymorphisms in Colorectal Cancer
    594 Vol. 11, 594–599, January 15, 2005 Clinical Cancer Research Prognostic Significance of MMP-1 and MMP-3 Functional Promoter Polymorphisms in Colorectal Cancer Franck Zinzindohoue´,1 Thierry Lecomte,2 INTRODUCTION Jean-Marc Ferraz,2 Anne-Marie Houllier,1 Matrix metalloproteinase (MMP) belongs to a large group Paul-Henri Cugnenc,2 Anne Berger,2 of proteases, which includes over 22 known human zinc- He´le`ne Blons,1 and Pierre Laurent-Puig1 dependent proteolytic enzymes. These are capable of breaking essentially all components of the extracellular matrix (1, 2). 1INSERM U490 Laboratoire de toxicologie Mole´culaire and 2 MMPs take part in high tissue turnover and remodeling, both Poˆle de cance´rologie Hoˆpital europe´en Georges Pompidou, Paris, France physiologic and pathologic conditions such as cancer. MMPs are also implicated in all steps of tumorogenesis, cancer invasion, and metastasis (3). Tumor invasion and metastasis formation ABSTRACT always begin with blood and lymphatic vessel infiltration. As Purpose: Matrix metalloproteinase (MMP) belongs to a these processes involve proteolysis of the extracellular matrix, large group of proteases capable of breaking essentially all MMPs are suggested to play a major role in tumor progression. components of the extracellular matrix. They are implicated Colorectal cancer is the most common malignancy of the in all steps of tumorogenesis, cancer invasion, and gastrointestinal tract. It is the third cause of cancer overall and metastasis. Among them, metalloproteinase type 1 (MMP- the second leading cause of cancer-related death in the Europe 1) is implicated in tumor invasion and metastasis in and the United States with an incidence of 300,000 new cases different types of cancers including colorectal cancer in (4).
    [Show full text]
  • Cadherin Disruption to Promote Melanocyte Loss in Vitiligo
    Type-1 cytokines regulate matrix metalloprotease-9 production and E- cadherin disruption to promote melanocyte loss in vitiligo Nesrine Boukhedouni1*, Christina Martins1*, Anne-Sophie Darrigade1,2, Claire Drullion1, Jérôme Rambert3, Christine Barrault4, Julien Garnier4, Clément Jacquemin1, Denis Thiolat1, Fabienne Lucchese1, Franck Morel5, Khaled Ezzedine6, Alain Taieb2, François-Xavier Bernard4, Julien Seneschal1,2, †, Katia Boniface1† Affiliations: 1INSERM U1035, BMGIC, Immuno-dermatology ATIP-AVENIR, University of Bordeaux, FHU ACRONIM 2Department of Dermatology and Pediatric Dermatology; National Reference Center for Rare Skin Disorders, Hôpital Saint-André, Bordeaux, France 3AQUIDERM, University of Bordeaux 4Bioalternatives SAS, Gençay, France 5Laboratoire Inflammation Tissus Epithéliaux et Cytokines EA 4331, University of Poitiers, Poitiers, France. 6Department of Dermatology, AP-HP, Hôpital Henri-Mondor, Créteil, France. *,† These authors contributed equally to this study. Corresponding author: Katia Boniface INSERM U1035, BMGIC – Immunodermatology team University of Bordeaux 146 rue Léo Saignat, Bâtiment TP zone sud, 4ème étage 33076 Bordeaux Cedex Phone: +33 (0)5 57 57 13 73 Email: [email protected] Supplemental Table 1. Distribution of individual features of 135 vitiligo patients depending on their spreading score Stable vitiligo Active vitiligo Feature (n=69) (n=66) Total (N=135) Sex, No. (%) Female 41(59.42) 45(68.18) 86(63.70) Male 28(40.58) 21(31.82) 49(36.29) Age at inclusion (years) Mean (±SD) 43.43(±12.98) 43.64(±14.32) 43.53(±13.65) Range 16-76 14-80 14-80 Age at vitiligo onset (years) Mean (±SD) 28.76(±14.93) 29.28(±16.87) 29.02(±15.9) Range 3-57 4-77 3-77 Disease duration (years) Mean (±SD) 14.75(±12.65) 14.79(±11.93) 14.77 (±12.29) Type of vitiligo, No.
    [Show full text]
  • Supplement Data Supplemental Table 1. Stem-Loop Structure
    Supplement Data Supplemental Table 1. Stem-loop structure oligonucleotide sequences. tgctgttgacagtgagcgaccagatacctgcaccaccttatagtgaagccacagatgtataaggt MMP2 ggtgcaggtatctgggtgcctactgcctcgga tgctgttgacagtgagcgccgatgctgccatttctaataatagtgaagccacagatgtattatta MMP3 gaaatggcagcatcgatgcctactgcctcgga tgctgttgacagtgagcgcgcaaggttatcccaaggatattagtgaagccacagatgtaatatcc MMP8 ttgggataaccttgcatgcctactgcctcgga tgctgttgacagtgagcgccgacatagacggcatccagtatagtgaagccacagatgtatactgg MMP9 atgccgtctatgtcgttgcctactgcctcgga tgctgttgacagtgagcgacgagcctgaatttcatttgattagtgaagccacagatgtaatcaaa MMP10 tgaaattcaggctcggtgcctactgcctcgga tgctgttgacagtgagcgagcaatatttcagctaccaatatagtgaagccacagatgtatattgg MMP11 tagctgaaatattgcctgcctactgcctcgga tgctgttgacagtgagcgccgcgggaatcctgaaggagaatagtgaagccacagatgtattctcc MMP13 ttcaggattcccgcgatgcctactgcctcgga tgctgttgacagtgagcgcggctgacatcatgatcttatttagtgaagccacagatgtaaataag MMP14 atcatgatgtcagccttgcctactgcctcgga tgctgttgacagtgagcgcggccacaccttcttcttccaatagtgaagccacagatgtattggaa MMP15 gaagaaggtgtggccttgcctactgcctcgga tgctgttgacagtgagcgaggcaaacgtgatgtggatatatagtgaagccacagatgtatatatc MMP16 cacatcacgtttgccgtgcctactgcctcgga tgctgttgacagtgagcgcaggaaggatattacacctatttagtgaagccacagatgtaaatagg MMP24 tgtaatatccttcctttgcctactgcctcgga tgctgttgacagtgagcgaccgactcctgctatacctttatagtgaagccacagatgtataaagg ADAM8 tatagcaggagtcggctgcctactgcctcgg tgctgttgacagtgagcgcgccatttcactctgtcatttatagtgaagccacagatgtataaatg ADAM10 acagagtgaaatggcatgcctactgcctcgga tgctgttgacagtgagcgccgacatcctctccttagctaatagtgaagccacagatgtattagct ADAM17 aaggagaggatgtcgttgcctactgcctcgga MOCK tgctgttgacagtgagcgcggcttcagactcattattatatagtgaagccacagatgtatataat
    [Show full text]
  • Discovery and Optimization of Selective Inhibitors of Meprin Α (Part I)
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 December 2020 doi:10.20944/preprints202012.0354.v1 Discovery and Optimization of Selective Inhibitors of Meprin α (Part I) Shurong Hou1,3 Juan Diez2, Chao Wang3, Christoph Becker-Pauly4, Gregg B. Fields5, Thomas Bannister3, Timothy P. Spicer1,3 Louis D. Scampavia1,3 and Dmitriy Minond2,6 1 - The Scripps Research Molecular Screening Center, Department of Molecular Medicine, Scripps Research, Jupiter, Florida 33458 2 - Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314 3 - Department of Molecular Medicine, Scripps Research, Jupiter, Florida 33458 4 - University of Kiel, Institute of Biochemistry, Unit for Degradomics of the Protease Web, Rudolf-Höber-Str.1, 24118 Kiel, Germany 5 - Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 6 - Dr. Kiran C. Patel College of Allopathic Medicine, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314 *Correspondence to: Dmitriy Minond, Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314, [email protected]; Short title: Selective inhibitors of meprin α Subject category: Enzymatic assays KEYWORDS: meprin α, meprin β, zinc metalloproteinase, uHTS. 1 © 2020 by the author(s). Distributed under a Creative Commons CC BY license. Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 December 2020 doi:10.20944/preprints202012.0354.v1 ABSTRACT Meprin α and β are zinc-dependent proteinases implicated in multiple diseases including cancers, fibrosis, and Alzheimer’s. However, until recently, only a few inhibitors of either meprin were reported and no inhibitors are in pre-clinical development.
    [Show full text]
  • DEVELOPMENT and KINETIC MODELING of MULTIPLEX MICROSPHERE ASSAYS for HIGH- THROUGHPUT DISCOVERY of PROTEASE ACTIVE SMALL MOLECULE COMPOUNDS Jingsh Zhu
    University of New Mexico UNM Digital Repository Nanoscience and Microsystems ETDs Engineering ETDs 7-12-2014 DEVELOPMENT AND KINETIC MODELING OF MULTIPLEX MICROSPHERE ASSAYS FOR HIGH- THROUGHPUT DISCOVERY OF PROTEASE ACTIVE SMALL MOLECULE COMPOUNDS Jingsh Zhu Follow this and additional works at: https://digitalrepository.unm.edu/nsms_etds Recommended Citation Zhu, Jingsh. "DEVELOPMENT AND KINETIC MODELING OF MULTIPLEX MICROSPHERE ASSAYS FOR HIGH- THROUGHPUT DISCOVERY OF PROTEASE ACTIVE SMALL MOLECULE COMPOUNDS." (2014). https://digitalrepository.unm.edu/nsms_etds/10 This Dissertation is brought to you for free and open access by the Engineering ETDs at UNM Digital Repository. It has been accepted for inclusion in Nanoscience and Microsystems ETDs by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected]. i DEVELOPMENT AND KINETIC MODELING OF MULTIPLEX MICROSPHERE ASSAYS FOR HIGH-THROUGHPUT DISCOVERY OF PROTEASE ACTIVE SMALL MOLECULE COMPOUNDS BY JINGSHU ZHU B.E. Marine Fishery Science and Technology, Jimei University, China P.R. 2006 M.S. Chemistry, Nanjing University, China P.R. 2009 DISSERTATION Submitted in Partial Fullfillment of the Requirtments for the Degree of Doctor of Philosophy Nanoscience & Microsystems Engineering The University of New Mexico Albuquerque, New Mexico May, 2014 ii ACKNOWLEDGMENTS I am very grateful to my research advisors, Prof. Graves and Prof. Edwards, for their guidance and assistance in my research project, and I am extremely fortunate to have had their help and support for the completion of my project work. I would also like to express my deepest gratitude to my advisors for their caring, for their patience, and for providing me with an excellent atmosphere for doing research.
    [Show full text]
  • Biochemical Characterization and Zinc Binding Group (Zbgs) Inhibition Studies on the Catalytic Domains of Mmp7 (Cdmmp7) and Mmp16 (Cdmmp16)
    MIAMI UNIVERSITY The Graduate School Certificate for Approving the Dissertation We hereby approve the Dissertation of Fan Meng Candidate for the Degree DOCTOR OF PHILOSOPHY ______________________________________ Director Dr. Michael W. Crowder ______________________________________ Dr. David L. Tierney ______________________________________ Dr. Carole Dabney-Smith ______________________________________ Dr. Christopher A. Makaroff ______________________________________ Graduate School Representative Dr. Hai-Fei Shi ABSTRACT BIOCHEMICAL CHARACTERIZATION AND ZINC BINDING GROUP (ZBGS) INHIBITION STUDIES ON THE CATALYTIC DOMAINS OF MMP7 (CDMMP7) AND MMP16 (CDMMP16) by Fan Meng Matrix metalloproteinase 7 (MMP7/matrilysin-1) and membrane type matrix metalloproteinase 16 (MMP16/MT3-MMP) have been implicated in the progression of pathological events, such as cancer and inflammatory diseases; therefore, these two MMPs are considered as viable drug targets. In this work, we (a) provide a review of the role(s) of MMPs in biology and of the previous efforts to target MMPs as therapeutics (Chapter 1), (b) describe our efforts at over-expression, purification, and characterization of the catalytic domains of MMP7 (cdMMP7) and MMP16 (cdMMP16) (Chapters 2 and 3), (c) present our efforts at the preparation and initial spectroscopic characterization of Co(II)-substituted analogs of cdMMP7 and cdMMP16 (Chapters 2 and 3), (d) present inhibition data on cdMMP7 and cdMMP16 using zinc binding groups (ZBG) as potential scaffolds for future inhibitors (Chapter 3), and (e) summarize our data in the context of previous results and suggest future directions (Chapter 4). The work described in this dissertation integrates biochemical (kinetic assays, inhibition studies, limited computational methods), spectroscopic (CD, UV-Vis, 1H-NMR, fluorescence, and EXAFS), and analytical (MALDI-TOF mass spectrometry, isothermal calorimetry) methods to provide a detailed structural and mechanistic view of these MMPs.
    [Show full text]
  • The Extracellular Matrix and VEGF Processing
    5 The Extracellular Matrix and VEGF Processing Sunyoung Lee, PhD, and M. Luisa Iruela-Arispe, PhD Summary Tumor neovascularization requires the activation of a subset of endothelial cells from normal vascular beds, the digestion of the underlying basement membrane, and the directional migration of these cells toward an avascular site. The contri- bution of vascular endothelial growth factor (VEGF) to each one of these steps has received large experimental support, and it has been demonstrated that pharmaco- logical and/or genetic inactivation of this growth factor can impact the angiogenic response and consequently suppress tumor growth. Thus, understanding the mecha- nisms that control VEGF levels has become an important focus of investigation. Today, we have a fairly comprehensive understanding of the mechanisms that regulate VEGF transcriptional rate and half-life. In contrast, little emphasis has been placed on the regulation of VEGF biology post-secretion. In this chapter, we focus our attention on the question of how VEGF becomes released from the extracellular environment and contributes to tumor neovascularization. We discuss this point in the larger context of matrix interaction with growth factors and their modulation by matrix metalloproteinases (MMPs). Key Words: Matrix metalloproteinases; growth factors; angiogenesis; tumor microenvironment; endothelial cells; capillaries; neovascularization. 1. INTRODUCTION It is generally accepted that the tissue/tumor microenvironment plays an active role in regulating the angiogenic response. Matrix molecules serve as substrate for migration of endothelial cells, as well as provide differentiation cues for the maturation and stabilization of new vascular beds (1–3). Thus, the nature and physical features of the extracellular environment can provide differential permissive signals for angiogenesis progression and stabilization.
    [Show full text]
  • Towards Third Generation Matrix Metalloproteinase Inhibitors for Cancer Therapy
    British Journal of Cancer (2006) 94, 941 – 946 & 2006 Cancer Research UK All rights reserved 0007 – 0920/06 $30.00 www.bjcancer.com Minireview Towards third generation matrix metalloproteinase inhibitors for cancer therapy ,1 1 CM Overall* and O Kleifeld 1CBCRA Program in Breast Cancer Metastasis, Departments of Oral Biological & Medical Sciences, Biochemistry & Molecular Biology, The UBC Centre for Blood Research, University of British Columbia, Vancouver, BC, Canada V6T 1Z3 The failure of matrix metalloproteinase (MMP) inhibitor drug clinical trials in cancer was partly due to the inadvertent inhibition of MMP antitargets that counterbalanced the benefits of MMP target inhibition. We explore how MMP inhibitor drugs might be developed to achieve potent selectivity for validated MMP targets yet therapeutically spare MMP antitargets that are critical in host protection. British Journal of Cancer (2006) 94, 941–946. doi:10.1038/sj.bjc.6603043 www.bjcancer.com Published online 14 March 2006 & 2006 Cancer Research UK Keywords: target validation; antiproteolytic drug; cancer therapy; drug design; zinc chelation Twenty five years ago, the therapeutic strategy of controlling avenues for the therapeutic control of cancer. Conversely, stromal cancer by broadly targeting collagenase (matrix metalloproteinase cells harness the beneficial actions of MMPs in tissue homeostasis (MMP)1), stromelysin-1 (MMP3), and gelatinase A (MMP2), the and innate immunity for host resistance against cancer (Overall three then known MMPs, was founded on reducing degradation of and Kleifeld, 2006). All MMPs exhibit some of these functions, basement membrane and extracellular matrix proteins by cancer but MMPs -3, -8 and -9 have activities so important that when cells in metastasis and angiogenesis (Liotta et al, 1980; Hodgson, genetically knocked out, this leads to enhanced tumorigenesis and 1995).
    [Show full text]
  • Polymorphisms of Genes Involved in Extracellular Matrix Remodeling And
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Florence Research BASIC RESEARCH STUDIES Polymorphisms of genes involved in extracellular matrix remodeling and abdominal aortic aneurysm Claudia Saracini, PhD,a Paola Bolli, PhD,a Elena Sticchi, PhD,a,b Giovanni Pratesi, MD,c Raffaele Pulli, MD,d Francesco Sofi, PhD,a Carlo Pratesi, MD,d Gian Franco Gensini, MD,a,b Rosanna Abbate, MD,a and Betti Giusti, PhD,a Florence and Rome, Italy Background: Abdominal aortic aneurysm (AAA) has a multifactorial etiology and the relevance of genetic factors is getting increasing interest, in particular those related to the destructive remodeling of extracellular matrix. Methods: We performed a candidate gene association study of polymorphisms in genes coding matrix metalloproteinases (MMPs), tissue inhibitors of MMPs (TIMPs), and elastin (ELN) in AAA. DNA samples from 423 AAA patients and 423 ;controls were genotyped for 12 polymorphisms in 10 genes: MMP1 (؊1607G/GG), MMP2 (؊735C/T; ؊1306C/T ,(؊1575 G/A), MMP3 (5A/6A), MMP9 (؊1562C/T), MMP10 (A180G), MMP-12 (؊82A/G), MMP-13 (؊77A/G .(TIMP1 (C434T), TIMP3 (؊1296T/C), and ELN (G1355A Results: Genotype distribution was significantly different between patients and controls for the following polymorphisms: ؊1306C/T MMP2; 5A/6A MMP3; ؊77A/G MMP-13; G1355A ELN; and C434T TIMP1. In a multivariable logistic regression analysis adjusted for traditional cardiovascular risk factors and chronic obstructive pulmonary disease, confidence interval, CI .34-.85], P < .007) and G1355A ELN %95] 0.55 ؍ [؊1306C/T MMP2 (odds ratios [OR polymorphisms resulted in independent protective factors for abdominal aortic (046.
    [Show full text]