O-Glcnac-Modified SNAP29 Inhibits Autophagy-Mediated Degradation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Yeast Phenomic Model for the Gene Interaction Network Modulating
Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1. -
Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases. -
Mig-6 Controls EGFR Trafficking and Suppresses Gliomagenesis
Mig-6 controls EGFR trafficking and suppresses gliomagenesis Haoqiang Yinga,1, Hongwu Zhenga,1, Kenneth Scotta, Ruprecht Wiedemeyera, Haiyan Yana, Carol Lima, Joseph Huanga, Sabin Dhakala, Elena Ivanovab, Yonghong Xiaob,HaileiZhangb,JianHua, Jayne M. Stommela, Michelle A. Leea, An-Jou Chena, Ji-Hye Paika,OresteSegattoc, Cameron Brennand,e, Lisa A. Elferinkf,Y.AlanWanga,b, Lynda China,b,g, and Ronald A. DePinhoa,b,h,2 aDepartment of Medical Oncology, bBelfer Institute for Applied Cancer Science, Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; cLaboratory of Immunology, Istituto Regina Elena, Rome 00158, Italy; dHuman Oncology and Pathogenesis Program and eDepartment of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; fDepartment of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, TX 77555; gDepartment of Dermatology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and hDepartment of Medicine and Genetics, Harvard Medical School, Boston, MA 02115 Edited* by Webster K. Cavenee, Ludwig Institute, University of California, La Jolla, CA, and approved March 8, 2010 (received for review December 23, 2009) Glioblastoma multiforme (GBM) is the most common and lethal structural aberrations that serve as a key pathological driving primary brain cancer that is driven by aberrant signaling of growth force for tumor progression and many of them remain to be factor receptors, particularly the epidermal growth factor receptor characterized (6, 7). GBM possesses a highly rearranged genome (EGFR). EGFR signaling is tightly regulated by receptor endocytosis and high-resolution genome analysis has uncovered myriad and lysosome-mediated degradation, although the molecular somatic alterations on the genomic and epigenetic levels (2, 3). -
UVRAG Is Required for Virus Entry Through Combinatorial Interaction with the Class C-Vps Complex and Snares
UVRAG is required for virus entry through combinatorial interaction with the class C-Vps complex and SNAREs Sara Dolatshahi Pirooza, Shanshan Hea, Tian Zhanga, Xiaowei Zhanga, Zhen Zhaoa, Soohwan Oha, Douglas O’Connella, Payam Khalilzadeha, Samad Amini-Bavil-Olyaeea, Michael Farzanb, and Chengyu Lianga,1 aDepartment of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033; and bDepartment of Infectious Diseases, The Scripps Research Institute, Jupiter, FL 33458 Edited by Peter Palese, Icahn School of Medicine at Mount Sinai, New York, NY, and approved January 15, 2014 (received for review November 4, 2013) Enveloped viruses exploit the endomembrane system to enter host (R)-SNAREs embedded in the other (3). Specifically, syntaxin 7 cells. Through a cascade of membrane-trafficking events, virus-bearing (STX7; Qa), Vti1b (Qb), and STX8 (Qc) on the LE, when paired vesicles fuse with acidic endosomes and/or lysosomes mediated by with VAMP7 (R), mediate the LE fusion with the lysosome, but SNAREs triggering viral fusion. However, the molecular mechanisms when paired with VAMP8 (R), regulate homotypic fusion of the underlying this process remain elusive. Here, we found that UV- LEs (4). The upstream process regulating LE-associated SNARE radiation resistance-associated gene (UVRAG), an autophagic tumor pairing relies on the class C vacuolar protein sorting (Vps) complex suppressor, is required for the entry of the prototypic negative- (hereafter referred to as C-Vps), composed of Vps11, Vps16, strand RNA virus, including influenza A virus and vesicular stoma- Vps18, and Vps33 as core subunits (5, 6). A recent study indicated titis virus, by a mechanism independent of IFN and autophagy. -
Autophagy Suppresses Ras-Driven Epithelial Tumourigenesis by Limiting the Accumulation of Reactive Oxygen Species
OPEN Oncogene (2017) 36, 5576–5592 www.nature.com/onc ORIGINAL ARTICLE Autophagy suppresses Ras-driven epithelial tumourigenesis by limiting the accumulation of reactive oxygen species This article has been corrected since Advance Online Publication and a corrigendum is also printed in this issue. J Manent1,2,3,4,5,12, S Banerjee2,3,4,5, R de Matos Simoes6, T Zoranovic7,13, C Mitsiades6, JM Penninger7, KJ Simpson4,5, PO Humbert3,5,8,9,10 and HE Richardson1,2,5,8,11 Activation of Ras signalling occurs in ~ 30% of human cancers; however, activated Ras alone is not sufficient for tumourigenesis. In a screen for tumour suppressors that cooperate with oncogenic Ras (RasV12)inDrosophila, we identified genes involved in the autophagy pathway. Bioinformatic analysis of human tumours revealed that several core autophagy genes, including GABARAP, correlate with oncogenic KRAS mutations and poor prognosis in human pancreatic cancer, supporting a potential tumour- suppressive effect of the pathway in Ras-driven human cancers. In Drosophila, we demonstrate that blocking autophagy at any step of the pathway enhances RasV12-driven epithelial tissue overgrowth via the accumulation of reactive oxygen species and activation of the Jun kinase stress response pathway. Blocking autophagy in RasV12 clones also results in non-cell-autonomous effects with autophagy, cell proliferation and caspase activation induced in adjacent wild-type cells. Our study has implications for understanding the interplay between perturbations in Ras signalling and autophagy in tumourigenesis, -
On the Move : Endocytic Trafficking in Cell Migration
Erschienen in: Cellular and Molecular Life Sciences ; 72 (2015), 11. - S. 2119-2134 https://dx.doi.org/10.1007/s00018-015-1855-9 On the move: endocytic trafficking in cell migration Tanja Maritzen • Hannah Schachtner • Daniel F. Legler Abstract Directed cell migration is a fundamental process unraveling the contribution of cellular trafficking pathways underlying diverse physiological and pathophysiological to cell migration. phenomena ranging from wound healing and induction of immune responses to cancer metastasis. Recent advances Keywords Endocytosis Á Cellular motility Á Clathrin Á reveal that endocytic trafficking contributes to cell migration Chemotaxis Á Signal transduction Á Vesicular transport in multiple ways. (1) At the level of chemokines and che- mokine receptors: internalization of chemokines by scavenger receptors is essential for shaping chemotactic Introduction gradients in tissue, whereas endocytosis of chemokine re- ceptors and their subsequent recycling is key for maintaining Diverse physiological processes ranging from embryonic a high responsiveness of migrating cells. (2) At the level of development to the induction of immune responses require integrin trafficking and focal adhesion dynamics: endosomal coordinated cell migration within the organism. In addi- pathways do not only modulate adhesion by delivering in- tion, migratory abilities of cells also represent a tegrins to their site of action, but also by supplying factors determining factor in pathological settings such as metas- for focal adhesion disassembly. (3) At the level of extra- tasis and inflammatory diseases. The term cell migration cellular matrix reorganization: endosomal transport comprises a number of different migration modes with contributes to tumor cell migration not only by targeting different mechanistic requirements. -
Functions of Syntaxin 8 in Human Cytotoxic T Lymphocytes
Aus dem Bereich Biophysik Theoretische und Klinische Medizin der Medizinischen Fakultät der Universität des Saarlandes, Homburg/Saar Functions of Syntaxin 8 in human cytotoxic T lymphocytes Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Medizinischen Fakultät der UNIVERSITÄT DES SAARLANDES 2013 vorgelegt von: Shruthi. S. Bhat geb.am: 27.03.1985 in Manipal, India Tag des Promotionskolloquiums: __________________________________ Dekan: __________________________________ Vorsitzender: __________________________________ Berichterstatter: __________________________________ __________________________________ __________________________________ __________________________________ To my beloved parents and teachers Index INDEX I ABBREVIATIONS VI ZUSAMMENFASSUNG VII 1. INTRODUCTION 1 1.1. Immune system 1 1.2. Cell mediated and humoral immunity 2 1.3. Cytotoxic T Lymphocytes (CTLs) 4 1.3.1. T Cell Receptor complex 5 1.3.2. Immunological Synapse 6 1.3.3. Lytic granules, the secretory lysosomes in immune cells 7 1.3.3.1. Perforin 8 1.3.3.2. Granzymes, lytic granule serine proteases 9 1.3.4. Fas and Fas ligand pathway 11 1.4. Sorting, delivery and maturation of proteins and vesicles through endosomal pathway 12 1.5. SNARE proteins 15 1.6. SNARE and related proteins in immune cells 17 1.7. Syntaxin 8: the protein of interest 20 1.8. Aims of this study 21 2. MATERIALS AND METHODS 23 2.1. Antibodies and Reagents 23 2.2. Peripheral blood mononuclear cell (PBMC) isolation 23 2.3. Stimulation of PBLs with Staphylococcal enterotoxin A 24 2.4. Positive isolation of CD8+ T lymphocytes 25 2.5. Negative isolation of CD8+ T lymphocytes 26 2.6. siRNA transfection of CTLs 27 I Index 2.7. -
Analysis of Mir-34A-5P Over-Expression by Qrt-PCR
Supplementary material files Supplementary Figure 1: Analysis of miR-34a-5p over-expression by qRT-PCR. Primary CD4+ T cells were transfected either with allstars negative control (ANC) or miR-34a-5p mimic. 48 h post transfection the total RNA was isolated and analyzed by qRT-PCR using a specific hsa-miR-34a-5p primer. Supplementary Figure 2: FACS Controls CD4+ T cells were stained for CD4 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD4+ T cells (A) were analyzed for CD11A expression (B, dark grey) in comparison to isotype controls (light grey). CD8+ T cells were stained for CD8 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD8+ T cells (C) were analyzed for CD11A expression (D, dark grey) in comparison to isotype controls (light grey). Supplementary Table 1 target cloning sequence ID gene primers (restriction sites are underlined) 5'-VAMP2-SpeI ggactagtccatcatcctcatcatcatc VAMP2 NM_014232.2 3'-VAMP2-NaeI gccggccctcaatcagttcacccaatgag 5'-IKBKE-SpeI ggactagtcacatgaggcatcctgaag IKBKE NM_014002.3 3'-IKBKE-SacI cgagctcgcatagaaagaacaggaggctc 5'-MYH9-SpeI ggactagtcgaagaggtagatggcaaagc MYH9 NM_002473.5 3'-MYH9-SacI cgagctccctttgtgacagcaactggg 5'-MARCH8-SpeI ggactagtgtgtgcgggttgtcattttc MARCH8 NM_001282866.1 3'-MARCH8-SacI cgagctccagaatgcactgagagtggg 5'-KLRK1-SpeI ggactagtgagactgtgcactctatgcctc KLRK1 NM_007360.3 3'-KLRK1-SacI cgagctcccttcttaactgtgaacctgtg 5'-CD11A-SpeI ggactagtgagaaggactctgagagtgg -
WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US). -
Human Gene Copy Number Spectra Analysis in Congenital Heart Malformations Aoy Tomita-Mitchell Medical College of Wisconsin
CORE Metadata, citation and similar papers at core.ac.uk Provided by epublications@Marquette Marquette University e-Publications@Marquette Mathematics, Statistics and Computer Science Mathematics, Statistics and Computer Science, Faculty Research and Publications Department of 5-1-2012 Human gene copy number spectra analysis in congenital heart malformations Aoy Tomita-Mitchell Medical College of Wisconsin Donna K. Mahnke Medical College of Wisconsin Craig Struble Marquette University, [email protected] Maureen E. Tuffnell Marquette University Karl D. Stamm Marquette University See next page for additional authors Accepted version. Physiological Genomics, Vol. 44, No. 9 (May 2012): 518-541. DOI. © 2012 The American Physiological Society. Used with permission. Authors Aoy Tomita-Mitchell, Donna K. Mahnke, Craig Struble, Maureen E. Tuffnell, Karl D. Stamm, Mats Hidestrand, Susan Harris, Mary A. Goetsch, Pippa Simpson, David P. Bick, Ulrich Broeckel, Andrew N. Pelech, James S. Tweddell, and Michael Mitchell This article is available at e-Publications@Marquette: https://epublications.marquette.edu/mscs_fac/272 NOT THE PUBLISHED VERSION; this is the author’s final, peer-reviewed manuscript. The published version may be accessed by following the link in the citation at the bottom of the page. Human Gene Copy Number Spectra Analysis in Congenital Heart Malformations Aoy Tomita-Mitchell Department of Surgery, Division of Cardiothoracic Surgery; Biotechnology and Bioengineering Center; Human and Molecular Genetics Center; Medical College of Wisconsin; Milwaukee, WI Donna K. Mahnke Department of Surgery, Division of Cardiothoracic Surgery; Biotechnology and Bioengineering Center; Human and Molecular Genetics Center; Medical College of Wisconsin; Milwaukee, WI Craig A. Struble Department of Mathematics, Statistics and Computer Science; Marquette University; Milwaukee, WI Maureen E. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Supplementary Table 3: Genes Only Influenced By
Supplementary Table 3: Genes only influenced by X10 Illumina ID Gene ID Entrez Gene Name Fold change compared to vehicle 1810058M03RIK -1.104 2210008F06RIK 1.090 2310005E10RIK -1.175 2610016F04RIK 1.081 2610029K11RIK 1.130 381484 Gm5150 predicted gene 5150 -1.230 4833425P12RIK -1.127 4933412E12RIK -1.333 6030458P06RIK -1.131 6430550H21RIK 1.073 6530401D06RIK 1.229 9030607L17RIK -1.122 A330043C08RIK 1.113 A330043L12 1.054 A530092L01RIK -1.069 A630054D14 1.072 A630097D09RIK -1.102 AA409316 FAM83H family with sequence similarity 83, member H 1.142 AAAS AAAS achalasia, adrenocortical insufficiency, alacrimia 1.144 ACADL ACADL acyl-CoA dehydrogenase, long chain -1.135 ACOT1 ACOT1 acyl-CoA thioesterase 1 -1.191 ADAMTSL5 ADAMTSL5 ADAMTS-like 5 1.210 AFG3L2 AFG3L2 AFG3 ATPase family gene 3-like 2 (S. cerevisiae) 1.212 AI256775 RFESD Rieske (Fe-S) domain containing 1.134 Lipo1 (includes AI747699 others) lipase, member O2 -1.083 AKAP8L AKAP8L A kinase (PRKA) anchor protein 8-like -1.263 AKR7A5 -1.225 AMBP AMBP alpha-1-microglobulin/bikunin precursor 1.074 ANAPC2 ANAPC2 anaphase promoting complex subunit 2 -1.134 ANKRD1 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1.314 APOA1 APOA1 apolipoprotein A-I -1.086 ARHGAP26 ARHGAP26 Rho GTPase activating protein 26 -1.083 ARL5A ARL5A ADP-ribosylation factor-like 5A -1.212 ARMC3 ARMC3 armadillo repeat containing 3 -1.077 ARPC5 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa -1.190 activating transcription factor 4 (tax-responsive enhancer element ATF4 ATF4 B67) 1.481 AU014645 NCBP1 nuclear cap