DOCSLIB.ORG

Protein Kinase Induction in Escherichia Coli by Bacteriophage T7 (Early T7 Protein/Serylphosphate/UV Mappikig/Ribosomal Proteins) H

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Kinase Induction in Escherichia Coli by Bacteriophage T7 (Early T7 Protein/Serylphosphate/UV Mappikig/Ribosomal Proteins) H Proc. Nat. Acad. Sci. USA Vol. 71, No. 2, pp. 586-589, February 1974 Protein Kinase Induction in Escherichia coli by Bacteriophage T7 (early T7 protein/serylphosphate/UV mappikig/ribosomal proteins) H. J. RAHMSDORF, S. H. PAI, H. PONTA, P. HERRLICH, R. ROSKOSKI, JR.*, M. SCHWEIGER, AND F. W. STUDIERt Max-Planck-Institut far Molekulare Genetik, Berlin-Dahlem, Germany; and * Department of Biochemistry, The University of Iowa, Iowa City, Iowa; t Brookhaven National Laboratory, Upton, New York Communicated by Fritz Lipmann, October 11, 1973 ABSTRACT After bacteriophage T7 infection, a protein MgSO4, 50 AM phosphate, and 2 mM of each amino acid. Cells kinase (EC 2.7.1.37; ATP:protein phosphotransferase) at = 0.25 were infected at a of infection of activity can be demonstrated in E. coli in vivo by sodium OD600 multiplicity dodecyl sulfate-polyacrylamide gel electrophoresis and 10, and surviving cells were measured. Survivors were in all ex- autoradiography. Cell-free extracts catalyzed the transfer periments less than 3% at 3 min after infection. The cells were of the terminal phosphoryl group of [-y_32P]ATP to endoge- harvested on frozen TMA buffer [10 mM Tris * HCl (pH 7.5)-10 nous protein acceptor or to added histone. The bond be- mM MgCl2-22 mM NH4Cl-5% glycerol-i mM dithiothrei- tween phosphate and protein shows the characteristies of serine phosphate: it is stable in 1 N HCl (1000) and cleaved toll, and washed once with TMA buffer. They were stored in by 1 N KOH (370) and by alkaline phosphatase treatment. liquid nitrogen. Phage stocks were purified by CsCl gradient Moreover, after partial acid hydrolysis, radiophosphate centrifugation. migrates with marker O-phosphoserine on polyethylene- imine-cellulose thin-layer chromatograms. Enzyme ac- Phosphorylation of Proteins In Vivo. Two minutes after tivity in uninfected cells is negligible. Ultraviolet irradia- infection, 200-Isl aliquots of the noninfected or infected cul- tion of the phage genome prevents the appearance of the tures were mixed with 5 1Ci of [82P]orthophosphate and incu- protein kinase; irradiation of the host genome does not. The enzyme activity occurs 4 min after infection and bation was continued for another 7 min. The cell pellet was its gene maps in the early region (promoter proximal to treated with 50 Il of sodium dodecyl sulfate (SDS) buffer [1% gene 1). Ribosomal proteins are phosphorylated in vivo and SDS, 1% mercaptoethanol, 10% glycerol, 20 mM EDTA, 50 are substrates in vitro. Enzyme activity in vitro is not mM Tris . HCl (pH 6.8)] at 1000 for 2 min. Treatment with changed by addition of cyclic AMP or cyclic GMP. RNase (100 Ag/ml) at 200 for 30 min followed. The samples Bacteriophage systems have been used extensively to study were then subject to SDS slab-gel electrophoresis (9); the gels the regulation of gene expression (1, 2). One particular aspect were dried and placed on x-ray film overnight. of these systems is the rapidity of changes in the pattern of Assay for Protein Kinase In Vitro. Brij-lysozyme cell ex- gene expression; phage T7 induces a whole series of control tracts (10) were used as enzyme sources. The incubations were mechanisms within 4-5 min (2, 3). This rapidity of change in carried out at 300 for 5 min in a total volume of 0.1 ml. The gene expression prompted our search for group transfers after incubation mixtures contained 30A]. of cell extract, 3 mg/ml of phage infection (4-6). A phage-induced group transfer to type II histone, and either (1) 15 mM sodium phosphate (pH components of the existing host machinery of gene expression 7.0), 0.01 MMgCl2, 0.14 mM ATP (35.7 Ci ['y32-P]ATP/mol) would allow both a fast and an economical control. or (2) 25 mM Tris HCl (pH 7.0), 5 mM MgCI2, 0.1 mM In our previous work on phage T7, we reported that labeled EDTA, 44,AM, ATP (114 Ci of [32P]ATP/mol). The incuba- phosphate is incorporated into ribosomal protein after T7 in- tions were started by the addition of enzyme (cell extract) fection (6, 23). A bacteriophage T7-induced protein kinase and stopped by addition of 1.5 ml of 10% trichloroacetic acid. (EC 2.7.1.3.7) is the subject of the present paper. The enzyme The precipitates were boiled in trichloroacetic acid for 15 min, is an early T7 gene product. The gene maps promoter-prox- chilled in ice for 10 min, and collected on glass-fiber filter imal to gene 1 (RNA polymerase). The kinase transfers phos- discs. The discs were washed 5 times with 10mlof 10% trichloro- phate from 'ylabeled ATP to seryl residues in protein. Its acetic acid and once with 10 ml of methanol. After the filters activity is not affected by the addition of adenosine 3':5'- were dried, radioactivity on the filters was measured by liquid cyclic monophosphate (cAMP) or guanosine 3': 5'-cyclic scintillation spectrometry. In selected experiments, the 10% monophosphate (cGMP). trichloroacetic acid suspensions of precipitate were heated to METHODS 900 for 20 min, cooled to ambient temperature, and centri- fuged at 2500 X g. These precipitates were washed twice in Stains used were described in ref. 7 and legends to Figs. 1 ethanol-ether (3:1) at 370 for 30 min and then for 10 min, and 3. collected again by centrifugation, and air dried. The precipi- Growth of Bacteria and Phage. Escherichia coli B,,1 were tates were taken up in 0.5 ml of NCS solubilizer (Nuclear grown at 300 in TG medium (8) supplemented with 50 ,MI Chicago) for liquid scintillation counting. Chemicals. [7y-32P]ATP and [32P]orthophosphate were pur- Abbreviations: SDS, sodium dodecyl sulfate; PEI, polyethyl- chased from Amersham Radiochemicals. E. coli alkaline phos- eneimine; cAMP, adenosine 3':5'-cyclic monophosphate; cGMP, phatase and pancreatic DNase and RNase were purchased guanosine 3':5'-cyclic monophosphate. from Boehringer Mannheim. Pronase and type II calf-thymus 586 Downloaded by guest on September 24, 2021 Proc. Nat. Acad. Sci. USA 71 (1974) Protein Kinase Induction 587 histone were products of Sigma Chemical Co., St. Louis. Control Polyethyleneimine PEI-cellulose thin layers were a product of T7 am 23 Brinkmann. T7 arn 23 Pronase RESULTS T7 cm 23 UV Incorporation of [32P]OrthophosphaMt into Protein In Vivo. To demonstrate protein phosphorylation in vio, control and Control a- T7 am 23 '.4. C 44It N T7-infected cells were grown in the presence of-labeled phos- T7 am 23 UV w phate. The cells were grown in a low-phosphate medium (high T7 orn, 23 CAM ..r je, ......... specific activity); the cells were harvested at specific times (7 in shown in Fig. 1) after infection, lysed Control aI >a min the experiment T7 am 23 _ _ i P H with SDS, treated with RNase, and subjected to polyacryl- T7 om 23/UV cells _4nI W amide gel electrophoresis. The location of the labeled phos- phate was determined by autoradiography. Control 14C The formation of phosphoprotein in the control cells was Control 32p modest (Fig. 1). However, there is a considerable increase in T7 am 23 14C the number of labeled bands and in the extent of labeling in T7 om 23 32p T-; 14C .. 4VZ__,.t* I the T7-infected cells. The latter is also demonstrated by the 32p difference in total hot trichloroacetic acid-precipitable, labeled T7' material. 3-4 times more label is precipitated from homoge- T7 an 342o nates of T7-infected cells than from control cells (not shown). T7 H3 The labeled bands detected in gels appear to represent phos- T7V ; V .. ;' CS'>- phate-carrying proteins since the bands disappear upon Pro- *JV cells nase digestion (Fig. 1). ® C----H FIG. 1. Incorporation of [32Plorthophosphate into proteins Phosphorylation In Vitro. The characteristics of protein in vivo after T7 infection. Aliquots (50-200 Al) of culture were labeling in vitro were studied by measurement of the incorpora- labeled and analyzed on 10% slab gels as described in Methods. tion of radiophosphate from ['y-82P]ATP into various acceptor Individual sets were subjected to electrophoresis on the same slab substances by cell homogenates. Incorporation was observed gel with equal amounts of culture in each sample. Where indi- in cell homogenates from T7-infected cells with or without cated, UV treatment of phage or bacteria in sets I-III was for added histone (Table 1). Among those proteins tested, histone 10 min under the conditions of ref. 20; the bacteria used in set V is the best acceptor protein, better than albumin, RNase, were treated before infection with 6 min of UV under the condi- and washed ribosomes from E. coli (not shown). The addition tions of ref. 9. Samples were labeled with 25 A&Ci/ml of 32PO4 or of cAMP (Table 1) or cGMP does not alter the amount of I'4C]aminoacids where indicated. Label was present between 2 preparations, and 7 min after infection for sets I-IV, and 0-10 min in set V. phosphate incorporation. With these enzyme All samples were treated with RNase; sample 3 of set I was also the incorporation is linear for the first 6 min (not shown). treated with Pronase. Sample 4 of set II was infected in the Properties of the Bond Between Phosphate and Protein. presence of 75 pg/ml of chloramphenicol. T7 strains: am23 and Because of the lack' of definitive evidence for a bacterial am342a are amber mutants in gene 1 (7, 9). The amber peptide protein kinase (11), extensive studies on the nature of the link of T7 am23 is very small and only the ligase and two peptides between phosphate and protein were undertaken.
Load more

Recommended publications
  • A Simple Colorimetric RNA Polymerase Assay
    Virology 274, 429–437 (2000) doi:10.1006/viro.2000.0492, available online at http://www.idealibrary.com on Exploiting Polymerase Promiscuity: A Simple Colorimetric RNA Polymerase Assay William Vassiliou,* Jeffery B. Epp,† Bin-Bin Wang,* Alfred M. Del Vecchio,‡,1 Theodore Widlanski,§ and C. Cheng Kao*,2 *Department of Biology, Indiana University, Bloomington, Indiana 47405; †Dow AgroSciences, Indianapolis, Indiana 46268; ‡SmithKline Beecham Inc., Collegeville, Pennsylvania 19426; and §Department of Chemistry, Indiana University, Bloomington, Indiana 47405 Received May 18, 2000; accepted June 29, 2000 We developed a convenient colorimetric assay for monitoring RNA synthesis from DNA-dependent RNA polymerases (DdRp) and viral RNA-dependent RNA polymerases (RdRp). ATP and GTP with a p-nitrophenyl moiety attached to the ␥-phosphate were synthesized (PNP–NTPs). These PNP–NTPs can be used for RNA synthesis by several RNA polymerases, including the RdRps from brome mosaic virus and bovine viral diarrhea virus and the DdRps from bacteriophage T7 and SP6. When the polymerase reactions were performed in the presence of alkaline phosphatase, which digests the p-nitrophe- nylpyrophosphate side-product of phosphoryl transfer to the chromogenic p-nitrophenylate, an increase in absorbence at 405 nm was observed. These nucleotide analogues were used in continuous colorimetric monitoring of polymerase activity. Furthermore, the PNP–NTPs were found to be stable and utilized by RNA polymerases in the presence of human plasma. This simple colorimetric polymerase assay can be performed in a standard laboratory spectrophotometer and will be useful in screens for inhibitors of viral RNA synthesis. © 2000 Academic Press INTRODUCTION polymerases are primarily tested using radioactive assays that require special handling of the isotope RNA and DNA polymerases carry out the synthesis of and are incompatible with continuous monitoring of oligonucleotides by transfer of a nucleoside monophos- polymerase activity (Ferrari et al., 1999).
    [Show full text]
  • Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
    Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14).
    [Show full text]
  • The Conserved Structure of Plant Telomerase RNA Provides the Missing Link for an Evolutionary Pathway from Ciliates to Humans
    The conserved structure of plant telomerase RNA provides the missing link for an evolutionary pathway from ciliates to humans Jiarui Songa, Dhenugen Logeswaranb,1, Claudia Castillo-Gonzáleza,1, Yang Lib, Sreyashree Bosea, Behailu Birhanu Aklilua, Zeyang Mac,d, Alexander Polkhovskiya,e, Julian J.-L. Chenb,2, and Dorothy E. Shippena,2 aDepartment of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843; bSchool of Molecular Sciences, Arizona State University, Tempe, AZ 85287; cNational Maize Improvement Center of China, China Agricultural University, 100193 Beijing, China; dCollege of Agronomy and Biotechnology, China Agricultural University, 100193 Beijing, China; and eCenter of Life Sciences, Skolkovo Institute of Science and Technology, 121205 Moscow, Russian Federation Edited by Thomas R. Cech, University of Colorado Boulder, Boulder, CO, and approved October 24, 2019 (received for review September 4, 2019) Telomerase is essential for maintaining telomere integrity. Although transcribed by RNA polymerase III (Pol III) (6, 7). The La-related telomerase function is widely conserved, the integral telomerase protein P65 in Tetrahymena recognizes the 3′ poly-U tail of TR RNA (TR) that provides a template for telomeric DNA synthesis has and bends the RNA to facilitate telomerase RNP assembly (8, 9). diverged dramatically. Nevertheless, TR molecules retain 2 highly In contrast, fungi maintain much larger TR molecules (900 to conserved structural domains critical for catalysis: a template- 2,400 nt) that are transcribed by RNA polymerase II (Pol II) (3). proximal pseudoknot (PK) structure and a downstream stem-loop The 3′ end maturation of fungal TRs requires components of the structure. Here we introduce the authentic TR from the plant canonical snRNA biogenesis pathway and results in RNP assembly Arabidopsis thaliana, called AtTR, identified through next-generation sequencing of RNAs copurifying with Arabidopsis TERT.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • RNA-Dependent RNA Polymerase Speed and Fidelity Are Not the Only Determinants of the Mechanism Or Efficiency of Recombination
    G C A T T A C G G C A T genes Article RNA-Dependent RNA Polymerase Speed and Fidelity are not the Only Determinants of the Mechanism or Efficiency of Recombination Hyejeong Kim y, Victor D. Ellis III, Andrew Woodman, Yan Zhao, Jamie J. Arnold y and , Craig E. Cameron y * Department of Biochemistry and Molecular Biology, The Pennsylvania State University, 201 Althouse Laboratory, University Park, PA 16802, USA; [email protected] (H.K.); [email protected] (V.D.E.); [email protected] (A.W.); [email protected] (Y.Z.); [email protected] (J.J.A.) * Correspondence: [email protected]; Tel.: +1-919-966-9699 Present address: Department of Microbiology and Immunology, School of Medicine, University of North y Carolina at Chapel Hill, 125 Mason Farm Rd., Chapel Hill, NC 27599-7290, USA. Received: 15 October 2019; Accepted: 21 November 2019; Published: 25 November 2019 Abstract: Using the RNA-dependent RNA polymerase (RdRp) from poliovirus (PV) as our model system, we have shown that Lys-359 in motif-D functions as a general acid in the mechanism of nucleotidyl transfer. A K359H (KH) RdRp derivative is slow and faithful relative to wild-type enzyme. In the context of the KH virus, RdRp-coding sequence evolves, selecting for the following substitutions: I331F (IF, motif-C) and P356S (PS, motif-D). We have evaluated IF-KH, PS-KH, and IF-PS-KH viruses and enzymes. The speed and fidelity of each double mutant are equivalent. Each exhibits a unique recombination phenotype, with IF-KH being competent for copy-choice recombination and PS-KH being competent for forced-copy-choice recombination.
    [Show full text]
  • T7 RNA Polymerase from Escherichia Coli BL 21/Par 1219 Nucleoside-Triphosphate: RNA Nucleotidyltransferase (DNA-Directed), EC 2.7.7.6 Cat
    For life science research only. Not for use in diagnostic procedures. T7 RNA Polymerase From Escherichia coli BL 21/pAR 1219 Nucleoside-triphosphate: RNA nucleotidyltransferase (DNA-directed), EC 2.7.7.6 Cat. No. 10 881 767 001 y Version 22 1,000 U Content version: March 2016 Cat. No. 10 881 775 001 5,000 U Store at Ϫ15 to Ϫ25° C Product Overview Standard Transcription Assay Pack Content Additional Reagents Required • lin. template DNA including T7 RNA promotor Vial Content • Ribonucleoside triphosphates T7 RNA • 1,000 U • labeled nucleotide (according to application) Polymerase • 5,000 U •RNAse inhibitor Enzyme storage buffer: 10 mM Potassium phosphate, • Water, PCR Grade 200 mM KCl, 0.1 mM EDTA, 30 mM 2-mercaptoethanol, 50% glycerol (v/v), 0.1% Tween 20, pH 7.9 (+4°C). Radioactive Assay Supplied Transcrip- Buffer composition (10x conc.): Pipet the following components into a microfuge tube, mix and make up to a tion buffer 0.4 M Tris-HCl, pH 8.0 (+20°C), 60 mM MgCl2 , 100 mM final volume of 20 µl: dithiothreitol, 20 mM spermidine. Storage and Stability Reagent Volume/Concentration Stable at -15 to -25°C until the expiration date printed on the label. Template DN A 0.5 µg Product Description Nucleotides ATP, GTP, CTP, UTP each 0.5 mM final T7 RNA polymerase is commonly used to transcribe DNA which has been α 32 cloned into vectors which have two phage promoters in opposite orientation. Labeled nucleotide [ - P] CTP [400 Ci/ 0.1 µl aqueous solution RNA can be selectively synthesized from either strand of the insert DNA with mmol; 15 TBq/mmol] different polymerases.
    [Show full text]
  • Datasheet for T7 RNA Polymerase
    Applications: 1X RNAPol Reaction Buffer: Incubate at 37°C for 1 hour. For shorter (< 300 nt) • Radiolabeled RNA probes 40 mM Tris-HCl transcripts incubate at 37°C for 2–16 hours. T7 RNA Polymerase 6 mM MgCl • Non-isotopic RNA labeling 2 2 mM spermidine Notes on use: • Preparation of RNA vaccines 1 mM dithiothreitol For radio labeled high specific activity RNA 1-800-632-7799 • Guide RNA for gene targeting pH 7.9 @ 25°C probes, the concentration of the radioactive [email protected] nucleotide should be limited to 6 μM. www.neb.com • mRNA for in vitro translation and micro injection Unit Definition: One unit is defined as the amount of M0251S 013160118011 • RNA structure, processing and catalysis studies enzyme required to incorporate 1 nmol ATP into an To protect RNA against ribonuclease, RNase inhibitor (NEB #M0314 or #M0307) should be • RNA amplification acid-insoluble material in 1 hour at 37°C. added to a final concentration of 1 U/μl. M0251S • Anti-sense RNA for gene expression experiment Unit Assay Conditions: 1X RNAPol Reaction Buffer, T7 RNA Polymerase is extremely sensitive to salt supplemented with 0.5 mM each ATP, UTP, GTP, CTP 5,000 units 50,000 U/ml Lot: 0131601 Supplied in: 100 mM NaCl, 50 mM Tris-HCl (pH 7.9), inhibition. The overall salt concentration should and 1 µg T7 DNA in 50 µl. RECOMBINANT Store at –20°C Exp: 1/18 1 mM EDTA, 20 mM 2-mercaptoethanol, 0.1% Triton not exceed 50 mM. X-100 and 50% glycerol. Description: Bacteriophage T7 RNA Polymerase is Protocol for Standard RNA Synthesis: Assemble the Quality Control Assays a DNA-dependent RNA polymerase that is highly reaction at room temperature in the following order.
    [Show full text]
  • Substrate Recognition and Mechanism Revealed by Ligand-Bound Polyphosphate Kinase 2 Structures
    Substrate recognition and mechanism revealed by ligand-bound polyphosphate kinase 2 structures Alice E. Parnella,1, Silja Mordhorstb,1, Florian Kemperc, Mariacarmela Giurrandinoa, Josh P. Princea, Nikola J. Schwarzerc, Alexandre Hoferd, Daniel Wohlwendc, Henning J. Jessend,e, Stefan Gerhardtc, Oliver Einslec,f, Petra C. F. Oystong,h, Jennifer N. Andexerb,2, and Peter L. Roacha,g,2 aChemistry, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; bInstitute of Pharmaceutical Sciences, Albert-Ludwigs- University Freiburg, 79104 Freiburg, Germany; cInstitute of Biochemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; dOrganic Chemistry Institute, University of Zürich, 8057 Zürich, Switzerland; eInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; fBioss Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; gInstitute for Life Sciences, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; and hBiomedical Sciences, Defence Science and Technology Laboratory Porton Down, SP4 0JQ Salisbury, United Kingdom Edited by David Avram Sanders, Purdue University, West Lafayette, IN, and accepted by Editorial Board Member Gregory A. Petsko February 13, 2018 (received for review June 20, 2017) Inorganic polyphosphate is a ubiquitous, linear biopolymer built of mechanism is proposed to proceed via a phosphorylated enzyme up to thousands of phosphate residues that are linked by energy- intermediate (8), which
    [Show full text]
  • Regulation of Trypanosoma Brucei
    Clemson University TigerPrints All Dissertations Dissertations 5-2011 REGULATION OF TRYPANOSOMA BRUCEI HEXOKINASE 1 AND 2 ON MULTIPLE LEVELS: TRANSCRIPT ABUNDANCE, PROTEIN EXPRESSION AND ENZYME ACTIVITY Heidi Dodson Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Biochemistry Commons Recommended Citation Dodson, Heidi, "REGULATION OF TRYPANOSOMA BRUCEI HEXOKINASE 1 AND 2 ON MULTIPLE LEVELS: TRANSCRIPT ABUNDANCE, PROTEIN EXPRESSION AND ENZYME ACTIVITY" (2011). All Dissertations. 703. https://tigerprints.clemson.edu/all_dissertations/703 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. REGULATION OF TRYPANOSOMA BRUCEI HEXOKINASE 1 AND 2 ON MULTIPLE LEVELS: TRANSCRIPT ABUNDANCE, PROTEIN EXPRESSION AND ENZYME ACTIVITY A Dissertation Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Biochemistry and Molecular Biology by Heidi Cornelia Dodson May 2011 Accepted by: Dr. James C. Morris, Committee Chair Dr. Kimberly S. Paul Dr. Michael G. Sehorn Dr. Kerry S. Smith ABSTRACT Trypanosoma brucei, a unicellular eukaryotic parasite, is the causative agent of African sleeping sickness in sub-Saharan Africa. The parasite encounters two main environments as it progresses through its life cycle: the tsetse fly and the mammalian bloodstream. Nutrient availability is distinct in the two environments, requiring the parasite to utilize diverse metabolic pathways to efficiently produce ATP for survival. Bloodstream form parasites (BSF), residing in a glucose rich environment, rely solely on glycolysis for energy, while procyclic form (PF) parasites metabolize readily available proline and threonine in addition to glucose.
    [Show full text]
  • Interaction of Ribonucleoside Triphosphates with the Gene 4 Primase of Bacteriophage T7*
    THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 50, Issue of December 10, pp. 35899–35907, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Interaction of Ribonucleoside Triphosphates with the Gene 4 Primase of Bacteriophage T7* (Received for publication, June 9, 1999, and in revised form, September 3, 1999) David N. Frick‡§, Shiv Kumar¶, and Charles C. Richardson‡ʈ From the ‡Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 and the ¶Nucleic Acid Chemistry, Amersham Pharmacia Biotech, Piscataway, New Jersey 08855 The primase fragment of bacteriophage T7 gene 4 pro- acterization of T7 DNA primase activity. For example, al- tein catalyzes the synthesis of oligoribonucleotides in though the T7 helicase preferentially hydrolyzes dTTP as the the presence of ATP, CTP, Mg2؉ (or Mn2؉), and DNA energy source to unwind double-stranded DNA, the enzyme containing a primase recognition site. During chain ini- also hydrolyzes ATP (9). Hence, this activity would dramati- tiation, ATP binds with a Km of 0.32 mM, and CTP binds cally lower the concentration of ATP in primase assays and with a Km of 0.85 mM. Synthesis of the dinucleotides therefore artificially decrease rates of primer synthesis proceeds at a rate of 3.8/s. The dinucleotide either dis- measured. sociates or is extended to a tetranucleotide. The primase We have recently isolated the DNA primase from bacterio- preferentially inserts ribonucleotides forming Watson- phage T7 as a 30-kDa peptide fragment containing only the Crick base pairs with the DNA template >200-fold more N-terminal 271 amino acids (14), a region homologous to the rapidly than other ribo- or deoxynucleotides.
    [Show full text]
  • Inhibition and Regulation of Isoprenoid Biosynthetic Pathways in Plants Inhibition Et Régulation Des Voies De Biosynthèse Des Isoprénoïdes Chez Les Végétaux
    Université de Strasbourg Thèse présentée à la FACULTÉ DES SCIENCES DE LA VIE ET DE LA TERRE pour obtenir le titre de DOCTEUR DE L’UNIVERSITÉ de STRASBOURG Domaine : Biologie Moléculaire Végétale par Michael Hartmann Titre du sujet de thèse: Inhibition and regulation of isoprenoid biosynthetic pathways in plants Inhibition et régulation des voies de biosynthèse des isoprénoïdes chez les végétaux Soutenue le 14 septembre 2010 devant la Comission d’Examen : Thomas J. BACH Directeur de thèse Université de Strasbourg, Strasbourg Francis KARST Rapporteur interne Institut National de la Recherche Agronomique, Colmar Michael H. WALTER Rapporteur externe Leibniz-Institut für Pflanzenbiochemie, Halle/Saale (GER) Benoît ST-PIERRE Rapporteur externe Université François Rabelais, Tours Rüdiger HELL Examinateur Heidelberg Institute for Plant Science, Heidelberg (GER) Michel ROHMER Examinateur Université de Strasbourg, Strasbourg This doctoral thesis has been supported by a full grant of the „Région ALSACE” (Bourse Régionale de Recherche 2005: Convention de thèse n° d’enregistrement 05/908/702 – HARTMANN Michael). Table of Contents Table of contents: 1 INTRODUCTION ............................................................................................. 11 1.1 Isoprenoids 11 1.1.1 Isoprenoids – a diverse class of metabolites ............................................................................. 11 1.1.2 Biosynthesis of isoprenoids in plants ....................................................................................... 14 1.1.3 Plants
    [Show full text]
  • Mechanical Unfolding of Long Human Telomeric RNA (TERRA) Miguel Garavís,‡Ab Rebeca Bocanegra,‡C Elías Herrero-Galán,C Carlos González,*B Alfredo Villasante,*A and J
    Electronic Supplementary Material (ESI) for Chemical Communications This journal is © The Royal Society of Chemistry 2013 Supplementary DATA FOR: Mechanical unfolding of long human telomeric RNA (TERRA) Miguel Garavís,‡ab Rebeca Bocanegra,‡c Elías Herrero-Galán,c Carlos González,*b Alfredo Villasante,*a and J. Ricardo Arias-Gonzalez*d SUPPLEMENTARY FIGURES Figure S1. Schematic representation of the steps involved in the preparation of long TERRA samples for NMR experiments and RNA constructions for optical tweezers. RNA appears in blue. For further details see Experimental Methods section. Electronic Supplementary Material (ESI) for Chemical Communications This journal is © The Royal Society of Chemistry 2013 EXPERIMENTAL METHODS RNA preparations The RNA sequences used for NMR, CD and optical-tweezers studies were obtained by in vitro transcription. The DNA template was generated by standard PCR methods using the following overlapping primers: 5’-GAGCAAGCTTAATACGACTCACTATA(GGGTTA)16TA-3’ and 1 5’-GCTCGAATTCGAAGACTA(TAACCC)16TA-3’. The resulting sequence was ligated into the pUC18 vector and transformed into E. coli DH5α competent cells. Given the instability of repeated sequences in E. coli, different mutations (deletions, amplifications and single point mutations) frequently occur in the telomeric repeats during plasmid cloning. Nevertheless, this disadvantage has been used to obtain plasmid constructions containing variable number of telomeric repeats. These plasmids were then used for the synthesis of the RNA required for NMR of optical-tweezers studies. To prepare large quantities of RNA for NMR, plasmid DNA was purified from 2 L of cell culture using Qiagen Giga-prep columns. The purified plasmid was resuspended in deionized water at 500 μg/mL and linearized with the Fermentas restriction enzyme BpiI (12 h, 37 ºC, 1 U of enzyme per 50 μg plasmid DNA).
    [Show full text]