DOCSLIB.ORG

Supplementary Tables

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Tables Supplementary Table 1. Primers for Q-RT-PCR Gene Sequence Product lenght AR CTCACCAAGCTCCTGGACTC 247 AR CAGGCAGAAGACATCTGAAAG 247 ASF1B ACAGGAGTTCATCCGAGTGG 164 ASF1B CCATGTTGTTGTCCCAGTTG 164 CDCA3 CCAAGGAGGAAGCAAGACAG 295 CDCA3 GCTCGTCCTCCAGTTTTCAG 295 DTL AAGTCCGTCATCCCAGACAC 100 DTL TGTGCAGATTTTCCTCATGG 100 ERG TCTTGGACCAACAAGTAGCC 151 ERG GTCGGGATCCGTCATCTTG 151 ETV1 GTTGGGGCATTCAGAAAAAC 165 ETV1 TATCTGGAAAGGCCATGGAG 165 KIAA0101 CTGAAGAGGCAGGAAGCAGT 134 KIAA0101 CCAGGGTAAACAAGGAGACG 134 NUSAP1 AGTTTGTCTCGTCCCCTCAA 167 NUSAP1 CGTTTCTTCCGTTGCTCTTC 167 PSA GCAGCATTGAACCAGAGGAG 393 PSA AGAACTGGGGAGGCTTGAGT 393 TBP GAATATAATCCCAAGCGGTTTG 226 TBP ACTTCACATCACAGCTCCCC 226 UBE2T GTGGACAGAGAAGCATGCAA 208 UBE2T TCACCTTGGCAAAGAACACA 208 Supplementary Table 2. Androgen responsive genes in LNCaP-pcDNA3.1 according to microarray expression analysis Ratio values Official symbol RefSeq Acc# 0nM DHT 1.0nM DHT 10nM DHT 100nM DHT 4h: > 2-fold up-regulated at 4 h FKBP5 NM_004117 1 1.197 1.803 2.229 KCNN2 NM_021614 1 1.307 2.324 2.586 C1orf116 NM_023938 1 1.332 2.467 2.528 TMPRSS2 NM_005656 1 1.632 4.844 6.09 SLC45A3 NM_033102 1 1.63 3.194 3.843 TMEPAI NM_020182 1 1.364 2.197 2.631 KLK2 NM_001002231 1 1.102 2.592 3.08 KCNN2 NM_021614 1 1.435 2.032 2.393 C19orf48 NM_199249 1 1.225 1.876 2.065 C19orf48 NM_199249 1 1.42 2.217 2.325 RTN4 NM_007008 1 1.586 2.054 2.372 NKX3-1 NM_006167 1 1.48 2.972 3.572 LOC400451 NM_207446 1 1.275 1.9 2.033 ZBTB16 NM_001018011 1 2.204 6.005 6.737 TMEPAI NM_020182 1 1.37 3.526 3.973 ZNF187 NM_001023560 1 2.239 2.733 2.288 FAM110B NM_147189 1 1.086 1.725 2.097 GHR NM_000163 1 1.513 1.932 2.02 MBOAT2 NM_138799 1 1.262 1.887 2.056 SGK NM_005627 1 0.961 1.529 2.041 IRS2 NM_003749 1 1.388 1.989 2.519 RHOU NM_021205 1 1.663 3.86 4.136 CLEC2D NM_001004419 1 1.411 2.105 1.745 KLK3 NM_001030047 1 0.966 2.071 2.973 >2-fold downregulated at 4h KCNJ13 NM_002242 1 0.602 0.491 0.537 LDOC1 NM_012317 1 0.505 0.395 0.493 CCDC83 NM_173556 1 0.541 0.485 0.464 C20orf46 NM_018354 1 0.443 0.447 0.488 MT2A NM_005953 1 0.481 0.469 0.567 MT1A NM_005946 1 0.418 0.402 0.517 LCN2 NM_005564 1 0.569 0.504 0.497 DUSP5 NM_004419 1 0.635 0.508 0.48 IGFBP3 NM_000598 1 0.415 0.465 0.491 EFHC2 NM_025184 1 0.491 0.449 0.503 ANXA1 NM_000700 1 0.422 0.357 0.4 SYT11 NM_152280 1 0.471 0.459 0.504 TNNT1 NM_003283 1 0.429 0.426 0.574 PLA2G2A NM_000300 1 0.359 0.341 0.432 MT1G NM_005950 1 0.271 0.261 0.355 BASP1 NM_006317 1 0.562 0.397 0.429 TLL1 NM_012464 1 0.448 0.415 0.536 CP NM_000096 1 0.473 0.425 0.475 TGM3 NM_003245 1 0.578 0.499 0.597 DAPK1 NM_004938 1 0.496 0.41 0.497 SDCBP2 NM_015685 1 0.518 0.493 0.547 SDCBP2 NM_015685 1 0.453 0.414 0.44 MT1X NM_005952 1 0.434 0.407 0.532 PIGR NM_002644 1 0.463 0.469 0.481 LOC440087 NM_001013698 1 0.55 0.5 0.528 S100P NM_005980 1 0.365 0.395 0.411 MT1F NM_005949 1 0.532 0.481 0.605 KLHL1 NM_020866 1 0.457 0.458 0.575 >2-fold upregulated at 24h SORD NM_003104 1 1.439 1.602 2.137 KLK3 NM_001030047 1 0.871 2.533 4.188 PTTG1 NM_004219 1 1.677 2.211 1.751 PSMC4 NM_006503 1 2.017 1.951 1.595 C21orf100 1 1.711 2.023 1.689 RLN1 NM_006911 1 1.67 2.083 2.74 UGT2B17 NM_001077 1 2.422 1.628 0.973 CDC20 NM_001255 1 1.212 2.028 2.336 KCNN2 NM_021614 1 1.207 2.192 3.59 ATP5F1 NM_001688 1 2.042 2.119 2.013 CDCA5 NM_080668 1 1.24 2.936 3.326 MAD2L1 NM_002358 1 1.238 1.984 2.598 TCP1 NM_001008897 1 2.406 2.478 2.326 DC2 NM_021227 1 1.79 1.964 2.16 CENPN NM_018455 1 1.231 2.045 3.903 TMPRSS2 NM_005656 1 0.813 1.358 2.847 DHCR24 NM_014762 1 0.889 1.433 2.243 CDC25A NM_001789 1 1.133 1.714 2.137 SLC45A3 NM_033102 1 0.992 1.509 2.223 PPAPDC1B NM_032483 1 1.624 2.243 2.301 HMBS NM_000190 1 1.837 2.109 2.138 SEMA6A NM_020796 1 2.153 1.744 1.232 FIGNL1 NM_001042762 1 1.584 2.079 1.93 DBI NM_020548 1 1.254 1.692 2.203 HIST1H2AC NM_003512 1 2.074 1.939 1.63 MCM2 NM_004526 1 0.919 1.721 2.074 MCM4 NM_005914 1 1.196 2.362 2.93 PIGW NM_178517 1 1.426 2.035 1.983 TMEPAI NM_020182 1 1.074 1.6 2.728 EHF NM_012153 1 1.961 1.998 2.101 TSC22D1 NM_006022 1 1.861 1.905 2.147 TMSL8 NM_021992 1 1.711 2.198 2.233 PAK1IP1 NM_017906 1 1.303 1.621 2.072 CAPRIN1 NM_005898 1 2.103 1.883 1.618 KLK2 NM_001002231 1 0.995 1.209 2.204 SLC39A6 NM_012319 1 1.739 2.03 2.017 DTL NM_016448 1 0.995 1.963 2.611 CDC2 NM_001786 1 1.904 3.259 2.652 C19orf48 NM_199249 1 0.708 1.237 2.108 LDLR NM_000527 1 1.306 1.645 2.16 CENPM NM_001002876 1 1.09 1.997 2.172 FEN1 NM_004111 1 1.034 1.985 2.133 UGT2B11 NM_001073 1 2.308 1.549 0.928 FBXL17 NM_022824 1 2.438 1.966 1.377 PDIA5 NM_006810 1 1.231 1.761 2.521 TRIP13 NM_004237 1 1.194 1.886 2.153 MCM5 NM_006739 1 1.014 1.659 2.037 NKX3-1 NM_006167 1 1.024 1.624 2.973 SRP9 NM_003133 1 2.345 2.018 1.867 FKBP11 NM_016594 1 1.137 1.634 2.144 CDCA7 NM_031942 1 1.024 1.917 2.658 EPB41L4B NM_018424 1 2.14 1.978 1.679 ID2 NM_002166 1 2.146 1.863 1.915 ACTG1 NM_001614 1 2.364 2.1 1.998 IDH1 NM_005896 1 1.945 2.216 2.343 KIF22 NM_007317 1 1.345 1.775 2.084 CCNB2 NM_004701 1 1.22 2.15 2.182 C1orf43 NM_015449 1 1.963 2.144 2.188 DSEL NM_032160 1 1.437 1.403 2.116 ZBTB16 NM_001018011 1 0.988 1.374 2 MCM7 NM_005916 1 1.085 1.704 2.154 TUBA1A NM_006009 1 2.009 2.196 1.834 NIPSNAP3A NM_015469 1 2.292 1.805 1.22 C7orf24 NM_024051 1 1.54 2.048 2.23 MB NM_005368 1 2.128 2.182 1.715 SLC4A4 NM_003759 1 1.729 2.443 2.795 LEPREL1 NM_018192 1 2.117 1.942 1.657 TMEPAI NM_020182 1 1.138 1.929 3.989 UHRF1 NM_013282 1 1.349 2.633 3.623 LYAR NM_017816 1 1.442 1.923 2.138 TYMS NM_001071 1 1.661 3.74 4.543 NUSAP1 NM_016359 1 1.318 2.7 2.691 PPAP2A NM_003711 1 1.554 2.043 2.198 ID1 NM_002165 1 2.141 1.954 1.656 IL8 NM_000584 1 2.083 2.081 1.8 PASK NM_015148 1 1.282 1.837 2.212 MANEA NM_024641 1 2.333 1.806 1.218 GINS2 NM_016095 1 1.044 2.131 2.798 TMEFF2 NM_016192 1 1.334 2 2.638 FGFR3 NM_000142 1 1.222 1.876 2.211 PCNA NM_002592 1 1.282 1.746 2.464 CCNE2 NM_057735 1 1.601 2.065 1.838 RPL29 NM_000992 1 1.399 1.878 2.178 STT3B NM_178862 1 2.07 2.007 2.071 ATAD2 NM_014109 1 1.577 3.009 3.023 CCT6A NM_001009186 1 2.185 2.319 2.049 CNIH NM_001009551 1 1.934 1.943 2.005 C1orf80 NM_022831 1 2.579 2.395 2.121 CLEC2D NM_001004419 1 1.739 1.306 2.95 TK1 NM_003258 1 1.182 2.315 2.394 SEC11C NM_033280 1 1.238 1.663 2.001 DEGS1 NM_003676 1 1.228 1.729 2.012 UBE2C NM_007019 1 1.334 2.792 2.623 GULP1 NM_016315 1 2.447 2.015 1.693 AADAT NM_016228 1 1.726 2.319 2.856 CACYBP NM_001007214 1 1.91 2.093 2.164 FBXO5 NM_012177 1 1.326 1.933 2.125 MRPL45 NM_032351 1 2.068 2.178 1.921 KLK3 NM_001030047 1 0.809 1.985 2.634 KIAA0101 NM_001029989 1 2.538 4.662 4.382 >2-fold downregulated at 24h LDOC1 NM_012317 1 0.494 0.481 0.475 TNNT1 NM_003283 1 0.444 0.403 0.428 PLA2G2A NM_000300 1 0.241 0.178 0.163 C4orf18 NM_001031700 1 0.763 0.584 0.379 C4orf18 NM_001031700 1 0.998 0.726 0.485 ATP1B1 NM_001001787 1 0.888 0.851 0.467 TLL1 NM_012464 1 0.899 0.682 0.4 PBEF1 NM_005746 1 1.034 0.684 0.487 TGM3 NM_003245 1 0.388 0.355 0.285 SLC30A4 NM_013309 1 0.302 0.244 0.188 OAZ2 NM_002537 1 0.615 0.577 0.498 TFF3 NM_003226 1 0.522 0.493 0.496 LGALS3BP NM_005567 1 0.494 0.462 0.386 S100P NM_005980 1 0.301 0.315 0.327 DHRS3 NM_004753 1 0.439 0.421 0.445 COL5A2 NM_000393 1 0.656 0.554 0.398 ACPP NM_001099 1 0.71 0.584 0.499 RARRES3 NM_004585 1 0.771 0.553 0.48 Supplementary Table 3.
Load more

Recommended publications
  • Ali Shokoohmand Thesis (PDF 8MB)
    IDENTIFYING THE MOLECULAR MEDIATORS OF VN AND THE IGF:VN COMPLEX-STIMULATED BREAST CANCER CELL SURVIVAL Ali Shokoohmand School of Biomedical Sciences, Faculty of Health Queensland University of Technology, Australia A thesis submitted for the degree of Doctor of Philosophy of the Queensland University of Technology 2015 QUT Verified Signature Acknowledgements Commencing, pursuing and completing this dissertation like any other project, required abundant resources as well as strong motivation, which wouldn’t have been possible without the people who provided me with the much needed encouragement, support, scientific advice and help with experiments. Therefore, I would like to express my gratitude to the people below. I would like to thank my principal supervisor ‘Dr Mr’ Hollier whose advice, guidance and encouragement has been always available for me through my PhD journey. Thanks for encouraging me to work hard at all times and keeping me motivated during my PhD. Your work ethic and your scientific expertise will always inspire me and I truly learned a lot from you. Abhi, I have always been appreciating to have you beside me. Your encouragement and support was a very great thing to me. I have learnt many deals from you. Your encouragement and support always helped me to work harder. Above all, I always enjoyed talking with you about our cultures, people and countries. I am sure we still have many things to talk about! Zee, thanks for the support you have given throughout my PhD. Without your support, this journey could have been harder for me. Derek, I would like to thank you for listening to me sometimes and being here for me.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • Functional Annotations of Single-Nucleotide Polymorphism
    CLINICAL RESEARCH e-ISSN 1643-3750 © Med Sci Monit, 2020; 26: e922710 DOI: 10.12659/MSM.922710 Received: 2020.01.08 Accepted: 2020.02.20 Functional Annotations of Single-Nucleotide Available online: 2020.03.30 Published: 2020.05.25 Polymorphism (SNP)-Based and Gene-Based Genome-Wide Association Studies Show Genes Affecting Keratitis Susceptibility Authors’ Contribution: BCDEF 1 Yue Xu* 1 Department of Ophthalmology, First Affiliated Hospital of Soochow University, Study Design A BCDEF 2 Xiao-Lin Yang* Suzhou, Jiangsu, P.R. China Data Collection B 2 Center for Genetic Epidemiology and Genomics, School of Public Health, Medical Statistical Analysis C BCD 1 Xiao-Long Yang College of Soochow University, Suzhou, Jiangsu, P.R. China Data Interpretation D BC 1 Ya-Ru Ren Manuscript Preparation E BC 1 Xin-Yu Zhuang Literature Search F Funds Collection G ADE 2 Lei Zhang ADE 1 Xiao-Feng Zhang * Yue Xu and Xiao-Lin Yang contributed equally Corresponding Authors: Xiao-Feng Zhang, e-mail: [email protected], Lei Zhang, e-mail: [email protected] Source of support: Departmental sources Background: Keratitis is a complex condition in humans and is the second most common cause of legal blindness worldwide. Material/Methods: To reveal the genomic loci underlying keratitis, we performed functional annotations of SNP-based and gene- based genome-wide association studies of keratitis in the UK Biobank (UKB) cohort with 337 199 subjects of European ancestry. Results: The publicly available SNP-based association results showed a total of 34 SNPs, from 14 distinct loci, associated with keratitis in the UKB. Gene-based association analysis identified 2 significant genes:IQCF3 (p=2.0×10–6) and SOD3 (p=2.0×10–6).
    [Show full text]
  • Molecular Characterization of Acute Myeloid Leukemia by Next Generation Sequencing: Identification of Novel Biomarkers and Targets of Personalized Therapies
    Alma Mater Studiorum – Università di Bologna Dipartimento di Medicina Specialistica, Diagnostica e Sperimentale Dottorato di Ricerca in Oncologia, Ematologia e Patologia XXX Ciclo Settore Scientifico Disciplinare: MED/15 Settore Concorsuale:06/D3 Molecular characterization of acute myeloid leukemia by Next Generation Sequencing: identification of novel biomarkers and targets of personalized therapies Presentata da: Antonella Padella Coordinatore Prof. Pier-Luigi Lollini Supervisore: Prof. Giovanni Martinelli Esame finale anno 2018 Abstract Acute myeloid leukemia (AML) is a hematopoietic neoplasm that affects myeloid progenitor cells and it is one of the malignancies best studied by next generation sequencing (NGS), showing a highly heterogeneous genetic background. The aim of the study was to characterize the molecular landscape of 2 subgroups of AML patients carrying either chromosomal number alterations (i.e. aneuploidy) or rare fusion genes. We performed whole exome sequencing and we integrated the mutational data with transcriptomic and copy number analysis. We identified the cell cycle, the protein degradation, response to reactive oxygen species, energy metabolism and biosynthetic process as the pathways mostly targeted by alterations in aneuploid AML. Moreover, we identified a 3-gene expression signature including RAD50, PLK1 and CDC20 that characterize this subgroup. Taking advantage of RNA sequencing we aimed at the discovery of novel and rare gene fusions. We detected 9 rare chimeric transcripts, of which partner genes were transcription factors (ZEB2, BCL11B and MAFK) or tumor suppressors (SAV1 and PUF60) rarely translocated across cancer types. Moreover, we detected cryptic events hiding the loss of NF1 and WT1, two recurrently altered genes in AML. Finally, we explored the oncogenic potential of the ZEB2-BCL11B fusion, which revealed no transforming ability in vitro.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Wo2017/132291
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date W O 2017/132291 A l 3 August 2017 (03.08.2017) P O P C T (51) International Patent Classification: [US/US]; 77 Massachusetts Avenue, Cambridge, MA A61K 48/00 (2006.01) C12Q 1/68 (2006.01) 02139 (US). THE GENERAL HOSPITAL CORPORA¬ A61K 39/395 (2006.01) G01N 33/574 (2006.01) TION [US/US]; 55 Fruit Street, Boston, MA 021 14 (US). C12N 15/11 (2006.01) (72) Inventors; and (21) International Application Number: (71) Applicants : REGEV, Aviv [US/US]; 415 Main Street, PCT/US2017/014995 Cambridge, MA 02142 (US). BERNSTEIN, Bradley [US/US]; 55 Fruit Street, Boston, MA 021 14 (US). (22) International Filing Date: TIROSH, Itay [US/US]; 415 Main Street, Cambridge, 25 January 20 17 (25.01 .2017) MA 02142 (US). SUVA, Mario [US/US]; 55 Fruit Street, (25) Filing Language: English Bostn, MA 02144 (US). ROZENBALTT-ROSEN, Orit [US/US]; 415 Main Street, Cambridge, MA 02142 (US). (26) Publication Language: English (74) Agent: NIX, F., Brent; Johnson, Marcou & Isaacs, LLC, (30) Priority Data: 317A East Liberty St., Savannah, GA 31401 (US). 62/286,850 25 January 2016 (25.01.2016) US 62/437,558 2 1 December 201 6 (21. 12.2016) US (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, 415 Main Street, Cambridge, MA 02142 (US).
    [Show full text]
  • Adaptive Introgression and De Novo Mutations Increase Access to 2 Novel Fitness Peaks on the Fitness Landscape During a Vertebrate Adaptive Radiation 3 Austin H
    1 Supplementary Materials: Adaptive introgression and de novo mutations increase access to 2 novel fitness peaks on the fitness landscape during a vertebrate adaptive radiation 3 Austin H. Patton1,2, Emilie J. Richards1,2, Katelyn J. Gould3, Logan K. Buie3, Christopher H. 4 Martin1,2 5 1Museum of Vertebrate Zoology, University of California, Berkeley, CA 6 2Department of Integrative Biology, University of California, Berkeley, CA 7 3Department of Biology, University of North Carolina at Chapel Hill, NC 8 9 10 Supplementary Methods 11 Sampling of hybrid individuals 12 Samples of hybrid Cyprinodon pupfish included herein were first collected following two 13 separate fitness experiments, conducted on San Salvador Island in 2011 (17) and 2016 (18) 14 respectively. Experiments were carried out in two lakes: Little Lake (LL), and Crescent Pond 15 (CP). Following their initial collection at the conclusion of their respective experiments (see (17) 16 and (18) for protocols), samples were stored in ethanol in C.H.M.’s personal collection. In late 17 2018, 149 hybrid samples were selected for use in this experiment. Of these, 27 are from the 18 experiment conducted in 2011 (14 from LL, 13 from CP), and the remaining 122 are from the 19 2016 experiment (58 from LL, 64 from CP). Due to reduced sample size for some species within 20 Little Lake, we include fish obtained from Osprey Lake for downstream analyses comparing 21 hybrids to Little Lake, as the two comprise a single, interconnected body of water. 22 23 Genomic Library Prep 24 DNA was extracted from the muscle tissue of hybrids using DNeasy Blood and Tissue kits 25 (Qiagen, Inc.); these extractions were then quantified using a Qubit 3.0 fluorometer (Thermo 26 Scientific, Inc).
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]