Plantibacter Flavus Strain 251, Increased A

Identification of Plant Growth-Promoting Bacterial Endophytes Using Culture-Dependent In Vitro and

Laboratory In Planta Methods

Evan Mayer

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Cell and Systems Biology University of Toronto

©Copyright by Evan Mayer 2019

Identification of Plant Growth-Promoting Bacterial Endophytes Using Culture-Dependent In Vitro and

Laboratory In Planta Methods

Evan Mayer Master of Science Cell and Systems Biology University of Toronto 2019

Abstract

This study examined a collection of 220 bacterial endophytes isolated from herbaceous plants growing in petroleum-contaminated soils for plant growth promotion abilities. 12% of endophytes tested induced statistically significant growth benefits in Arabidopsis. The strongest plant growth promoting endophyte, Plantibacter flavus strain 251, increased A. thaliana fresh biomass and total root length by 4.7 and 5.8 times respectively over control plants and contained genes for auxin and ACC deaminase production. In vitro tests showed that 26% of endophytes from 19 different genera were potentially capable of nitrogen fixation, while 42% of endophytes from 16 different genera were capable of phosphate solubilization. Of the potential nitrogen fixers, 80% demonstrated free-living nitrogen fixation capability when grown in nitrogen-free media. None of the three endophytes tested improved Arabidopsis tolerance to drought stress. Overall, this study showed that a large variety of bacterial endophytes are capable of direct plant growth promotion.

Acknowledgements I would like to thank my supervisor, Roberta Fulthorpe, for giving me the opportunity to not just get a Master’s degree, but to also grow as a person. I feel like I have become more independent, creative, and passionate about science as a result of working with you for two years at U of T Scarborough, and I’m very appreciative of that. I would like to thank my committee members, Marney Isaac and Keiko Yoshioka, for being open with their input and providing me with the necessary tools to facilitate this research. Lastly, I would like to thank my labmates, particularly the three Patricias, for helping and entertaining me throughout the Masters.

iii

Table of Contents

List of Tables ...... vi List of Figures ...... viii List of Appendices ...... xi List of Abbreviations ...... xii Chapter 1: Introduction ...... 1 1.1 The Plant Microbiome ...... 1 1.2 The Endosphere and Endophytes ...... 2 1.3 Beneficial Functions of Plant Growth-Promoting Microbes ...... 4 1.3.1 Production of Phytochemicals and Phytohormones ...... 4 1.3.2 Nutrient Acquisition ...... 5 1.3.3 Abiotic Stress Tolerance ...... 5 1.3.4 Protection from Pathogens ...... 6 1.4 Practical Application of Plant Growth-Promoting Microbes ...... 7 1.4.1 Biofertilizers and Biopesticides ...... 7 1.4.2 Other Uses ...... 8 1.5 Methods of Studying Plant Growth-Promoting Microbes...... 8 1.5.1 In Vitro vs. In Vivo Methods ...... 8 1.5.2 Arabidopsis thaliana as a Model Laboratory Plant ...... 9 1.6 Research Objectives and Hypotheses ...... 10 Chapter 2: Identification of Direct Plant Growth-Promoting Bacterial Endophytes Using In Planta Screening Tests ...... 12 2.1 Introduction ...... 12 2.2 Materials and Methods ...... 13 2.2.1 Endophyte Collection and Bacterial Culture Growth ...... 13 2.2.2 Surface Sterilization of Arabidopsis Seeds ...... 13 2.2.3 In Planta Screening Tests ...... 14 2.2.4 Statistical Analysis ...... 15 2.3 Results ...... 15 2.4 Discussion...... 19 Chapter 3: Quantification and Explanation of Direct Plant Growth Promotion by Select Bacterial Endophytes ...... 21 3.1 Introduction ...... 21 3.2 Materials and Methods ...... 21

3.2.1 16S rRNA Gene Sequencing of Select Endophytes ...... 21 3.2.2 In planta Tests Using Select Endophytes ...... 22 3.2.3 Statistical Analysis ...... 23 3.2.4 Plantibacter flavus strain 251 Genome Annotation and Search ...... 23 3.3 Results ...... 24 3.3.1 Identification of Select Isolates ...... 24 3.3.2 Select in planta tests ...... 25 3.3.3 Plant Beneficial Genes in Plantibacter flavus Strain 251 ...... 34 3.4 Discussion...... 35 Chapter 4: Effects of Bacterial Endophytes on Plant Nitrogen Acquisition ...... 41 4.1 Introduction ...... 41 4.2 Materials and Methods ...... 43 4.2.1 nifH PCR ...... 43 4.2.2 Growth in Nitrogen-Free Medium ...... 43 4.2.3 Nitrogen-Limiting In Planta Tests ...... 44 4.3 Results ...... 44 4.3.1 nifH PCR ...... 44 4.3.2 Growth in Nitrogen-Free Medium ...... 45 4.3.3 Nitrogen-Limiting In Planta Tests ...... 46 4.4 Discussion...... 47 Chapter 5: Effects of Bacterial Endophytes on Plant Phosphorus Uptake ...... 51 5.1 Introduction ...... 51 5.2 Materials and Methods ...... 52 5.3 Results ...... 52 5.4 Discussion...... 52 Chapter 6: Effects of Bacterial Endophytes on Plant Tolerance to Drought Stress ...... 55 6.1 Introduction ...... 55 6.2 Materials and Methods ...... 56 6.2.1 Selection of Drought Tolerant Endophytes ...... 56 6.2.2 Drought Stress In Planta Tests ...... 57 6.3 Results ...... 58 6.3.1 Selection of Drought Tolerant Endophytes ...... 58 6.3.2 Drought Stress In Planta tests ...... 60 6.4 Discussion...... 63 Chapter 7: Conclusions and Future Directions ...... 65

List of Tables

Table 2.1: Effects of bacterial endophyte inocula from Oil Springs and Komoka Provincial Park on various Arabidopsis growth characteristics. The majority of plants inoculated with endophytes from the collection exhibited increased growth over uninoculated control plants.

Table 2.2: List of Arabidopsis growth characteristics showing significant improvement after inoculation with endophytes.

Table 2.3: List of endophyte genera showing significant improvement of Arabidopsis growth.

Table 2.4: Growth benefits by selected endophytes on Arabidopsis growth throughout the growth period of in planta screening tests. All listed growth improvements were statistically significant (p<0.1).

Table 2.5: Coefficients of variation of growth characteristics for all uninoculated control plants.

Table 3.1: Species identities of select endophytes. Isolate Identities were determined by Sanger sequencing purified 16S rDNA and comparing results to those in GenBank using NCBI BLAST.

Table 3.2: Effects of endophyte inocula on shoot growth for Arabidopsis plants grown in MS media without sucrose. Numbers represent mean ± standard deviation at 21 DAI. Significant improvement over control plants is noted by one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Table 3.3: Effects of endophyte inocula on shoot growth for Arabidopsis plants grown in MS media supplemented with 1% sucrose. Numbers represent mean ± standard deviation at 21 DAI. Significant improvement over control plants is noted by one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Table 3.4: Plant beneficial traits found from annotating and searching the genome of Plantibacter flavus strain 251 with RAST and PATRIC.

Table 4.1: List of the most prevalent endophyte genera potentially containing nifH.

Table 4.2: List of the most prevalent endophyte genera showing a positive result for free-living nitrogen fixation.

Table 5.1: Most prevalent endophyte genera testing positive for phosphate solubilization.

Table 6.1: Growth results for endophytes inoculated into 0.5X TSB containing 3%, 6%, 9%, or 12% NaCl. “+” indicates visible turbidity, “(+)” indicates slight turbidity, and “-” indicates no turbidity seen in the medium.

Table 6.2: Drought tolerance characteristics of endophytes planned to be used as inocula for drought stress in planta tests. Isolate codes of endophytes that were ultimately used for in planta tests are bolded.

Table 7.1: Plant growth promotion traits of five beneficial endophytes for Arabidopsis growth.

vii

List of Figures

Figure 2.1: Flow chart summarizing methodology for in planta screening tests

Figure 3.1: Flow chart summarizing methodology for select in planta tests

Figure 3.2: Photographs of Arabidopsis plants inoculated with select endophyte isolates at 7, 14, and 21 DAI. Plants that had six leaves of fewer at 21 DAI were excluded from analysis.

Figure 3.3: Scanned root images of Arabidopsis plants inoculated with select endophytes at 21 DAI. The two plant replicates with the longest roots (i.e. greatest total root length) are shown for each treatment.

Figure 3.4: Photographs of Arabidopsis plants inoculated with M112 and the bacterial consortium at 7, 14, and 21 DAI. Plants from both treatments were excluded from analysis.

Figure 3.5: Effects of endophyte inocula on fresh biomass 21 DAI for Arabidopsis plants grown in MS media without sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks

Figure 3.6: Effects of endophyte inocula on total root length 21 DAI for Arabidopsis plants grown in MS media without sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 3.7: Effects of endophyte inocula on root tip abundance 21 DAI for Arabidopsis plants grown in MS media without sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks

viii

Figure 3.8: Effects of endophyte inocula on fresh biomass 21 DAI for Arabidopsis plants grown in MS media supplemented with 1% sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 3.9: Effects of endophyte inocula on total root length 21 DAI for Arabidopsis plants grown in MS media supplemented with 1% sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 3.10: Effects of endophyte inocula on root tip abundance 21 DAI for Arabidopsis plants grown in MS media supplemented with 1% sucrose. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 3.11: Effects of sucrose on Arabidopsis growth for each treatment. Bars represent the differences between growth characteristics results for plants grown in media containing sucrose and those grown in media without sucrose. Positive values show better growth in media containing sucrose, while negative values show better growth in media without sucrose.

Figure 4.1: Image of nitrogen-free medium containing a ring of high turbidity (indicated by the red arrow).

Figure 4.2: Photographs of Arabidopsis plants for nitrogen-limiting in planta tests at 13 DAI. Negative control plants (no bacterial inoculation) are highlighted the red box (top left) while positive control plants (inoculated with the known nitrogen fixer S. meliloti) are highlighted by the green box (top right).

Figure 6.1: Diagram summarizing timeline for drought stress in planta tests.

Figure 6.2: Photographs of Arabidopsis plants for each treatment group throughout the 10-day drought stress period.

Figure 6.3: Effects of endophyte inocula on Arabidopsis leaf diameter when exposed to drought stress conditions. The y-axis represents the difference between the diameter of the third leaf at the end and beginning of the drought stress period. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 6.4: Effects of endophyte inocula on Arabidopsis leaf growth when exposed to drought stress conditions. The y-axis represents the difference between the number of leaves at the end and beginning of the drought stress period. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 6.5: Effects of endophyte inocula on Arabidopsis water content when exposed to drought stress conditions. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

List of Appendices Appendix A...……………………………………………………………………………………………83 Appendix B……………………………………………………………………………………………...94

List of Abbreviations

ABA: abscisic acid ACC: 1-aminocyclopropane-1-carboxylate ATP: adenosine triphosphate BLAST: basic local alignment search tool DAI: days after inoculation DNA: deoxyribonucleic acid IAA: indole-3-acetic acid MS: Murashige and Skoog NCBI: National Center for Biotechnology Information PATRIC: Pathosystems Resource Integration Center ppm: parts per million R2A: Reasoner’s 2A agar RAST: Rapid Annotations using Subsystems Technology TSA: tryptic soy agar TSB: tryptic soy broth

xii

Chapter 1 Introduction

1.1 The Plant Microbiome The plant microbiome is defined as the community of microorganisms that is associated with a plant. The plant microbiome can be broken down into smaller microbial communities from three distinct regions of the plant: the phyllosphere, rhizosphere, and endosphere. Microbes in the phyllosphere are associated with the surfaces of plants above ground, microbes in the rhizosphere are found on the root and in soil closely adhering to the roots below ground, and microbes in the endosphere are present inside plant tissue both above and below ground (Turner et al. 2013). The abiotic and biotic conditions in each of the three regions are distinct (Berg et al. 2014), resulting in different microbial communities in each region with distinct structures and functions.

The composition of the plant microbiome is affected by the plant itself as well as its environment. There is strong evidence that plants contain a species-specific “core microbiome”. Examples of this core microbiome have been observed in many plants, including soybean, clover, agave, and Arabidopsis thaliana (Delmotte et al. 2009; Coleman-Derr et al. 2015; Lundberg et al. 2012). Because microbes in the core are conserved throughout generations, the core microbiome is thought to be critical for proper plant functioning (Vandenkoornhuyse et al. 2015). The core microbiome is supplemented by the “accessory microbiome”, which consists of microbes that associate with the plant depending on the environmental conditions. Since the composition of the accessory microbiome is more variable, it is likely to contain dispensable functions that are useful in some situations but not always necessary for plant survival (Vandenkoornhuyse et al. 2015). This is evidenced by the fact that plants can grow in laboratory-controlled sterile environments, where the accessory microbiome is likely to be minimal.

The relationship between a plant and its microbiome is highly complex. The composition of the microbiome is thought to be influenced by the plant’s immune system, as Arabidopsis thaliana plants with deficiencies in their immune systems have shown altered microbial community structures in the rhizosphere (Hein et al. 2008) and phyllosphere (Kniskern et al. 2007). Other aspects of plant genetics are also known to influence the composition of the plant microbiome.

A. thaliana plants with mutated cuticle-forming genes showed increased bacterial abundance in the phyllosphere (Bodenhausen et al. 2014). Different ecotypes of A. thaliana were also found to contain differing phyllosphere communities (Bodenhausen et al. 2014).

Most studies examining the effects of plant genetics on the microbiome have been conducted in controlled laboratory settings. As such, these results may not translate fully to natural environments, which are multi-dimensional and more complex. Alteration of the plant microbiome can have a large impact on plant growth. Plants artificially supplemented with microbes can show improved or reduced growth (Dubeikovsky et al. 1993; Turner et al. 2013; Farrar et al. 2014), though the results are dependent on the specific interactions between the plant and microbial genotypes and surrounding environment. Overall, there are still large gaps in our understanding of the interplay between plants and their microbiomes.

1.2 The Endosphere and Endophytes The plant endosphere is colonized by free-living microbes called endophytes. Endophytes are found inside all different plant species, and live intra- and extracellularly in all varieties of plant tissue, including roots, leaves, stems, flowers, and seeds (Farrar et al. 2014; Kandel et al. 2017). Although endophytes include plant pathogens, the majority of endophytes are thought to exist in mutualistic or neutral relationships with their host plants. Beneficial endophytes can improve plant fitness by providing them with advantages such as extra nutrients, phytohormones, and protection from pathogens (described further in Chapter 1.3). In exchange, plants provide endophytes with access to carbon sources, as evidenced by the large numbers of endophytes seen colonizing carbohydrate-rich niches (Kandel et al. 2017). For some endophytes, the dynamics of the plant-endophyte relationship is flexible, as their roles can change in the presence of particular environmental conditions. An example of this was seen in a study by Kloepper et al. (2013), which suggested that fluorescent pseudomonad endophytes in ferns became pathogenic once bacterial population densities exceeded a baseline level.

A large diversity of microbes have been discovered as endophytes. As an example, by 2015 bacterial species from 21 different phyla had been identified as endophytes (Hardoim et al. 2015). The majority of endophytes are bacteria and fungi, though protists and archaea have also been seen living endophytically (Kandel et al. 2017). Despite the large diversity, similar traits are consistently observed in most endophytes. Metagenomic studies have deduced that

3 flagella, siderophores, quorum sensing, and protein secretion systems are common features of various bacterial endophytes (Compant et al. 2010; Sessitsch et al. 2012; Levy et al. 2018). Characteristics of endophytes can also correspond with the tissue in which they are located. For example, large numbers of nitrogen fixation, nitrification, and denitrification protein domains were discovered in the root endosphere of rice (Sessitsch et al. 2012), likely because root endophytes play a role in plant nitrogen acquisition from soil.

Microbes can enter the plant endosphere through two different methods. They can be passed directly into offspring from the previous generation vertically (vertical transmission) or can enter from external environments (horizontal transmission) like soil and air. The majority of endophytes are thought to arise from external environments (Frank et al. 2017), although there is not conclusive evidence for this. The overall mechanisms of horizontal endophyte entry are relatively unknown, though there is evidence of a selection process by which plants influence which microbes enter the endosphere. The selection process is initiated by the release of root exudates by plants, which then communicate with certain quorum-sensing microbes in the rhizosphere, causing them to penetrate root tissue and enter the endosphere (Kandel et al. 2017). The presence of specific plant exudates and microbial quorum sensing seem to be crucial components of the entry process as they have been observed in many plant colonization studies, including colonization by the known plant growth promoter Burkholderia phytofirmans PsJN (Kost et al. 2014; Zúñiga et al. 2013). Soil microbes can also enter the plant endosphere through cracked or damaged roots (Romero et al. 2014), while airborne microbes enter through leaf stomata or damaged shoots (Frank et al. 2017). Once inside the plant, endophytes are transported to other regions via the plant xylem (Turner et al. 2013).

The composition of microbial communities in the endosphere differ than those in other plant regions. Endosphere communities are generally less diverse than those in the phyllosphere and rhizosphere (Vandenkoornhuyse et al. 2015). This seems likely to be a result of the aforementioned endophyte selection process, as well as the high levels of available carbohydrates, inorganic nutrients, and amino acids in the endosphere (Kandel et al. 2017). It is suggested that beneficial endophytes may exhibit stronger effects on plant growth promotion than rhizosphere or phyllosphere microbes because endophytes are always in direct contact with plant tissues (Santoyo et al. 2016). Compared to the rhizosphere and phyllosphere, the composition and dynamics of the endosphere are still relatively unknown. This is reflected in the number of publications relating to the endosphere: searching the term “endosphere” on Google

Scholar gives 3,840 results, compared to 21,300 for “phyllosphere” and 376,000 for “rhizosphere” (searches conducted on November 6th, 2018). The overall lack of knowledge of the endosphere, combined with its uniqueness, makes it an exciting environment to explore for discovering novel microbes and functions.

1.3 Beneficial Functions of Plant Growth-Promoting Microbes 1.3.1 Production of Phytochemicals and Phytohormones Phytochemicals and phytohormones are groups of biologically-active compounds that are produced by plants. Phytochemicals often play roles in plant pigmentation and various plant defense pathways, while phytohormones are typically involved in plant growth stimulation and regulation, though individual phytohormones and phytochemicals can have specific functions. Two of the most well-characterized phytochemicals are flavonoids, which are plant pigments that attract pollinators and protect against UV light and herbivory (Harborne and Williams 2000), and carotenoids, which are pigments involved in photosynthesis and photoprotection pathways and are precursors for the production of some phytohormones (Nisar et al. 2015). Phytohormones are signalling molecules responsible for regulating plant growth throughout all different cell types. Although they often have overlapping functions, phytohormones can be subdivided into those primarily involved in growth coordination, which control plant cell division and developmental processes like flowering and fruiting, and stress tolerance, which alter plant growth depending on external stresses such as drought, nutrient, or pH stresses. Well-known growth coordinating phytohormones include auxins, cytokinins, and gibberellins, while well- known stress response phytohormones include abscisic acid (ABA) and ethylene.

In terms of plant-microbe relations, the most commonly studied phytohormones are auxins. Auxins promote cell division and elongation in all plant tissues and play specific roles in stem growth towards light (Teale et al. 2006) and lateral root branching (Overvoorde et al. 2010). The most well-characterized auxin, indole-3-acetic acid (IAA), increases plant growth rate with increasing concentrations up to a high threshold, where it eventually inhibits growth (Hansen and Grossmann 2000). A wide variety of plant-associated microbes are known to synthesize auxins: many bacteria and fungi isolated from the rhizosphere, endosphere, and phyllosphere have been identified as auxin producers (Asghar et al. 2002; Dias et al. 2009; Sun et al. 2014), and components of genetic pathways for auxin biosynthesis have been discovered on plasmids or on the chromosomes of plant-associated bacteria (Patten and Glick 1996). Plants inoculated

5 with auxin-producing microbes show consistently improved growth (Asghar et al. 2002; Khalid et al. 2003; Kuan et al. 2016), suggesting that microbially-produced auxins are utilized by plants. Aside from auxins, there is also evidence of microbial biosynthesis of cytokinins, gibberellins, and ABA (Costacurta and Vanderleyden 1995; Tsavkelova et al. 2006; Dobbelaere et al. 2003) as well as flavonoids and carotenoids (Qiu et al. 2010; Fibach-Paldi et al. 2012). Although they are not as well studied as microbial auxin production, microbial synthesis of these other phytohormones and phytochemicals seems likely to benefit plant growth in similar ways.

1.3.2 Nutrient Acquisition Microbes in bulk soil are well-known to play important roles in the cycling of nutrients like nitrogen and phosphorus, ultimately converting them into useable forms for plant uptake. These processes have also been discovered in plant-associated microbes in the rhizosphere and endosphere. The most well-known example of this is symbiotic nitrogen fixation by rhizosphere microbes in legume root nodules, though free-living nitrogen fixing microbes such as Azotobacter, Azospirillum, and Acetobacter species can also be found in the endosphere of non-leguminous plants (Baldani et al. 1997). Since plants obtain nutrients through their roots, beneficial microbes for nutrient acquisition would be expected to be located in the rhizosphere or root endosphere; however nitrogen fixing microbes have been identified in the phyllosphere as well (Venkatachalam et al. 2016). Microbes in the rhizosphere and endosphere also facilitate plant uptake of phosphorus by solubilizing soil-bound phosphates, making them accessible for plant roots (Alori et al. 2017). More information on microbial facilitation of plant nitrogen and phosphorus acquisition is described in Chapters 3 and 4 respectively.

The uptake of many plant macro- and micronutrients can be facilitated by beneficial microbes. This includes improved plant iron uptake through production of siderophores (Crowley et al. 1991) and assisting in the activation of the plant’s own iron acquisition mechanisms (Zhang et al. 2009), as well as improved sulphur (Grayston and Germida 1991) and potassium (Basak and Biswas 2010) uptake. Microbes have also been found to synthesize and provide plants with vitamins like biotin, ascorbic acid, and niacin (Palacios et al. 2014).

1.3.3 Abiotic Stress Tolerance Microbes can improve plant tolerance to abiotic stresses using “general mechanisms”, which aid plant growth and survival when subjected to all different types of stresses, or “specific mechanisms”, which aid plant growth and survival when subjected to a particular stress.

General stress tolerance mechanisms alleviate stress symptoms by altering the concentrations of plant stress hormones while specific mechanisms vary in their functioning. One of the most well-known general stress tolerance mechanisms by microbes is production of the enzyme 1- aminocyclopropane-1-carboxylate (ACC) deaminase. ACC deaminase reduces stress symptoms in the plant by breaking down ethylene (Glick 2014). Plants inoculated with ACC deaminase-producing bacteria have shown increased stress tolerance to a variety of abiotic and biotic stresses such as drought, flooding, metal, and pathogen stresses (Glick 2014). Another stress tolerance molecule, ABA, closes leaf stomata, which helps to prevent plants from losing water during drought stress conditions (Steuer et al. 1988). As previously mentioned in section 1.3.1, some plant-associated microbes have been shown to increase plant ABA levels. More information on ACC deaminase and ABA and how they improve plant drought tolerance is described in Chapter 5.

Since specific stress tolerance mechanisms only act towards one particular stress, their effectiveness is dependent on the conditions of the growth environment. For example, some microbes can alter plant gene expression to increase salt tolerance (Jha et al. 2014), which would be advantageous for plants growing in saline soils or coastal environments. Another example is improved nutrient acquisition, which could benefit plant growth in environments depleted in certain nutrients (e.g. nitrogen fixing microbes would help plant survival in nitrogen- limited soils). Other specific microbial stress tolerance mechanisms include degradation of toxic hydrocarbons (Hou et al. 2015) and heavy metals such as lead and cadmium (Tripathi et al. 2005; Dary et al. 2010), which would aid plant survival in petroleum-contaminated and heavy metal contaminated soils respectively.

1.3.4 Protection from Pathogens A variety of mechanisms are seen in plant-associated microbes which offer plants with protection from pathogens. Some beneficial microbes can directly trigger the plant immune response, inducing broad-spectrum pathogen resistance (Van Wees et al. 2008). Others produce antimicrobials (Haas and Keel 2003; Compant et al. 2005), which may inhibit the growth of pathogens on plant surfaces or inside plant tissues. Siderophore-producing endophytes can indirectly provide plants with disease protection by out-competing pathogenic microbes for iron, preventing their colonization inside the plant (Compant et al. 2005). Many laboratory-based studies have demonstrated examples of improved pathogen resistance in plants inoculated with certain plant-associated microbes including Bacillus subtilis and a variety

7 of Pseudomonas and Curtobacterium species (Raupach and Kloepper 1998; Kloepper et al. 2004).

1.4 Practical Applications of Plant Growth-Promoting Microbes 1.4.1 Biofertilizers and Biopesticides Beneficial microbes have recently been used to improve the growth of agricultural crops through biofertilizers and biopesticides. Currently, synthetic chemical fertilizers and pesticides are more frequently used over the biological alternatives: for pesticides, the projected market values in 2023 are $4.17 billion USD for chemical pesticides compared to only $1.66 billion USD for biopesticides (Timmusk et al. 2017). The majority of biofertilizers are used to improve plant nitrogen acquisition through the addition of nodule-forming and free-living nitrogen-fixing bacteria, like Azospirillum, Azotobacter, Actinorhizobium, and Rhizobium species (Timmusk et al. 2017). The second most common use is to improve plant phosphorus uptake through the application of phosphate-solubilizing microbes (Timmusk et al. 2017). Other types of biofertilizers are specifically tailored for sulphur oxidation, pathogen protection, and degradation of organic wastes (Kumar et al. 2017).

Despite their popularity, chemical fertilizers can be detrimental to the environment, as they lead to aquatic eutrophication (Bhardwaj et al. 2014) and have been found to reduce overall ecosystem biodiversity (Hallmann et al. 2014), along with other negative effects. Biofertilizers are advantageous over chemical fertilizers in that they are more cost-efficient and less detrimental towards the environment (Bhardwaj et al. 2014). Biofertilizers are also more efficient long-term, as microbes in biofertilizers can proliferate in the environment while chemicals from traditional fertilizers run out and have to continuously be re-applied (Singh et al. 2011). Microbes in biofertilizers can provide plants with a multitude of benefits, as mentioned in section 1.3, making them versatile. The biggest limitation to biofertilizers is that their performance is dependent on the environmental conditions and plant species, as microbial functions can change in different environments, generally leading to less consistent benefits than those from chemical fertilizers (Timmusk et al. 2017). To account for this, the composition of biofertilizers can be adjusted to optimize them for particular environments, though this can be a time- consuming process. The beneficial effects from biofertilizers may also take longer to show than those from chemical fertilizers, as microbes have to proliferate and establish their environmental niches before benefits can be observed. Since biofertilizers and biopesticides are relatively new,

8 there are strict regulations involved in the registration process with government agencies (Timmusk et al. 2017), further complicating the discovery and application of new biofertilizers.

1.4.2 Other Uses Plant-associated microbes can naturally synthesize a variety of metabolites which can be beneficial for improving human health. One such class of metabolites is antimicrobials, which are used to treat pathogenic microbe infections. Some examples are the production of antimycotics by the endophytic fungus Cryptosporiopsis cf. quercina (Strobel et al. 1999) and the production of an antibacterial by the fungal endophyte Colletotrichum gloeosporioides (Zou et al. 2000). Other metabolites produced by plant-associated microbes include immunosuppressives, antioxidants, and antidiabetic agents (Strobel and Daisy 2003). Metabolites can be obtained by isolating and culturing metabolite-producing microbes, then growing them in a favourable environment and chemically extracting metabolites.

1.5 Methods of Studying Plant Growth-Promoting Microbes 1.5.1 In Vitro vs. In Vivo Methods The discovery of new plant growth-promoting microbes is especially important for improving the effectiveness and versatility of biofertilizers. In general, there are two directions that can be taken to examine culturable microbes for plant growth promotion. Microbes can be tested individually for particular plant growth promotion traits (i.e. in vitro examination) or they can be examined in association with plants (in planta) to directly observe their effects on plant growth (i.e. in vivo examination). In vitro methods are always conducted in controlled laboratory conditions while in vivo methods can take place in controlled laboratory or natural field environments. For plant growth promotion, examples of in vitro tests include using PCR to identify the presence of the ACC deaminase gene acdS, acetylene reduction assay to examine microbial nitrogen fixation, and growing microbes on differential media to identify the presence of siderophores, while examples of in vivo tests include in planta inoculation of microbes into plants and subsequent measurements of plant growth characteristics or plant genetic activity.

Both in vitro and in vivo methods have their pros and cons. Because they do not involve interactions between different organisms, in vitro methods are generally more straightforward, which can make them effective for large-scale screens. In vitro methods are useful for the examination of microbes for specific known plant growth promotion functions, such as IAA

9 production, nitrogen fixation, and phosphate solubilization. The main limitation to in vitro tests is that they cannot provide evidence that observed putative plant growth promotion traits are actually benefiting plant growth, as the functioning of microbes can alter when in different environments. Because natural environments are much more complex than those in laboratories, results from in vitro tests may not always be as useful for real world applications.

As opposed to in vitro methods, in vivo methods are advantageous in that they directly show the impacts of microbes on plant growth: plants grown in association with beneficial microbes will show enhanced growth while plants grown in association with detrimental microbes will show decreased growth. This generally makes their results more applicable, as most applications of plant growth-promoting microbes involve interactions between plants and microbes. The greatest limitation in in vivo tests is that the observed impact of the microbe is dependent on the plant being used. Microbes that are not beneficial for a specific plant species may still be beneficial for other plants, or even different cultivars of the same plant (Dubeikovsky et al. 1993; Kucey 1988). Because of this, results from in vivo tests should not be assumed to be true for all plants. In vivo methods are also less effective at deducing specific growth promotion mechanisms because of the complexity of plant-microbe relationships.

1.5.2 Arabidopsis thaliana as a Model Laboratory Plant Arabidopsis thaliana, also known as thale cress, is a member of the family Brassicaceae. A. thaliana (hereby referred to as Arabidopsis) originally became popular for laboratory-based plant studies in the 1970s because of its small genome size, short life cycle, and ability to self- pollinate (Koornneef and Meinke 2010). In 2000, the entire genome of Arabidopsis was sequenced by The Arabidopsis Genome Initiative, marking Arabidopsis as the first plant to have its genome fully sequenced. Nowadays, over 750 ecotypes, or accessions, of Arabidopsis are available, with the most commonly used accession being Columbia (Col-0).

Due to its frequent usage, the growth patterns and preferences of Arabidopsis are well-known. The growth rate of Arabidopsis changes depending on conditions like light intensity, humidity, and food and nutrient availability. When grown under standard lab conditions (as detailed by Boyes et al. 2001), Arabidopsis Col-0 takes on average 3-5 days for seed germination, 10-12 days for full growth of the first two true rosette leaves, 26 days for the formation of the first flower buds, 31 days for the first flower to open, and 50 days for the completion of flowering

(Boyes et al. 2001). Overall, the entire life cycle of Arabidopsis Col-0 is around 6-8 weeks, making it one of the faster growing plants (Boyes et al. 2001).

Though it is most frequently used for plant genetic or knockout mutation studies, Arabidopsis has also been used for studies involving plant-associated microbes, including those examining microbes for plant growth promotion and plant pathogen protection (Conn et al. 2008; Vadassery et al. 2009; Jaschke et al. 2010). The core microbiome of Arabidopsis has also been examined and characterized (Lundberg et al. 2012). Although it is not directly used for agriculture, Arabidopsis is in the same family as many crops, like cabbage, cauliflower, broccoli, and mustard plants, making it possible that beneficial microbes for Arabidopsis may be similarly beneficial for these related agricultural plants. This, in combination with its well-known growth patterns, makes Arabidopsis a reasonable choice to use as a model plant for in vivo examinations of plant growth-promoting microbes.

1.6 Research Objectives and Hypotheses My thesis is based off of a collection of 318 endophytic bacteria isolated by Rhea Lumactud, a Ph.D. graduate from the Fulthorpe lab. The majority of the collection (273 endophytes) was isolated from plants growing in petroleum-contaminated soils at Oil Springs, Ontario, while a small proportion of the collection (45 endophytes) was isolated from plants growing in non- contaminated soils at Komoka Provincial Park, Ontario (Lumactud et al. 2016; Lumactud and Fulthorpe 2018). Due to the toxicity of petroleum hydrocarbons, I would have expected plant growth at Oil Springs to be limited and unhealthy in appearance. In contrast, soils at Oil Springs were lush with a variety of thriving plant species. Based on this observation, and my understanding of plant growth-promoting microbes, I thought that plant growth at these sites was likely facilitated by beneficial plant-associated microbes, including those isolated in Lumactud’s collection. I therefore hypothesized that:

1. Bacterial endophytes from this collection can provide direct benefits for plant growth (Chapters 2 and 3). 2. Bacterial endophytes from this collection can improve plant nitrogen acquisition, phosphorus acquisition, and drought tolerance (Chapters 4-6).

Nitrogen and phosphorus acquisition and drought tolerance were specified because they are some of the greatest limitations of crop growth worldwide (Alori et al. 2017) and are known to be impacted by plant growth-promoting microbes. The overarching objective of this study was to identify which endophytes were the most beneficial for plant growth at these sites. This would provide insights into the roles and functions of various bacterial endophytes and identify plant growth-promoting microbes that could be beneficial for future usage in biofertilizers. To examine the collection for plant growth promotion, I used a combination of in vitro and in vivo methods using Arabidopsis thaliana.

Chapter 2 Identification of Direct Plant Growth-Promoting Bacterial

Endophytes Using In Planta Screening Tests

2.1 Introduction Mechanisms of microbial plant growth promotion are generally divided into two categories: those that directly promote growth and those that indirectly promote growth. Direct growth promotion mechanisms are those which primarily function to improve plant growth, while indirect growth promotion mechanisms have other primary functions but ultimately also lead to improved plant fitness. Examples of direct growth promotion mechanisms include improved nutrient acquisition, production of phytohormones, and degradation of toxic pollutants, while an example of an indirect growth promotion mechanism is pathogen protection through the production of siderophores.

For large microbial collections, plant growth promotion assays typically involve the use of rapid screening tests. These screens are useful because they can narrow overwhelmingly large collections down to smaller, more manageable subsets of microbes. Recent studies examining collections of endophytes for direct plant growth promotion have used either or both of in vitro and in vivo screening methods (Kandel et al. 2017; Karthik et al. 2017; Ali et al. 2018). As described in Chapter 1.5.1, both strategies have general pros and cons to them. When looking for direct plant growth promotion, an important thing to consider is that a variety of different mechanisms can contribute to direct growth promotion. Although in vivo tests may have difficulty elucidating which of these mechanisms are in play, they can provide a snapshot of the direct growth promotion ability of each microbe through one in planta test. In contrast, most in vitro tests can only examine one specific trait at a time, meaning that multiple tests would be needed to fully determine which microbes are capable of direct plant growth promotion. Because of the size of microbial collections, this kind of approach would be more time consuming, making an in vivo approach a sensible choice for the screening of these collections for direct plant growth promotion.

There were three main objectives for the experiments described in this chapter: to determine the proportion of endophytes from this collection which are directly benefiting plant growth, to

13 identify bacterial genera which consistently improve plant growth, and to identify the most beneficial endophytes for further examination of their growth promotion abilities. For all objectives, I used in planta tests with Arabidopsis Col-0 to obtain results. I chose to use Arabidopsis for all in planta tests because its growth preferences and growth characteristics are well-understood and it has small seeds, which combined with its fast growth speed makes it a practical choice for screening tests.

2.2 Materials and Methods 2.2.1 Endophyte Collection and Bacterial Culture Growth All plant sampling and bacterial isolation methods were conducted in 2013 by Lumactud et al. (2016). Briefly, five different plant species were taken from two different sampling sites: a petroleum-contaminated environment in Oil Springs, Ontario, and a non-contaminated environment at Komoka Provincial Park. Sampled plant stems and roots were surface sterilized, then macerated in a sterile blender. The resulting solution was spread plated and incubated to allow for growth, after which isolated colonies were transferred to glycerol stock cultures and kept at -20℃ for long-term storage. In total, the collection consisted of 318 endophyte isolates, 273 of which were from isolated from plants at the Oil Springs site and 45 of which were isolated from plants at the Komoka Park site. Of these 318 endophytes, 209 had been identified to species level through 16S rRNA gene sequencing by Rhea Lumactud. For full details on the sampling and endophyte isolation process please refer to Lumactud et al. (2016).

To obtain pure cultures, bacterial isolates were streaked from glycerol stock cultures onto tryptic soy agar (TSA) or Reasoner’s 2A agar (R2A) plates, which were incubated at 28°C for 3 days to allow for growth. Isolated colonies from these plates were transferred into tubes containing 10 mL tryptic soy broth (TSB), which were incubated in an orbital shaker at 28°C and 125rpm for 2 days, then transferred to a cold room at 4°C for short-term storage.

2.2.2 Surface Sterilization of Arabidopsis Seeds Arabidopsis seeds were surface sterilized in a microcentrifuge tube using the following protocol: wash with reverse osmosis water for 30 seconds, sterilization with 95% ethanol for 15 seconds, sterilization with 1% bleach for 2 minutes, inactivation of remaining bleach with 2% sodium thiosulfate for 10 minutes (Miché and Balandreau 2001), and 6 washes with sterile water for 15 seconds each. For each step, 1 mL of the liquid was pipetted onto the seeds and the solution

14 was mixed via pipetting for the specified time period, after which seeds were allowed to settle to the bottom of the tube and remaining liquid was removed and discarded.

To confirm the effectiveness of the sterilization procedure, 200µL of the final wash water was spread onto one TSA and one R2A plate. Plates were incubated at 28°C for 3 days and examined for growth. A lack of growth on both plates indicated that the sterilization procedure was successful.

2.2.3 In Planta Screening Tests In planta screening tests were conducted with 220 endophytes from the collection. Sterilized seeds were inoculated with endophytes by soaking them in 1 mL of bacterial culture grown in TSB (endophyte treatments) or sterile TSB (controls) for 2 hours. Inoculated seeds were then sown onto MS agar in 96-well microtiter plates. Each microtiter plate contained twelve control plants and four plant replicates per endophyte treatment. The height of microtiter plate lids was increased using plastic extenders, then sealed tightly using Parafilm to reduce the amount of media evaporation. Plates were stored at 4°C for 3 days to allow for seed stratification, then transferred under a FloraLight 16h/8h day-night light source containing two 40-watt bulbs at room temperature to allow for growth. Plates were located approximately 20 cm below the light source. The number of leaves, stem height, number of buds, and number of flowers for each plant were recorded every 3 or 4 days. At the end of the growth period (ranging from 24 to 32 days), plants were extracted from the media and fresh biomass was weighed using an analytical scale. Results in each category were analyzed using R (see section 2.2.4 for statistical analysis). All data from seeds that did not germinate was excluded from analysis, and treatments with only one plant replicate as a result of ungerminated seeds were also excluded from analysis. An overview of the methods used for in planta screens is diagrammed in Figure 2.1.

Figure 2.1: Flow chart summarizing methodology for in planta screening tests

2.2.4 Statistical Analysis To evaluate the effects of each endophyte on Arabidopsis growth, results for each category (i.e. fresh biomass, stem height, etc.) were compared between plants inoculated with each endophyte treatment and control plants on the same microtiter plate. Differences between controls and treatments were evaluated using a one-way ANOVA followed by a Dunnett’s test post-hoc. Statistical significance was set at a probability level of p<0.1. All statistical analyses were done in R version 3.4.2 using the multcomp package. Bar graphs were also made in R version 3.4.2 using the ggplot2 package.

2.3 Results Overall, the majority of endophytes were beneficial towards Arabidopsis growth, though the improvements were not always statistically significant. Growth improvements were observed through measurement of all growth characteristics: inoculation with 68% of the tested endophytes increased fresh biomass, 58% increased number of leaves, 70% increased stem height, 70% increased number of buds, and 62% increased number of flowers at the end of the growth period compared to uninoculated control plants. The overall effects of the endophyte collection on Arabidopsis growth are shown in Table 2.1.

Number of Percentage of Arabidopsis growth endophytes showing Total number of endophytes improving Sampling site characteristic improved growth endophytes tested plant growth Fresh biomass 138 194 71.1 Number of leaves 115 194 59.3 Oil Springs Stem height 139 194 71.6 Number of buds 98 133 73.7 Number of flowers 125 194 64.4 Fresh biomass 12 26 46.2 Komoka Number of leaves 13 26 50.0 Provincial Stem height 14 26 53.8 Park Number of buds 14 26 53.8 Number of flowers 11 26 42.3 Fresh biomass 150 220 68.2 Number of leaves 128 220 58.2 Total Stem height 153 220 69.5 Number of buds 112 159 70.4 Number of flowers 136 220 61.8

Inoculation with 18 of the 220 endophyte isolates (8%) showed statistically significant improvements for Arabidopsis growth at p<0.05, while inoculation with 27 of the 220 endophyte isolates (12%) showed significant improvements at p<0.1. The most frequent measures of significant growth improvement were increases in stem height and numbers of buds and flowers, while significant increases in fresh biomass and number of leaves were less common. A summary of all significant improvements of Arabidopsis growth by endophyte inocula is listed in Table 2.2. Of the 27 significant plant growth-promoting endophytes (p<0.1), the most prevalent genera were Bacillus (5 isolates), Curtobacterium (3 isolates), Microbacterium (2 isolates), Plantibacter (2 isolates), and Arthrobacter (2 isolates). A full list of endophyte genera showing significant growth promotion at both probability levels is listed in Table 2.3.

Table 2.2: List of Arabidopsis growth characteristics showing significant improvement after inoculation with endophytes.

Growth characteristic Number of endophytes Number of endophytes showing significant growth showing significant growth improvement (p<0.05) improvement (p<0.1)

Number of leaves 1 1

Stem height 10 17

Number of buds 5 9

Number of flowers 9 17

Fresh biomass 3 5

Table 2.3: List of endophyte genera showing significant improvement of Arabidopsis growth.

Endophyte genus Number of isolates Number of isolates Percent positive for demonstrating significant demonstrating significant significant growth plant growth-promotion at plant growth-promotion at promotion p<0.05 p<0.1

Bacillus 2 5 20.8

Curtobacterium 3 3 18.8

Microbacterium 2 2 9.1

Plantibacter 2 2 25.0

Arthrobacter 1 2 25.0

Brevundimonas 1 1 20.0

Pseudomonas 1 1 8.3

Rhizobium 1 1 25.0

Paenibacillus 1 1 25.0

Clavibacter 0 1 16.7

Micrococcus 0 1 100.0

Methylobacterium 0 1 50.0

Serratia 0 1 50.0

Unknown genus 4 6 10.0

Total 18 27 12.3

Six of the most promising plant growth-promoting strains were selected for further examination based on their significant growth improvements of multiple Arabidopsis characteristics. Isolate codes for these selected endophytes were M112, M132, M175, M251, M259, and M267. All selected isolates showed growth improvements at p<0.05. Significant benefits on Arabidopsis growth by each selected endophyte are listed in Table 2.4.

Table 2.4: Growth benefits by selected endophytes on Arabidopsis growth throughout the growth period of in planta screening tests.

Selected endophyte Significant growth Significance level isolate code improvements

M112 Height 0.05 Flowers 0.1

M132 Height 0.1 Flowers 0.05

M175 Height 0.05 Buds 0.1 Fresh biomass 0.1

M251 Height 0.05 Buds 0.05 Flowers 0.1

M259 Height 0.05 Buds 0.05 Flowers 0.05

M267 Height 0.05 Buds 0.1 Flowers 0.05

High amounts of variation in plant growth were seen within treatment groups, including uninoculated control plants. Variation was especially high for stem height, number of buds, and number of flowers. The coefficients of variation for growth characteristics of uninoculated control plants are listed in Table 2.5.

Table 2.5: Coefficients of variation of growth characteristics for all uninoculated control plants.

Growth characteristic Coefficient of variance

Number of leaves 15.08%

Stem height 109.95% Number of buds 106.85% Number of flowers 141.70% Fresh biomass 50.845

2.4 Discussion The majority of plants inoculated with endophytes showed improved growth over uninoculated control plants, though only a small fraction of these improvements were found to be statistically significant (8% at p<0.05). Two reasons for the lack of significance were the low numbers of biological replicates used (maximum four per endophyte treatment) and the high amounts of variance present, as seen from the high values for coefficients of variance. Due to the high levels of variation and low number of biological replicates used, the stringency of the p-value was lowered to 0.1 to increase the range of endophytes to be considered for plant growth promotion. Even when p-value stringency was lowered, only 12% of endophytes tested showed significant growth promotion towards Arabidopsis. Future methods should use a greater number of replicates for each treatment to account for the extreme variation.

Of the plant growth-promoting endophytes showing significant improvements, the most prevalent genus was Bacillus with five significant isolates at p<0.1 and three at p<0.05. Of these five isolates, four were previously identified (by Rhea Lumactud) as Bacillus aryabhattai. Many examples of in vitro plant growth promotion by B. aryabhattai have also been noted in literature, including auxin production, siderophore production, phosphate solubilization, and zinc solubilization (Lee et al. 2012; Ramesh et al. 2014), while an example of in vivo growth promotion by B. aryabhattai was also seen when inoculated in Xanthium italicum (Ji et al. 2014). Other prevalent significant growth-promoting genera included Curtobacterium, Microbacterium, Plantibacter, and Arthrobacter. Direct plant growth promotion by various Curtobacterium,

Microbacterium, and Arthrobacter species has been observed in other studies (Diez-Mendes and Rivas 2017; Karlidag et al. 2007; Armada et al. 2016; Barnawal et al. 2014), though growth promotion by Plantibacter species has not been recorded. More information on the growth- promoting capabilities of three of these genera, Curtobacterium, Microbacterium, and Plantibacter, is discussed in Chapter 3.4.

Although growth improvements by endophytes were seen with respect to all five growth characteristics measured, statistical significance for leaf growth was only seen from inoculation with one endophyte isolate. In contrast to this, results from the subsequent select in planta tests (shown in Chapter 3.3) showed that inoculation with many of the same endophytes (i.e. the “select” endophytes) did significantly increase the number of leaves. One of the constraints of the screening tests compared to the select tests was space for root and shoot growth, as individual plants were confined to small wells (approximately 0.3 mL in volume). When limited to small spaces, Arabidopsis growth patterns tend to change in that leaf growth (i.e. number of leaves and leaf diameter) slows but stem height increases (Joseph et al. 2015). For in planta screens, it therefore seems likely that significant improvements in leaf growth would have be seen for some endophytes if plants were grown in a more spacious environment.

Overall, the objectives of Chapter 2 were successfully achieved using in vivo screening tests. A majority of endophytes in the collection were seen to directly improve plant growth, although only a small subset of these improvements were deemed to be statistically significant. The most prevalent endophytes demonstrating significant growth improvement were Curtobacterium, Microbacterium, and Bacillus species. The collection was narrowed down to the six most promising plant growth-promoting endophytes, which will be examined in detail in the following chapter.

Chapter 3 Quantification of Direct Plant Growth Promotion by Select

Bacterial Endophytes

3.1 Introduction The purposes of the experiments done in this chapter were to confirm the growth-promoting abilities of six of the strongest plant growth-promoting endophytes from Chapter 2, and to quantify their improvements on Arabidopsis shoot and root growth. To quantify plant growth promotion, methods were modified from the in planta screening tests conducted in Chapter 2. Microtiter plates were replaced by GA-7 boxes to allow for more space and to examine roots, and more biological replicates were used to improve reliability and replicability. Plants were grown in MS media without sucrose and MS media supplemented with sucrose in case sucrose was necessary to increase respiration rate. To obtain possible explanations for growth promotion, the genome of one of the selected endophytes, Plantibacter flavus strain 251, was annotated and searched for genes encoding known plant growth-promoting products.

When growing plants in artificial growth media, such as MS agar, it is often supplemented with sucrose to increase the rate of respiration (Bryce and Rees 1985; Plaxton and Podesta 2006). Typically, the rate of photosynthesis in plants is much faster than that of respiration (Plaxton and Podesta 2006). If plants are grown in a sealed environment, which is often used for laboratory growth, this imbalance eventually results in excess oxygen gas and a lack of available carbon dioxide, limiting photosynthesis. Increasing the rate of respiration through sucrose addition balances the concentrations of these gases, facilitating photosynthesis. Sucrose also functions as an osmotic agent, helping to maintain the osmotic potential of plant cells (Sumaryono et al. 2012). The addition of sucrose generally accelerates plant growth, though its effects can differ depending on the concentration and plant species (de Faria et al. 2004; Nilanthi and Yang 2014).

3.2 Materials and Methods 3.2.1 16S rRNA Gene Sequencing of Select Endophytes Bacteria species of isolates M132, M175, M259, and M267 were identified by Sanger sequencing of 16S rDNA regions. M251 was previously identified by Lumactud et al. (2017).

Genomic DNA was extracted from TSB cultures using the DNeasy Blood & Tissue Kit (QIAGEN). 16S rDNA regions were amplified through 20µL PCR reactions containing 10µL HotStart Taq Master Mix, 1µL of both forward and reverse 16S-specific primers (forward: AGAGTTTGATCCTGGCTCAG, reverse: TACCTTGTTACGACTT), and 1µL genomic DNA template. The amplification protocol was as follows: initial denaturation at 95°C for 5:00, followed by 35 cycles of (denaturation at 94°C for 1:00, primer annealing at 55°C for 1:00, and extension at 72°C for 1:30), finished with a final extension at 72°C for 10:00. PCR products were visualized via gel electrophoresis with a 1% agarose gel, then purified using the QIAquick PCR Purification Kit (QIAGEN) and analyzed using the NanoDrop 1000 Spectrophotometer (Thermo Scientific). Purified PCR products were sent to The Centre for Applied Genomics (SickKids Hospital, Toronto, Canada) for Sanger sequencing. Species were identified by comparing sequence results to GenBank 16S rDNA sequences using NCBI BLAST.

3.2.2 In Planta Tests Using Select Endophytes Arabidopsis seeds were surface sterilized as described in Chapter 2.2.2. Sterilized seeds were sown onto plates containing MS agar and stored at 4°C for 3 days to allow for seed stratification, then transferred under a FloraLight 16h/8h day-night light source at room temperature to allow for growth. After four days, seedlings were aseptically removed using sterile forceps and inoculated by transferring them into 1 mL of bacterial culture in TSB for the six endophytes selected from the screening tests (individual endophyte treatments), 1 mL of a mixed bacterial cultures in TSB (endophyte consortium treatment), or sterile TSB (control) for 30 minutes. The consortium consisted of an equal volume of each of the selected endophytes. To ensure relatively consistent cell densities, cultures were adjusted to an OD600 between 0.2 and 0.5 before seedling inoculation.

Inoculated seedlings were transferred to Magenta GA-7 boxes containing 150 mL MS agar with or without 1% sucrose. Each treatment had twelve plant replicates (eight plants without sucrose and four with sucrose) while controls had thirteen plant replicates (eight plants without sucrose and five with sucrose). Lids of Magenta boxes were left slightly open (i.e. not sealed tightly) to facilitate gas exchange with the external environment. Magenta boxes were transferred to a the 16h/8h light source to allow for plant growth. Leaves, height, buds, and flowers were recorded as previously mentioned. At 21 days after inoculation (DAI), plants were extracted, then roots were washed with deionized water and dried with paper towels. Fresh biomass was weighed using an analytical scale. Roots were removed, then scanned and analyzed using the WinRhizo

23 software. Data from seedlings which had fewer than six leaves after 21 DAI were excluded from the analysis, as they were thought to be damaged during the seedling removal and inoculation process. An overview of the methods used for select in planta tests is diagrammed in Figure 3.1.

Figure 3.1: Flow chart summarizing methodology for select in planta tests

3.2.3 Statistical Analysis To evaluate the effects of each endophyte on Arabidopsis growth, results for each category were compared between control plants and plants inoculated with each endophyte treatment. Before analysis, data were normalized using the Tukey ladder of power. Comparisons of transformed data were evaluated using a one-way ANOVA followed by a Dunnett’s test post- hoc. Statistical significance was noted at a probability level of p<0.05. All data transformations and statistical analyses were done in R version 3.4.2 using the rcompanion and multcomp packages respectively. For data visualization, box plots were created in R using the boxplot function.

3.2.4 Plantibacter flavus strain 251 Genome Annotation and Search To get a better understanding of the mechanisms behind its plant growth promotion abilities, the genome of M251 (previously sequenced by Lumactud et al. 2017) was annotated using PATRIC version 3.5.17 (Wattam et al. 2017) and the RAST server (Aziz et al. 2008). Annotated genomes were searched for potential plant beneficial genes using keyword searches (PATRIC) or through

24 subsystem searches in the SEED Viewer (RAST). In cases where multiple genes from a particular beneficial pathway were found by both platforms, results were taken from the one that identified a greater number of genes in that pathway (e.g. 6 genes in the auxin production pathway were identified with RAST compared to 1 gene in the pathway identified with PATRIC, so the auxin production gene results were taken from the RAST search).

3.3 Results 3.3.1 Identification of Select Isolates Isolate M132 was identified as Curtobacterium herbarum, M175 as Paenibacillus taichungensis, M259 as Plantibacter flavus, and M267 as Rhizobium selenitireducens. Isolate M112, which was excluded from growth promotion analysis due to bacterial growth on the medium, was identified as Clavibacter michiganensis. Species identities of select isolates are shown in Table 3.1.

Table 3.1: Species identities of select endophytes. Isolate Identities were determined by Sanger sequencing purified 16S rDNA and comparing results to those in GenBank using NCBI BLAST.

Isolate code Closest match Identity, cover (%) GenBank accession number

M112 Clavibacter michiganensis 98, 98 N/A M132 Curtobacterium herbarum 99, 96 SUB4491165 M132 MH843493 M175 Paenibacillus taichungensis 97, 99 SUB4491165 M175 MH843494 M251 Plantibacter flavus 100, unknown N/A

M259 Plantibacter flavus 96, 98 SUB4491165 M259 MH843495 M267 Rhizobium selenitireducens 98, 94 SUB4491165 M267 MH843496

3.3.2 Select In Planta Tests

Inoculation with five of the selected endophytes (M122, M175, M251, M259, and M267) generally improved plant growth compared to uninoculated control plants. Most inoculated plants, particularly those inoculated with M251 and M259, appeared fuller with larger leaves than control plants. Growth benefits by endophytes were most visible at the end of the growth period (21 DAI), though they can also be seen at 14 DAI in plants inoculated with M132, M251, and M259. Variation was notable between plant replicates from the same treatment, particularly for uninoculated control plants and plants inoculated with M175 and M267. Photographs of the shoots of Arabidopsis plants inoculated with five of the select endophytes (M122, M175, M251, M259, and M267) are shown in Figure 3.2, while scanned images of roots are shown in Figure 3.3.

Figure 3.2: Photographs of Arabidopsis plants inoculated with select endophyte isolates at 7, 14, and 21 DAI. Plants that had six leaves of fewer at 21 DAI were excluded from analysis.

Inoculation with M112 and the bacterial consortium stunted the growth of most Arabidopsis plants. These two treatments were ultimately excluded from statistical analysis due to a lack of usable replicates and bacterial growth present on the media. Photographs throughout the

27 growth period of Arabidopsis plants inoculated with M112 and the consortium are shown in Figure 3.4.

Figure 3.4: Photographs of Arabidopsis plants inoculated with M112 and the bacterial consortium at 7, 14, and 21 DAI. Plants from both treatments were excluded from analysis.

Effects of select endophytes on Arabidopsis fresh biomass and shoot growth - no sucrose Inoculation with all isolates except for M267 resulted in significant improvement in biomass and/or shoot growth. The greatest beneficial effects were seen in plants inoculated with M251: they showed significant improvement in fresh biomass (4.7x increase over controls, p<0.001), number of leaves (p<0.01), and number of buds (p<0.05) compared to control plants. Significant increases in growth were also seen in plants inoculated with M259 for number of leaves (p<0.05) and biomass (3.3x increase, p<0.05), M132 for number of leaves (p<0.05) and biomass (2.9x increase, p<0.05), and M175 for number of leaves (p<0.05) and buds (p<0.05). Although the stem height and number of flowers were considerably greater for all endophyte treatments than control plants, the differences were not found to be statistically significant. The effects of select isolates on shoot growth and fresh biomass for Arabidopsis plants grown without sucrose are shown in Table 3.2 and Figure 3.5 respectively.

Table 3.2: Effects of endophyte inocula on shoot growth for Arabidopsis plants grown in MS media without sucrose. Numbers represent mean ± standard deviation at 21 DAI. Significant

28 improvement over control plants is noted by one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Treatment Number of leaves Stem height (cm) Number of buds Number of flowers

Control (n=8) 10.0±2.0 24.3±28.3 3.9±3.3 0.5±0.8

M132 (n=8) 13.5±1.4* 45.0±19.0 9.0±2.0 1.4±1.1

M175 (n=6) 13.2±3.1* 48.0±34.4 9.0±5.4* 1.8±1.6

M251 (n=6) 14.5±2.1** 41.3±13.7 10.3±2.7* 1.3±1.0

M259 (n=7) 13.9±3.2* 29.3±24.2 8.7±4.9 0.9±1.1

M267 (n=7) 11.4±10.5 34.4±34.1 7.0±6.0 1.3±1.4

Effects of select endophytes on Arabidopsis root growth - no sucrose Inoculation with all five isolates resulted in improved root growth. Inoculation with M251 had the greatest effect, increasing total root length by 5.8 times (p<0.001), and root tip abundance by 3.9 times (p<0.001) over control plants. Significant improvements in Arabidopsis root growth were also seen from inoculation with M132 (4.1x increase in total root length, p<0.01; 3.4x increase in root tip abundance, p<0.01), M175 (3.5x increase in root tip abundance, p<0.01), M259 (3.6x increase in total root length, p<0.05; 2.5x increase in root tip abundance, p<0.05), and M267 (4.1x increase in total root length, p<0.05; 2.9x increase in root tip abundance, p<0.05). The effects of select inocula on Arabidopsis total root length and root tip abundance when growth without sucrose are shown in Figures 3.6 and 3.7 respectively.

Effects of select endophytes on Arabidopsis fresh biomass and shoot growth - with 1% sucrose Two endophytes stood out as the most beneficial for improving shoot growth of plants grown with sucrose: M132 and M259. M132 showed significant increases in stem height (p<0.01), buds (p<0.01), flowers (p<0.05), and fresh biomass (3.7x increase, p<0.05). M259 significantly increased fresh biomass by 4.1x (p<0.01), number of buds (p<0.05), and number of leaves (p<0.05). M267 also significantly increased fresh biomass (3.7x increase, p<0.01), number of buds (p<0.05), and number of leaves (p<0.05) over control plants. Despite its effectiveness seen in plants grown without sucrose, M251 only significantly increased the number of leaves (p<0.05) for plants grown with sucrose. Data on the effects of endophytes on Arabidopsis shoot growth and fresh biomass when grown in media with sucrose are displayed in Table 3.3 and Figure 3.8 respectively.

Treatment Number of leaves Stem height (cm) Number of buds Number of flowers

Control (n=5) 11.0±1.9 29.0±25.3 6.0±3.5 0.8±0.8

M132 (n=3) 16.0±1.0* 90.0±7.2** 15.3±1.5** 3.7±0.6*

M175 (n=4) 8.5±1.7 22.3±22.6 3.3±2.8 0.8±1.0

M251 (n=4) 15.25±2.5* 49.5±38.1 11.0±5.6 1.8±2.2

M259 (n=4) 16.0±4.2* 62.0±2.9 13.0±4.7* 2.5±0.6

M267 (n=4) 15.5±1.9* 55.3±16.4 12.8±1.7* 2.0±1.4

Figure 3.8: Effects of endophyte inocula on fresh biomass 21 DAI for Arabidopsis plants grown in MS media supplemented with 1% sucrose. Dots represent means for each treatment. The

32 horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Effects of select endophytes on Arabidopsis root growth - with 1% sucrose Significant improvements in total root length were observed for plants inoculated with M259 and M267 (both 4.6x increase, p<0.01) as well as M132 (4.2x increase, p<0.05). Significant improvements in root tip abundance were seen in plants inoculated with M132 (3.2x increase, p<0.01), M259 (2.4x increase, p<0.05), and M267 (3.0x increase, p<0.01). Data for total root length and root tip abundance are shown in Figures 3.9 and 3.10 respectively.

Overall, the effects of different treatments on Arabidopsis growth were considerably different when plants were grown with and without sucrose. Plants inoculated with four of the treatment groups (Control, M132, M259, and M267) generally grew better in media containing sucrose, while plants inoculated with the other two treatments (M175, M251) grew better in media without sucrose. The effects of sucrose on fresh biomass, total root length, and root tip abundance for each treatment are summarized in Figure 3.11.

3.3.3 Plant Beneficial Genes in Plantibacter flavus strain 251 Seventy-nine genes with potential plant beneficial effects were discovered in eleven different metabolic pathways present in the genome of M251. Of these 79 genes, the most noteworthy in terms of direct plant growth promotion were auxin and cytokinin biosynthesis, ACC deaminase production, and carotenoid and flavonoid biosynthesis genes. The majority of genes identified (50/79) were involved in siderophore production and various antibiotic production pathways, while genes for the degradation of two hydrocarbons, naphthalene and toluene, were also found. Beneficial gene products found in the annotated genome of P. flavus strain 251 are described in Table 3.4.

Table 3.4: Plant beneficial traits found from annotating and searching the genome of Plantibacter flavus strain 251 with RAST and PATRIC.

Plant benefit Metabolic pathway Number of Annotation genes present program used

Phytochemicals Carotenoid biosynthesis 5 PATRIC

Flavonoid biosynthesis 3 PATRIC

Phytohormones Auxin biosynthesis 6 RAST

Cytokinin biosynthesis 1 PATRIC

Stress tolerance ACC deaminase 1 PATRIC production

Pathogen protection/iron Siderophore biosynthesis 27 RAST uptake

Pathogen protection Tetracycline biosynthesis 4 PATRIC

Penicillin biosynthesis 8 PATRIC

Streptomycin biosynthesis 11 PATRIC

Hydrocarbon degradation Naphthalene degradation 9 PATRIC

Toluene degradation 4 PATRIC

3.4 Discussion Select in planta tests - differences between sucrose and no sucrose results Inoculation of Arabidopsis with the five select endophytes generally resulted in improved growth. This was expected since the isolates were selected based on their growth-promoting potential seen during the in planta screening tests conducted in Chapter 2. However, when comparing results for Arabidopsis plants grown in media supplemented with 1% sucrose versus plants grown in media without sucrose, noticeable differences were seen within treatments. The addition of sucrose to growth media generally improves plant growth (de Faria et al. 2004), however this was not seen for plants inoculated with isolates M175 (Paenibacillus taichungensis) and M251 (Plantibacter flavus). It seems likely that both of these bacteria can utilize sucrose, as P. flavus strain 251 contains the sucrose-6-phosphate hydrolase gene (data not shown) and strains of Paenibacillus, such as P. polymyxa, have been grown on media containing sucrose as the sole carbon source (Choi et al. 2008). A well-known concept is

36 carbon catabolite repression, where the uptake of one carbon source by bacteria represses pathways for the uptake of other carbon sources (Deutscher 2008). The activation of sucrose pathways could potentially repress other pathways, such as those involved in plant growth promotion, in a similar manner, though further testing would be required to prove this. Another possibility could be that these strains degraded sucrose in the media before it could be beneficial for plant growth.

A difference in the experimental methods between growth with and without sucrose was the number of biological replicates, as twice as many plant replicates were used for growth without sucrose than growth with sucrose (eight replicates versus four or five replicates). The lack of replicates for sucrose experiments meant that any outliers in a treatment group would have a stronger impact on significance calculations. Because of the difference in replicate numbers, the non-sucrose growth results were thought to be more reliable than the sucrose results and were therefore taken into greater consideration.

Plant growth promotion by Plantibacter flavus For the in planta tests with select endophytes, the largest and most developed Arabidopsis plants in terms of shoot growth were generally those inoculated with the two strains of Plantibacter flavus (M251 and M259). When looking at the root data for plants inoculated with P. flavus, it is interesting to note that both strains significantly increased the abundance of root tips in addition to total root length. Root tip abundance was measured because it gives an indication of lateral root production - plants with more root tips should contain more lateral root formations. Lateral roots are important for facilitating nutrient and water uptake by increasing root surface area and improving plant anchorage into the ground (Nibau et al. 2008). Although the growth rate of lateral roots is dependent on environmental factors, it is also stimulated by auxins (Overvoorde at al. 2010). Based on these results we can conclude that these two strains of Plantibacter flavus provide direct benefits for Arabidopsis shoot growth, total root length and lateral root production.

Bacteria of the genus Plantibacter have been found in association with a variety of plants, including the phyllosphere of grasses (Behrendt et al. 2002), the endosphere of yarrow, goldenrod, dactylis and clover (Lumactud et al. 2016), and the rhizosphere of wheat (Costerousse et al. 2018), maple sap (Lagace et al. 2004), and rye flakes (Herranen et al. 2010). There is indirect evidence in literature that P. flavus may provide benefits for plant

37 growth: strains have been seen to solubilize zinc in soil, making it accessible for plants (Costerousse et al. 2018) and degrade hydrocarbon contaminants (Lumactud et al. 2016) which could improve plant survival in polluted environments. However, prior to this study there was a lack of evidence for direct plant growth promotion by Plantibacter species, making this finding a novel discovery.

The search for plant beneficial genes was conducted to discover possible explanations for the observed direct plant growth-promoting ability of P. flavus strain 251 on Arabidopsis. Genes potentially responsible for direct plant growth promotion included carotenoid biosynthesis, ACC deaminase production, cytokinin biosynthesis, and auxin biosynthesis genes. In general, one of the largest contributors to microbial plant growth promotion is often found to be increased auxin production (Asghar et al. 2002; Khalid et al. 2004; Dobbelaere et al. 1999). This makes sense since auxins play important roles in stimulating plant growth and development throughout all cell types (Su et al. 2011). Increased cytokinin production has also shown to improve plant growth through increased root development, increased stomatal activity, and inhibition of senescence (Salisbury and Ross 1992; de Garcia Salamone et al. 2005). Carotenoid production can also benefit plant growth through increased photosynthesis (Nisar et al. 2015), though its benefits are less documented than those of auxins or cytokinins. ACC deaminase functions to improve plant growth in stressful environments. For the growth experiments, the growth environment was intended to be relatively stress-free; however based on the small size and appearance of some of the control plants, the growth environment may not have been as favourable as it was intended. If this was the case, it is also possible that ACC deaminase production contributed to plant growth promotion, though it is difficult to determine if this was true. Overall, the most likely mechanisms contributing to direct plant growth promotion by Plantibacter flavus strain 251 appear to be auxin and cytokinin production.

An interesting observation from the genome search was the large number of siderophore and antibiotic production genes present. As mentioned in Chapter 1.3, siderophores can indirectly impede the colonization of competing pathogens in the plant endosphere by out-competing them for available iron and antibiotics can directly kill pathogens. The presence of genes from these two classes suggests that P flavus strain 251 could play a role in plant pathogen protection. The presence of multiple hydrocarbon degradation genes and ACC deaminase suggests that P. flavus strain 251 would be particularly beneficial for improving plant survival in environments with high amounts of hydrocarbon contamination. Since P. flavus strain 251 was

38 originally isolated from the sampling site in Oil Springs, it seems likely that it played a role in improving plant tolerance to hydrocarbon contamination at Oil Springs. Overall, the variety of beneficial genes found in P. flavus strain 251 indicate that it could provide an array of benefits for plants, including improved phytochemical and phytohormone production, pathogen protection, and tolerance to different stresses.

Bacteria of the genus Plantibacter are classified as members of Microbacteriaceae, which is a family that contains many other genera that are commonly found living in association with plants. Within Microbacteriaceae, Plantibacter is most closely related to the genus Okibacterium, followed by Microbacterium (Evtushenko and Takeuchi 2006). Strains of both of these genera have been discovered inside the plant endosphere (Wang et al. 2015; Zinniel et al. 2002), with certain strains of Microbacterium having also been identified as plant growth promoters (Karlidag et al. 2007; Sheng et al. 2008; He et al. 2010). Another closely related genus is Curtobacterium, which is a genus that includes known plant pathogens such as C. flaccumfaciens pv. flaccumfaciens (Agarkova et al. 2012; Soares et al. 2013) in addition to plant growth promoters such as C. flaccumfaciens strain E108, C. albidum, and C. herbarum (Cardinale et al. 2015; Vimal et al. 2018; Diez-Mendes and Rivas 2017). The similarity of Plantibacter to other known plant growth-promoting genera suggests that other strains of Plantibacter, along with the two discovered in this study, are also likely to provide benefits for plant growth.

Plant growth promotion by non-Plantibacter select isolates The other three isolates (M132, M175, and M259) also stimulated Arabidopsis growth. Inoculation with M132 (Curtobacterium herbarum) improved both root and shoot growth. As previously mentioned, Curtobacterium strains have been noted as both plant pathogens and plant growth promoters. Examples of plant growth promotion by Curtobacterium include improving rice and barley salinity tolerance (Cardinale et al. 2015; Vimal et al. 2018), increasing saffron yield (Diez-Mendes and Rivas 2017), and protecting against the plant pathogen Pseudomonas syringae (Barriuso et al. 2008). Inoculation with M175 (Paenibacillus taichungensis) was especially beneficial for Arabidopsis shoot growth. Similar examples of plant growth promotion by Paenibacillus species have been noted in previously laboratory (de Souza et al. 2014) and field studies (Furnkranz et al. 2012; Ker et al. 2012). Conserved plant beneficial genes, including those for phosphate solubilization, auxin production, and nitrogen fixation, have also been seen throughout different strains of Paenibacillus (Xie et al. 2016). Inoculation with

M267 (Rhizobium selenitireducens) increased Arabidopsis total root length and root tip abundance. Bacteria of the genus Rhizobium are typically associated with the nitrogen fixation process in root nodules of leguminous plants. However, they have also been observed to improve the growth of non-legumes, such as peppers and tomatoes, and produce plant benefits like auxins and siderophores (Garcia-Fraile et al. 2012). This study provides further evidence that strains of Curtobacterium, Paenibacillus, and Rhizobium can provide direct plant growth benefits.

Arabidopsis core microbiome The largest study which examined the Arabidopsis core microbiome was conducted by Lundberg et al. (2012) and was focused on characterizing the prevalence of different bacterial phyla in the rhizosphere and root endosphere. They generally found a large number of core microbes from the phyla Actinobacteria and Proteobacteria. Looking at the select plant growth promoting strains, Plantibacter and Curtobacterium species are members of the Actinobacteria phylum while Rhizobium species are members of the Proteobacteria phylum (specifically α- proteobacteria). Based on this information, it is possible that some of these microbes could already be associated with the Arabidopsis core microbiome. It would be interesting to determine if this is true, and to also determine if these beneficial endophytes become integrated into the Arabidopsis core microbiome after inoculation.

Differences in methodology for screening and select in planta tests The methods for GA-7 box tests were altered from those used in microtiter plate tests (Chapter 2) to improve their reliability and replicability. For microtiter tests sterilized seeds were inoculated with endophytes while in select tests sterilized seeds were first germinated, then the seedlings were inoculated with endophytes. The reason behind this change was to create more consistent replicate numbers for each treatment. Throughout the microtiter tests, a small percentage of Arabidopsis seeds (approximately 15%) did not germinate, often resulting in inconsistent replicate numbers for treatments. Germinating the seeds before inoculation would filter out these “dead” seeds from the experiment, leading to more consistent replicate numbers for each treatment. Endophyte inoculation times were also shortened for the select in planta tests (30 minutes compared to 2 hours). This was adjusted since seedlings were inoculated instead of seeds. Seedlings contain stomata by which microbes can enter the endosphere (Frank et al. 2017) and lack the protective outer coat found in seeds, making it likely that bacteria would be able to enter seedlings faster than seeds. Another difference between the

40 methods was the available space for plant growth: GA-7 boxes provided much more space for plant growth than small microtiter wells. Although available space in natural environments can vary, the small amount of space in the screening tests seemed like it would be particularly constraining. One more difference was that the cell concentrations of bacterial cultures were adjusted in the GA-7 box tests so that they were approximately even for all treatments, while they were not adjusted for the microtiter plate tests. Differences in cell density can have a large impact on the effects of microbes towards plant growth - in some instances, increases in cell density can cause beneficial microbes to act pathogenic towards plants (Kloepper et al. 2013).

Summary of direct plant growth promotion Overall, direct plant growth promotion was evident throughout the collection of endophytes. Two of the strongest plant growth promoters were strains of Plantibacter flavus, which substantially increased Arabidopsis shoot growth, root growth, and overall biomass. Many plant growth- promoting genes were found in the genome of Plantibacter flavus strain 251, including genes for auxin and cytokinin production, ACC deaminase production, and siderophore biosynthesis, suggesting that it could have potential for future usage in biofertilizers.

Chapter 4

Effects of Bacterial Endophytes on Plant Nitrogen Acquisition

4.1 Introduction Nitrogen is required for most plant cellular processes, as it is a major component of macromolecules like DNA and proteins. To obtain nitrogen, plants must uptake it from soil through their roots, followed by assimilation and translocation throughout all plant tissues. However, many soils worldwide are low in nitrogen content, as nitrogen limitation is the most common constraint for crop growth (Alori et al. 2017). One of the largest potential sources of nitrogen in soil is from the atmosphere in the form of dinitrogen gas. However, the strong triple bond between nitrogen atoms in dinitrogen gas makes it fairly inert and not directly usable for plants (Galloway et al. 2004). Atmospheric nitrogen must therefore first be converted to alternative forms before it can be taken up by plants.

Nitrogen fixation is the process that transforms atmospheric nitrogen gas into useable forms. There are three main methods of nitrogen fixation: industrially via direct reduction of nitrogen using hydrogen, abiotically via lightning formation, and biotically via capable microbes called diazotrophs. Abiotic nitrogen fixation converts dinitrogen gas directly into nitrates while both industrial and biotic nitrogen fixation converts dinitrogen gas into ammonia, which can subsequently be converted into nitrates by nitrifying microbes (Galloway et al. 2004). Ammonia and nitrates can both be assimilated into plants through their roots and used for cellular processes, though certain plants prefer ammonia over nitrates and vice versa (Forde and Clarkson 1999).

Since lightning does not occur on a consistent basis, the most biologically-important natural source of usable nitrogen is created through diazotrophic nitrogen fixation. Diazotrophs can be divided into two subgroups: symbiotic diazotrophs, which commonly fix nitrogen in symbiotic relationships with leguminous plants, and free-living diazotrophs, which fix nitrogen without requiring an association with plants. Most symbiotic diazotrophs associate with the roots of leguminous plants, forming nodules wherein they fix nitrogen. The nodule environment is controlled and maintained by the plant, allowing it to create a favourable anaerobic environment for nitrogen fixation (Franche et al. 2009). The plant-diazotroph relationship is mutualistic, as diazotrophs provide the plant with usable nitrogen while the plant provides diazotrophs with

42 energy sources. Symbiotic diazotrophs are typically rhizobacteria, with common genera being Rhizobium, Sinorhizobium, and Frankia (Franche et al. 2009). In contrast, free-living diazotrophs fix nitrogen independently, allowing for nitrogen fixation in a variety of different regions like aquatic systems, bulk soil, and the plant rhizosphere and endosphere. Unlike nodules, environments for free-living nitrogen fixation are not optimized for the fixation process, so the rate of free-living nitrogen fixation is generally much slower than that of symbiotic fixation (Franche et al. 2009). A wide variety of different bacteria have been observed as free-living diazotrophs, with some of the more well-known microbes being Azotobacter, Azospirillum, Bacillus, Kelbsiella, and cyanobacterial species (Franche et al. 2009).

The biological nitrogen fixation process is catalyzed by the enzyme nitrogenase. Nitrogenase is composed of two major subunits: dinitrogenase, which reduces dinitrogen gas to ammonia using electrons, and dinitrogenase reductase, which transfers electrons to dinitrogenase using energy from ATP (Burgess and Lowe 1996). The dinitrogenase subunit is encoded by the genes nifD and nifK while the dinitrogenase reductase subunit is encoded by the gene nifH (Stacey et al. 1992). The dinitrogenase subunit can vary within different types of nitrogenases, as its core can contain molybdenum, vanadium, or iron (Burgess and Lowe 1996); however the dinitrogenase reductase subunit is strongly conserved across all types of nitrogenase (Raymond et al. 2004). Due to this conservation, nifH is the gene most commonly tested for when identifying the presence of nitrogenase genes in microbes. Nitrogenase activity is strongly inhibited by oxygen, so the enzyme requires anaerobic or microaerophilic environments in order to function (Wong and Burris 1972).

The purpose of the experiments described in this chapter were to determine if bacterial endophytes from the collection are capable of fixing nitrogen and transferring the resulting usable nitrogen to plants. Nitrogen acquisition was chosen for examination because of its relevance to agricultural crop growth. To understand the roles of endophytes in plant nitrogen acquisition, endophytes were first examined individually to see if they were capable of nitrogen fixation, then nitrogen fixers were examined in association with Arabidopsis plants in a nitrogen- limiting environment.

4.2 Materials and Methods 4.2.1 nifH PCR 282 endophytes from the collection were screened for nitrogen fixation potential using PCR. Isolates were streaked from glycerol stock cultures onto R2A or TSA plates, which were incubated at 30℃ for 4 days. Isolated colonies were suspended in a microcentrifuge tube with 100µl sterile water. Tubes were then heated in a 95℃ water bath for 7 minutes to allow for complete lysis of cells. Lysates of each endophyte were used as templates in the PCR reaction. The PCR protocol was as follows: 20µl total volume consisting of 10µl HotStarTaq Plus Master Mix, 1µl hqf primer, 1µl hqr primer, 7µl sterilized distilled water, and 1µl lysate template. A positive control, which used a lysate of the known nitrogen fixer Sinorhizobium meliloti (Meilhoc et al. 2010) as the template, and a negative control, which used water as the template, were also included. The primers used (forward - TAYGGNAARGGBGGYATHGG; reverse - GGCATNGCRAADCCDCCRCA) had previously been optimized by Tony Qian to correspond to conserved regions of nifH (Qian 2014). The locations of the primers in relation to nifH are shown in Figure A1. DNA was amplified using the BioRad S1000 Thermal Cycler with the following settings: initial denaturation at 95℃ for 5 minutes, followed by 35 cycles of denaturation at 95℃ for 1 minute, annealing at 51℃ for 1.5 minutes, and extension at 72℃ for 1 minute, and finishing with a final extension at 72℃ for 10 minutes. Amplified DNA was separated via gel electrophoresis through a 1% agarose gel and examined under UV light for bands approximately 400 base pairs in length.

4.2.2 Growth in Nitrogen-Free Medium Endophytes which were potentially positive for nitrogen fixation (i.e. showed amplicons of 400 base pairs) were tested for free-living nitrogen fixation ability using a selective and differential nitrogen-free medium. Forty-nine endophytes were inoculated into 15 mL test tubes containing 10 mL semi-solid nitrogen-free medium (recipe in Table A1). Bacterial inoculation was performed by touching a pure colony with an inoculation needle and stabbing approximately 2 centimetres into the centre of the nitrogen-free medium. A negative control (no inoculum) and positive control (S. meliloti) were also included. Tubes were incubated at 28°C for 7 days to allow for sufficient bacterial growth. A colour change from blue to yellow in the medium was considered a positive result for free-living nitrogen fixation. The presence of a cloudy ring in the medium, indicating an area of high turbidity, was also recorded, and the locations of rings in the

44 media were recorded by measuring the distance from the top of the ring to the surface of the medium.

4.2.3 Nitrogen-Limiting In Planta Tests Endophytes which were free-living nitrogen fixers were examined for their ability to improve Arabidopsis nitrogen uptake. Arabidopsis seeds were surface sterilized and germinated as described previously for in planta select tests (see Chapters 2.2.2 and 2.2.4). Seedlings were aseptically removed from the medium and inoculated with bacteria by soaking them in 0.25X TSB broth cultures for approximately 20 minutes. Treatments included a negative control (sterile 0.25X TSB), positive control (S. meliloti), eight individual bacterial treatments (isolate codes M122, M141, M173A, M175, M178, M207, M212, and M247), and two consortia (consortium #1: equal volumes of isolates M122, M141, M173A, and M175; consortium #2: equal volumes of isolates M178, M207, M212, and M247). To ensure relatively even cell densities, all bacterial cultures were adjusted to an OD600 between 0.2 and 0.3 before seedling inoculation.

Inoculated seedlings were transferred to 24-well microtiter plates containing nitrogen-free Murashige and Skoog medium (purchased from bioWORLD) with an agar concentration of 2%. Each plate contained four different treatments with six plant replicates each. Lids were raised using plastic extenders and sealed tightly with parafilm, then plates were incubated under the 16h/8h light source at room temperature. Plant growth observations and plate photographs were taken at seven and thirteen DAI.

4.3 Results 4.3.1 nifH PCR Of the 282 isolates that were screened for nifH, 73 isolates (26%) contained a band approximately 400 base pairs in length, signifying that they potentially contained the nifH gene. Nitrogen fixation ability was widespread throughout the collection, as 19 different genera contained at least one nitrogen-fixing strain. The most commonly positive genus was Pantoea, with twelve different isolates of the genus showing a positive result. A list of the most prevalent genera producing putative nifH amplicons are listed in Table 4.1.

Table 4.1: List of the most prevalent endophyte genera potentially giving nifH-sized amplicons.

Number of isolates Number of isolates Percent positive Genus positive for nifH negative for nifH

Pantoea 12 3 80

Agrobacterium 7 0 100

Microbacterium 6 22 21.4

Sinorhizobium 6 2 75

Rhizobium 4 2 66.7

Stenotrophomonas 4 11 26.7

Plantibacter 3 10 23.1

Pseudomonas 3 10 23.1

Xanthomonas 3 2 60

Bacillus 2 22 8.3

4.3.2 Growth in Nitrogen-Free Medium Of the 49 nifH-containing endophytes that were examined for free-living nitrogen fixation, inoculation with 39 (80%) resulted in a colour change in the medium from blue to yellow, indicating that they were free-living diazotrophs. These 39 free-living nitrogen fixers consisted of microbes from 12 different genera. Similar to nifH results, the most prevalent genera for free- living nitrogen fixation was Pantoea, with five isolates showing a positive result. A list of the most prevalent genera testing positive for free-living nitrogen fixation are listed in Table 4.2.

Table 4.2: List of the most prevalent endophyte genera showing a positive result for free-living nitrogen fixation in test tube assays.

Number of isolates Number of isolates Percent positive positive for free-living negative for free- Genus nitrogen fixation living nitrogen fixation

Pantoea 5 0 100

Microbacterium 4 1 80

Xanthomonas 3 0 100

Agrobacterium 3 1 75

Stenotrophomonas 3 1 75

Plantibacter 2 0 100

Sinorhizobium 2 0 100

Rings of high turbidity were observed for 10 of the 39 isolates positive for free-living nitrogen fixation. Ring location in the medium varied, ranging from 0.5 cm to 3.5 cm below the surface. An image showing a turbidity ring in one of the tubes is shown in Figure 4.1.

Figure 4.1: Image of nitrogen-free medium containing a ring of high turbidity (indicated by the red arrow).

4.3.3 Nitrogen-Limiting In Planta Tests No noticeable differences were seen between all treatments, including negative and positive controls, throughout the growth period. As shown in Figure 4.2, plants appeared stressed (i.e. wilted and light green in colour) and exhibited stunted growth (i.e. all plants had four or fewer leaves) after thirteen DAI.

Growth statistics were not measured after 13 DAI due to the poor condition of all plants.

4.4 Discussion Results from the nifH PCR and nitrogen-free media growth tests successfully showed that nitrogen fixation is widespread throughout the endophyte collection. As previously mentioned, there was a large variety of different genera in the collection capable of nitrogen fixation. Looking back a step further, diazotrophic microbes in the collection were also widespread between families: endophytes potentially positive for nifH were classified as members of ten different families, while endophytes positive for free-living nitrogen fixation were classified as members of seven different families. A possible explanation for the large variety of nitrogen fixing bacteria is that nitrogen fixation genes can be transferred horizontally between different organisms. When looking through the literature, genes for nitrogen fixation, including nifH, have been found both chromosomally and on mobile elements such as plasmids (Okubo et al. 2016; Riedel et al. 1983). Microbes carrying plasmids containing nitrogen fixation genes can transfer these genes horizontally to other compatible microbes via conjugation. Since microbes do not have to be of the same species for plasmid transfer to occur, conjugation can result in the spread of plasmid genes into many different species depending on the incompatibility group of the plasmids. This therefore supports the idea that the large variety of nitrogen fixers is due to horizontal transfer of nitrogen fixation genes.

Although many different genera were shown to be capable of nitrogen fixation, the most consistent nitrogen-fixing genus throughout the collection was Pantoea, with most of these isolates being Pantoea agglomerans. This study is not the first to identify Pantoea as a nitrogen-

48 fixing bacterium: free-living nitrogen-fixing strains of Pantoea have been identified from many different plants, such as the endospheres of sugarcane (Loiret et al. 2004) and sweet potato (Asis Jr. and Adachi 2003) and the phyllosphere of winter wheat (Ruppel and Merbach 1995). Pantoea is a functionally diverse genus in terms of its relationship to plants: some strains have been observed as plant pathogens, causing wilt and necrosis in agricultural crops, while other have been described as promoters of plant growth by producing IAA and cytokinins (Walterson and Stavrinides 2015; Dutkiewicz et al. 2016). Because of this functional diversity, it is difficult to infer if nitrogen-fixing strains of Pantoea are benefiting plant nitrogen uptake without examining their interactions in planta.

Aside from Pantoea, other prevalent free-living nitrogen fixing endophytes included Microbacterium, Xanthomonas, Agrobacterium, and Stenotrophomonas species. Of these genera, Agrobacterium is the most well-known free-living diazotroph, with the type species Agrobacterium tumefaciens having been identified as a diazotroph almost 30 years ago (Kanvinde and Sastry 1990), though examples of the other three genera as free-living diazotrophic endophytes have been observed (Puri et al. 2017; Reinhardt et al. 2008; Taule et al. 2011). Similarly to Pantoea, certain species of Agrobacterium and Xanthomonas (A. tumefaciens and X. gardneri) are known as plant pathogens (James and Olivares 1998; Goodner et al. 2001), meaning that in planta tests would be required to directly show their effects on plant growth and nitrogen uptake.

In order to improve plant nitrogen acquisition via nitrogen fixation, microbes in the endosphere must be capable of fixing nitrogen independently (i.e. free-living nitrogen fixation). Many microbes that can fix nitrogen symbiotically are also capable of free-living nitrogen fixation. These symbiotic nitrogen fixers contain regulatory genes that can repress free-living or symbiotic fixation genes under appropriate situations. An example of this is seen in Sinorhizobium meliloti, where the ntrC gene is responsible for this regulation process (Szeto et al. 1987). For the methods conducted, the nifH PCR should identify both symbiotic and free- living diazotrophs due to the strong conservation of the nifH gene, while the nitrogen-free media growth tests should only identify free-living diazotrophs. Many endophytes that demonstrated free-living nitrogen fixation were microbes that are traditionally thought of as symbiotic nitrogen fixers, such as Rhizobium and Sinorhizobium species. The growth of these bacteria in the nitrogen-free medium can be explained by the presence and regulation of genetic pathways for both types of nitrogen fixation.

The nifH PCR and nitrogen-free media growth tests were useful for determining which endophytes in the collection were capable of nitrogen fixation (i.e. qualifying nitrogen fixation) but they were not useful for determining the amount of nitrogen fixation by each endophyte (i.e. quantifying nitrogen fixation). Quantifying nitrogen fixation would be useful because it would give a better idea as to which endophytes were the most beneficial for increasing plant nitrogen uptake. The most commonly used method for quantifying nitrogen fixation is the acetylene reduction assay. During the acetylene reduction assay, cultures of nitrogen-fixing microbes are provided with equal amounts of acetylene gas. Since acetylene contains a similar triple bond structure to dinitrogen gas it acts as a suitable substrate for nitrogenase, allowing the enzyme to cleave it into ethylene (Koch and Evans 1966). Levels of ethylene in each culture are then measured by gas chromatography/mass spectrometry to determine the rate of nitrogenase activity, with higher amounts of ethylene indicating greater nitrogenase activity. Conducting the acetylene reduction assay on the nitrogen-fixing endophytes in the collection would be a logical next step towards improving the understanding of the effects of these bacterial endophytes on plant nitrogen acquisition.

The nitrogen-free in planta growth tests were conducted to discover if nitrogen-fixing endophytes were improving growth of plants by providing them with usable nitrogen. The lack of success by the nitrogen limiting in planta tests made it unclear if this was occurring. Two possible explanations for the failed in planta tests are that the experimental setup was flawed or that the hypothesis is simply incorrect and these nitrogen fixing microbes are not providing nitrogen to their associated plants. Of these possibilities, I believe that the most likely explanation is that the methods were flawed. Firstly, there is a multitude of evidence of free- living diazotrophic bacteria improving plant nitrogen uptake in literature (Urquiaga et al. 1992; Garcia de Salamone 1996; Hurek et al. 2002), leading me to believe that the microbes in this collection are also capable of this. Secondly, when examining the methods there are some plausible reasons as to why the experiment did not work: 1. Aerobic environmental conditions: As mentioned in section 4.1, nitrogen fixation functions best in microaerophilic environments. After seedling inoculation, nitrogen-fixing bacteria would be present on the surface of and inside plants, both of which are aerobic environments. The excessive amounts of oxygen would likely inhibit nitrogenase function.

2. Sub-optimal plant development stage: The methods were focused on nitrogen acquisition via nitrogen fixation during the early stages of Arabidopsis growth; however microbial nitrogen fixation has been seen to be a more prominent source of nitrogen during later stages of plant growth (Jensen 1986; Hamawaki and Kantartzi 2018) 3. Insufficient nitrogen production: In natural environments there are typically many different nitrogen-fixing microbes, as well as a variety of other nitrogen sources available. The Arabidopsis plants grown in this experiment were entirely reliant on the inoculated microbes to provide them with nitrogen. If inocula concentrations were insubstantial, then the amount of ammonia produced through nitrogen fixation may have been too minimal to have a noticeable effect on plant growth.

Overall, evidence of free-living nitrogen fixation was present throughout a large variety of bacterial endophytes in the collection. Although improved plant nitrogen acquisition by these endophytes was not directly proven, the evidence in literature make it appear likely that bacteria in this collection are beneficial for plant nitrogen uptake.

Chapter 5

Effects of Bacterial Endophytes on Plant Phosphorus Uptake

5.1 Introduction Phosphorus is a necessary element for plant growth, as it is a key component of DNA, cell walls, and ATP (Schachtman et al., 1998). Plants acquire phosphorus from soil through their roots, where it is then transferred to all other tissues. Phosphorus is present in a few different forms in soil, though the vast majority of soil phosphorus (over 99%) exists in mineral form or is bound to soil particles in insoluble, or immobile, forms (Rodriguez et al. 2006; Alori et al. 2017). Phosphorus can only be taken up when it is in a solubilized state, meaning that the largest pool of phosphorus is not directly available to them. Adding more phosphorus to soil through chemical fertilizers can provide temporary benefits but is inefficient, as over 80% of this supplemented phosphorus becomes immobilized by soil particles (Schachtman et al. 1998). Overall, phosphorus limitation is the second most common limitation for crop growth behind nitrogen limitation in temperate ecosystems (Alori et al. 2017).

In order to be assimilated by plants, insoluble and soil-bound phosphates must first be mobilized. The phosphate solubilization process is naturally facilitated by phosphate-solubilizing microbes in the soil through a variety of different mechanisms. The most effective and well- known solubilization mechanism involves the release of organic acids into soil (Alori et al. 2017). These acids reduce soil pH, which releases immobile phosphates from soil molecules (Mohammadi 2012). A wide range of 21 different organic acids are known to facilitate this process, though the organic acid most frequently seen is gluconic acid (Alori et al. 2017). Other mechanisms of phosphate solubilization involve lowering soil pH through the release of inorganic acids, like sulphuric and nitric acid, and the release of certain extracellular enzymes, as well as the production of chelating substances (Alori et al. 2017). Once phosphates are released from soil particles, they are uptaken into plants through their roots, transported throughout all tissue types, and utilized in cellular processes.

As previously mentioned in Chapter 1, some plant associated bacteria in the rhizosphere and endosphere are known to solubilize phosphate. The objective of the experiment in this chapter was to determine which endophytes in the collection were phosphate solubilizers and therefore likely to be benefiting plants with phosphorus uptake.

5.2 Materials and Methods To examine for phosphate solubilization, 249 endophytes from the collection were streaked from pure cultures onto Pikovskaya’s agar (purchased from Sigma). Pikovskaya’s agar was used because it is a well-known medium for identify phosphate-solubilizing bacteria. Plates were incubated at 28°C for 4 days, then examined for a zone of clearance around colonies.

5.3 Results Of the 249 endophytes examined for phosphate solubilization, 105 (42%) showed a positive result. Overall, 16 different genera contained at least one positive isolate for phosphate solubilization. The majority of phosphate solubilizing bacteria (59/105) belonged to six different genera, with the most prevalent genera being Pantoea and Curtobacterium. A list of the most prevalent phosphate-solubilizing genera are listed in Table 5.1.

Table 5.1: Most prevalent endophyte genera testing positive for phosphate solubilization.

Genus Number of isolates Number of isolates Percent positive positive for phosphate negative for phosphate solubilization solubilization

Curtobacterium 12 4 75

Pantoea 11 1 91.7

Pseudomonas 11 2 84.6

Bacillus 9 12 42.9

Plantibacter 8 5 61.5

Microbacterium 8 19 29.6

5.4 Discussion Compared to the nitrogen fixation results (Chapter 4), phosphate solubilization ability was found to be more common throughout bacterial endophytes in the collection (42% positive for phosphate solubilization compared to 26% positive for nifH). A wide range of different bacterial genera from the endophyte collection were found to be capable of phosphate solubilization.

Similar wide ranges of phosphate solubilizing microbes have been seen in literature: examples include a study by Maitra et al. (2015) which identified 10 different phosphate-solubilizing genera from the Oxbow Lakes in India, and a review by Sharma et al. (2013) which summarized 23 bacterial genera and 28 fungal genera that are known phosphate solubilizers. The results from the endophyte collection agree with those from similar studies, providing further evidence that a large variety of plant associated microbes are capable of phosphate solubilization. This large pool of phosphate solubilizing genera can be explained by the flexibility of the solubilization process: having a large variety of different mechanisms for phosphate solubilization makes it more likely that any given bacterium will have the ability to solubilize phosphate.

Throughout the endophyte collection, the most prevalent endophytes positive for phosphate solubilization were Curtobacterium, Pantoea, and Pseudomonas species. These three genera are all well-known phosphate solubilizing soil microbes (Castagno et al. 2011; Sharma et al. 2013; Maitra et al. 2015; Sharon et al. 2016), with Pantoea and Curtobacterium having also been observed as phosphate solubilizing endophytes (Chen et al. 2014; Kandel et al. 2017). These results therefore provide further support for the phosphate solubilization capabilities of these three genera.

As mentioned in section 5.1, phosphate solubilization is an important process for the mobilization of soil phosphates. It may seem surprising then that endophytes are capable of phosphate solubilization, since soil-bound phosphates are only present in the rhizosphere and bulk soil. It is possible that endophytes still can contribute to the solubilization of soil phosphates from the endosphere: since solubilization mechanisms typically involve the release of acidic or chelating substances, these substances could be released from endophytes into the plant, then translocated and released through roots into the rhizosphere, where they could contribute to the solubilization process. Many endophytes originate from the rhizosphere (Kandel et al. 2017), where phosphate solubilization is known to be important. This could also explain the large number of phosphate-solubilizing microbes present in the endosphere.

Similar to the nitrogen fixation tests, the test used to identify phosphate solubilization was a qualitative test. Using Pikovskaya’s agar, it is also possible to obtain a quantitative estimate of the amount of phosphate solubilization for each microbe. This is done by calculating a solubilization index which factors the diameters of the colony and surrounding zone of clearance

(Paul and Sinha 2017). A higher solubilization index is indicative of a stronger phosphate- solubilizing bacterium. Quantifying the amount of phosphate solubilization would give an idea as to which endophytes were providing the greatest benefits for plant phosphorus uptake. Nonetheless, the qualitative results from the endophyte collection successfully showed that a large variety of bacteria in the endosphere are capable of phosphate solubilization.

In contrast to nitrogen fixation methods, in planta tests for phosphate solubilization were not attempted. These in vivo tests would have been useful for providing direct insight to the impacts of phosphate-solubilizing microbes on improving plant phosphorus acquisition. Ultimately, in planta tests were not attempted because of complications in determining a suitable growth medium. To show that microbes improve plant phosphorus uptake through phosphate solubilization, inoculated plants would have to be grown in a medium which has most or all of its phosphorus in insoluble forms. The issue with this is that soils naturally contain soluble phosphorus, while nutrients in artificial plant growth media are entirely solubilized, meaning both options seem unlikely to work. One option that has been used for a growth medium is a combination of washed horticultural sand and tricalcium phosphate (Oteino et al. 2015), however this was used for pea plants (Pisum sativum L.) and it is unknown if Arabidopsis would be able to grow in a similar environment.

In summary, evidence of phosphate solubilization ability was seen in close half of the endophytes examined in the collection. The most frequent phosphate solubilizers were Curtobacterium, Pantoea, and Pseudomonas species, though many other genera were also capable of phosphate solubilization. Although it was not directly shown here, based on other studies it seems likely that these endophytes are important in facilitating plant phosphorus uptake.

Chapter 6 Effects of Bacterial Endophytes on Plant Tolerance to Drought

Stress

6.1 Introduction Due to climate change, osmotic stresses are expected to place greater limitations on crop growth each year (Ngumbi and Kloepper 2016). Water uptake is necessary in plants for cellular respiration and the maintenance of turgor pressure. Limitation of water (i.e. drought stress) creates a hypertonic environment, resulting in an imbalance between solute concentrations in cells and the surrounding environment. In order to maintain osmotic balance, water is forced out of cells into the environment, causing cells to dehydrate and eventually die. Similar situations are seen in salt-stressed environments, where high external solute concentrations create a hypertonic environment, drawing water out from cells and leading to dehydration. For plants, excess water loss can inhibit cell elongation and cell division, ultimately resulting in wilting, reduction in leaf size, stunted growth, and faded leaf colouration (Farooq et al. 2009).

Plants cope with drought stress through many ways over different time scales. In the short term, they can close leaf stomata and decrease leaf size to avoid excess water loss and increase root depth and thickness to access water deep in soil (Farooq et al. 2009). In the long term, plants adapt by shortening their life cycle to escape periods of drought (Farooq et al. 2009). The short- term drought responses are controlled by stress enzymes and hormones. Two of the most important molecules for influencing plant responses to drought stress are ACC deaminase and ABA. ACC deaminase functions in plants by breaking down ACC, a precursor to stress ethylene formation (Glick 2014). Ethylene functions as a stress hormone in plants which modulates the growth of plant tissues in response to a wide variety of stresses, such as drought conditions (Glick 2014). High levels of stress results in the over-production of ethylene, resulting in excessive ethylene concentrations which damages plant tissue through processes like chlorosis and leaf abscission (Glick 2014). Decreases in stress ethylene levels via ACC deaminase have been shown to increase plant growth rate and decrease visible signs of damage in various stressful environments, including drought stress (Glick 2014; Saikia et al. 2018). ABA functions by altering the growth patterns of different tissue types, generally resulting in increased root length and decreased leaf size (Sharp et al. 1994). ABA is also responsible for stomatal closure,

56 aiding in leaf water retention, and the induction of various other water-stress genes (Farooq et al. 2009). These changes are advantageous to plants facing drought stress conditions, as longer roots increase the likelihood of finding water and smaller leaves decrease the amount of water lost through transpiration. When drought stress conditions are present, ABA accumulates in plants, facilitating these changes. Aside from ACC deaminase and ABA, other plant molecules that provide protection against drought stress include some auxins, salicylic acid, and putrescence (Farooq et al. 2009).

As mentioned in Chapter 1.6, the majority of endophytes from the collection were isolated from plants at the Oil Springs site, which was highly stressed in terms of soil hydrocarbon content. Although soil salt content at the site was not measured, it is often found to be high in hydrocarbon-contaminated environments (Emerson and Breznak 1997), suggesting that plants growing at the site at Oil Springs may also have been subjected to salt stress. Since salt stress has similar effects on plant growth to drought stress, endophytes from the collection were thought to potentially play a role in improving plant survival when exposed to drought stress. Therefore, the purpose of the experiments in Chapter 6 were to determine if this was true, and if so, to identify endophytes which were providing these benefits using in planta tests with Arabidopsis.

6.2 Materials and Methods 6.2.1 Selection of Drought Tolerant Endophytes Endophytes were selected for in planta tests based on three criteria: ACC deaminase production, direct plant growth promotion ability, and tolerance to hypertonic environments. Two of the criteria were previously determined: ACC deaminase production was identified by Rhea Lumactud using PCR with primers corresponding to the ACC deaminase gene acdS (Blaha et al. 2006), while direct plant growth promotion ability was previously examined (Chapters 2 and 3). To determine their ability to tolerate hypertonic environments, a subset of 18 endophytes were inoculated into TSB containing total NaCl concentrations of 3, 6, 9, and 12%. Positive controls (TSB with standard NaCl concentration) and negative controls (NaCl-supplemented TSB with no inocula) were included to confirm reliability of the methods. All treatments and controls were incubated at 28°C and 128 rpm for 2 days, then cultures were observed for turbidity in the growth medium, indicating bacterial growth.

6.2.2 Drought Stress In Planta Tests Arabidopsis seeds were surface sterilized as described in Chapter 2.2.2. Sterilized seeds were sown onto plates containing 0.5X MS agar and stored at 4°C for 3 days to allow for seed stratification, then transferred under a FloraLight 12h/12h day-night light source at room temperature to allow for growth. After four days, seedlings were removed using forceps and transplanted into in 59 mL plastic cups containing autoclaved potting soil (Schultz Potting Soil Plus). Nutrient composition of the soil used is listed in Table A2. Bottoms of all cups contained three holes approximately 1.5mm in diameter to allow for water uptake. Cups were placed in plastic trays and transferred to the 12h/12h day-night light source to allow for plant growth. Plants were watered via subirrigation by filling trays with water to approximately 1cm in height every 3-4 days.

After 21 days, individual plants were divided into five treatment groups: control drought (CD), control water (CW), M122, M251, and M259. Each treatment group contained four plant replicates. To ensure that each group contained consistently-sized plants, plants were first sorted based on size then divided equally among the five groups so that each group had some larger and some smaller plants. Total number of leaves was counted and the lengthwise diameter of the third leaf was measured for each plant. Plants were then inoculated with bacteria by pipetting 0.5 mL of bacterial cultures grown in 0.25X TSB (endophyte treatments) or sterile 0.25X TSB (drought and water controls) onto shoots and into soil. To ensure relatively consistent cell densities, bacterial cultures were adjusted to an OD600 of approximately 0.3 before inoculation.

After inoculation, endophyte-treated plants and drought control plants were placed under the 12h/12h light source without watering to simulate drought stress, while water control plants were placed under the light source but still watered via subirrigation every 3-4 days. After 10 days, number of leaves and diameter of the third leaf were measured for each plant, after which fresh biomass was measured by removing plants from soil, cleaning roots of remaining soil, and weighing cleaned plants with an analytical scale. Plants were then dried at 40°C for 3 days, after which dry biomass was weighed using an analytical scale. Differences in leaf numbers and leaf diameter before and after the drought stress period and differences between fresh and dry biomass (i.e. water content) were calculated for each plant. Difference values for endophyte treatments and water control treatments were compared to difference values for drought control treatments as described in Chapter 3.2.2 to examine for statistical significance. A general

58 overview of the methods and timeline for the drought stress in planta tests is shown in Figure 6.1.

Figure 6.1: Diagram summarizing timeline and methodology for drought stress in planta tests.

6.3 Results 6.3.1 Selection of Drought Tolerant Endophytes Of the 18 endophytes tested, the four most osmotolerant endophytes showing growth at 12% NaCl were M122, M251, M259, and M267. Seven endophytes grew at 9% NaCl, ten endophytes grew at 6% NaCl, and all endophytes grew at 3% NaCl. A summary of the osmotolerance results for each of the 18 endophytes tested is in Table 6.1.

Endophyte code Species 3% NaCl 6% NaCl 9% NaCl 12% NaCl

J9 Pantoea agglomerans + + - -

J35 Rhizobium sp. G3Ec1 + - - -

J38 Unknown + + + -

J64 Xanthomonas campestris + - - -

J74 Unknown + + + -

J79 Pantoea agglomerans + + + -

J85 Erwinia sp. + + - -

J89 Pseudomonas putida + + - -

J108 Stenotrophomonas sp. + - - -

J112 Unknown + - - -

J117 Unknown + - - -

M112 Clavibacter michiganensis + - - -

M122 Microbacterium phyllosphaerae + + + (+)

M132 Curtobacterium flaccumfaciens + - - -

M175 Paenibacillus taichungensis + - - -

M251 Plantibacter flavus + + + +

M259 Plantibacter flavus + + + +

M267 Rhizobium selenitireducens + + (+) (+)

Six endophytes were selected for drought stress in planta tests based on a combination of their osmotolerance, presence of the acdS gene, and direct plant growth promotion abilities. The isolate codes of the selected endophytes were J38, J74, J79, M122, M251, and M259. A list of these isolates and their preliminary test results are listed in Table 6.2.

Endophyte Species Highest NaCl concentration acdS PCR Direct plant code capable of growth result growth promotion

J38 Unknown 9% + - J74 Unknown 9% + -

J79 Pantoea agglomerans 9% + -

M122 Microbacterium 12% - + phyllosphareae

M251 Plantibacter flavus 12% + +

M259 Plantibacter flavus 12% Unknown +

6.3.2 Drought Stress In Planta tests No significant improvements in Arabidopsis drought tolerance as measured by water content, changes in leaf diameter, and changes in number of leaves were seen in endophyte-inoculated plants. All plants subjected to drought conditions appeared wilted and dehydrated after 10 days of stress. Photographs of plants throughout the drought stress period are shown in Figure 6.2, while the effects of endophyte inocula on leaf diameter, number of leaves, and water content of Arabidopsis are shown in Figures 6.3, 6.4, and 6.5 respectively.

Figure 6.2: Photographs of Arabidopsis plants for each treatment group throughout the 10-day drought stress period. “CW” indicates watered control treatment, “CD” indicates drought control treatment, and M122, M251, and M259 indicate endophyte-treated plants.

Figure 6.3: Effects of endophyte inocula on Arabidopsis leaf diameter when exposed to drought stress conditions. The y-axis represents the difference between the diameter of the third leaf after and before the onset of drought stress. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 6.4: Effects of endophyte inocula on Arabidopsis leaf growth when exposed to drought stress conditions. Watered controls were excluded from the graph to allow for better visualization of data from other treatments. The y-axis represents the difference between the number of leaves after and before the onset of drought stress. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

Figure 6.5: Effects of endophyte inocula on Arabidopsis water content when grown under drought stress conditions. Dots represent means for each treatment. The horizontal dashed line represents the mean of control plants. Significant improvement over control plants is noted with one (p<0.05), two (p<0.01), or three (p<0.001) asterisks.

6.4 Discussion Based on the results from the drought stress in planta tests, it appears that none of the three endophytes examined (one strain of Microbacterium phyllosphareae and two strains of Plantibacter flavus) improves Arabidopsis drought tolerance. In literature, there is no evidence of Plantibacter species displaying plant drought tolerance ability. Endophytic strains of Microbacterium have also not been seen to improve plant drought tolerance, though one strain from the rhizosphere, Microbacterium sp. 3J1, was seen to improve drought tolerance in green peppers (Vilchez et al. 2018). There is also evidence of strains of Microbacterium improving salt tolerance for wheat in a study by Ashraf et al. (2004), though specific data and strain names were not given. Endophytic bacteria improving plant drought tolerance include Burkholderia phytofirmans strain PsJN, Enterobacter sp. strain FD17, and Azospirillum species for maize (Naveed et al. 2014; Cohen et al. 2009) and three species of Streptomyces (S. coelicolor, S.

64 olivaceous, and S. geysiriensis) for wheat (Yandigeri et al. 2012). Generally, most studies looking at bacterial improvement of plant drought tolerance have examined rhizosphere bacteria. From these studies, a large variety of bacteria from the rhizosphere have shown improved plant drought tolerance, with the most prevalent being various species of Bacillus and Pseudomonas (Ngumbi and Kloepper 2016).

The methods used for the drought stress in planta tests were relatively straightforward in that standard plant characteristics were measured to determine the effects of endophytes towards plant tolerance to drought conditions. More in-depth approaches used to study drought tolerance involve biochemical, molecular and genetic methods. A study by Saravanakumar et al. (2011) used a biochemical assay approach and found greater catalase and peroxidase activity and proline content in leaves of drought-stressed plants inoculated with Pseudomonas fluorescens. Vilchez et al. used a metabolomic approach to examine drought tolerance and found that tolerance is induced by Microbacterium sp. 3J1 through modulation of glutamine and α-ketoglutarate. Another study by Lim and Kim (2013) used a genetic approach and discovered that drought-stressed peppers inoculated with Bacillus licheniformis K11 contained six differentially-expressed stress proteins and 1.5-fold increases in four corresponding genes. Although drought tolerance improvements were not observed by the endophytes tested in this study, it still would have been interesting to have examined plant genetics or metabolites to see if any subtler changes occurred as a result of endophyte inoculation.

Originally, 48 individual plants were planned to be used for the drought stress in planta tests. These plants would be divided into six different endophyte treatments and the two control treatments, with each treatment containing six biological replicates. However, only 20 of the 48 plants showed substantial growth and were healthy in appearance after 21 days of growth. Because of this, the set-up was adjusted to three different endophyte treatments and the two control treatments, with four biological replicates per treatment. The reason as to why many plants did not grow properly is not entirely known, though one possibility is that many of the seedlings were damaged during the transplant process from MS agar to soil. Due to plant growth issues, fewer biological replicates were used than was originally planned (four versus six). It would therefore be logical to repeat the methods with more replicates to confirm results.

Chapter 7

Conclusions and Future Directions

In this study, I have characterized some of the plant growth-promoting abilities of endophytes from plants growing at Oil Springs and Komoka Provincial Park. Using a combination of in vitro and in vivo methods allowed for growth promotion analysis for endophytes individually and in association with plants. Overall, the following conclusions can be made from this study: • The majority of endophytes sampled at these sites appeared to show direct promotion of Arabidopsis thaliana Col-0 shoot growth when inoculated and grown in a controlled laboratory environment, though these improvements were statistically significant for only 12% of endophytes. A variety of different bacterial strains were found to be significant growth promoters, including Bacillus, Curtobacterium, Microbacterium, Arthrobacter, and Plantibacter species. • Inoculation of Arabidopsis with five different endophytes (Paenibacillus taichungensis, Curtobacterium herbarum, Rhizobium selenitireducens, and two strains of Plantibacter flavus) resulted in significant increases in fresh biomass, shoot growth, total root length, and root tip abundance. The most effective growth-promoting bacterium was P. flavus strain 251, marking the first example of P. flavus as a direct plant growth-promoting microbe. Plant growth-promoting traits of these five endophytes are listed in Table 7.1.

Table 7.1: Plant growth promotion traits of five beneficial endophytes for Arabidopsis growth

Isolate Species Arabidopsis Arabidopsis Nitrogen Phosphate Drought code identification shoot root growth fixation solubilization tolerance growth promotion promotion M132 Curtobacterium + + - + Unknown herbarum M175 Paenibacillus + + + + Unknown taichungensis M251 Plantibacter + + - + - flavus M259 Plantibacter + + - + - flavus M267 Rhizobium + + - - Unknown selenitireducens

• Nitrogen fixation and phosphate solubilization were widespread throughout the collection. The most prevalent nitrogen fixers were Pantoea, Xanthomonas, and Microbacterium species, while the most prevalent phosphate solubilizers were Pantoea, Curtobacterium, and Pseudomonas species. A greater proportion of endophytes were capable of phosphate solubilization than nitrogen fixation (42% compared to 26%), though a larger variety of endophytes were capable of nitrogen fixation than phosphate solubilization (19 different nitrogen-fixing genera compared to 16 different phosphate- solubilizing genera). Although it was not proven, it seems likely that these processes are contributing to plant growth through facilitation of nitrogen and phosphorus uptake. • None of the three endophytes tested (Microbacterium phyllosphareae and two strains of P. flavus) showed to improve Arabidopsis drought tolerance, though methods should be adjusted with a greater number of biological replicates to confirm this. • No clear correlations were seen between plant growth promotion, nitrogen fixation, and phosphate solubilization. A summary of plant growth-promoting traits for all endophytes in the collections can be found in Appendix A as Table A5.

At various points throughout this study, there were difficulties with inconsistent or variable plant growth. For future continuations of this project, here are some recommendations to consider with regards to plant growth: • Plant seeds should be stored in a suitable environment. Conditions vary depending on plant species, though it is generally suggested to store seeds in cool, dry conditions. Throughout the course of this project, I stored Arabidopsis seeds in a 4℃ “cold room”, which had a suitable temperature but may have been too humid. • Transplanting should be avoided whenever possible, as this could cause damage to roots and ultimately stunt plant growth. If transplanting is necessary, it should be done quickly to prevent plants from drying out, and care should be taken to apply as little pressure as possible on plant roots or leaves. For this project, I transplanted seedlings to avoid including dead seeds in experiments; however, in hindsight it might have been a better idea to use more seed replicates instead (and just ignore those that do not germinate, or only select the healthiest plants to use). • The easiest way to transfer very small seeds, such as those of Arabidopsis, is by using a sterile pipet tip. If other tools, such as forceps, are to be used, they should be ethanol- flamed to sterilize, then given sufficient time to cool before contacting seeds. • A dilute medium should be used when inoculating plant seeds or seedlings with microbes, as high nutrient concentrations (such as those in full-strength TSB) may induce unnecessary stress. • In vivo tests for specific growth promotion traits (such as in planta nitrogen fixation tests) are complex, so all factors should be taken into consideration when designing methodology. For example, future attempts at in planta nitrogen fixation tests should take into account factors like the anaerobic requirements of nitrogenase, the diffusion of atmospheric nitrogen throughout the growth medium, the nitrogen preferences of plants, and plant growth stage being used. • 96-well microtiter plates are useful for large-scale in planta screens, as they allow for the processing of a large number of samples. Although I did not use antifungal agents in plant growth media, they should be considered when using microtiter plates, as contamination can quickly spread to a large number of plants. For more in-depth or reliable in planta testing, GA-7 boxes are more suitable, as microtiter wells are constrained for space and media inside can quickly evaporate if plates are not sealed tightly with parafilm.

Continuations of this study could further examine the plant growth-promoting abilities of these endophytes using in vitro or in vivo methods. An in vivo approach would provide more insight into interactions between plants and beneficial bacteria. Questions that could be examined using an in vivo approach include: • Are the most effective endophytes for improving Arabidopsis growth equally effective for more agriculturally-relevant plant species? • Are these endophytes equally effective at improving plant growth in other environments, such as natural fields or aquaponic systems? • How does inoculation with these microbes affect plant qualities such as flavour, aroma, and reproductive capability? • Are inoculated endophytes be transmitted vertically to future plant generations, or would they continuously have to be reapplied to each new generation? • Where do these beneficial microbes locate after they are inoculated into plants? Do they enter the endosphere, or are they more prevalent in the rhizosphere or phyllosphere? • Do endophytes have a different effect on plant growth when inoculated in consortia with other microbes? • How does the inclusion of sucrose in plant growth media alter the effectiveness of plant- beneficial microbes?

An in vitro approach would focus on further characterization of specific plant growth-promotion abilities of endophytes in this collection. Questions that could be examined using an in vitro approach include: • Which endophytes are capable of synthesizing auxins and siderophores? • Are common endophytic genes, such as those for motility and carbohydrate metabolism, found consistently throughout these endophytes? • What kinds of antibiotic activities are expressed by the collection?

Answers to some of these questions would provide more information about endophytes, furthering our knowledge of plant-microbe interactions. This information would also be important to further our knowledge for specific bacteria that are to be used as biofertilizer inocula in the future.

References

Agarkova IV, Lambrecht PA, Vadaver AK, Harveson RM (2012) Genetic diversity among Curtobacterium flaccumfaciens pv. flaccumfaciens populations in the American high plains. Can J Microbiol 58:788-801.

Ali S, Isaacson J, Kroner Y, Saldias S, Kandasamy S, Lazarovits G (2018) Corn sap bacterial endophytes and their potential in plant growth-promotion. Environ Sustain: 1-15.

Alori ET, Glick BR, Babalola OO (2017) Microbial phosphorus solubilization and its use in sustainable agriculture. Front Microbiol 8: 971.

Armada E, Probanza A, Roldan A, Azcon R (2016) Native plant growth promoting bacteria Bacillus thuringiensis and mixed or individual mycorrhizal species improved drought tolerance and oxidative metabolism in Lavandula dentata plants. J Plant Physiol 192: 1- 12.

Asghar HN, Zahir ZA, Arshad M, Khaliq A (2002) Relationship between in vitro production of auxins by rhizobacteria and their growth-promoting activities in Brassica juncea L. Biol Fertil Soils 35: 231-237.

Ashraf A, Hasnain S, Berge O, Mahmood T (2004) Inoculating wheat seedlings with exopolysaccharide-producing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biol Fertil Soils 40(3): 157-162.

Asis Jr. CA, Adachi K (2003) Isolation of endophytic diazotroph Pantoea agglomerans and nondiazotroph Enterobacter asburiae from sweet potato stem in Japan. Lett Appl Microbiol 38(1): 19-23.

Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. (2008) The RAST Server: rapid annotations using subsystems technology. BMC Genomics 8:75.

Baldani JI, Caruso L, Baldani VLD, Goi SR, Dobereiner J. (1997) Recent advances in BNF with non-legume plants. Soil Biol Biochem 29: 911–922.

Barnawal D, Bharti N, Maji D, Chanotiya CS, Kalra A (2014) ACC deaminase-containing Arthrobacter protophormiae induces NaCl stress tolerance through reduced ACC oxidase activity and ethylene production resulting in improved nodulation and mycorrhization in Pisum sativum. J Plant Physiol 171(11): 884-894.

Barriuso J, Solano BR, Gutiérrez Mañero FJ (2008) Protection against pathogen and salt stress by four plant growth-promoting rhizobacteria isolated from Pinus sp. on Arabidopsis thaliana. Phytopathology 98:666-672.

Basak BB, Biswas DR (2010) Co-inoculation of potassium solubilizing and nitrogen fixing bacteria on solubilization of waste mica and their effect on growth promotion and nutrient acquisition by a forage crop. Biol Fertil Soils 46(6): 641-648.

Behrendt U, Ulrich A, Schumann P, Naumann D, Suzuki K (2002) Diversity of grass-associated Microbacteriaceae isolated from the phyllosphere and litter layer after mulching the

sward; polyphasic characterization of Subtercola pratensis sp. nov., Curtobacterium herbarum sp. Nov. and Plantibacter flavus gen. nov., sp. nov. Int J Syst Evol Micr 52:1441-1454.

Berg G, Grube M, Schloter M and Smalla K (2014) Unraveling the plant microbiome: looking back and future perspectives. Front Microbiol 5: 148.

Bhardwaj D, Ansari MW, Sahoo RK, Tuteja N (2014) Biofertilizers function as key player in sustainable agriculture by improving soil fertility, plant tolerance and crop productivity. Microb Cell Fact 13(66).

Blaha D, Prigent-Combaret C, Mirza MS, Moenne-Loccoz Y (2006) Phylogeny of the 1- aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phytobeneficial and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiol Ecol 56(3): 455-470.

Bodenhausen N, Bortfeld-Miller M, Ackermann M, Vorholt JA (2014) A synthetic community approach reveals plant genotypes affecting the phyllosphere microbiota. PLoS Genet 10(4): e1104283.

Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Gorlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13(7): 1499-1510.

Bryce JH, Rees TA (1986) Effects of sucrose on the rate of respiration of the roots of Pisum sativum. J Plant Physiol 120(4): 363-367.

Burgess BK and Lowe DJ (1996) Mechanism of molybdenum nitrogenase. Chem Rev 96(7): 2983-3012.

Cardinale M, Ratering S, Suarez C, Montoya AMZ, Geissler-Plaum R, Schnell S (2015) Paradox of plant growth promotion potential of rhizobacteria and their actual promotion effect on growth of barley (Hordeum vulgare L.) under salt stress. Microbiol Res 181:22-32.

Castagno LN, Estrella MJ, Sannazzaro AI, Grassano AE, Ruiz OA (2011) Phosphate- solubilization mechanism and in vitro plant growth promotion activity mediated by Pantoea eucalypti isolated from Lotus tenuis rhizosphere in the Salado River Basin (Argentina). J Appl Microbiol 110(5): 1151-1165.

Chen Y, Fan JB, Du L, Xa H, Zhang QH, He YQ (2012) The application of phosphate solubilizing endophyte Pantoea dispersa triggers the microbial community in red acidic soil. Appl Soil Ecol 84: 235-244.

Choi H, Kim CS, Kim P, Jung H, Oh D (2004) Lactosucrose Bioconversion from Lactose and Sucrose by Whole Cells of Paenibacillus polymyxa Harboring Levansucrase Activity. Biotechnol Prog 20(6): 1876-1879.

Cohen AC, Travaglia CN, Bottini R, Piccoli PN (2009) Participation of abscisic acid and gibberellins produced by endophytic Azospirillum in the alleviation of drought effects in maize. Botany 87(5): 455-462.

Coleman-Durr D, Desgarennes D, Fonseca-Garcia C, Gross S, et al. (2015) Plant compartment and biogeography affects microbiome composition in cultivated and native Agave species. New Phytol 209(2): 798-811.

Compant S, Clement C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42(5): 669-678.

Compant S, Duffy B, Nowak J, Clement C Barka EA (2005) Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microbiol 71(9): 4951-4959.

Conn VM, Walker AR, Franco CMM (2008) Endophytic Actinobacteria induce defense pathways in Arabidopsis thaliana. Mol Plant-Microbe Int 21(2): 208-218.

Costacurta A, Vanderleyden J (1995) Synthesis of phytohormones by plant-associated bacteria. Crit Rev Microbiol 21(1): 1-18.

Costerousse B, Schonholzer-Mauclaire L, Frossard E, Thonar C (2018) Identification of heterotrophic zinc mobilization processes among bacterial strains isolated from wheat rhizosphere (Triticum aestivum L.). Appl Environ Microbiol 84:e01715-17.

Crowley DE, Wang YC, Reid P, Szaniszlo PJ (1991) Mechanisms of iron acquisition from siderophores by microorganisms and plants. Plant and Soil 130(1): 179-198.

Dary M, Chamber-Perez MA, Palomares AJ, Pajuelo E (2010) “In situ” phytostabilisation of heavy metal polluted soils using Lupinus luteus inoculated with metal resistant plant growth-promoting rhizobacteria. J Hazard Mater 177: 323-330. de Faria RT, Rodrigues FN, Oliveira LVR, Muller C (2004) In vitro Dendrobium nobile plant growth and rooting in different sucrose concentrations. Hortic Bras 22(4): 780-783. de Garcia Salamone IE, Hynes RK, Nelson LM (2005) Role of Cytokinins in Plant Growth Promotion by Rhizosphere Bacteria. In: Siddiqui Z.A. (eds) PGPR: Biocontrol and Biofertilization. Springer, Dordrecht.

De Souza R, Meyer J, Schoenfeld R, da Costa PB, Passaglia LMP (2014) Characterization of plant growth-promoting bacteria associated with rice cropped in iron-stressed soils. Ann Microbiol 65:951-964.

Delmotte N, Knief C, Chaffron S, Innerebner G, Roschitzki B, Schlapback R, von Mering C, Vorholt JA (2009) Community proteogenomics reveals insights into the physiology of phyllosphere bacteria. PNAS 106(38): 16428-16433.

Deutscher J (2008) The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol 11(2): 87-93.

Dias ACF, Costa FEC, Andreote FD, Lacava PT, Teixeira MA (2009) Isolation of micropropagated strawberry endophytic bacteria and assessment of their potential for plant growth promotion. World J Microbiol Biotechnol 25(2): 189-195.

Diéz-Mendéz A, Rivas R (2017) Improvement of saffron production using Curtobacterium herbarum as a bioinoculant under greenhouse conditions. AIMS Microbiol 3:354-364.

Dixon R, Kahn D (2004) Genetic regulation of biological nitrogen fixation. Nature Rev Microbiol 2: 621-631.

Dobbelaere S, Croonenborghs A, Thys A, Vande Broek A, Vanderleyden J (1999) Phytostimulatory effect of Azospirillium brasilense wild type and mutant strains altered in IAA production on wheat. Plant and Soil 212:153-162.

Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22: 107-149.

Dubeikovsky AN, Mordukhova EA, Kochetkov VV, Polikarpova FY, Boronin AM (1993) Growth promotion of blackcurrant softwood cuttings by recombinant strain Pseudomonas fluorescens BSP53a synthesizing an increased amount of indole-3-acetic acid. Soil Biol Biochem 25(9): 1277-1281.

Dutkiewicz J, Mackiewicz B, Kinga Lemieszek M, Golec M, Milanowski J (2016) Pantoea agglomerans: a mysterious bacterium of evil and good. Part III. Deleterious effects: infections of humans, animals and plants. Ann Agric Environ Med 23(2): 197-205.

Emerson D and Breznak JA (1997) The response of microbial populations from oil-brine contaminated soil to gradients of NaCl and sodium p-toluate in a diffusion gradient chamber. FEMS Microbiol Ecol 23(4): 285-300. Evtushenko LI, Takeuchi M (2006) The Family Microbacteriaceae. In: Dworkin M, Falkow S, Rosenberg E, Schleifer KH, Stackebrandt E (eds) The Prokaryotes. Springer, New York, NY. Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA (2009) Plant drought stress: effects, mechanisms, and management. In: Lichtfouse E., Navarrete M., Debaeke P., Véronique S., Alberola C. (eds) Sustainable Agriculture. Springer, Dordrecht.

Farrar K, Bryant D, Cope-Selby N (2014) Understanding and engineering beneficial plant- microbe interactions: plant growth promotion in energy crops. Plant Biotechnol J 12(9): 1193-1206.

Fibach-Paldi S, Burdman S, Okon Y (2012) Key physiological properties contributing to rhizosphere adaptation and plant growth promotion abilities of Azospirillum brasilense. FEMS Microbiol Lett 326(2): 99-108.

Forde BG, Clarkson DT (1999) Nitrate and ammonium nutrition of plants: physiological and molecular perspectives. Adv Bot Res 30: 1-90.

Franche C, Lindstrom K, Elmerich C (2009) Nitrogen-fixing bacteria associated with leguminous and non-leguminous plants. Plant and Soil 321(1-2): 35-59.

Frank AC, Guzman JPS, Shay JE (2017) Transmission of bacterial endophytes. Microorganisms 5:70.

Furnkranz M, Eveline A, Muller H, Grube M, Huss H, Winkler J, Berg G (2012) Promotion of growth, health, and stress tolerance of Styrian oil pumpkins by bacterial endophytes. Eur J of Plant Pathol 134.

Galloway JN, et al. (2004) Nitrogen cycles: past, present, and future. Biogeochemistry 70(2): 153-226.

Garcia de Salamone IE, Dobereiner J, Uriquaga S, Boddey RM (1996) Biological nitrogen fixation in Azospirillum strain-maize genotype associations as evaluated by the 15N isotope dilution technique. Biol Fert Soils 23(3): 249-256.

Garcia-Fraile P, Carro L, Robledo M, Ramirez-Bahena MH, Flores-Felix JD, Fernández MT, Mateos PF, Rivas R, Igual JM, Martinez-Molina E, Peix A, Velazquez E (2012) Rhizobium promotes non-legumes growth and quality in several production steps: towards a biofertilization of edible raw vegetables healthy for humans. PLoS One 7:e38122.

Glick B (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res 169: 30-39.

Goodner B, Hinkle G, Gattung S, Miller N, Blanchard M, Qurollo B, Goldman BS, et al. (2001) Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens c58. Science 294(5550): 2323-2328.

Grayston SJ, Germida JJ (1991) Sulfur-oxidizing bacteria as plant growth promoting rhizobacteria for canola. Can J Microbiol 37(7): 521-529.

Haas D, Keel C (2003) Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance for biological control of plant disease. Ann Rev Phytopath 41: 117-153.

Hallmann CA, Foppen RP, van Turnhout CA, de Kroon H, Jongejans E (2014) Declines in insectivorous birds are associated with high neonicotinoid concentrations. Nature 511341–343.

Hamawaki RL, Kantartzi SK (2018) Di-nitrogen fixation at the early and late growth stages of soybean. Acta Sci Agron 40.

Hansen H, Grossmann K (2000) Auxin-induced ethylene triggers abscisic acid biosynthesis and growth inhibition. Plant Physiol 124(3): 1437-1448.

Harborne JB, Williams, CA (2000) Advances in flavonoid research since 1992. Phytochemistry 55:481-504.

He LY, Zhang YF, Ma HY, Su LN, Chen ZJ, Wang QY, Qian M, Sheng XF (2010) Characterization of copper-resistant bacteria and assessment of bacterial communities in rhizosphere soil of copper-tolerant plants. Appl Soil Ecol 44:49-55.

Hein JW, Wolfe GV, Blee KA (2008) Comparison of rhizosphere bacterial communities in Arabidopsis thaliana mutants for systemic acquired resistance. Microb Ecol 55: 333-343.

Herranen M, Kariluoto S, Edelmann M, Piironen V, Ahvenniemi K, Iivonen V, Salovaara H, Korhola M (2010) Isolation and characterization of folate-producing bacteria from oat bran and rye flakes. Int J Food Microbiol 142:277-285.

Hoffman BM, Lukoyanov D, Yang ZY, Dean DR, and Seefeldt LC (2014) Mechanism of nitrogen fixation by nitrogenase: the next stage. Chem Rev 114(8): 4041-4062.

Hou J, Liu W, Wang B, Wang Q, Luo Y, Franks AE (2015) PGPR enhanced phytoremediation of petroleum contaminated soil and rhizosphere microbial community response. Chemosphere 138: 592-598.

Hurek T, Handley LL, Reinhold-Hurek B, Piche Y (2002) Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Mol Plant-Microbe Int 15(3): 233-242.

James EK, Olivares F (1998) Infection and colonization of sugarcane and other graminaceous plants by endophytic bacteria. Crit Rev Plant Sci 17: 77-119.

Jaschke D, Dugassa-Gobena D, Karlovsky P, Vidal S, Ludwig-Muller J (2010) Suppression of clubroot (Plasmodiophora brassicae) development in Arabidopsis thaliana by the endophytic fungus Acremonium alternatum. Plant Pathol 59(1): 100-111.

Jensen ES (1986) Seasonal patterns of growth and nitrogen fixation in field-grown pea. Plant and Soil 101:29-37.

Jha Y, Sablok G, Subbarao N, Sudhakar R, Fazil MHU, Subramanian RB, Squartini A, Kumar S (2014) Bacterial-induced expression of RAB18 protein in Orzya sativa salinity stress and insights into molecular interaction with GTP ligand. J Mol Recognit 27(9): 521-527.

Ji SH, Gururani MA, Chun S (2014) Isolation and characterization of plant growth promoting endophytic diazotrophic bacteria from Korean rice cultivars. Microbiol Res 169(1): 83-98.

Joseph B, Lau L, Kliebenstein DJ (2015) Quantitative variation in response to root spatial constraint within Arabidopsis thaliana. Plant Cell 27(8): 2227-2243.

Kandel SL, Firrincieli A, Joubert PM, Okubara PA, Leston ND, McGeorge KM, Mugnozza GS, Harfouche A, Kim SH, Doty SL (2017) An in vitro study of bio-control and plant growth promotion potential of Salicaceae endophytes. Front Microbiol 8: 386.

Kandel SL, Joubert PM, Doty SL (2017) Bacterial endophyte colonization and distribution within plants. Microorganisms 5(77).

Kanvinde L, Sastry GRK (1990) Agrobacterium tumefaciens is a diazotrophic bacterium. Appl Environ Microbiol 56(7): 2087-2092.

Karlidag H, Esitken A, Turan M, Sahin F (2007) Effects of root inoculation of plant growth promoting rhizobacteria (PGPR) on yield, growth, and nutrient element contents of leaves of apple. Scientia Horticulturae 114:16-20.

Karthik M, Pushpakanth P, Krishnamoorthy R, Senthilkumar M (2017) Endophytic bacteria associated with banana cultivars and their inoculation effect on plant growth. J Hortic Sci Biotechnol 92(6): 568-576.

Ker K, Seguin P, Driscoll BT, Fyles JW, Smith DL (2012) Switchgrass establishment and seeding year production can be improved by inoculation with rhizosphere endophytes. Biomass Bioenergy 47:295-301.

Khalid A, Arshad M, Zahir ZA (2004) Screening plant growth-promoting rhizobacteria for improving growth and yield of wheat. J Appl Microbiol 96:473-480.

Khalid A, Arshad M, Zahir Z (2003) Growth and yield response of wheat to inoculation with auxin producing plant growth promoting rhizobacteria. Pak J Bot 35(4): 483-498.

Kloepper JW, McInroy JA, Liu K, Hu C (2013) Symptoms of fern distortion syndrome resulting from inoculation with opportunistic endophytic fluorescent Pseudomonas spp. PLoS One 8(3): e58531.

Kloepper JW, Ryu CM, Zhang S (2004) Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathol 94(11): 1259-1266.

Kniskern JM, Traw MB, Bergelson J (2007) Salicylic acid and jasmonic acid signaling defense pathways reduce natural bacterial diversity on Arabidopsis thaliana. Mol Plant Microbe Interact 20: 1512-1522.

Koch B, Evans HJ (1966) Reduction of acetylene to ethylene by soybean root nodules. Plant Physiol 41: 1748-1750.

Koornneef M, Meinke D (2010) The development of Arabidopsis as a model plant. Plant J 61(6): 909-921.

Kost T, Stopnisek N, Agnoli K, Eberl L, Weisskopf L (2014) Oxalotrophy, a widespread trait of plant-associated Burkholderia species, is involved in successful root colonization of lupin and maize by Burkholderia phytofirmans. Front Microbiol 4: 1–9.

Kuan KB, Othman R, Abdul Rahim K, Shamsuddin ZH (2016) Plant growth-promoting rhizobacteria inoculation to enhance vegetative growth, nitrogen fixation, and nitrogen remobilization of maize under greenhouse conditions. PLoS One 11(3): e0152478.

Kucey RMN (1988) Plant growth-altering effects of Azospirillum brasilense and Bacillus C-11-25 on two wheat cultivars. J Appl Bacteriol 64: 187-196.

Kumar R, Sharma AK, Ahluwalia SS (2017) Advances in Environmental Biotechnology. Singapore: Springer Nature.

Lagacé L, Pitre M, Jacques M, Roy D (2004) Identification of the microbial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing. Appl Environ Microbiol 70:2052-2060.

Lee S, Ka J, Song H (2012) Growth promotion of Xanthium italicum by application of rhizobacterial isolates of Bacillus aryabhattai in microcosm soil. J Microbiol 50(1): 45-49.

Levy A, Gonzalez IS, Mittelviefhaus M, Clingenpeel S, Paredes SH, et al. (2018) Genomic features of bacterial adaptation to plants. Nature Genet 50: 138-150.

Lim J, Kim S (2013) Induction of drought stress resistance by multi-functional PGPR Bacillus lichenformis K11 in pepper. Plant Pathol J 29(2): 201-208.

Loiret FG, Ortega E, Kleiner D, Ortega-Rodes P, Rodes R, Dong Z (2004) A putative new endophytic nitrogen-fixing bacterium Pantoea sp. from sugarcane. J Appl Microbiol 97(3): 504-511.

Lumactud R, Fulthorpe R (2018) Endophytic bacterial community structure and function of herbaceous plants from petroleum hydrocarbon contaminated and non-contaminated sites. Front Microbiol 9: 1926.

Lumactud R, Fulthorpe R, Sentchilo V, van der Meer JR (2017) Draft genome sequence of Plantibacter flavus strain 251 isolated from a plant growing in a chronically hydrocarbon- contaminated site. Genome Announc 5:e00276-17.

Lumactud R, Shen SY, Lau M, Fulthorpe R (2016) Bacterial endophytes isolated from plants in natural oil seep soils with chronic hydrocarbon contamination. Front Microbiol 7.

Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, et al. (2012) Defining the core Arabidopsis thaliana root microbiome. Nature 488: 86-90.

Maitra N, Bandopadhyay C, Samanta S, Sarkar K, Sharma AP, Manna SK (2015) Isolation, Identification and Efficacy of Inorganic Phosphate-Solubilizing Bacteria from Oxbow Lakes of West Bengal, India. Geomicrobiol J 32(8): 751-758.

Meilhoc E, Cam Y, Skapski A, and Bruand C (2010) The response to nitrous oxide of the nitrogen-fixing symbiont Sinorhizobium meliloti. Mol Plant-Microbe Int 23: 748-759.

Mohammadi K (2012) Phosphorus solubilizing bacteria: occurrence, mechanisms and their role in crop production. Res Environ 2(1): 80-85.

Naveed M, Mitter B, Reichenauer TG, Wieczorek K, Sessitsch A (2014) Increased drought stress resilience of maize through endophytic colonization by Burkholderia phytofirmans PsJN and Enterobacter sp. FD 17. Environ Exp Bot 97: 30–39.

Ngumbi E, Kloepper J (2016) Bacterial-mediated drought tolerance: current and future prospects. Appl Soil Ecol 105: 109-125.

Nibau C, Gibbs DJ, Coates JC (2008) Branching out in new directions: the control of root architecture by lateral root formation. New Phytol 179: 595-614.

Nilanthi D, Yang Y (2014) Effects of sucrose and other additives on in vitro growth and development of purple coneflower (Echinacea purpurea L.). Adv Biol

Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid metabolism in plants. Mol Plant 8:68-82.

Okubo T, Piromyou P, Tittabutr P, Teaumroong N, Minamisawa K (2016) Origin and evolution of nitrogen fixation genes on symbiosis islands and plasmid in Bradyrhizobium. Microbes Environ 31(3): 260-267.

Oteino N, Lally RD, Kiwanuka S, Lloyd A, Ryan D, Germaine KJ, Dowling DN (2015) Plant growth promotion induced by phosphate solubilizing endophytic Pseudomonas isolates. Front Microbiol 6: 745.

Overvoorde P, Fukaki H, Beeckman T (2010) Auxin control of root development. Cold Spring Harb Perspect Biol 2: a001537.

Palacios OA, Bashan Y, de-Bashan LE (2014) Proven and potential involvement of vitamins in interactions of plants with plant growth-promoting bacteria: an overview. Biol Fertil Soils 50(3): 415-432.

Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol 42(3): 207-220.

Paul D, Sinha SN (2017) Isolation and characterization of phosphate solubilizing bacterium Pseudomonas aeruginosa KUPSB12 with antibacterial potential from river Ganga, India. Ann Agrar Sci 15(1): 130-136.

Plaxton WC, Podesta FE (2006) The functional organization and control of plant respiration. Crit Rev Plant Sci 25(2): 159-198.

Puri A, Padda KP, Chanway CP (2017) Nitrogen-fixation by endophytic bacteria in agricultural crops: recent advances. Nitrogen in Agriculture.

Qian H (2014) Improved primers and a pyrosequencing approach of recover wide range of nitrogenase reductase genes from peatlands. Unpublished manuscript.

Qiu M, Xie R, Shi Y, Zhang H, Chen H (2010) Isolation and identification of two flavonoid- producing endophytic fungi from Gingko biloba L. Ann Microbiol 60(1): 143-150.

Ramesh A, Sharma SK, Sharma MP, Yadav N, Joshi OP (2014) Inoculation of zinc solubilizing Bacillus aryabhattai strains for improved growth, mobilization and biofortification of zinc in soybean and wheat cultivated in Vertisols of central India. Appl Soil Ecol 73: 87-96.

Raupach GS, Kloepper JW (1998) Mixtures of plant growth-promoting rhizobacteria enhance biological control of multiple cucumber pathogens. Phytopathol 88(11): 1158-1164.

Raymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21(3): 541-554.

Reinhardt EL, Ramos PL, Manfio GP, Barbosa HR, Pavan C, Moreira-Filho CA (2008) Molecular characterization of nitrogen-fixing bacteria isolated from Brazilian agricultural plants at Sao Paulo site. Braz J Microbiol 39(3): 414-422.

Riedel GE, Brown SE, Ausubel FM (1983) Nitrogen fixation by Klebsiella pneumoniae is inhibited by certain multicopy hybrid nif plasmids. J Bacteriol 153(1): 45-56.

Rodriguez H, Fraga R, Gonzalez T, Bashan Y (2006) Genetics of phosphate solubilization and it potential applications for improving plant growth-promoting bacteria. Plant Soil 287: 15- 21.

Romero FM, Marina M, Pieckenstain FL (2014) The communities of tomato (Solanum lycopersicum L.) leaf endophytic bacteria, analyzed by 16S-ribosomal RNA gene pyrosequencing. FEMS Microbiol Lett 351:187-194.

Ruppel S, Merbach W (1995) Effects of different nitrogen sources on nitrogen fixation and bacterial growth of Pantoea agglomerans and Azospirillum sp. in bacterial pure culture: an investigation using 15N2 incorporation and acetylene reduction measures. Microbiol Res 150: 409-418.

Salisbury FB, Ross CW (1992) Plant physiology. Wadsworth Publishing Company, Belmont, Calif. pp. 329–407.

Santoyo G, Moreno-Hagelsieb G, Orozco-Mosqueda MC, Glick BR (2016) Plant growth- promoting bacterial endophytes. Microbiol Res 183: 92-99.

Saravanakumar D, Kavino M, Raguchander T, Subbian P, Samiyappan R (2011) Plant growth promoting bacteria enhance water stress resistance in green gram plants. Acta Physiologiae Plantarum 33(1): 203-209.

Schachtman DP, Reid RJ, and Ayling SM (1998) Phosphorus uptake by plants: from soil to cell. Plant Physiol 116(2): 447-453.

Sessitsch A, Hardoim P, Doring J, Weilharter A, et al. (2012) Functional characteristics of an endophyte community colonizing rice roots as revealed by metagenomic analysis. Mol Plant-Microbe Int 25(1): 28-36.

Sharma SB, Sayyed RZ, Trivedi MH, Gobi TA (2013) Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. Springerplus 2: 587.

Sharon JA, Hathwaik LT, Glenn GM, Imam SH, Lee CC (2016) Isolation of efficient phosphate solubilizing bacteria capable of enhancing tomato plant growth. J Soil Sci Plant Nutr 16(2).

Sharp RE, Wu Y, Voetberg GS, Soab IN, LeNoble ME (1994) Confirmation that abscisic acid accumulation is required for maize primary root elongation at low water potentials, J Exp Bot 45, 1743–1751.

Sheng XF, Xia JJ, Jiang CY, He LY, Qian M (2008) Characterization of heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting the growth and lead accumulation in rape. Environ Pollution 156:1164-1170.

Singh JS, Pandey VS, and Singh DP (2011) Efficient soil microorganisms: a new dimension for sustainable agriculture and environmental development. Agricult Ecosys Environ 140(3- 4): 339-353.

Soares RM, Fantinato GGP, Darben LM, Marcelino-Guimarães FC, Seixas CDS, Carneiro CES (2013) First report of Curtobacterium flaccumfaciens pv. Flaccumfaciens on soybean in Brazil. Trop Plant Pathol 38:452-454.

Stacey G, Burris RH, Evans HJ. Biological Nitrogen Fixation. New York: Chapman and Hall; 1992.

Steuer B, Stuhlfauth T, Fock HP (1988) The efficiency of water use in water stressed plants is increased due to ABA induced stomatal closure. Photosynth Res 18(3): 327-336.

Strobel G and Daisy B (2003) Bioprospecting for microbial endophytes and their natural products. Microbial Mol Biol Rev 67(4): 491-502.

Strobel GA, Miller RV, Concepcion MM, Condron MM, Teplow DB, and Hess WM (1999) Cryptocandin, a potent antimycotic from the fungus Cryptosporiosis cf. quercina. Microbiol 145: 1919-1926.

Su YH, Liu YB, Zhang XS (2011) Auxin-cytokinin interaction regulates meristem development. Mol Plant 4:616-625.

Sumaryono, Muslihatin W, Ratnadewi D (2012) Effect of carbohydrate source on growth and performance of in vitro sage palm (Metroxylon sagu Rottb.) plantlets. HAYATI J Biosci 19(2): 88-92.

Sun PF, Fang WT, Shin LY, Wei JY, Fu SF, Chou JY (2014) Indole-3-acetic acid-producing yeasts in the phyllosphere of the carnivorous plant Drosera indica L. PLoS One 9(12): e114196.

Szeto WW, Nixon BT, Ronson CW, Ausubel FM (1987) Identification and characterization of the Rhizobium meliloti ntrC gene: R. meliloti has separate regulatory pathways for activation of nitrogen fixation genes in free-living and symbiotic cells. J Bacteriol 169(4): 1423- 1432.

Taule C, Mareque C, Barlocco C, Hackembruch F, Reis VM, Sicardi M, Battistoni F (2012) The contribution of nitrogen fixation to sugarcane (Saccharum officinarum L.), and the identification and characterization of part of the associated diazotrophic bacterial community. Plant Soil 356(1-2): 35-49.

Teale WD, Paponov IA, Palme K (2006) Auxin in action: signalling, transport and the control of plant growth and development. Nature Rev Mol Cell Biol 7: 847-859.

The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815.

Timmusk S, Behers L, Muthoni J, Muraya M, Aronsson AC (2017) Perspectives and challenges of microbial application for crop improvement. Front Plant Sci 8:49.

Tripathi M, Munot HP, Shouche Y, Meyer JM, Goel R (2005) Isolation and functional characterization of siderophore-producing lead- and cadmium-resistant Pseudomonas putida KNP9. Current Microbiol 50(5): 233-237.

Tsavkelova EA, Klimova SY, Cherdyntseva TA, Netrusov AI (2006) Microbial producers of plant growth stimulators and their practical use: a review. Appl Biochem Microbiol 42(2): 117- 126.

Turner TR, James EK, Poole PS (2013) The plant microbiome. Genome Biol 14:209.

Urquiaga S, Cruz KHS, Boddey RM (1992) Contribution of Nitrogen Fixation to Sugar Cane: Nitrogen-15 and Nitrogen-Balance Estimates. Soil Sci Soc Am J 56: 105-114.

Vadassery J, Ranf S, Drzewiecki C, Mithofer A, Mazars C, Scheel D, Lee J, Oelmuller R (2009) A cell wall extract from the endophytic fungus Piriformospora indicai promotes growth of Arabidopsis seedlings and induces intracellular calcium elevation in roots. Plant J 59(2): 193-206.

Van Wees SCM, Van der Ent S, Pieterse CMJ (2008) Plant immune responses triggered by beneficial microbes. Curr Opin Plant Biol 11(4): 443-448.

Vandenkoornhuyse P, Quaiser A, Duhamel M, Le Van A, Dufresne A (2015) The importance of the microbiome of the plant holobiont. New Phytol Trust 206: 1196-1206.

Venkatachalam S, Ranjan K, Prasanna R, Ramakrishnan B, Thapa S, Kanchan A (2016) Diversity and functional traits of culturable microbiome members, including cyanobacteria in the rice phyllosphere. Plant Biol 18: 627-637.

Vilchez JI, Niehaus K, Dowling DN, Gonzalez-Lopez J, Manzanera M (2018) Protection of pepper plants from drought by Microbacterium sp. 3J1 by modulation of the plant's glutamine and α-ketoglutarate content: a comparative metabolomics approach. Front Microbiol 9: 284.

Vimal SR, Patel VK, Singh JS (2018) Plant growth promoting Curtobacterium albidum strain SRV4: an agriculturally important microbe to alleviate salinity stress in paddy plants. Ecol Indic.

Walterson AM, Stavrinides J (2015) Pantoea: insights into a highly versatile and diverse genus within the Enterobacteriaceae. FEMS Microbiol Rev 39: 968-984.

Wang HF, Zang YG, Li L, Liu WH, Hozzein WN, Chen JY, Guo JW, Zhang YM, Li WJ (2015) Okibacterium endophyticum sp. nov., a novel endophytic actinobacterium isolated from roots of Salsola affinis C. A. Mey. Antonie van Leeuwenhoek 107:835-843.

Wattam AR, Davis JJ, Assaf R, Boisvert S, Brettin T, Bun C, et al (2017) Improvements to PATRIC, the all-bacterial bioinformatics database and analysis resource center. Nucleic Acids Res 4:535-542.

Wong PP and Burris RH (1972) Nature of oxygen inhibition of nitrogenase from Azotobacter vinelandii. Proc Nat Acad Sci USA 69(3): 672-675.

Xie J, Shi H, Du Z, Wang T, Liu X, Chen S (2016) Comparative genomic and functional analysis reveal conservation of plant growth-promoting traits in Paenibacillus polymyxa and its closely related species. Sci Rep 6.

Yandigeri MS, Meena KK, Singh D, Malviya N, Singh DP, Solanki MK, Yadav AK, Arora DK (2012) Drought-tolerant endophytic actinobacteria promote growth of wheat (Triticum aestivum) under water stress conditions. Plant Growth Reg 68(3): 411-420.

Zhang H, Sun Y, Xie X, Kim MS, Dowd SE, Pare PW (2009) A soil bacterium regulates plant acquisition of iron via deficiency-inducible mechanisms. Plant J 58(4): 568-577.

Zinniel DK, Lambrecht P, et al (2002) Isolation and characterization of endophytic colonizing bacteria from agronomic crops and prairie plants. Appl Environ Microbiol 68:2198-2208.

Zou WX, Meng JC, Lu H, Chen GX, Shi GX, Zhang TY, and Tan RX (2000) Metabolites of Colletotrichum gloeosporioides, an endophytic fungus in Artemisia mongolica. J Nat Prod 63(11): 1529-1530.

Zúñiga A, Poupin MJ, Donoso R, Ledger T, Guiliani N, Gutiérrez RA, González B (2013) Quorum sensing and indole-3-acetic acid degradation play a role in colonization and plant growth promotion of Arabidopsis thaliana by Burkholderia phytofirmans PsJN. Mol Plant Microbe Interact 26: 546–553.

Appendix A: Figures and Tables

Figure A1: Alignment of primers used for nifH PCR. The forward primer (hqf) corresponded with an ATP binding site while the reverse primer (hqr) corresponded with an Fe-S binding site on nifH. The image was modified from Qian et al. 2014.

Table A1: Chemical composition of semi-solid nitrogen-free medium.

Ingredient Quantity

DI H2O 1.0L

Sucrose 4.25g

Glucose 2.24g

Mannitol 2.24g

K2HPO4 500.0mg

FeSO4·7H2O 50.0mg

MgSO4·7H2O 10.0mg

NaCl 20.0mg

CaCl2·2H2O 13.0mg

CuSO4·5H2O 1.04mg

ZnSO4·7H2O 0.48mg

H3BO3 5.60mg

Na2MnO4·2H2O 0.40mg

MnSO4·H2O 6.00mg

Biotin 0.10mg

Pyridoxol H2O 0.20mg

Bromothymol blue powder 20.0mg

Agar 2.0g

10M NaOH (before autoclaving) 40µL

10M NaOH (after autoclaving) 100µL

Table A2: Nutrient composition of Schultz Potting Soil Plus used for drought stress in planta tests.

Nutrient Concentration

Total nitrogen (N) 0.08%

Available phosphoric acid (P2O5) 0.12%

Soluble potash (K2O) 0.08%

Table A3: Raw Arabidopsis root data for select endophytes grown in MS media without sucrose.

Isolate code Length (cm) Surface Area (cm2) Tips Forks Crossings

Control 0.1991 0.0186 2 0 0

Control 1.8391 0.1942 8 18 1

Control 3.1993 0.1886 35 17 1

Control 0.7565 0.052 13 1 0

Control 17.12 1.3101 61 134 11

Control 25.9335 1.9708 59 185 37

Control 10.8822 0.7462 44 58 8

Control 1.4075 0.0726 7 3 0

M112 31.282 2.4687 63 153 33

M112 14.0523 1.0458 35 25 4

M132 25.1526 1.8138 68 113 15

M132 43.1195 2.8177 136 227 43

M132 33.3851 2.2654 130 101 16

M132 22.0739 1.4182 65 104 16

M132 34.7768 2.394 128 196 23

M132 30.6187 2.0557 123 162 22

M132 21.3281 1.5277 78 127 19

M132 38.7572 3.2052 58 345 42

M175 40.9488 2.9148 158 257 36

M175 2.7494 0.1925 22 10 0

M175 20.5706 1.5884 86 140 21

M175 20.2144 1.8325 98 163 13

M175 36.3283 2.7056 144 228 30

M251 63.3232 4.3139 111 248 54

M251 40.5621 3.3221 102 275 33

M251 23.5891 2.1002 55 134 9

M251 54.0016 3.9195 135 351 56

M251 52.2429 4.0187 114 328 55

M251 33.9556 2.7189 160 249 23

M259 22.6511 1.6672 85 100 5

M259 7.9276 0.5921 58 22 2

M259 37.7253 2.9172 85 196 26

M259 43.8913 3.5683 96 330 48

M259 43.7922 3.4227 83 340 51

M259 24.7169 1.5167 58 76 10

M259 14.1849 1.058 41 32 6

M267 76.3941 5.6615 187 392 54

M267 15.2018 1.2846 38 113 9

M267 0.8922 0.0621 14 2 0

M267 29.8928 2.5384 100 124 15

M267 35.0766 3.3561 78 262 24

Consortium 8.2179 0.7666 27 37 5

Table A4: Raw Arabidopsis root data for select endophytes grown in MS media supplemented with 1% sucrose.

Isolate code Length (cm) Surface Area (cm2) Tips Forks Crossings

Control 1.8195 0.1679 22 14 0

Control 20.906 1.3876 67 100 16

Control 2.6368 0.2219 35 13 1

Control 11.9066 0.881 62 47 5

M112 28.6883 1.9505 144 149 27

M112 10.2414 0.6683 59 54 7

M132 54.7298 4.2435 146 560 74

M132 40.0094 2.7585 213 284 25

M132 22.8777 1.7594 94 208 21

M175 1.2426 0.1119 11 1 0

M175 2.2524 0.22 26 10 0

M175 2.198 0.2219 25 9 0

M251 32.6168 2.1545 99 124 17

M251 5.8465 0.501 32 33 3

M251 24.2471 1.6393 78 91 8

M251 47.0141 3.7076 120 499 53

M259 49.8231 3.3251 136 293 49

M259 48.4184 3.7682 107 326 36

M259 36.4876 2.6815 98 140 26

M259 37.4354 2.3746 99 201 43

M267 25.3622 1.8858 94 181 20

M267 58.3743 4.1261 131 327 58

M267 35.3685 2.5063 186 192 20

M267 53.4694 3.6419 145 393 77

Consortium 6.2576 0.495 38 42 1

Consortium 13.0759 0.9963 53 70 12

Table A5: Summary of growth promotion results for all endophytes. “+” indicates a positive result, “-“ indicates a negative result, and “ND“ indicates an undetermined result.

General Significant Free- Arabidopsis Arabidopsis living growth growth Sampling nifH nitrogen Phosphate improvement promotion Isolate code site Species identity amplicon fixation solubilization (fresh biomass) (p<0.1) M101 Oil Springs Plantibacter flavus + + - - - Microbacterium M102 Oil Springs phyllosphaerae - - - + - Pseudoclavibacter M103 Oil Springs helvolus - - - - - Microbacterium M104 Oil Springs phyllosphaerae - - - + - M105 Oil Springs Bacillus aryabhattai - - + + - M106 Oil Springs Bacillus aryabhattai - - + + - M107 Oil Springs Bacillus aryabhattai - - + + -

M108 Oil Springs Clavibacter michiganensis - - - + - M109 Oil Springs Clavibacter michiganensis - - - + - M110 Oil Springs Clavibacter michiganensis - - - + - M111 Oil Springs Unknown - - - + - M112 Oil Springs Clavibacter michiganensis - - - + + M113 Oil Springs Unknown + + + + - M114 Oil Springs Clavibacter michiganensis - - - + - M115 Oil Springs Clavibacter michiganensis - - - + - M116 Oil Springs Unknown + + + + - M117 Oil Springs Microbacterium foliorum + + - - - Microbacterium M118 Oil Springs phyllosphaerae - - - + - M119 Oil Springs Unknown ND ND ND ND ND M120 Oil Springs Pseudomonas syringae ND ND ND ND ND M121 Oil Springs Arthrobacter defluvii - - - + - Microbacterium M122 Oil Springs phyllosphaerae + ND + + + M123 Oil Springs Microbacterium sp. Iso-74 ND ND ND ND ND M124 Oil Springs Unknown ND ND ND ND ND M125 Oil Springs Arthrobacter defluvii - - ND ND ND M126 Oil Springs Unknown - - ND + - Chryseobacterium sp. ND M127 Oil Springs ARS188-11 + - + - Chryseobacterium sp. ND M128 Oil Springs ARS188-11 ND - + - Aeromicrobium sp. GWS- M129 Oil Springs BW-H89M - - - + - Curtobacterium M130 Oil Springs flaccumfaciens - - + - - M131 Oil Springs Unknown - - - + - M132 Oil Springs Curtobacterium herbarum - - + + + M133 Oil Springs Pseudomonas sp. NL5 ND ND ND ND ND Curtobacterium sp. WB20- M134 Oil Springs 13 - - + + - Microbacterium M135 Oil Springs phyllospharae - - + + - Mycobacterium M136 Oil Springs aubagnense - - - + - M137 Oil Springs Unknown - - + + + M138 Oil Springs Pseudomonas sp. ABA21 - - + + - Microbacterium M139 Oil Springs phyllospharae + - - + - M140 Oil Springs Unknown - - - + - M141 Oil Springs Arthrobacter pascens + ND + + + M142 Oil Springs Pseudomonas brenneri - - + + - M143 Oil Springs Bacillus aryabhattai - - - + + Curtobacterium M144 Oil Springs flaccumfaciens - - + + - M145 Oil Springs Bacillus aryabhattai - - - + - M146 Oil Springs Arthrobacter pascens - - - - - M147 Oil Springs Rhodococcus erythropolis - - - + - M148 Oil Springs Bacillus aryabhattai ND ND ND ND ND M149 Oil Springs Arthrobacter pascens - - - + - M150 Oil Springs Bacillus aryabhattai - - + + - M151 Oil Springs Bacillus sp. M62 - - - + - M152 Oil Springs Curtobacterium sp. U17 - - + - - Curtobacterium M153 Oil Springs flaccumfaciens - - - + - M154 Oil Springs Bacillus nealsonii - - - + -

Curtobacterium M155 Oil Springs flaccumfaciens - - - + - Curtobacterium M156 Oil Springs flaccumfaciens - - + + + M157 Oil Springs Bacillus aryabhattai - - - + - M158 Oil Springs Bacillus aryabhattai - - - + + M159 Oil Springs Bacillus megaterium - - - + + M160 Oil Springs Bacillus aryabhattai - - - + + M161 Oil Springs Unknown - - - + - M162 Oil Springs Arthrobacter pascens - - + + + M163 Oil Springs Methylobacterium sp. L2-5 - - + - - M164 Oil Springs Bacillus megaterium - - + + - Curtobacterium M165 Oil Springs flaccumflaciens - - + + + M166 Oil Springs Arthrobacter pascens - - - + - M167 Oil Springs Pseudomonas fluorescens - - + + - M168 Oil Springs Sinorhizobium medicae + + - + - M169 Oil Springs Brevundimonas nasdae - - - + - Microbacterium M170 Oil Springs phyllosphaerae - - - + - M171 Oil Springs Unknown + + - + - Pseudomonas sp. ND ND M172 Oil Springs ABAC21 + ND + M173A Oil Springs Xanthomonas gardneri + ND - + - M173B Oil Springs Unknown - - + - - Pseudomonas sp. ND ND ND ND ND M174 Oil Springs ABAC21 Paenibacillus M175 Oil Springs taichungensis + + + + + M176 Oil Springs Unknown ND ND ND ND ND Rhizobium sp. ND C3/Agrobacterium sp. M177 Oil Springs MS2 + - + - M178 Oil Springs Micrococcus sp. MBTD + ND - + + M179 Oil Springs Sphingomonas wittichii ND ND + + - M180 Oil Springs Microbacterium sp. 3502 - - + + - M181 Oil Springs Sphingomonas wittichii + ND - + - Stenotrophomonas M182 Oil Springs rhizophila - - - + - Agrobacterium M183 Oil Springs tumefaciens + ND + - - M184 Oil Springs Plantibacter flavus - - + + - Curtobacterium M185 Oil Springs flaccumfaciens - - + + - M186 Oil Springs Aeromicrobium ND ND ND ND ND M187 Oil Springs Clavibacter michiganensis ND ND ND + - M188 Oil Springs Curtobacterium herbarum - - + - - M189 Oil Springs Unknown - - + + - M190 Oil Springs Microbacterium sp. Iso-74 - - - - - M191 Oil Springs Unknown - - - + - M192 Oil Springs Arthrobacter pascens - - - + - M193 Oil Springs Unknown ND ND ND - - Curtobacterium M194 Oil Springs flaccumfaciens - - + + - M195 Oil Springs Arthrobacter pascens - - - + - M196 Oil Springs Unknown - - + + - M197 Oil Springs Unknown + + - - - Curtobacterium M198 Oil Springs flaccumfaciens - - + + - M199 Oil Springs Bacillus megaterium - - - - -

Curtobacterium M200 Oil Springs flaccumfaciens - - + + - M201 Oil Springs Unknown - - - + - M202 Oil Springs Pseudomonas poae - - + + - M203 Oil Springs Unknown - - - - - Pseudomonas sp. M204 Oil Springs ABAC21 - - + + + Pseudomonas M205 Oil Springs brassicacearum - - - + - Pseudomonas M206 Oil Springs brassicacearum - - + - - M207 Oil Springs Sinorhizobium medicae + ND ND + - M208 Oil Springs Microbacterium oleivorans - - - + - M209 Oil Springs Xanthomonas gardneri + ND - + - M210 Oil Springs Brevundimonas nasdae - - ND + - M211 Oil Springs Brevundimonas nasdae - - ND + - M212 Oil Springs Xanthomonas gardneri + ND - - - Pseudomonas sp. ND ND ND ND ND M213 Oil Springs ABAC21 M214 Oil Springs Unknown - - + ND ND M215 Oil Springs Unknown + ND + + - M216 Oil Springs Unknown ND ND ND ND ND M217 Oil Springs Pseudomonas poae ND ND ND ND ND Pseudomonas sp. ND ND ND ND ND M218 Oil Springs ABAC21 Ensifer ND garamanticus/Sinorhizobiu M219 Oil Springs m sp. T9 - - + - M220 Oil Springs Acinetobacter johnsonii - - ND - - M221 Oil Springs Unknown - - ND - - M222 Oil Springs Acinetobacter johnsonii + ND - + - M223 Oil Springs Unknown - - + - - M224 Oil Springs Bacillus aryabhattai - - + + - M225 Oil Springs Plantibacter flavus - - - + - M226 Oil Springs Microbacterium sp. C10d - - - + - M227 Oil Springs Clavibacter michiganensis - - - ND ND Microbacterium sp. TMB3- M228 Oil Springs 14 - - - + - M229 Oil Springs Clavibacter michiganensis - - + ND ND M230 Oil Springs Bacillus aryabhattai - - + + + M231 Oil Springs Paenibacillus sp. 9-1 + ND ND + - Rhizobiales sp. BGM3/Agrobacterium M232 Oil Springs tumefaciens + ND + + - M233 Oil Springs Staphylococcus sp. H-179 - - ND + - M234 Oil Springs Unknown - - - ND ND M235 Oil Springs Plantibacter cousiniae - - + + - M236 Oil Springs Unknown + ND + + + M237 Oil Springs Bacillus sp. SZ-5 + ND ND - - M238 Oil Springs Plantibacter flavus - - + + - M239 Oil Springs Unknown - - + + - M240 Oil Springs Unknown - - + - - M241 Oil Springs Brevundimonas nasdae - - - + + M242 Oil Springs Unknown - - ND + + M243 Oil Springs Microbacterium sp. HKA7 - - + + + M244 Oil Springs Microbacterium sp MVC3 - - ND + - Methylobacterium sp. M245 Oil Springs NG05 - - - + + M246 Oil Springs Plantibacter flavus + ND - ND ND M247 Oil Springs Unknown + ND + + -

M248 Oil Springs Unknown ND ND ND ND ND M249 Oil Springs Unknown - - - + - M250 Oil Springs Unknown + - + + - M251 Oil Springs Plantibacter flavus - - + + + Microbacterium M252 Oil Springs phyllosphaerae - - + - - M253 Oil Springs Microbacterium sp. HKA7 - - - ND ND M254 Oil Springs Unknown ND ND ND ND ND Agrobacterium M255 Oil Springs tumefaciens + ND - - - M256 Oil Springs Unknown - - + ND ND M257 Oil Springs Unknown - - + ND ND M258 Oil Springs Plantibacter flavus - - + ND ND M259 Oil Springs Plantibacter flavus - - + + + M260 Oil Springs Unknown ND ND ND ND ND M261 Oil Springs Unknown + ND - ND ND Stenotrophomonas ND M262 Oil Springs rhizophila + - + - M263 Oil Springs Pseudomonas Erb9 ND ND ND ND ND M264 Oil Springs Microbacterium foliorum - - - ND ND M265 Oil Springs Unknown - - - ND ND M266 Oil Springs Plantibacter flavus - - - ND ND Rhizobium M267 Oil Springs selenitireducens - - - + + M268 Oil Springs Unknown - - - ND ND M269 Oil Springs Unknown - - + ND ND M270 Oil Springs Sinorhizobium medicae - - ND ND ND Plantibacter sp. PDD-26b- ND ND M271 Oil Springs 21 - - + M272 Oil Springs Unknown - - + + - M273 Oil Springs Unknown + ND ND ND ND Rhizobiales sp. BGM3/Agrobacterium M274 Oil Springs tumefaciens + - - + - M275 Oil Springs Microbacterium foliorum - - - ND ND M276 Oil Springs Unknown - - + ND ND Rhizobiales sp. ND ND BGM3/Agrobacterium M277 Oil Springs tumefaciens + ND - Paenibacillus ND ND ND M278 Oil Springs xylanexedens - - M279 Oil Springs Unknown - - + - - M280 Oil Springs Unknown + ND - + - M281 Oil Springs Unknown - - ND - - M282 Oil Springs Bacillus aryabhattai - - - ND ND M283 Oil Springs Unknown + - - + - M284 Oil Springs Unknown - - ND - - M285 Oil Springs Unknown ND ND ND ND ND J1 Oil Springs Pantoea agglomerans + ND + - - J2 Oil Springs Pantoea agglomerans + ND ND ND ND J3 Oil Springs Pantoea agglomerans + + + + - J4 Oil Springs Pantoea agglomerans + ND ND - - J5 Oil Springs Pantoea agglomerans - - + - - J6 Oil Springs Pantoea agglomerans + ND ND ND ND J7 Oil Springs Bacillus sp. BJ61 - - ND + - Agrobacterium J8 Oil Springs tumefaciens strain At4 + ND - - - J9 Oil Springs Pantoea agglomerans + + + + - Pseudomonas fulva strain J10 Oil Springs 6 - - + - -

J11 Oil Springs Unknown + ND + ND ND J12 Oil Springs Microbacterium testaceum + + + - - J13 Oil Springs Labedella gwakjiensis + - + + - J14 Oil Springs Unknown - - - ND ND J15 Oil Springs Rhizobium sp. CR 5-1 ND ND - ND ND Stenotrophomonas ND ND rhizophila strain J16 Oil Springs UepopsAL100-06 - - - J17 Oil Springs Pantoea agglomerans + + - - - Paenibacillus illinoisensis ND ND J18 Oil Springs strain WR_17 - - - J19 Oil Springs Unknown - - - + - Stenotrophomonas sp. J20 Oil Springs DoB48 - - - - - Curtobacterium J21 Oil Springs flaccumfaciens + + - + - Xanthomonas campestris J22 Oil Springs pv. campestris strain TUr1 - - - + - Curtobacterium J23 Oil Springs flaccumfaciens - - - + - J24 Oil Springs Paenibacillus sp. Q1-R10 - - + - - Stenotrophomonas J25 Oil Springs maltophilia + + - - - Acetobacter pasteurianus ND ND J26 Oil Springs strain RS172 - - - J27 Oil Springs Unknown - - - + - Stenotrophomonas J28 Oil Springs chelatiphaga strain LPM-5 + - - - - J29 Oil Springs Curtobacterium - - ND ND ND J30 Oil Springs Bacillus sp. PPB17 - - - - - J31 Oil Springs Unknown - - - + - Microbacterium testaceum J32 Oil Springs StLB037 - - + - - Brevundimonas sp. J33 Oil Springs GC044 - - - - - Plantibacter J34 Oil Springs cousiniae/flavus + + + - -

J35 Oil Springs Rhizobium sp. G3Ec1 - - - - - Microbacterium J36 Oil Springs hatanonis/oxydans - - - - - J37 Oil Springs Pantoea agglomerans - - + ND ND J38 Oil Springs Unknown - - + + -

Stenotrophomonas J39 Oil Springs rhizophila strain SN1 + + - - - J40 Oil Springs Bacillus - - + - - J41 Oil Springs Unknown - - + + - J42 Oil Springs Unknown - - - ND ND J43 Oil Springs Unknown - - + - - J43C Oil Springs Bacillus pumilus - - + - - J44 Oil Springs Unknown - - - - - J45 Oil Springs Unknown - - ND - - J46 Oil Springs Unknown - - - - - J47 Oil Springs Unknown + + ND + - Stenotrophomonas J48 Komoka rhizophila - - - - - Microbacterium J49 Komoka hydrocarbonoxydans + + - + -

Stenotrophomonas ND J50 Komoka rhizophila - - - - J51 Komoka Unknown ND ND ND ND ND J52 Komoka Pantoea agglomerans + + + ND ND J53 Komoka Serratia ficaria - - + + + J54 Komoka Bacillus megaterium - - - - - J55 Oil Springs Paenibacillus amylolyticus - - - - - Bacillus/Paenibacillus J56 Oil Springs amylolyticus - - - + - J57 Oil Springs Unknown + ND - + + J58 Oil Springs Unknown - - ND ND ND J59 Oil Springs Pantoea agglomerans + ND + + - J60 Oil Springs Pseudomonas - - + - - J61 Oil Springs Rhizobium sp. A2Ec4 + - - - - J62 Oil Springs Unknown - - - + - Microbacterium ND ND J63 Oil Springs hydrocarbonoxydans + ND - J64 Oil Springs Xanthomonas campestris - - ND ND ND J65 Oil Springs Unk + + ND + - J66 Komoka Pantoea agglomerans + + + - - J67 Komoka Serratia plymuthica - - + - - J68 Oil Springs Unknown - - - - - J69 Oil Springs Unknown - - - + - J70 Oil Springs Unknown - - - + - J71 Oil Springs Unknown - - ND ND ND J72 Oil Springs Unknown - - - ND ND J73 Komoka Unknown - - - + - J74 Komoka Unknown + + + - - J75 Komoka Unknown - - - + - J76 Komoka Unknown + + + - - J77 Komoka Sanguibacter inulinus - - - - - J78 Komoka Pantoea agglomerans + ND + + - J79 Komoka Pantoea agglomerans + + + ND ND J80 Komoka Microbacterium testaceum - - - ND ND J81 Komoka Microbacterium testaceum - - + + - J82 Komoka Plantibacter cousiniae - - - ND ND J83 Komoka Pantoea agglomerans - - + - - Microbacterium J84 Komoka hydrocarbonoxydans - - - + - J85 Komoka Erwinia - - + - - J86 Komoka Unknown - - ND ND ND Stenotrophomonas ND ND ND ND J87 Komoka rhizophila - Stenotrophomonas ND ND J88 Komoka maltophilia - - - J89 Komoka Pseudomona putida - - + - - J90 Oil Springs Unknown + ND ND ND ND J91 Oil Springs Unknown ND ND - ND ND J92 Oil Springs Unknown - - - + + J93 Komoka Unknown ND ND ND ND ND J94 Komoka Unknown ND ND ND ND ND J95 Oil Springs Unknown - - ND - - J96 Oil Springs Unknown - - + - - J97 Oil Springs Labedella gwakjiensis - - ND + - J98 Oil Springs Labedella gwakjiensis - - ND - - J99 Oil Springs Unknown - - + - - J100 Komoka Unknown ND ND ND ND ND J101 Komoka Unknown ND ND ND ND ND Stenotrophomonas J102 Oil Springs maltophilia - - - + -

Stenotrophomonas J103 Oil Springs rhizophila - - - - - J104 Komoka Unknown ND ND ND ND ND J105 Komoka Unknown - - - - - J106 Komoka Unknown - - - ND ND

Stenotrophomonas J107 Komoka rhizophila strain S8 - - - - - J108 Komoka Stenotrophomonas - - - + - J109 Komoka Pseudomonas + ND + + - J110 Komoka Unknown ND ND ND ND ND ND ND Stenotrophomonas J111 Komoka maltophilia - - - J112 Komoka Achromobacter - - + + - J113 Komoka Unknown ND ND ND ND ND J114 Komoka Pseudomonas - - + + - J115 Oil Springs Unknown - - + + - J116 Oil Springs Unknown - - + ND ND J117 Oil Springs Unknown - - - ND ND J118 Oil Springs Unknown - - - ND ND J119 Oil Springs Unknown + ND ND ND ND J120 Oil Springs Unknown + ND ND ND ND J121 Oil Springs Unknown - - - ND ND J122 Oil Springs Unknown ND ND ND ND ND J123 Oil Springs Unknown - - - ND ND J124 Oil Springs Unknown - - ND ND ND J125 Oil Springs Unknown + ND ND ND ND J126 Oil Springs Unknown - - - ND ND J127 Oil Springs Unknown - - + ND ND J128 Oil Springs Unknown - - ND ND ND J129 Komoka Pseudomonas putida + ND - - - Agrobacterium ND J130 Komoka tumefaciens ND - + - J131 Komoka Serratia ficaria + ND ND ND ND J132 Komoka Unknown - - ND ND ND J133 Oil Springs Microbacterium yanicii - - - ND ND

Appendix B: Manuscript

The novel plant growth-promoting endophyte Plantibacter flavus improves shoot growth, total root length, and lateral root production of Arabidopsis thaliana

Authors: Evan Mayer (University of Toronto Scarborough) 1065 Military Trail Toronto, Ontario, Canada

Patricia Dörr de Quadros (University of Toronto Scarborough) 1065 Military Trail Toronto, Ontario, Canada

Corresponding author: Roberta Fulthorpe (University of Toronto Scarborough) 1065 Military Trail Toronto, Ontario, Canada Tel: 416-287-7221 Email: [email protected]

Abstract Plantibacter flavus strain 251 is a novel plant growth-promoting bacterium. The strain was previously isolated from the stem tissues of an Achillea millefolium plant growing in soils highly contaminated with petroleum hydrocarbons. This strain was already known to have hydrocarbon degradation capabilities; however in addition it was shown to exhibit plant growth promotion through a large screen of endophytes from this site. Of 182 bacterial endophytes tested, 24 isolates significantly improved Arabidopsis thaliana growth in comparison to uninoculated control plants. Two strains of Plantibacter flavus, including strain 251, were among the five most beneficial isolates. These five were examined in more detail and found to significantly improve Arabidopsis shoot growth, root growth, and fresh biomass over uninoculated plants. Plantibacter flavus strain 251 increased Arabidopsis fresh biomass and total root length by 4.7 and 5.8 times respectively over control plants. The sequenced genome of P. flavus strain 251 was annotated and found to contain 79 known plant beneficial genes, including genes coding for auxin biosynthesis, 1-aminocyclopropane-1-carboxylate deaminase production, carotenoid and flavonoid biosynthesis, and siderophore biosynthesis. To our knowledge this is the first study providing evidence of direct plant growth promotion by Plantibacter flavus.

Keywords: plant growth promotion, Arabidopsis thaliana, Plantibacter flavus, plant-microbe interactions, endophytes

Introduction

Plant growth promoting microbes (PGPM) have been isolated from a wide range of stressful environments, from the saline coast of the Yellow Sea, to acidic and metallic mine tailings, to

the cold deserts of the Himalayas [1-3]. Regardless of the environment, PGPM can be found throughout all different regions of the plant, including the phyllosphere (plant aerial surface), rhizosphere (plant root surface), and endosphere (internal plant tissue) [4]. PGPM can directly improve plant growth through various mechanisms, including improved nutrient acquisition, such as nitrogen and phosphorus uptake through nitrogen fixation [5] and phosphate solubilization [6] respectively, increasing production of plant growth hormones like auxins, cytokinins, and gibberellins [7], and producing stress tolerance enzymes like 1-aminocyclopropane-1- carboxylate (ACC) deaminase [8]. Some other benefits include the breakdown of toxic metals or pollutants and improved iron acquisition and pathogen protection through siderophore production [9].

The majority of previous plant microbiome studies focused on the rhizosphere, while only a small proportion of them examined the endosphere. Endophytes, or non-pathogenic microbes in the endosphere, can enter plants through vertical transmission (from previous plant generations) or from the environment [10]. Most horizontally-transferred endophytes originate from the rhizosphere through entry into seeds or invasion of root tissue [11, 12] though they can also enter from the phyllosphere via leaf stomata [10]. Although it is not well-defined, there is evidence of a selection process by the plant that favors the entry of beneficial microbes into the endosphere [13, 14]. This suggests that the relatively unexplored endosphere would be a promising area to examine for the discovery of new PGPM.

PGPM have great potential for improving plant yield in agriculture through usage in biofertilizers.

Traditionally, agriculture has relied on chemical fertilizers to provide plants with essential nutrients that may be limited in soil. The downsides to using chemical fertilizers are that they have long-term detrimental effects on the environment: they can leave residual salts in soils

which decrease long-term soil fertility, enter bodies of water through run-off resulting in eutrophication [15], and decrease overall biodiversity [16]. Biofertilizers, which contain beneficial microorganisms or natural compounds originating from microbes [17] are an environmentally- friendly alternative to chemical fertilizers. Biofertilizers are also advantageous in that they are more cost-efficient, provide a renewable source of nutrients, and can provide plants with a multitude of different benefits [18]. Currently, biofertilizers are most commonly used as a means of improving crop nitrogen uptake through application of nitrogen-fixing bacteria like

Azotobacter, Azospirillum, and Rhizobium species [19].

The main limitation for using biofertilizers is that their benefits are dependent on the capability of plant-microbe associations. Plant benefits like nutrients, phytohormones, and siderophores are only available if they can be synthesized by microbes when associated with plants; however, plant-microbe associations can differ depending on plant species and environmental conditions

[20]. If the interaction is not favorable then the growth of microbes may be limited, meaning that plant benefits from biofertilizers would be minimal. It is therefore important to discover a wide variety of PGPM that will improve the effectiveness and versatility of biofertilizers throughout different plants and environments.

The aim of our study was to examine a collection of 220 bacterial endophytes for plant growth promotion abilities. The collection derived primarily from plants growing in an oil field developed over a natural oil seep (petroleum contamination of 250,000-300,000ppm) [21]. However, despite the toxicity of oil residues at the site plant growth was unimpeded. Based on the soil conditions of the site and evidence of plant growth promotion in other hydrocarbon- contaminated environments [22, 23], we hypothesized that these plants contain beneficial bacterial endophytes that are facilitating their survival through hydrocarbon degradation and

direct improvement of shoot and root growth. Hydrocarbon degradation was previously examined and found to be present in the collection [21], so the focus of this study was on direct plant growth promotion. To identify PGPM, the endophyte collection was screened using in planta rapid screens with Arabidopsis thaliana (hereby referred to as Arabidopsis) and the most promising bacteria were examined using more reliable in planta tests. Arabidopsis was used because its in vitro growth preferences are well-known and it has small seeds, making it advantageous for high-throughput laboratory screening procedures.

Materials and Methods

Plant sampling and endophyte isolation

The 182 endophytes screened in this study were previously isolated in 2013 by Lumactud et al.

(2016) [21] from stems of plants growing in oil-soaked soil in Oil Springs, Ontario, Canada.

Briefly, stem samples were taken from five different plant species, then surface sterilized and macerated into a solution using a blender. The solution was spread onto tryptic soy agar (TSA) and Reasoner’s 2A agar (R2A) plates, which were incubated at 28°C. Distinct colonies were selected and streaked onto TSA to create pure bacterial cultures. For more details on the sampling site and bacterial isolation process refer to Lumactud et al. (2016) [21].

Bacterial cultures

Bacterial isolates were streaked from glycerol stock cultures onto TSA or R2A plates, which were incubated at 28°C for 3 days to allow for growth. Isolated colonies from these plates were transferred into tubes containing 10 mL tryptic soy broth (TSB), which were then incubated at

28°C and 128rpm for 2 days.

Seed sterilization

Arabidopsis Col-0 seeds were surface sterilized in a microcentrifuge tube using the following protocol: wash with reverse osmosis water for 30 seconds, sterilization with 95% ethanol for 15 seconds, sterilization with 1% bleach for 2 minutes, inactivation of remaining bleach with 2% sodium thiosulfate for 10 minutes [24], and 6 washes with sterile water for 15 seconds each. For each step, 1 mL of the liquid was mixed with seeds via pipetting for the given length of time, after which seeds were allowed to settle to the bottom of the tube and surface liquid was removed and discarded.

To confirm the effectiveness of the sterilization procedure, 200µL of the final wash water was spread onto one TSA and R2A plate. Plates were incubated at 28°C for 4 days and examined for growth. A lack of growth on either plate indicated that the sterilization procedure was successful.

Plant inoculation and growth - in planta rapid screening tests

In planta screening tests were conducted with the 182 endophyte isolates to determine if direct plant growth promotion was present in the collection and to identify the most promising PGPM.

Sterilized seeds were inoculated with endophytes by soaking them in 1 mL of TSB bacterial culture (treatments) or sterile TSB (controls) for 2 hours. Individual seeds were then sown onto

1X Murashige and Skoog (MS) agar (pH adjusted to ~6.0) in wells of a 96-well microtiter plate.

Each microtiter plate contained twelve control plants and four plant replicates per treatment.

Plates were stored at 4°C for 3 days to allow for seed stratification, then transferred under a 68- watt FloraLight 16h/8h day-night light source at room temperature to allow for growth. Number of leaves, stem height, number of buds, and number of flowers were recorded for each plant every 3 or 4 days. At the end of the growth period (29 or 30 days) plants were extracted and fresh biomass was weighed using an analytical scale. Results for each category were analyzed

in R (see section on statistical analysis). Data from seeds that did not germinate were excluded from analysis.

Plant inoculation and growth - in planta tests on select endophytes

To quantify plant growth promotion more accurately, select in planta tests were conducted on five of the best performing PGPM as selected from the screening test. Sterilized seeds were sown onto Petri plates containing 1X MS agar and stored at 4°C for 3 days to allow for seed stratification, then transferred under a FloraLight 16h/8h day-night light source at room temperature to grow for 4 days. Seedlings were aseptically removed using sterilized forceps and inoculated into 1 mL of TSB bacterial culture for each of the five endophytes selected from the screening tests (bacterial treatments) or sterile TSB (controls) for 30 minutes. To ensure relatively consistent concentrations, bacterial culture densities were adjusted via centrifugation to approximately 2.4 x 108 cells/mL before seedling inoculation.

Inoculated seedlings were transferred to Magenta GA-7 boxes containing 150 mL of 1X MS agar. Two GA-7 boxes containing four seedlings each (eight replicates in total) were used for all treatments and controls. Lids of GA-7 boxes were left slightly open (i.e. not sealed tightly) to facilitate gas exchange. GA-7 boxes were transferred to the 68-watt FloraLight 16h/8h light source to allow for plant growth. Number of leaves, buds, flowers, and stem height were recorded every 3 or 4 days. At 21 days after inoculation plants were extracted from the agar and roots were rinsed with deionized water to remove residual media. Extracted plants were weighed with an analytical scale to measure fresh biomass. Roots were then removed from shoots, scanned, and analyzed using the WinRhizo software. Results for each category were analyzed in R (see section below on statistical analysis). Data from plants which never grew

100

more than four leaves were excluded from analysis, as they were thought to be damaged during the seedling transfer process.

Statistical analysis

To evaluate the effects of each endophyte on Arabidopsis growth, results for each category were compared between control plants and plants inoculated with each endophyte treatment.

Before analysis, data were normalized using the Tukey ladder of power. Comparisons of transformed data were evaluated using a one-way ANOVA followed by a Dunnett’s test post- hoc. Statistical significance was noted at a probability level of p<0.05. All data transformations and statistical analyses were done in R version 3.4.2 using the rcompanion and multcomp packages respectively. For data visualization, box plots were created in R using the boxplot function.

Isolate identification

Bacteria species of isolates M132, M175, M259, and M267 were identified by Sanger sequencing of 16S rDNA regions. Genomic DNA was extracted from TSB cultures using the

DNeasy Blood & Tissue Kit (QIAGEN). 16S rDNA regions were amplified through 20µL PCR reactions containing 10µL HotStart Taq Master Mix, 1µL of both forward and reverse 16S- specific primers (forward: AGAGTTTGATCCTGGCTCAG, reverse: TACCTTGTTACGACTT), and 1µL genomic DNA template. The amplification protocol was as follows: initial denaturation at 95°C for 5:00, followed by 35 cycles of (denaturation at 94°C for 1:00, primer annealing at

55°C for 1:00, and extension at 72°C for 1:30), finished with a final extension at 72°C for 10:00.

PCR products were visualized via gel electrophoresis with a 1% agarose gel, then purified using the QIAquick PCR Purification Kit (QIAGEN) and analyzed using the NanoDrop 1000

Spectrophotometer (Thermo Scientific). Purified PCR products were sent to The Centre for

101

Applied Genomics (SickKids Hospital, Toronto, Canada) for Sanger sequencing. Species were identified by comparing sequence results to GenBank 16S rDNA sequences using NCBI

BLAST.

Identification of plant growth promotion genes

To obtain a better understanding of its plant growth promotion ability, the genome of M251

(previously sequenced by Lumactud et al. [25]) was annotated using PATRIC version 3.5.17

[26] and the RAST server [27] and searched for potential plant beneficial genes.

Results

In planta rapid screening tests

From screening tests, 24 of the 182 endophytes in the collection showed plant growth promoting effects on Arabidopsis as measured by significant (p<0.05) increases number of buds and flowers, stem height, and/or fresh biomass compared to control plants (shown in Table 1). Five of the most promising plant growth-promoting bacteria were selected for further examination based on their growth improvement in multiple categories (Table 1). Isolate codes for these select bacteria were M132, M175, M251, M259, and M267.

Effects of select endophytes on Arabidopsis fresh biomass and shoot growth

The effects of isolates M132, M175, M251, M259, and M267 on shoot growth and fresh biomass of Arabidopsis plants at 21 days after inoculation (DAI) are shown in Table 2 and Figure 1 respectively. Inoculation with all isolates except for M267 resulted in significant improvement in biomass and/or shoot growth. The greatest beneficial effects were seen in plants inoculated with

M251: they showed significant improvement in fresh biomass at 21 DAI (4.7x increase over

102

controls, p<0.001), number of leaves (p<0.01), and number of buds at 21 DAI (p<0.05) compared to control plants.

Significant increases in growth were seen in plants inoculated with M259 for number of leaves

(p<0.05) and biomass (3.3x increase, p<0.05), M132 for number of leaves (p<0.05) and biomass (2.9x increase, p<0.05), and M175 for number of leaves (p<0.05). Although the stem height and number of flowers were considerably greater for all endophyte treatments than control plants, the differences were not found to be statistically significant.

Effects of select endophytes on Arabidopsis root growth

The effects of select inocula on Arabidopsis total root length and root tip abundance at 21 DAI are shown in Figures 2 and 3 respectively. Inoculation with all five isolates improved root growth. Inoculation with M251 had the greatest effect, increasing total root length by 5.8 times

(p<0.001), and root tip abundance by 3.9 times (p<0.001) over control plants. Significant improvements in Arabidopsis root growth were also seen from inoculation with M132 (4.1x increase in total root length, p<0.01; 3.4x increase in root tip abundance, p<0.01), M175 (3.5x increase in root tip abundance, p<0.01), M259 (3.6x increase in total root length, p<0.05; 2.5x increase in root tip abundance, p<0.05), and M267 (4.1x increase in total root length, p<0.05;

2.9x increase in root tip abundance, p<0.05).

Isolate identification

Species identities of select isolates are shown in Table 3. Isolate M132 was identified as

Curtobacterium herbarum, M175 as Paenibacillus taichungensis, M259 as Plantibacter flavus, and M267 as Rhizobium selenitireducens. Isolate M251 had previously been identified as

103

Plantibacter flavus strain 251 by Lumactud et al. (2017) [25]. GenBank accession numbers for the 16S datasets analyzed in this study are mentioned in Table 3.

Plant beneficial genes in M251

Beneficial gene products found in the annotated genome of P. flavus strain 251 are described in

Table 4. Seventy-nine genes with potential plant beneficial effects were discovered in eleven different metabolic pathways present in the genome of M251. Of these 79 favorable genes, the most noteworthy were auxin and cytokinin, ACC deaminase, and carotenoid and flavonoid biosynthesis genes. The majority of genes identified (50) were involved in siderophore production and various antibiotic production pathways.

Discussion

This is the first study to report that Plantibacter flavus can provide direct benefits for plant growth. We discovered evidence of significant plant growth promotion throughout our endophyte collection, suggesting that stem endophytes are likely benefitting plant growth in the crude oil- contaminated soils at Oil Springs. We conclusively showed that five bacteria from Oil Springs, including two strains of P. flavus, directly improve the growth of Arabidopsis in a laboratory setting.

Plant growth promotion by Plantibacter flavus

In terms of shoot growth and fresh biomass, the largest and most developed Arabidopsis plants were those inoculated with the two strains of Plantibacter flavus. When looking at the root data, it is interesting to note that both strains significantly increased the abundance of root tips in addition to total root length. Root tip abundance was measured because it gives an indication of lateral root production - plants with more root tips should contain more lateral root formations.

104

Lateral roots are important for facilitating nutrient and water uptake by increasing root surface area and improving plant anchorage into the ground [28]. Although the growth rate of lateral roots is dependent on environmental factors, it is also stimulated by auxins [29]. Based on our results we can conclude that these two strains of Plantibacter flavus provide direct benefits for

Arabidopsis leaf growth, total root length and lateral root production.

Bacteria of the genus Plantibacter have been found in association with a variety of plants, including the phyllosphere of grasses [30], the endosphere of yarrow, goldenrod, dactylis and clover [21], and the rhizosphere of wheat [31], maple sap [32], and rye flakes [33]. There is indirect evidence in literature that P. flavus may provide benefits for plant growth: strains have been seen to solubilize zinc in soil, making it accessible for plants [31] and degrade hydrocarbon contaminants [21] which could improve plant survival in polluted environments.

However, prior to this study there was a lack of evidence for direct plant growth promotion by

Plantibacter species, making our findings a novel discovery.

Genomic analysis of P. flavus strain 251 revealed the presence of auxin genes as well as a variety of other beneficial genes for plant growth. Phytohormones like auxins and cytokinins play important roles in stimulating plant growth and development throughout all cell types [34].

Flavonoids are plant pigments that protect plants against damage from UV-B light, microbial pathogens, and animal herbivory [35] while carotenoids are pigments that function in photosynthesis, photoprotection, and growth regulation [36]. The presence of an ACC deaminase gene benefits plant survival in stressful environments, as ACC deaminase breaks down excess stress ethylene, increasing plant growth and reducing stress symptoms [37]. The most prevalent genes were related to the production of siderophores, which are compounds with a high affinity to iron. Siderophores can provide microbes with a competitive edge, as they allow them to out-compete non-siderophore producing microbes for available iron [9]. This is

105

especially important in the endosphere where siderophore production can allow beneficial microbes to out-compete plant pathogens [38, 39]. The presence of a large number of siderophore and antibiotic biosynthesis genes suggests that P. flavus strain 251 may have a role in plant pathogen protection. The presence of hydrocarbon degradation genes is not surprising considering the soil conditions of the sampling site and our previous knowledge of its hydrocarbon-degradation abilities [21]. These degradation genes, combined with the presence of ACC deaminase, suggest that P. flavus strain 251 could be a useful bacterium for improving plant survival in hydrocarbon-stressed environments.

The search for plant beneficial genes was conducted to discover possible explanations for the observed plant growth-promoting ability of P. flavus strain 251 on Arabidopsis. Many of the traits discovered, like siderophores, antibiotic resistance, and ACC deaminase, seem more likely to be beneficial in a natural environment, where competition, pathogenicity, and unfavorable abiotic conditions may be more prevalent factors. When looking at controlled laboratory studies with favorable growth conditions, one of the largest contributors to microbial plant growth promotion is often found to be increased auxin production [40-42]. Since auxin production genes were present in P. flavus strain 251, this leads us to believe that increased auxin production was the primary mechanism behind the observed growth improvements.

Bacteria of the genus Plantibacter are classified as members of Microbacteriaceae, which is a family that contains many other plant associated genera. Within Microbacteriaceae, Plantibacter is most closely related to the genus Okibacterium, followed by Microbacterium [43]. Strains of both of these genera have been discovered inside the plant endosphere [44, 45], with certain strains of Microbacterium having also been identified as plant growth promoting bacteria [46-

48]. Another closely related genus is Curtobacterium, which is a known plant pathogen [49, 50] but can also be a plant growth promoter [51-54] depending on the strain. The similarity of

106

Plantibacter to other known plant growth promoting genera leads us to believe that other strains of Plantibacter, along with the two discovered in this study, are also likely to be beneficial for plants.

Plant growth promotion by non-Plantibacter isolates

The other three isolates (M132, M175, and M259) also showed to be beneficial for Arabidopsis growth. Inoculation with M132 (Curtobacterium herbarum) improved both root and shoot growth.

As previously mentioned, Curtobacterium strains have been noted as both plant pathogens and plant growth promoters. Examples of plant growth promotion by Curtobacterium include improving rice and barley salinity tolerance [51, 52] increasing saffron yield [53], and protecting against the plant pathogen Pseudomonas syringae [54]. Inoculation with M175 (Paenibacillus taichungensis) was especially beneficial for Arabidopsis shoot growth. Similar examples of plant growth promotion by Paenibacillus species have been noted in laboratory [55] and field studies

[56, 57] throughout literature. Conserved plant beneficial genes, including those for phosphate solubilization, auxin production, and nitrogen fixation, have also been seen throughout different strains of Paenibacillus [58]. Inoculation with M267 (Rhizobium selenitireducens) increased

Arabidopsis total root length and root tip abundance. Bacteria of the genus Rhizobium are typically associated with the nitrogen fixation process in root nodules of leguminous plants.

However, they have also been observed to benefit the growth of non-legumes, such as peppers and tomatoes, and produce plant benefits like auxins and siderophores [59]. Our study provides further evidence that strains of Curtobacterium, Paenibacillus, and Rhizobium can provide direct plant growth benefits.

In summary

This study identified Plantibacter flavus as a novel plant growth promoting bacterium and confirmed the effectiveness of Curtobacterium, Paenibacillus, and Rhizobium as plant growth

107

promoters. The best performing isolate on Arabidopsis growth, Plantibacter flavus strain 251, contained a wide range of plant growth promotion genes. Experiments examining the beneficial effects of P. flavus strain 251 on the growth of agricultural crops are currently underway and also show promising results, suggesting that P. flavus strain 251 should be considered for usage in future biofertilizers.