UBE4A Rabbit Mab

Total Page：16

File Type：pdf, Size：1020Kb

Leader in Biomolecular Solutions for Life Science UBE4A Rabbit mAb Catalog No.: A0710 Recombinant Basic Information Background Catalog No. This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein A0710 is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies Observed MW against the encoded protein may be markers for scleroderma and Crohn's disease. A 125KDa pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Calculated MW 123kDa Category Primary antibody Applications WB Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 9354 Q14139 Immunogen A synthesized peptide derived from human UBE4A. Synonyms UBE4A; E4; UBOX2; UFD2; ubiquitination factor E4A Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of HUVEC cells, using UBE4A antibody (A0710) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit (RM00020). Exposure time: 90s. Western blot analysis of extracts of various cell lines, using UBE4A antibody (A0710) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit (RM00020). Exposure time: 180s. Antibody | Protein | ELISA Kits | Enzyme | NGS | Service For research use only. Not for therapeutic or diagnostic purposes. Please visit http://abclonal.com for a complete listing of recommended products..

Copy Link

Recommended publications

Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in A
Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in a novel member of the chromodomain gene family cause CHARGE syndrome. L.E.L.M. Vissers1, C.M.A. van Ravenswaaij1, R. Admiraal2, J.A. Hurst3, B.B.A. de Vries1, I.M. Janssen1, W.A. van der Vliet1, E.H.L.P.G. Huys1, P.J. de Jong4, B.C.J. Hamel1, E.F.P.M. Schoenmakers1, H.G. Brunner1, A. Geurts van Kessel1, J.A. Veltman1. 1) Dept Human Genetics, UMC Nijmegen, Nijmegen, Netherlands; 2) Dept Otorhinolaryngology, UMC Nijmegen, Nijmegen, Netherlands; 3) Dept Clinical Genetics, The Churchill Hospital, Oxford, United Kingdom; 4) Children's Hospital Oakland Research Institute, BACPAC Resources, Oakland, CA. CHARGE association denotes the non-random occurrence of ocular coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear anomalies and deafness (OMIM #214800). Almost all patients with CHARGE association are sporadic and its cause was unknown. We and others hypothesized that CHARGE association is due to a genomic microdeletion or to a mutation in a gene affecting early embryonic development. In this study array- based comparative genomic hybridization (array CGH) was used to screen patients with CHARGE association for submicroscopic DNA copy number alterations. De novo overlapping microdeletions in 8q12 were identified in two patients on a genome-wide 1 Mb resolution BAC array. A 2.3 Mb region of deletion overlap was defined using a tiling resolution chromosome 8 microarray. Sequence analysis of genes residing within this critical region revealed mutations in the CHD7 gene in 10 of the 17 CHARGE patients without microdeletions, including 7 heterozygous stop-codon mutations.
[Show full text]
Deubiquitinases in Cancer: New Functions and Therapeutic Options
Oncogene (2012) 31, 2373–2388 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc REVIEW Deubiquitinases in cancer: new functions and therapeutic options JM Fraile1, V Quesada1, D Rodrı´guez, JMP Freije and C Lo´pez-Otıń Departamento de Bioquı´mica y Biologıá Molecular, Facultad de Medicina, Instituto Universitario de Oncologıá, Universidad de Oviedo, Oviedo, Spain Deubiquitinases (DUBs) have fundamental roles in the Hunter, 2010). Consistent with the functional relevance ubiquitin system through their ability to specifically of proteases in these processes, alterations in their deconjugate ubiquitin from targeted proteins. The human structure or in the mechanisms controlling their genome encodes at least 98 DUBs, which can be grouped spatiotemporal expression patterns and activities cause into 6 families, reflecting the need for specificity in diverse pathologies such as arthritis, neurodegenerative their function. The activity of these enzymes affects the alterations, cardiovascular diseases and cancer. Accord- turnover rate, activation, recycling and localization ingly, many proteases are an important focus of of multiple proteins, which in turn is essential for attention for the pharmaceutical industry either as drug cell homeostasis, protein stability and a wide range of targets or as diagnostic and prognostic biomarkers signaling pathways. Consistent with this, altered DUB (Turk, 2006; Drag and Salvesen, 2010). function has been related to several diseases, including The recent availability of the genome sequence cancer. Thus, multiple DUBs have been classified as of different organisms has facilitated the identification oncogenes or tumor suppressors because of their regula- of their entire protease repertoire, which has been tory functions on the activity of other proteins involved in defined as degradome (Lopez-Otin and Overall, 2002).
[Show full text]
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
[Show full text]
Beyond K48 and K63: Non-Canonical Protein Ubiquitination
Tracz and Bialek Cell Mol Biol Lett (2021) 26:1 https://doi.org/10.1186/s11658‑020‑00245‑6 Cellular & Molecular Biology Letters REVIEW LETTER Open Access Beyond K48 and K63: non‑canonical protein ubiquitination Michal Tracz and Wojciech Bialek* *Correspondence: [email protected] Abstract Faculty of Biotechnology, Protein ubiquitination has become one of the most extensively studied post-trans- University of Wroclaw, Wroclaw, Poland lational modifcations. Originally discovered as a critical element in highly regulated proteolysis, ubiquitination is now regarded as essential for many other cellular pro- cesses. This results from the unique features of ubiquitin (Ub) and its ability to form various homo- and heterotypic linkage types involving one of the seven diferent lysine residues or the free amino group located at its N-terminus. While K48- and K63-linked chains are broadly covered in the literature, the other types of chains assembled through K6, K11, K27, K29, and K33 residues deserve equal attention in the light of the latest discoveries. Here, we provide a concise summary of recent advances in the feld of these poorly understood Ub linkages and their possible roles in vivo. Keywords: Ubiquitin, Non-canonical, Atypical ubiquitination, Ubiquitin chains Introduction Protein ubiquitination (interchangeably called ubiquitylation) involves the covalent attachment of the 76-amino acid eukaryotic molecule ubiquitin (Ub) to substrate pro- teins. An enzymatic cascade of a Ub activating enzyme (E1), Ub-conjugating enzymes (E2s), and Ub ligases (E3s) governs the process, which is now recognized as an essential post-translational protein modifcation (PTM) of eukaryotic cells [1]. Ubiquitination is initiated by E1, an enzyme requiring ATP for the activation of Ub, which forms a thi- oester bond between the C-terminal Gly carboxyl group of Ub and its active site Cys.
[Show full text]
Post-Translational Modification of MRE11: Its Implication in DDR And
G C A T T A C G G C A T genes Review Post-Translational Modification of MRE11: Its Implication in DDR and Diseases Ruiqing Lu 1,† , Han Zhang 2,† , Yi-Nan Jiang 1, Zhao-Qi Wang 3,4, Litao Sun 5,* and Zhong-Wei Zhou 1,* 1 School of Medicine, Sun Yat-Sen University, Shenzhen 518107, China; [email protected] (R.L.); [email protected] (Y.-N.J.) 2 Institute of Medical Biology, Chinese Academy of Medical Sciences and Peking Union Medical College; Kunming 650118, China; [email protected] 3 Leibniz Institute on Aging–Fritz Lipmann Institute (FLI), 07745 Jena, Germany; zhao-qi.wang@leibniz-fli.de 4 Faculty of Biological Sciences, Friedrich-Schiller-University of Jena, 07745 Jena, Germany 5 School of Public Health (Shenzhen), Sun Yat-Sen University, Shenzhen 518107, China * Correspondence: [email protected] (L.S.); [email protected] (Z.-W.Z.) † These authors contributed equally to this work. Abstract: Maintaining genomic stability is vital for cells as well as individual organisms. The meiotic recombination-related gene MRE11 (meiotic recombination 11) is essential for preserving genomic stability through its important roles in the resection of broken DNA ends, DNA damage response (DDR), DNA double-strand breaks (DSBs) repair, and telomere maintenance. The post-translational modifications (PTMs), such as phosphorylation, ubiquitination, and methylation, regulate directly the function of MRE11 and endow MRE11 with capabilities to respond to cellular processes in promptly, precisely, and with more diversified manners. Here in this paper, we focus primarily on the PTMs of MRE11 and their roles in DNA response and repair, maintenance of genomic stability, as well as their Citation: Lu, R.; Zhang, H.; Jiang, association with diseases such as cancer.
[Show full text]
Product Data Sheet
For research purposes only, not for human use Product Data Sheet Anti-UBE4A Antibody Catalog # Source Reactivity Applications CPA2384 Rabbit H, M, R WB Description Rabbit polyclonal antibody to UBE4A Immunogen KLH-conjugated synthetic peptide encompassing a sequence within the N-term region of human UBE4A. The exact sequence is proprietary. Purification The antibody was purified by immunogen affinity chromatography. Specificity Recognizes endogenous levels of UBE4A protein. Clonality Polyclonal Conjugation Form Liquid in 0.42% Potassium phosphate, 0.87% Sodium chloride, pH 7.3, 30% glycerol, and 0.01% sodium azide. Dilution WB (1/500 - 1/1000) Gene Symbol UBE4A Alternative Names KIAA0126; Ubiquitin conjugation factor E4 A Entrez Gene 9354 (Human); 315608 (Rat) SwissProt Q14139 (Human); Q6P7A2 (Rat) Storage/Stability Shipped at 4°C. Upon delivery aliquot and store at -20°C for one year. Avoid freeze/thaw cycles. Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry, IF- Immunofluorescence, FC- Flow cytometry, IC- Immunocytochemistry, IP- Immunoprecipitation, ChIP- Chromatin Immunoprecipitation, EMSA- Electrophoretic Mobility Shift Assay, BL- Blocking, SE- Sandwich ELISA, CBE- Cell-based ELISA, RNAi- RNA interference Species reactivity key: H- Human, M- Mouse, R- Rat, B- Bovine, C- Chicken, D- Dog, G- Goat, Mk- Monkey, P- Pig, Rb- Rabbit, S- Sheep, Z- Zebrafish COHESION BIOSCIENCES LIMITED WEB ORDER SUPPORT CUSTOM www.cohesionbio.com [email protected] [email protected] [email protected] For research purposes
[Show full text]
Transcriptional Changes Involved in Atrophying Muscles During Prolonged Fasting in Rats
International Journal of Molecular Sciences Article Transcriptional Changes Involved in Atrophying Muscles during Prolonged Fasting in Rats 1,2 1,2, 3 1,2 Marianne Ibrahim , Thierry Wasselin y, Etienne Challet , Alain Van Dorsselaer , Yvon Le Maho 1,4,5, Thierry Raclot 1,4 and Fabrice Bertile 1,2,* 1 Institut Pluridisciplinaire Hubert Curien (IPHC), CNRS, Université de Strasbourg, 67000 Strasbourg, France; [email protected] (M.I.); [email protected] (T.W.); [email protected] (A.V.D.); [email protected] (Y.L.M.); [email protected] (T.R.) 2 Laboratoire de Spectrométrie de Masse Bio-Organique, 25 rue Becquerel, F-67087 Strasbourg, France 3 Institute of Cellular and Integrative Neurosciences, CNRS, Université de Strasbourg, F-67000 Strasbourg, France; [email protected] 4 Département Ecologie, Physiologie, Ethologie, 23 rue Becquerel, F-67087 Strasbourg, France 5 Centre Scientiﬁque de Monaco, 8 quai Antoine 1er, 98000 Monaco, Monaco * Correspondence: [email protected]; Tel.: +33-3-68-85-26-81 Present address: Department of Clinical Chemistry, University Medical Center, 37075 Göttingen, Germany. y Received: 3 July 2020; Accepted: 18 August 2020; Published: 20 August 2020 Abstract: Food deprivation resulting in muscle atrophy may be detrimental to health. To better understand how muscle mass is regulated during such a nutritional challenge, the current study deciphered muscle responses during phase 2 (P2, protein sparing) and phase 3 (P3, protein mobilization) of prolonged fasting in rats. This was done using transcriptomics analysis and a series of biochemistry measurements. The main ﬁndings highlight changes for plasma catabolic and anabolic stimuli, as well as for muscle transcriptome, energy metabolism, and oxidative stress.
[Show full text]
NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
[Show full text]
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name ubiquitin conjugation factor E4 A Gene Symbol Ube4a Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_207610 UniGene ID Rn.102204 Ensembl Gene ID ENSRNOG00000026833 Entrez Gene ID 315608 Assay Information Unique Assay ID qRnoCIP0022949 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000021321 Amplicon Context Sequence GCGATCAGCAGAGAGGTTTAAAGTTGCAGAGGAAGTCATGCTGATCAAGTGGTT TCCTGGATCTTGAAGCAGTAACCGAGCAAAGATGGCCTGCTCCACGTTGCTCAT ATCCAGCCAGTCTTG Amplicon Length (bp) 93 Chromosome Location 8:47874133-47875261 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 94 R2 0.9997 cDNA Cq 21.53 cDNA Tm (Celsius) 83 gDNA Cq 42.59 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ube4a, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
[Show full text]
Anti-UBE4A Antibody (ARG41168)
Product datasheet [email protected] ARG41168 Package: 100 μl anti-UBE4A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes UBE4A Tested Reactivity Hu, Ms Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name UBE4A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 797-1066 of Human UBE4A (NP_001191006.1). Conjugation Un-conjugated Alternate Names E4; UFD2; Ubiquitin conjugation factor E4 A; EC 6.3.2.-; UBOX2 Application Instructions Application table Application Dilution WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Mouse liver Calculated Mw 123 kDa Observed Size 140 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol UBE4A Gene Full Name ubiquitination factor E4A Background This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin.
[Show full text]
Skeletal Muscle Expression of Phosphofructokinase Is Influenced by Genetic Variation and Associated with Insulin Sensitivity
Diabetes Page 2 of 64 Skeletal Muscle Expression of Phosphofructokinase is Influenced by Genetic Variation and Associated with Insulin Sensitivity Sarah Keildson,1* Joao Fadista,2* Claes Ladenvall,2 Åsa K. Hedman,1 Targ Elgzyri,2 Kerrin S. Small,3,4 Elin Grundberg,3.4 Alexandra C. Nica,5 Daniel Glass,3 J. Brent Richards,3,6 Amy Barrett,7 James Nisbet,4 Hou-Feng Zheng,6 Tina Rönn,2 Kristoffer Ström,2,8 Karl-Fredrik Eriksson,2 Inga Prokopenko,1 MAGIC consortium, DIAGRAM consortium, MuTHER consortium, Timothy D Spector,3 Emmanouil T. Dermitzakis,5 Panos Deloukas,4 Mark I McCarthy,1,7,10 Johan Rung,9 Leif Groop,2 Paul W. Franks,11 Cecilia M. Lindgren,1,12* Ola Hansson,2* 1. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX3 7BN, United Kingdom 2. Lund University Diabetes Center, Department of Clinical Sciences, Diabetes and Endocrinology, Skåne University Hospital Malmö, Lund University, Malmö 20502, Sweden 3. Department of Twin Research and Genetic Epidemiology, King’s College London, London, SE1 7EH, United Kingdom 4. Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, CB10 1SA, United Kingdom 5. Department of Genetic Medicine and Development, University of Geneva, Medical School, 1211 Geneva 4, Switzerland 6. Department of Medicine, Human Genetics, Epidemiology and Biostatistics, McGill University, Lady Davis Institute for Medical Research, Jewish General Hospital, Montreal, Quebec, H3T 1E2, Canada 7. Oxford Centre for Diabetes, Endocrinology & Metabolism, University of Oxford, Churchill Hospital, Oxford, OX3 7LJ, United Kingdom 8. Swedish Winter Sports Research Centre, Department of Health Sciences, Mid Sweden University, SE-83125 Östersund, Sweden 9.
[Show full text]
The Ubiquitin Ligase Ube4b Is Required for Efficient Epidermal Growth Factor Receptor Degradation
The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 5-2010 THE UBIQUITIN LIGASE UBE4B IS REQUIRED FOR EFFICIENT EPIDERMAL GROWTH FACTOR RECEPTOR DEGRADATION Natalie Sirisaengtaksin Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry Commons, and the Cell Biology Commons Recommended Citation Sirisaengtaksin, Natalie, "THE UBIQUITIN LIGASE UBE4B IS REQUIRED FOR EFFICIENT EPIDERMAL GROWTH FACTOR RECEPTOR DEGRADATION" (2010). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 45. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/45 This Thesis (MS) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE UBIQUITIN LIGASE UBE4B IS REQUIRED FOR EFFICIENT EPIDERMAL GROWTH FACTOR RECEPTOR DEGRADATION by Natalie Sirisaengtaksin, B.S. APPROVED:
[Show full text]