DOCSLIB.ORG

Plasmodium Knowlesi Apical Membrane Antigen 1 Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Plasmodium Knowlesi Apical Membrane Antigen 1 Gene Low levels of polymorphisms and no evidence for diversifying selection on the Plasmodium knowlesi Apical Membrane Antigen 1 gene. Bart W Faber, Khamisah Abdul Kadir, Roberto Rodriguez-Garcia, Edmond J Remarque, Frederick A Saul, Brigitte Vulliez-Le Normand, Graham A Bentley, Clemens H M Kocken, Balbir Singh To cite this version: Bart W Faber, Khamisah Abdul Kadir, Roberto Rodriguez-Garcia, Edmond J Remarque, Frederick A Saul, et al.. Low levels of polymorphisms and no evidence for diversifying selection on the Plasmodium knowlesi Apical Membrane Antigen 1 gene.. PLoS ONE, Public Library of Science, 2015, 10 (4), pp.e0124400. 10.1371/journal.pone.0124400. pasteur-01256155 HAL Id: pasteur-01256155 https://hal-pasteur.archives-ouvertes.fr/pasteur-01256155 Submitted on 14 Jan 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License RESEARCH ARTICLE Low Levels of Polymorphisms and No Evidence for Diversifying Selection on the Plasmodium knowlesi Apical Membrane Antigen 1 Gene Bart W. Faber1*, Khamisah Abdul Kadir2, Roberto Rodriguez-Garcia1, Edmond J Remarque1, Frederick A. Saul3,4¤a, Brigitte Vulliez-Le Normand3,4¤b, Graham A. Bentley3,4¤c, Clemens H. M. Kocken1, Balbir Singh2* 1 Department of Parasitology, Biomedical Primate Research Centre, Rijswijk, The Netherlands, 2 Malaria Research Centre, Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak, Kuching, Sarawak, Malaysia, 3 Institut Pasteur, Unité d’Immunologie Structurale, Département de Biologie Structurale et Chimie, Paris, France, 4 CNRS URA 2185, Paris, France ¤a Current address: Institut Pasteur, Plate-forme de Cristallographie, Département de Biologie Structurale et Chimie, CNRS UMR 3528, Paris, France ¤b Current address: Institut Pasteur, Unité de Microbiologie Structurale, Département de Biologie OPEN ACCESS Structurale et Chimie, CNRS UMR 3528, Université Paris Diderot, Sorbonne Paris Cité, Microbiologie Citation: Faber BW, Abdul Kadir K, Rodriguez- Structurale, Paris, France ¤ Garcia R, Remarque EJ, Saul FA, Vulliez-Le c Current address: Institut Pasteur, Paris, France * [email protected] (BWF); [email protected] (BS) Normand B, et al. (2015) Low Levels of Polymorphisms and No Evidence for Diversifying Selection on the Plasmodium knowlesi Apical Membrane Antigen 1 Gene. PLoS ONE 10(4): Abstract e0124400. doi:10.1371/journal.pone.0124400 Academic Editor: Georges Snounou, Université Infection with Plasmodium knowlesi, a zoonotic primate malaria, is a growing human health Pierre et Marie Curie, FRANCE problem in Southeast Asia. P. knowlesi is being used in malaria vaccine studies, and a num- Received: December 23, 2014 ber of proteins are being considered as candidate malaria vaccine antigens, including the Apical Membrane Antigen 1 (AMA1). In order to determine genetic diversity of the ama1 Accepted: March 3, 2015 gene and to identify epitopes of AMA1 under strongest immune selection, the ama1 gene of Published: April 16, 2015 52 P. knowlesi isolates derived from human infections was sequenced. Sequence analysis Copyright: © 2015 Faber et al. This is an open of isolates from two geographically isolated regions in Sarawak showed that polymorphism access article distributed under the terms of the in the protein is low compared to that of AMA1 of the major human malaria parasites, P. fal- Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any ciparum and P. vivax. Although the number of haplotypes was 27, the frequency of muta- medium, provided the original author and source are tions at the majority of the polymorphic positions was low, and only six positions had a credited. variance frequency higher than 10%. Only two positions had more than one alternative Data Availability Statement: Sequence data are amino acid. Interestingly, three of the high-frequency polymorphic sites correspond to in- deposited at the Genbank repository, under variant sites in PfAMA1 or PvAMA1. Statistically significant differences in the quantity of accession numbers KP067834 to KP067885. three of the six high frequency mutations were observed between the two regions. These Funding: This work was supported by: European analyses suggest that the pkama1 gene is not under balancing selection, as observed for Commission EUROMALVAC2 (contract QLK2-CT- pfama1 pvama1 2002-01197), The Centre National de la Recherche and , and that the PkAMA1 protein is not a primary target for protective hu- Scientifique, The Universiti Malaysia Sarawak (grant moral immune responses in their reservoir macaque hosts, unlike PfAMA1 and PvAMA1 in number 01(TD03)/1003/2013(01)), European humans. The low level of polymorphism justifies the development of a single allele Commission EMVDA grant LSHP-CT-2007-037506, PkAMA1-based vaccine. E(M)VI, The European (Malaria) Vaccine Initiative, and Universiti of Sarawak: Grant E14054/F05/54/PKI/ PLOS ONE | DOI:10.1371/journal.pone.0124400 April 16, 2015 1/11 Polymorphisms and Selection on the PkAMA1 Gene 09/2012(01); www.emvda.org; www.euvaccine.eu; Introduction www.evimalar.org; ec.europa.eu/research/health/ Plasmodium infectious-diseases/poverty-diseases/projects/71_en. In the last decade it has become increasingly clear that the simian malaria parasite, htm. The external funders had no role in study knowlesi, is widely distributed in Southeast Asia and can cause severe disease and death in hu- design, data collection and analysis, decision to mans [1,2]. Its distribution coincides largely with the distribution of its natural hosts, the long- publish, or preparation of the manuscript. tailed and pig-tailed macaques, and the Anopheline vectors belonging to the Anopheles leuco- Competing Interests: The authors have declared sphyrus group [1]. P. knowlesi infections in humans were overlooked for a long time as they that no competing interests exist. were misdiagnosed by microscopy as the morphologically similar P. malariae [2]. Today, P. knowlesi is considered a serious threat, responsible for approximately 66% of all hospitalized malaria cases for the year 2013 in Malaysian Borneo [3]. Although P. knowlesi is an ancient parasite that has been infecting humans for a long time [4], such infections are considered to be primarily a zoonotic event. There are no biological barriers that would prevent transmission by mosquitoes from macaques to humans and from humans to humans, and this has been demonstrated under laboratory conditions [5]. The distribution and magnitude of infections by P. knowlesi warrants the development of a vaccine against P. knowlesi. Apical Membrane Antigen 1 (AMA1) is a promising vaccine candi- date (reviewed in [6]). A recent vaccination trial with rhesus monkeys using heterologously ex- pressed P. knowlesi AMA1 (PkAMA1) showed that, after two booster immunizations, five out of six animals were able to control the parasitemia [7]. P. falciparum and P. vivax AMA1 are highly polymorphic molecules, requiring the develop- ment of vaccine strategies to overcome the diversity [8–12]. In order to determine genetic di- versity of the ama1 gene and to identify epitopes on AMA1 under strongest immune selection, the ama1 gene of 52 P. knowlesi isolates derived from human infections was sequenced and analysed. Methods Sample collection: Blood samples were collected from Plasmodium knowlesi malaria patients at Kapit Hospital and Betong Hospital, Sarawak, Malaysia, after written informed consent was obtained. The distance between Kapit Hospital and Betong Hospital is 233 km. This study was approved by the Medical Ethics Committee of Universiti Malaysia Sarawak. DNA was ex- tracted from the blood samples using the QIAamp DNA Blood Midi Kit (Qiagen, Germany). The P. knowlesi ama1 gene was amplified from 65 samples using primers 2334F, GCTACCTG AACTCGGTTGCTA (starting 102 bp upstream from the start codon ATG) and 2335R, ACACCCACAGTTGTTACGACC (ending 57 bp after the stop codon). PCR amplifica- tion was undertaken with the Phusion High-Fidelity DNA Polymerase PCR Kit (Thermo Sci- entific, USA). Amplification was for 35 rounds, with denaturing at 98°C for 7 s, annealing at 63°C for 20 s and elongation at 72°C for 52 s. PCR products were purified using Gel/PCR DNA Fragment Extraction kit (Geneaid, Taiwan) and eluted using 20 μl of elution buffer. The same primers were used for sequencing the full-length pkama1 coding region. Addi- tionally, internal primers 2371F, GGTCCACGATAC and 2370R, TGGTTGATCTGAAGCGCT were used. The latter primers were designed based on preliminary sequencing results which showed that these parts of the gene were fully conserved. Sequencing was performed by Base- clear, Leiden, The Netherlands. Sequences were deposited in the Genbank database [Genbank Accession numbers KP067834-KP067885]. Five samples could not be sequenced with at least one of the four primers used and these were not included in the final analysis. Eight samples showed double signals at positions later identified as polymorphic, indicating multiple infec- tions.
Load more

Recommended publications
  • Flooding Projections from Elevation and Subsidence Models for Oil Palm Plantations in the Rajang Delta Peatlands, Sarawak, Malaysia
    Flooding projections from elevation and subsidence models for oil palm plantations in the Rajang Delta peatlands, Sarawak, Malaysia Flooding projections from elevation and subsidence models for oil palm plantations in the Rajang Delta peatlands, Sarawak, Malaysia Report 1207384 Commissioned by Wetlands International under the project: Sustainable Peatlands for People and Climate funded by Norad May 2015 Flooding projections for the Rajang Delta peatlands, Sarawak Table of Contents 1 Introduction .................................................................................................................... 8 1.1 Land subsidence in peatlands ................................................................................. 8 1.2 Assessing land subsidence and flood risk in tropical peatlands ............................... 8 1.3 This report............................................................................................................. 10 2 The Rajang Delta - peat soils, plantations and subsidence .......................................... 11 2.1 Past assessments of agricultural suitability of peatland in Sarawak ...................... 12 2.2 Current flooding along the Sarawak coast ............................................................. 16 2.3 Land cover developments and status .................................................................... 17 2.4 Subsidence rates in tropical peatlands .................................................................. 23 3 Digitial Terrain Model of the Rajang Delta and coastal
    [Show full text]
  • SARAWAK GOVERNMENT GAZETTE PART II Published by Authority
    For Reference Only T H E SARAWAK GOVERNMENT GAZETTE PART II Published by Authority Vol. LXXI 25th July, 2016 No. 50 Swk. L. N. 204 THE ADMINISTRATIVE AREAS ORDINANCE THE ADMINISTRATIVE AREAS ORDER, 2016 (Made under section 3) In exercise of the powers conferred upon the Majlis Mesyuarat Kerajaan Negeri by section 3 of the Administrative Areas Ordinance [Cap. 34], the following Order has been made: Citation and commencement 1. This Order may be cited as the Administrative Areas Order, 2016, and shall be deemed to have come into force on the 1st day of August, 2015. Administrative Areas 2. Sarawak is divided into the divisions, districts and sub-districts specified and described in the Schedule. Revocation 3. The Administrative Areas Order, 2015 [Swk. L.N. 366/2015] is hereby revokedSarawak. Lawnet For Reference Only 26 SCHEDULE ADMINISTRATIVE AREAS KUCHING DIVISION (1) Kuching Division Area (Area=4,195 km² approximately) Commencing from a point on the coast approximately midway between Sungai Tambir Hulu and Sungai Tambir Haji Untong; thence bearing approximately 260º 00′ distance approximately 5.45 kilometres; thence bearing approximately 180º 00′ distance approximately 1.1 kilometres to the junction of Sungai Tanju and Loba Tanju; thence in southeasterly direction along Loba Tanju to its estuary with Batang Samarahan; thence upstream along mid Batang Samarahan for a distance approximately 5.0 kilometres; thence bearing approximately 180º 00′ distance approximately 1.8 kilometres to the midstream of Loba Batu Belat; thence in westerly direction along midstream of Loba Batu Belat to the mouth of Loba Gong; thence in southwesterly direction along the midstream of Loba Gong to a point on its confluence with Sungai Bayor; thence along the midstream of Sungai Bayor going downstream to a point at its confluence with Sungai Kuap; thence upstream along mid Sungai Kuap to a point at its confluence with Sungai Semengoh; thence upstream following the mid Sungai Semengoh to a point at the midstream of Sungai Semengoh and between the middle of survey peg nos.
    [Show full text]
  • New Vectors That Are Early Feeders for Plasmodium Knowlesi and Other Simian Malaria Parasites in the Betong Division of Sarawak, Malaysian Borneo
    New Vectors That Are Early Feeders for Plasmodium Knowlesi and Other Simian Malaria Parasites in the Betong Division of Sarawak, Malaysian Borneo. Joshua Ang Universiti Malaysia Sarawak Khatijah Yaman Universiti Malaysia Sarawak Khamisah Kadir Universiti Malaysia Sarawak Asmad Matusop Sarawak Department of Health Balbir Singh ( [email protected] ) Universiti Malaysia Sarawak Research Article Keywords: COI, malaria, PCR, molecular Posted Date: December 23rd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-127897/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Scientic Reports on April 8th, 2021. See the published version at https://doi.org/10.1038/s41598-021-86107-3. Page 1/21 Abstract Plasmodium knowlesi is the main cause of malaria in Sarawak, where studies on vectors of P. knowlesi have been conducted in only two districts. Anopheles balabacensis and An. donaldi were incriminated as vectors in Lawas and An. latens in Kapit. We studied a third location in Sarawak, Betong, where of 2,169 mosquitoes collected over 36 days using human-landing catches, 169 (7.8%) were Anopheles spp. PCR and phylogenetic analyses identied P. knowlesi and/or P. cynomolgi, P. eldi, P. inui, P. coatneyi and novel Plasmodium spp. in salivary glands of An. latens and An. introlatus from the Leucosphyrus Group and in An. collessi and An. roperi from the Umbrosus Group. Phylogenetic analyses of cytochrome oxidase subunit I sequences indicated three P. knowlesi-positive An. introlatus had been misidentied morphologically as An. latens, while An.
    [Show full text]
  • Non-Detriment Findings Report on Gonystylus Bancanus – a Quantitative Assessment of G
    ACTIVITY REPORT Non-detriment Findings Report on Gonystylus bancanus – A Quantitative Assessment of G. bancanus in Two Selected Permanent Forests of Sarawak ITTO-CITES PROJECT Malaysia’s Work Programme For 2008 Ensuring international trade in CITES-listed timber species is consistent with their sustainable management and conservation Activity Coordinator: Ngui Siew Kong Forest Department Sarawak Wisma Sumber Alam Jalan Stadium, Petra Jaya 93660 Kuching, Sarawak Malaysia Tel. +6082 442180; Fax +6082 441377 Sarawak Forestry Corporation Km 10, Jalan Tapang Kota Sentosa 93250 Kuching, Sarawak Malaysia Tel. +6082 610088; Fax +6082 610099 The place the report was issued: Kuching, Sarawak, Malaysia Date: 31 January 2011 Non-detriment Findings Report on Gonystylus bancanus – A Quantitative Assessment of G. bancanus in Two Selected Permanent Forests of Sarawak Prepared by: 1Mohd. Shahbudin Bin Sabki 2Lucy Chong 3Ernest Chai 1 Forest Department Sarawak Wisma Sumber Alam Jalan Stadium, Petra Jaya 93660 Kuching, Sarawak Malaysia 2Sarawak Forestry Corporation Km 10, Jalan Tapang Kota Sentosa 93250 Kuching, Sarawak Malaysia 3Tropical Evergreen Enterprise 95, Seng Goon Garden 93250 Kuching, Sarawak Malaysia TABLE OF CONTENTS LIST OF TABLES.......................................................................ii LIST OF FIGURES.....................................................................ii ACTIVITY IDENTIFICATION.....................................................iii SUMMARY...............................................................................
    [Show full text]
  • Nitrous Oxide and Methane in Two Tropical Estuaries in a Peat- Dominated Region of North-Western Borneo D
    Biogeosciences Discuss., doi:10.5194/bg-2016-4, 2016 Manuscript under review for journal Biogeosciences Published: 18 January 2016 c Author(s) 2016. CC-BY 3.0 License. Nitrous oxide and methane in two tropical estuaries in a peat- dominated region of North-western Borneo D. Müller1, H. W. Bange2, T. Warneke1, T. Rixen3,4, M. Müller5, A. Mujahid6, and J. Notholt1,7 1 Institute of Environmental Physics, University of Bremen, Otto-Hahn-Allee 1, 28359 Bremen, Germany 5 2 GEOMAR Helmholtz Centre for Ocean Research Kiel, Düsternbrooker Weg 20, 24105 Kiel, Germany 3 Leibniz Center for Tropical Marine Ecology, Fahrenheitstr. 6, 28359 Bremen, Germany 4 Institute of Geology, University of Hamburg, Bundesstr. 55, 20146 Hamburg, Germany 5Swinburne University of Technology, Faculty of Engineering, Computing and Science, Jalan Simpang Tiga, 93350 Kuching, Sarawak, Malaysia 10 6Department of Aquatic Science, Faculty of Resource Science & Technology, University Malaysia Sarawak, 94300 Kota Samarahan, Sarawak Malaysia 7 MARUM Center for Marine Environmental Sciences at the University of Bremen, Leobener Str., 28359 Bremen, Germany Correspondence to: D. Müller ([email protected]) 1 Biogeosciences Discuss., doi:10.5194/bg-2016-4, 2016 Manuscript under review for journal Biogeosciences Published: 18 January 2016 c Author(s) 2016. CC-BY 3.0 License. Abstract. Estuaries are sources of nitrous oxide (N2O) and methane (CH4) to the atmosphere. However, our present knowledge of N2O and CH4 emissions from estuaries in the tropics is very limited because data is scarce. In this study, we present first measurements of dissolved N2O and CH4 from two estuaries in a peat-dominated region of north-western Borneo.
    [Show full text]
  • Rubber and the Modernisation of the Paku
    Working Paper No. 18, September 2007 RUBBER AND THE MODERNISATION OF THE PAKU IBAN IN BETONG DIVISION, SARAWAK - Stanley Bye Kadam-Kiai RUBBER AND THE MODERNISATION OF THE PAKU IBAN IN BETONG DIVISION, SARAWAK Stanley Bye Kadam-Kiai Faculty of Social Sciences UNIVERSITI MALAYSIA SARAWAK 1. Introduction Rubber is the tree of modemisation for the Paku Iban in Betong ~ivision'in Sarawak. The changes in the way of life of the Paku Iban in the first half of the 1900s were brought about by the wealth they obtained fiom planting rubber. Towards the end of the 1920s, for example, Paku Iban men were already wearing coats and ties during Gawai festivals. In the 1950s' according to Michael ~ardin~(Bato, 2003)' when the price of rubber was about $2 per katie, "some families in Paku who had vast rubber gardens with hired rubber tappers were earning as high as $200 daily". "That made a number of natives fiom Betong wealthym3,he said. With the money they had, they bought shop houses in Betong, Spaoh, in Kuching's main bazaar and in fiont of the General Post office4. During this time, "some of the prime land in Kuching ... also belonged to Betong native^."^ In his study of attitudes towards modemisation in three areas in Sarawak (Paku, Lubok Antu and Kuching), Peter Mulok Kedit (1980) said that Paku Iban are more 'future-oriented' than the Ibans from the two areas when 74% of them put "disagree" as response to the statement 'to live for the present', compared to Lubok Antu Iban (40 per cent) and Kuching Iban (68 per cent).
    [Show full text]
  • An Assessment of the Development Opportunities in Alit, Sarawak
    An assessment of the development opportunities in Alit, Sarawak Interdisciplinary Land Use and Natural Resource Management Spring 2008 Supervisors: Andreas de Neergaard Michael Eilenberg 10th of April 2008 Group members: Jen Bond (ADK07002) Rikke Hansen (EN06007) Flavia Nakaggwa (EMA07006) Martin Aubanton (NDI08004) Alexander Roscher (NDI08082) 2 Table of Contents Table of Contents ...................................................................................................... 3 List of Figures........................................................................................................... 5 Abstract..................................................................................................................... 6 Introduction............................................................................................................... 7 Objectives and research questions.......................................................................... 8 Methodology........................................................................................................... 10 Study design........................................................................................................ 10 Data collection methods ...................................................................................... 10 Iban History, Religion and Culture .......................................................................... 14 Iban history ........................................................................................................
    [Show full text]
  • Conservation Ecology of Bornean Orangutans in the Greater Batang Ai- Lanjak-Entimau Landscape, Sarawak, Malaysia
    Conservation Ecology of Bornean Orangutans in the Greater Batang Ai- Lanjak-Entimau Landscape, Sarawak, Malaysia Joshua Juan Anak George Pandong Student ID: a1683422 ORCID ID: 0000-0001-7856-7777 A thesis submitted to attain the degree of MASTER OF PHILOSOPHY (SCIENCES) Department of Ecology and Environmental Science School of Biological Sciences Faculty of Sciences THE UNIVERSITY OF ADELAIDE SOUTH AUSTRALIA February 2019 in memory of Tok Nan Conservation ecology of Bornean orangutans in Sarawak Abstract The Bornean Orangutan (Pongo pygmaeus) is one of the three great ape species in Asia. P. pygmaeus is further divided into three subspecies based on their genetic divergence. These subspecies are also geographically apart from each other; with the Malaysian state of Sarawak having the least number of wild orangutans. In 2016, the threat level for the species was upgraded to ‘Critically Endangered’ under the IUCN Red List of Threatened Species. The alarming upgrade was due to increased threats to the survival of the species in Borneo, mainly due to habitat degradation and forest loss as well as hunting. The actual orangutan numbers in the wild were still unclear despite the upgrade due to wide variance generated from various statistical methods or survey protocols used to estimate them. In Sarawak, the conservation efforts have been ongoing with the focus on preventing further population decline, habitat degradation and forest loss. The first step in this effort was to acquire baseline data on population estimates and distribution at the core habitats of Batang Ai-Lanjak-Entimau (BALE) where most of the viable orangutan populations are found in the State.
    [Show full text]
  • A-111 Case Studies on Design and Construction of Deep
    15TH INTERNATIONAL PEAT CONGRESS 2016 Abstract No: A-111 CASE STUDIES ON DESIGN AND CONSTRUCTION OF DEEP FOUNDATIONS IN SARAWAK SOFT SOIL Frydolin Siahaan1* and Junaidi Sahadan2 1Bridges and Wharves Branch, Public Works Department, Sarawak, Malaysia 2Quality Management Sector, Public Works Department, Sarawak, Malaysia *Corresponding author: [email protected] SUMMARY Eight (8) structures using deep foundation are selected and discussed in this paper. The eight (8) structures located in difficult ground of Sarawak are namely the Sg. Rimbas Bridge in Pusa, Sg. Sawit Bridge, Sg. Palasan Bridge, and Pusa Ferry Ramp in Pusa; all in Betong Division, Batang Samariang Bridge in Kuching Division, Batang Samarahan Bridge and Batang Sadong Bridge; both in Samarahan Division and Batang Baram Bridge in Miri Division. During the design stage, several important engineering decisions were made in order to meet both the design code and statutory requirements. The design was not to compromise the difficult condition of the ground. The ground at all eight (8) locations were reported to be having low bearing capacity with Standard Penetration Test (SPT) N values between 0 and 5 found at depths from 0 to 20m and (SPT) N values less than 10 found at depths between 20m and 80m. Very soft to soft soil that is of recent sedimentary deposit was found at all locations. This paper emphasizes on decisions made in the design of the bridge foundation and ferry fender foundation. Background and localities of the projects, geological and geotechnical findings, design and types of foundation used, method of constructing the foundation and preliminary test pile results obtained are presented in this paper.
    [Show full text]
  • The Sugi Sakit Ritual Storytelling in a Saribas Iban Rite of Healing
    CliffordWacana Vol. Sather, 17 No. 2 (2016):The Sugi 251–277 sakit 251 The Sugi sakit Ritual storytelling in a Saribas Iban rite of healing Clifford Sather Abstract This paper describes a Saribas Iban rite of healing called the Sugi sakit. What distinguished this rite from other forms of Saribas Iban healing was that it incorporated within its performance a long narrative epic concerned with the adventures and love affairs of an Iban culture hero named Bujang Sugi. Here I explore the language used by Iban priest bards both in telling the Sugi epic and in performing the larger ritual drama in which it was set, and look, in particular, at how the Sugi epic, which was otherwise told for entertainment, was integrated into this drama and recast by the priest bards as they performed the ritual, so that it not only entertained their listeners, but also served as a serious instrument of healing. Keywords Iban; Sarawak (Malaysia); Borneo (Kalimantan); ritual language; storytelling. In a recent conference paper on specialized speech genres in Indonesia, Pascal Couderc (2013) observed that among the Uut Danum of the upper Melawi region of West Kalimantan the same speech genres that are used in performing rituals also serve as media of epic storytelling. While storytelling itself is not considered by the Uut Danum as a form of ritual, oral epics, particularly those concerned with upper-world spirits, or songiang, are sometimes told in conjunction with rituals and their telling is generally thought to confer material benefits upon the audiences that take part in these storytelling events (Pascal Couderc, personal communication).
    [Show full text]
  • Sarawak Bario Rice (GI) Highly Commercialised GI Period: 10 Mac
    POTENTIAL OF SARAWAK TRADITIONAL RICES FOR EXPORT Lai KF, Kueh KH & Vu Thanh TA Domestic Rice Production & Rice Imported into Sarawak from 2010 to 2016 350,000 Rice production (tonne) 300,000 250,000 Quantity of rice imported 200,000 into Sarawak (tonne) 150,000 Imported quality rice (Frangrant & Basmati rice 100,000 (tonne) Quantity of rice (tonne) of rice Quantity 50,000 Total Rice Requirement (tonne) 0 2010 2011 2012 2013 2014 2015 2016 Year Self-sufficiency level ranges from 44.2 to 51.1% Introduction Rice Farming Systems in Sarawak Period: 2010-2016 Average annual area under paddy cultivation: 125,923 ha Hill paddy Rain-fed Irrigated paddy (589 ha) (45.9 – 50.5%) (49.5 – 54.1%) Ng. Merit: 130 ha Skuduk-Chupak: 101 ha Tg. Purun: 94 ha Paya Mending: 89 ha Pueh, Sematan: 39 ha Paya Payang: 36 ha (Agricultural Statistics Sarawak, 2016) Others: 100 ha CULTIVATION OF RICE IN SARAWAK – Predominantly practice low input traditional farming system Land preparation Dry nursery Transplanting Rain fed Drying Harvesting P & D Weeding management Traditional Rice Varieties • Sarawak is popular for its many traditional rice varieties • Estimated to be not less than 300 varieties • Diverse in grain shape, aroma, colour, texture and eating quality • Farmers continue to plant these varieties (i) lack of irrigation infrastructures (ii) stable yield (iii) resistant to abiotic and biotic stress (iv) excellent eating quality (v) premium price RM8 – RM16.50/kg rice Popular rice varieties in Sarawak UKONG Popular rice varieties by region Matu-Daro Miri-Limbang
    [Show full text]
  • Tender for the Yearly Contract of Air Conditioner Servicing at Batang Ai Power Generation Sdn Bhd REF
    Tender for the Yearly Contract of Air Conditioner Servicing at Batang Ai Power Generation Sdn Bhd REF. NO. BAPG56/2020/MSM TENDER NOTICE Suitably qualified tenderers are invited for the TENDER FOR THE YEARLY CONTRACT OF AIR CONDITIONER SERVICING AT BATANG AI POWER GENERATION SDN BHD stated as follows: Tender Reference No. Title Eligibility THE YEARLY CONTRACT OF AIR CONDITIONER Restricted to Bumiputra Contractor in Lubok BAPG56/2020/MSM SERVICING AT BATANG AI POWER GENERATION SDN Antu, Sri Aman & Betong Division with UPK class BHD F or above; Head V, Sub-head.3 Instruction to Tenderers: Mandatory Requirement Tenderers shall possess adequate financial capability and experience as follows: 1. Bumiputra Contractor with UPK class F or above; Head V, Sub-head 3 will be an advantage. 2. Restricted to Bumiputera Contractor in Lubok Antu, Sri Aman & Betong Division. *Interested tenderers are required to produce evidence of fulfilling above-mentioned mandatory requirement. Failing which, your intention will be rejected. General Instructions 1. This tender exercise will be conducted on an online Ariba platform. The entire event will be managed by SEPRO (Sarawak Energy e-Procurement) Team. Tender details are available for viewing at http://www2.sesco.com.my 2. Please note that all Tenderers are required to register in SEPRO to participate in this tender. If your company is not registered in SEPRO, please allow ample time to complete registration. Vendors can self-register to SEPRO via the URL provided: http://bit.ly/register2SEPRO. The registration is free of charge. 3. Interested Tenderer that meets the eligibility is required to do the following steps: A) Email your interest to participate for this tender exercise to [email protected].
    [Show full text]