DOCSLIB.ORG

( 12 ) United States Patent

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

US010280398B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 ,280 , 398 B2 Studer et al. (45 ) Date of Patent: May 7 , 2019 ( 54 ) MIDBRAIN DOPAMINE (DA ) NEURONS FOR 5 ,523 , 226 A 6 / 1996 Wheeler ENGRAFTMENT 5 , 589 , 376 A 12 / 1996 Anderson et al . 6 ,610 , 540 B1 8 / 2003 Csete et al . 6 ,787 , 356 B1 9 /2004 Studer et al . (71 ) Applicant: MEMORIAL SLOAN -KETTERING 6 ,833 ,269 B2 12 /2004 Carpenter CANCER CENTER , New York , NY 6 , 887 , 706 B2 5 /2005 Zhang et al . (US ) 7 , 005 , 252 B1 2 / 2006 Thomson 7 ,011 , 828 B2 3 /2006 Reubinoff et al . 7 , 112 ,437 B2 9 / 2006 Pera ( 72 ) Inventors : Lorenz Studer , New York , NY (US ) ; 7 , 211 , 434 B2 5 / 2007 Van Der Kooy et al. Jae - Won Shim , New York , NY (US ) ; 7 , 252 , 995 B2 8 / 2007 Fu et al. Sonja Kriks , New York , NY (US ) 7 , 294 , 510 B2 11/ 2007 Okano et al. 7 ,297 , 539 B2 11/ 2007 Mandalam et al. (73 ) Assignee : MEMORIAL SLOAN -KETTERING (Continued ) CANCER CENTER , New York , NY (US ) FOREIGN PATENT DOCUMENTS ( * ) Notice : Subject to any disclaimer, the term of this CA 2923592 A1 3 /2015 CN 102191221 A 9 / 2011 patent is extended or adjusted under 35 EP 1 645 286 A1 4 /2006 U . S . C . 154 (b ) by 0 days . KR 101331034 B1 11/ 2013 ( 21) Appl . No. : 14 /356 , 042 (Continued ) ( 22 ) PCT Filed : Nov . 2 , 2012 OTHER PUBLICATIONS ( 86 ) PCT No. : PCT/ US2012 / 063339 MacDonald (2009 , Developmental Cell, 17 : 9 - 26 ). * Katoh , Cancer Biology and Therapy, 2006 , 5 : 1059 - 1064 . * $ 371 ( c ) ( 1 ), Gordon , 2006 , Journal of Biological Chemistry , 281: 22429 - 22433 . * ( 2 ) Date : May 2 , 2014 Willert , CSH Perspectives in Biology , 2012 , 4 : 1 - 13 . * Wang , Stem Cells and Development , 2010 , 19 : 1375 - 1383. * ( 87 ) PCT Pub . No. : W02013 / 067362 Thomson et al. (PNAS , 92: 7844 - 7848 ( Aug. 1995 ) ). * NIH ( Stem Cells : Scientific Progress and Future Research Direc PCT Pub . Date : May 10 , 2013 tions , Department of Health and Human Services, Chapter 1 , pp . (65 ) Prior Publication Data 1 - 4 , Jun . 2001 ) . * US 2015 /0010514 A1 Jan . 8 , 2015 (Continued ) Primary Examiner — Valarie E Bertoglio Related U . S . Application Data ( 74) Attorney , Agent, or Firm — Baker Botts L .L .P . (60 ) Provisional application No . 61/ 555, 828 , filed on Nov. 4 , 2011 . ( 57 ) ABSTRACT The present invention relates to the field of stem cell (51 ) Int. Cl. biology , in particular the lineage specific differentiation of C12N 5 / 02 ( 2006 . 01 ) pluripotent or multipotent stem cells , which can include , but C12N 5 / 00 ( 2006 . 01) is not limited to , human embryonic stem cells (hESC ) in C12N 5 /0793 ( 2010 .01 ) addition to nonembryonic human induced pluripotent stem A61K 35 / 30 ( 2015 . 01 ) cells (hiPSC ) , somatic stem cells , stem cells from patients C12N 5 /0797 (2010 . 01) with a disease , or any other cell capable of lineage specific ( 52 ) U . S . CI. differentiation . Specifically described are methods to direct CPC . .. .. .. .. C12N 5 /0619 ( 2013 . 01 ) ; A61K 35 / 30 the lineage specific differentiation of hESC and/ or hiPSC ( 2013 . 01 ) ; CI2N 5 / 0623 ( 2013 .01 ) ; C12N into floor plate midbrain progenitor cells and then further 2501 /01 ( 2013 . 01 ) ; C12N 2501 / 119 (2013 .01 ) ; into large populations of midbrain fate FOXA2 + LMX1A + C12N 2501 / 13 (2013 .01 ) ; C12N 2501/ 15 TH + dopamine (DA ) neurons using novel culture condi ( 2013 .01 ) ; C12N 2501 / 16 ( 2013 . 01 ) ; C12N tions . The midbrain fate FOXA2 + LMX1A + TH + dopamine 2501 /41 (2013 . 01 ) ; C12N 2501 /415 ( 2013 .01 ) ; (DA ) neurons made using the methods of the present inven C12N 2501/ 999 ( 2013 .01 ) ; CI2N 2506 /02 tion are further contemplated for various uses including , but ( 2013 .01 ) ; C12N 2506 /45 ( 2013 .01 ) not limited to , use in in vitro drug discovery assays , neu (58 ) Field of Classification Search rology research , and as a therapeutic to reverse disease of, or CPC . .. .. C12N 5 /0619 damage to , a lack of dopamine neurons in a patient. Further, See application file for complete search history . compositions and methods are provided for differentiating midbrain fate FOXA2 + LMX1A + TH + dopamine (DA ) neu ( 56 ) References Cited rons from human pluripotent stem cells for use in disease modeling , in particular Parkinson ' s disease . Additionally , U . S . PATENT DOCUMENTS authentic DA neurons are enriched for markers , such as 5 , 166 , 065 A 11/ 1992 Williams et al. CD142 , and A9 type neuronal cells . 5 , 340 ,740 A 8 / 1994 Petitte et al . 5 ,453 , 357 A 9 / 1995 Hogan 14 Claims, 35 Drawing Sheets US 10 ,280 , 398 B2 Page 2 (56 ) References Cited Chambers , S . M . et al ., “ Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling ” , U . S . PATENT DOCUMENTS Nature Biotechnology, vol. 27 , No . 3 , Mar. 1 , 2009 , pp . 275 - 280 . Cooper , O . et al. , “ Differentiation of human ES and Parkinson ' s 7 , 332 , 336 B2 2 / 2008 Ochiya et al. 7 , 368 , 115 B2 5 / 2008 Ohta et al. disease iPS cells into ventralmidbrain dopaminergic neurons requires 7 , 763 , 463 B2 7 / 2010 Carpenter et al. a high activity form of SHH , FGF8a and specific regionalization by 7 , 892, 830 B2 2 / 2011 Bergendahl et al. retinoic acid ” , Molecular and Cellular Neurosciences , vol. 45 , No. 8 , 153 ,422 B2 4 / 2012 Isacson et al. 3 , Nov. 1 , 2010 , pp . 258 - 266 . 8 , 153 , 428 B2 4 /2012 Carpenter et al . Fasano , C . A . et al. , Efficient Derivation of Functional Floor Plate 8 , 252 , 585 B2 8 / 2012 Carpenter Tissue from Human Embryonic Stem Cells , Cell Stem Cell, Apr. 2 , 8 , 252 , 586 B2 8 / 2012 Carpenter et al . 8 ,323 ,971 B2 12 / 2012 Pedersen et al . 2010 , vol. 6 , No. 4 , pp . 336 -347 . 8 ,551 ,783 B2 10 / 2013 Kim et al. Joksimovic , M . et al . , “ Wnt antagonism of Shh facilitates midbrain 8 ,642 , 334 B2 2 / 2014 Chambers et al . floor plate neurogenesis ” , Developmental Biology , vol. 331 , No . 2 , 8 , 883 , 502 B2 11 / 2014 Zhang et al. Jul. 15, 2009 , pp . 507 -508 . 8 , 932 , 857 B2 1 / 2015 Yamanaka et al . Kriks, S . et al ., Dopamine neurons derived from human ES cells 9 ,249 , 389 B2 2 / 2016 Isacson et al. efficiently engraft in animal models of Parkinson ' s disease , Nature , 9 , 453 , 198 B2 9 / 2016 Studer et al . Nov . 6 , 2011 , vol . 480 , No. 7378 , pp . 547 -551 . 9 , 487 ,751 B2 11 / 2016 Anderson et al. Extended European Search Report dated Mar. 10 , 2015 issued in 2003 / 0036195 AL 2 / 2003 Studer et al . 2003/ 0211605 AL 11/ 2003 Lee et al. European Patent Application No. 12846715 . 6 . 2004 / 0005704 AL 1 / 2004 Csete et al. International Search Report dated Mar. 29 , 2013 in International 2004 /0087478 AL 5 / 2004 Gillen et al . Patent Application No. PCT/ US2012 /063339 . 2004 /0214324 Al 10 / 2004 Isacson et al . Written Opinion of the International Searching Authority dated Mar. 2005 /0260747 AL 11/ 2005 Reubinoff et al. 29 , 2013 in International Patent Application No . PCT /US2012 / 2006 /0078543 A1 4 / 2006 Reubinoff et al . 063339 2007 / 0224650 A1 9 / 2007 Jessell et al. Chambers et al. , “ Combined small -molecule inhibition accelerates 2009 /0035285 Al 2 / 2009 Condie et al. developmental timing and converts human pluripotent stem cells 2010 / 0009442 A1 1 / 2010 Sasai et al . into nociceptors, ” 2012 , Nature Biotechnology 30 ( 7 ) :715 - 720 . 2010 / 0093090 A1 4 / 2010 Deng et al. Crawford et al ., “ The Notch Response Inhibitor DAPT Enhances 2010 /0099772 A1 4 / 2010 Bean et al . Neuronal Differentiation in Embryonic Stem Cell - Derived Embryoid 2011/ 0229441 A1 9 / 2011 Benchoua et al. 2012 /0094381 A1 4 / 2012 Chambers et al. Bodies Independently of Sonic Hedgehog Signaling, " 2007 , Devel 2012 / 0142093 A1 6 / 2012 Takahashi et al. opmental Dynamics 236 : 886 - 892 . 2012 / 0148549 A1 6 / 2012 Anderson et al. Kirkeby et al. , “ Predictive Markers Guide Differentiation to Improve 2012/ 0322146 Al 12/ 2012 Carpenter et al . Graft Outcome in Clinical Translation of hESC Based Therapy for 2013 /0108669 Al 5 / 2013 Cooper et al. Parkinson ' s Disease , " Cell Stem Cell , available online Oct . 27 , 2013 / 0183674 AL 7 / 2013 Studer et al . 2016 ( 2016 ) , downloaded Feb . 2 , 2017 from < http : // dx . doi. org / 10 . 2014 /0199274 Al 7 / 2014 Kim et al. 1016 / j. stem / 2016 .09 . 004 > . 2014 / 0248696 A1 9 / 2014 Zhang et al. Li et al . , “ Rapid induction and long - term self- renewal of primitive 2014 / 0314721 Al 10 / 2014 Semechkin et al . neural precursors from human embryonic stem cells by small 2015 / 0010514 Al 1 / 2015 Studer et al. molecule inhibitors , " 2011 , PNAS 108 ( 20 ) : 8299 - 8304 . 2015 / 0010515 A1 1 / 2015 Schoeler et al . 2015 /0030570 A1 1 / 2015 Pan et al . Placantonakis et al. , “ BAC Transgenesis in Human Embryonic Stem 2015 / 0086481 Al 3 / 2015 Ganat et al . Cells as a Novel Tool to Define the Human Neural Lineage , ” 2009 , 2015 / 0087541 Al 3 / 2015 Gonzalez et al. Stem Cells 27 : 521 -532 . 2015 /0265652 A1 9 / 2015 George et al . Raymon et al ., “ Immortalized Human Dorsal Root Ganglion Cells 2015 /0353888 A1 12 / 2015 Inoue et al . Differentiate into Neurons with Nociceptive Properties, ” 1999 , J . 2016 /0108362 A1 4 / 2016 Su et al. Neurosci. 19 ( 13 ) : 5420 - 5428. 2016 /0115444 Al 4 / 2016 Studer et al. Steinbeck et al . , " Optogenetics enables functional analysis of human 2016 /0115448 A1 4 / 2016 Studer et al . embryonic stem cell -derived grafts in a Parkinson ' s disease model, ” 2016 /0145582 A1 5 / 2016 Yu 2015 , Nature Biotechnology 33 ( 2 ) : 204 - 209 . 2016 / 0201032 A1 7 / 2016 Studer et al .
Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
  • Core Transcriptional Regulatory Circuitries in Cancer

    Core Transcriptional Regulatory Circuitries in Cancer

    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • C3orf70 Is Involved in Neural and Neurobehavioral Development

    C3orf70 Is Involved in Neural and Neurobehavioral Development

    pharmaceuticals Article C3orf70 Is Involved in Neural and Neurobehavioral Development Yoshifumi Ashikawa 1, Takashi Shiromizu 1, Koki Miura 1, Yuka Adachi 1, Takaaki Matsui 2, Yasumasa Bessho 2, Toshio Tanaka 3 and Yuhei Nishimura 1,* 1 Department of Integrative Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] (Y.A.); [email protected] (T.S.); [email protected] (K.M.); [email protected] (Y.A.) 2 Gene Regulation Research, Graduate School of Biological Sciences, Nara Institute of Science and Technology, Takayama, Nara 630-0192, Japan; [email protected] (T.M.); [email protected] (Y.B.) 3 Department of Systems Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] * Correspondence: [email protected] Received: 10 October 2019; Accepted: 15 October 2019; Published: 16 October 2019 Abstract: Neurogenesis is the process by which undifferentiated progenitor cells develop into mature and functional neurons. Defects in neurogenesis are associated with neurodevelopmental and neuropsychiatric disorders; therefore, elucidating the molecular mechanisms underlying neurogenesis can advance our understanding of the pathophysiology of these disorders and facilitate the discovery of novel therapeutic targets. In this study, we performed a comparative transcriptomic analysis to identify common targets of the proneural transcription factors Neurog1/2 and Ascl1 during neurogenesis of human and mouse stem cells. We successfully identified C3orf70 as a novel common target gene of Neurog1/2 and Ascl1 during neurogenesis. Using in situ hybridization, we demonstrated that c3orf70a and c3orf70b, two orthologs of C3orf70, were expressed in the midbrain and hindbrain of zebrafish larvae.
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • HPV E2, E4, E5 Drive Alternative Carcinogenic Pathways in HPV Positive Cancers

    HPV E2, E4, E5 Drive Alternative Carcinogenic Pathways in HPV Positive Cancers

    Oncogene (2020) 39:6327–6339 https://doi.org/10.1038/s41388-020-01431-8 ARTICLE HPV E2, E4, E5 drive alternative carcinogenic pathways in HPV positive cancers 1,2 3 3 4,5 4 6 Shuling Ren ● Daria A. Gaykalova ● Theresa Guo ● Alexander V. Favorov ● Elana J. Fertig ● Pablo Tamayo ● 1,7 1 1 1 1 1 Juan Luis Callejas-Valera ● Mike Allevato ● Mara Gilardi ● Jessica Santos ● Takahito Fukusumi ● Akihiro Sakai ● 1 1 1 6 6 1 1 Mizuo Ando ● Sayed Sadat ● Chao Liu ● Guorong Xu ● Kathleen M. Fisch ● Zhiyong Wang ● Alfredo A. Molinolo ● 1 6 3 1,8 J. Silvio Gutkind ● Trey Ideker ● Wayne M. Koch ● Joseph A. Califano Received: 19 February 2020 / Revised: 19 July 2020 / Accepted: 13 August 2020 / Published online: 26 August 2020 © The Author(s) 2020. This article is published with open access Abstract The dominant paradigm for HPV carcinogenesis includes integration into the host genome followed by expression of E6 and E7 (E6/E7). We explored an alternative carcinogenic pathway characterized by episomal E2, E4, and E5 (E2/E4/E5) expression. Half of HPV positive cervical and pharyngeal cancers comprised a subtype with increase in expression of E2/E4/ E5, as well as association with lack of integration into the host genome. Models of the E2/E4/E5 carcinogenesis show p53 1234567890();,: 1234567890();,: dependent enhanced proliferation in vitro, as well as increased susceptibility to induction of cancer in vivo. Whole genomic expression analysis of the E2/E4/E5 pharyngeal cancer subtype is defined by activation of the fibroblast growth factor receptor (FGFR) pathway and this subtype is susceptible to combination FGFR and mTOR inhibition, with implications for targeted therapy.
  • Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays

    Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays

    MOLECULAR MEDICINE REPORTS 18: 5109-5116, 2018 Construction of an miRNA‑gene regulatory network in colorectal cancer through integrated analysis of mRNA and miRNA microarrays JUN HU, XIN YUE, JIANZHONG LIU and DALU KONG Department of Colorectal Cancer Surgery, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin's Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P.R. China Received December 19, 2017; Accepted August 8, 2018 DOI: 10.3892/mmr.2018.9505 Abstract. The aim of the present study was to identify poten- Introduction tial biomarkers associated with colorectal cancer (CRC). The GSE32323 and GSE53592 mRNA and microRNA (miRNA) Colorectal cancer (CRC) is a common malignancy that ranks expression profiles were selected from the Gene Expression as the second leading cause of cancer-associated mortality in Omnibus database. The differentially expressed genes (DEGs) men and women in the USA (1). Despite improvements in CRC and differentially expressed miRNAs (DEMs) in CRC tissue therapy, CRC remains a major public health problem, and it is samples compared with surrounding control tissue samples estimated that there are 1,000,000 individuals suffering from (DEGs-CC), and DEGs in cells treated with 5-aza-2'-de- CRC worldwide, with the mortality rate is as high as ~50% in oxycitidine compared with untreated cells (DEGs-TC) certain developed countries (2). The tumor stage is the most were identified with the Limma package. The Database for important prognostic indicator for CRC. However, the tumors Annotation, Visualization and Integrated Discovery was used are often diagnosed at an intermediate or late stage, and the to conduct the functional and pathways enrichment analysis.
  • Clinical Validation of the Tempus Xt Next-Generation Targeted Oncology Sequencing Assay

    Clinical Validation of the Tempus Xt Next-Generation Targeted Oncology Sequencing Assay

    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 24), pp: 2384-2396 Research Paper Clinical validation of the tempus xT next-generation targeted oncology sequencing assay Nike Beaubier1, Robert Tell1, Denise Lau1, Jerod R. Parsons1, Stephen Bush1, Jason Perera1, Shelly Sorrells1, Timothy Baker1, Alan Chang1, Jackson Michuda1, Catherine Iguartua1, Shelley MacNeil1, Kaanan Shah1, Philip Ellis1, Kimberly Yeatts1, Brett Mahon1, Timothy Taxter1, Martin Bontrager1, Aly Khan1, Robert Huether1, Eric Lefkofsky1 and Kevin P. White1 1Tempus Labs Inc., Chicago, IL 60654, USA Correspondence to: Nike Beaubier, email: [email protected] Kevin P. White, email: [email protected] Keywords: tumor profiling, next-generation sequencing assay validation Received: August 03, 2018 Accepted: February 03, 2019 Published: March 22, 2019 Copyright: Beaubier et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We developed and clinically validated a hybrid capture next generation sequencing assay to detect somatic alterations and microsatellite instability in solid tumors and hematologic malignancies. This targeted oncology assay utilizes tumor- normal matched samples for highly accurate somatic alteration calling and whole transcriptome RNA sequencing for unbiased identification of gene fusion events. The assay was validated with a combination of clinical specimens and cell lines, and recorded a sensitivity of 99.1% for single nucleotide variants, 98.1% for indels, 99.9% for gene rearrangements, 98.4% for copy number variations, and 99.9% for microsatellite instability detection. This assay presents a wide array of data for clinical management and clinical trial enrollment while conserving limited tissue.
  • Transcriptomic and Proteomic Profiling Provides Insight Into

    Transcriptomic and Proteomic Profiling Provides Insight Into

    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
  • Plasma Cells in Vitro Generation of Long-Lived Human

    Plasma Cells in Vitro Generation of Long-Lived Human

    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology , 32 of which you can access for free at: 2012; 189:5773-5785; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication November 2012; doi: 10.4049/jimmunol.1103720 http://www.jimmunol.org/content/189/12/5773 In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco, Sophie Stephenson, Matthew A. Care, Darren Newton, Nicholas A. Barnes, Adam Davison, Andy Rawstron, David R. Westhead, Gina M. Doody and Reuben M. Tooze J Immunol cites 65 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/11/16/jimmunol.110372 0.DC1 This article http://www.jimmunol.org/content/189/12/5773.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. The Journal of Immunology In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco,*,1 Sophie Stephenson,*,1 Matthew A.