DOCSLIB.ORG

Universidad Autónoma De Madrid Programa De Doctorado En Biociencias Moleculares

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Universidad Autónoma De Madrid Programa De Doctorado En Biociencias Moleculares Universidad Autónoma de Madrid Programa de Doctorado en Biociencias Moleculares IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Tesis Doctoral Teresa Lobo Jarne Madrid 2018 DEPARTAMENTO DE BIOQUÍMICA FACULTAD DE MEDICINA UNIVERSIDAD AUTÓNOMA DE MADRID IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Memoria presentada por la Licenciada en Biotecnología Teresa Lobo Jarne para optar al grado de Doctor por la Universidad Autónoma de Madrid Directora de Tesis: Dra. Cristina Ugalde Bilbao Instituto de Investigación Hospital 12 de Octubre (i+12) DEPARTAMENTO DE BIOQUÍMICA FACULTAD DE MEDICINA UNIVERSIDAD AUTÓNOMA DE MADRID Doña Cristina Ugalde Bilbao, Doctora en Ciencias, como Directora de Tesis, CERTIFICA: Que Doña Teresa Lobo Jarne, con DNI 72996109-C, licenciada en Biotecnología, ha realizado bajo mi dirección en el Instituto de Investigación Hospital 12 de Octubre (i+12) de Madrid, el trabajo titulado: IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Una vez supervisado el trabajo, considero que cumple con éxito todos los requisitos necesarios en cuanto a originalidad y calidad para ser presentado como Tesis Doctoral con el objeto de optar al título de Doctor por la Universidad Autónoma de Madrid. Madrid, a 25 de Enero del 2018 Dra. Cristina Ugalde Bilbao Directora de Tesis Laboratorio de Enfermedades Raras: Mitocondriales y Neuromusculares Instituto de Investigación Hospital 12 de Octubre (i+12) Avenida de Córdoba s/n 28041 Madrid Esta tesis doctoral ha sido realizada gracias a la concesión de una ayuda del Instituto de Investigación Hospital 12 de Octubre (i+12) para la incorporación de becarios a proyectos de investigación; de un Contrato de Formación en Investigación del Fondo de Investigaciones Sanitarias / Instituto de Salud Carlos III / fondos FEDER asignado a Doña Teresa Lobo Jarne con cargo al proyecto de investigación FIS 14-00209; así como por el proyecto del National Institute of General Medical Sciences (NIGMS-NIH, número 1R01GM105781-01) concedidos a la Dra. Cristina Ugalde Bilbao. A todos los que eché de menos, en especial a mis padres y a mi hermana AGRADECIMIENTOS Este trabajo no hubiera sido posible sin el interés y ánimo de muchas personas. A todos, gracias de corazón. Gracias a mi directora de tesis, la Dra. Cristina Ugalde Bilbao, por haberme dado la oportunidad de realizar mi doctorado en su grupo de investigación. Y por la formación científica que me ha brindado. Gracias al director del grupo de Enfermedades Raras, Mitocondriales y Neuromusculares el Dr. Miguel Ángel Casanueva y al director de la institución el Dr. Joaquín Arenas Barbero, por su cercanía y apoyo y por permitirme formar parte del Instituto de Investigación del Hospital 12 de Octubre de Madrid. Gracias a la Dra. María Morán y al Dr. Francisco Martínez, por su disposición a contestarme a las tantas preguntas experimentales y teóricas durante todo este tiempo y siempre con una sonrisa. Gracias a la Dra. Esther Gallardo, por su eficaz ayuda en la tutorización de este trabajo y por los buenos consejos que me ha dado. Gracias a Alberto Blázquez, por su ayuda con los análisis genéticos y a Inés García, por su ayuda proteómica con buen sentido del humor. Gracias a Pilar, Vicky, Sara y Charo, por sus buenos consejos tanto profesionales como personales. Sin ellas el laboratorio no sería lo mismo. Gracias a Pablo, Adrián y Guille, por las charlas de pasillo y de cultivos celulares. Gracias a Miguel, Dani, Vero, Patri, Javi y Gabriel, por sacarme una sonrisa cuando la he necesitado. Por los geniales momentos en el laboratorio, en la cafetería y fuera del trabajo. Gracias a Xandra, Gaba y Elena, por acogerme, escucharme, apoyarme y consolarme. Ellas han estado en los grandes momentos, en tantas risas, anécdotas y confesiones. Porque las fiestitas, las cañas, las películas y las charlas de ciencia y no-ciencia en el laboratorio hicieron el día a día mucho más fácil. Gracias a Laura, por todo lo que ha hecho por mí. Por las horas midiendo cadena respiratoria mitocondrial que se recompensaban con cines domingueros. Porque siempre ha estado para mí en cualquier circunstancia, amiga y consejera, dentro y fuera del laboratorio. Porque ella y David me han adoptado a la madrileña, y han hecho que mi experiencia en la gran ciudad haya sido genial. Gracias de todo corazón, porque me llevo dos grandes amigos. Gracias a Ana, por su sincera amistad. Por su sentido del humor, su capacidad de trabajo y su ayuda cuando la he necesitado, tanto experimental como personal. Gracias a Alberto y Rafa, esos monstruos monstruosos. Gracias por estar ahí siempre, serenos y guardianes. Por su enorme ayuda experimental, por aguantar mi organización de laboratorio y por sus palabras de consuelo, alegría y templanza siempre que las he necesitado. En especial a Rafa por las discusiones científicas, las hipótesis, las estrategias experimentales y toda su valiosa ayuda en el desarrollo de este trabajo. Gracias a David, por enseñarme durante mi primer año de tesis, por darme el testigo de la blue-native, por escuchar y entender y por seguir compartiendo buenos momentos. Y a Javi, también por escucharme. Gracias a la Dra. Erika Fernández-Vizarra, por su confianza en mí cuando era una estudiante de máster. Porque aquel año fue estupendo y aprendí mucho. Gracias al Dr. Antoni Barrientos y a todo su equipo del laboratorio de Mitochondrial Biogenesis in Health, Disease and Aging de la Universidad de Miami, por haberme acogido tan bien en su grupo y haberme enseñado nuevas técnicas experimentales y una forma diferente de trabajar en un laboratorio de investigación. Gracias a Marta, el destino nos volvió a unir. Gracias por todas las tardes de cañas sin alcohol con limón, de paseos, de Malasaña, de compras y de teatros. Por haber sido mi confidente, porque “en la calle pasábamos las horas… has estado ahí por encima de todas las cosas”. Y a Alfonso, por su gran interés por mi trabajo. Gracias a Carolina y Ana, por ser las mejores compañeras de piso que una puede tener. Gracias por ayudarme siempre que lo he necesitado. Gracias a Marina, por llevarme una vez a la semana a un mundo melódico lleno de notas, acordes y arpegios, donde las pipetas se sustituían por guitarras. Gracias a mis círculas, a Yoli, Ana M, Diana, Ana G, Mariaje y Belén, por apoyarme en cualquier circunstancia. Juntas desde los inicios biotec y desde cualquier punto del mundo. Gracias por los consejos, confidencias y desahogos circulares; los vídeos, correos y skype circulares; las fiestas, celebraciones y viajes circulares; las alegrías, risas y lloros circulares. Y gracias a los círculos Jordi N, Miguel, Jordi P y Tomás por animarme siempre y porque sin ellos el círculo no sería del todo circular. Gracias a Guillermo y Diana, por haber estado conmigo desde el principio. Porque para mí, Zaragoza son ellos. Y pase el tiempo que pase, están para escucharme. Gracias a toda mi familia, por su apoyo, ánimo y empuje en el desarrollo de este doctorado. En especial a mi tío Adolfo y a mi tito Antonio, por siempre preguntarme por mi tesis y darme buenos consejos. Y a mi yayo, por ser tan curioso y siempre estar dispuesto a aprender cosas de “aquello llamado mitocondria”. Estés donde estés, gracias yayo. Gracias a Romà, por ser paciente y comprensivo. Porque me conoce y me entiende, porque ha vivido esta tesis como si fuera suya. Gracias por animarme siempre, ser mi más sincero confidente y por haber hecho mucho más fácil esta aventura. Y gracias a su familia también, por su interés y ánimo en todo momento. Gracias a mi hermana Laura, por su gran ayuda en la maquetación y en la revisión gramatical de este trabajo. Por ser mi cómplice en cada nueva experiencia y por escucharme siempre. Gracias por darle el toque divertido, musical y artístico a mi vida. Gracias a mis padres Manuel y Maruxa, porque a ellos les debo todo. Gracias por vuestro apoyo, exigencia, dedicación y cariño en cada nueva etapa. Por todos los buenos consejos que me dais, por enseñarme tanto y siempre estar para mí. SUMMARY / RESUMEN SUMMARY / RESUMEN Mitochondrial respiratory chain (MRC) complexes I, III and IV are associated in large supramolecular structures termed supercomplexes (SCs) and respirasomes, whose biogenesis and functional and pathophysiological relevance remain unclear. Such superstructures originate interdependences between the individual OXPHOS complexes, with major biomedical implications for the diagnosis of mitochondrial disorders because combined deficiencies of these complexes can be attributed to a genetic defect of a single MRC complex. Furthermore, the functional implication of the mitochondrial protein COX7A2L / COX7RP / SCAFI in the biogenesis of SCs is a subject of intense and controversial debate. To elucidate the role of COX7A2L in the structural organization of human MRC, blue native electrophoresis, proteomic analyses and COX7A2L downregulation assays were performed in control and mutant transmitochondrial cybrids lacking one of each MRC complexes. Our results showed that human COX7A2L binds primarily to the SC-unbound complex III dimer (CIII2) and to a minor extent to free complex IV, to specifically promote the stabilization of the SC III2+IV without affecting the respirasomes formation. Further analyses in TALEN-mediated COX7A2L knockout (COX7A2L-KO) HEK293T cells demonstrated that the lack of COX7A2L prevents SC III2+IV formation without affecting de novo complex IV biogenesis, enhances the biogenetic rates of CIII2, and delays the formation of the complex III-containing respirasomes that, nonetheless, accumulate to control steady-state levels. Functional substrate competition assays revealed that, upon the induction of complex I deficiency, COX7A2L-KO cells significantly favour electron flux through complex II. Altogether, our data suggest that COX7A2L establishes a regulatory checkpoint for the biogenesis of CIII2 and complex III-containing SCs that limits succinate oxidation when complex I activity is compromised, and that independent regulatory mechanisms co-exist for the biogenesis of SC III2+IV and the respirasomes.
Load more

Recommended publications
  • Human Blastocysts of Normal and Abnormal Karyotypes Display Distinct Transcriptome Profles Received: 16 March 2018 Frederick Licciardi1, Tenzin Lhakhang2, Yael G
    www.nature.com/scientificreports OPEN Human blastocysts of normal and abnormal karyotypes display distinct transcriptome profles Received: 16 March 2018 Frederick Licciardi1, Tenzin Lhakhang2, Yael G. Kramer3, Yutong Zhang4, Adriana Heguy4,5,6 & Accepted: 26 September 2018 Aristotelis Tsirigos 2,5,6 Published: xx xx xxxx Unveiling the transcriptome of human blastocysts can provide a wealth of important information regarding early embryonic ontology. Comparing the mRNA production of embryos with normal and abnormal karyotypes allows for a deeper understanding of the protein pathways leading to viability and aberrant fetal development. In addition, identifying transcripts specifc for normal or abnormal chromosome copy number could aid in the search for secreted substances that could be used to non- invasively identify embryos best suited for IVF embryo transfer. Using RNA-seq, we characterized the transcriptome of 71 normally developing human blastocysts that were karyotypically normal vs. trisomic or monosomic. Every monosomy and trisomy of the autosomal and sex chromosomes were evaluated, mostly in duplicate. We frst mapped the transcriptome of three normal embryos and found that a common core of more than 3,000 genes is expressed in all embryos. These genes represent pathways related to actively dividing cells, such as ribosome biogenesis and function, spliceosome, oxidative phosphorylation, cell cycle and metabolic pathways. We then compared transcriptome profles of aneuploid embryos to those of normal embryos. We observed that non-viable embryos had a large number of dysregulated genes, some showing a hundred-fold diference in expression. On the contrary, sex chromosome abnormalities, XO and XXX displayed transcriptomes more closely mimicking those embryos with 23 normal chromosome pairs.
    [Show full text]
  • COX7A2L Rabbit Pab
    Leader in Biomolecular Solutions for Life Science COX7A2L Rabbit pAb Catalog No.: A8298 Basic Information Background Catalog No. Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory A8298 chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by Observed MW mitochondrial genes and multiple structural subunits encoded by nuclear genes. The 13KDa mitochondrially-encoded subunits function in electron transfer, and the nuclear- encoded subunits may function in the regulation and assembly of the complex. This Calculated MW nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C- 12kDa terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen Category treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several Primary antibody transcript variants, some protein-coding and others non-protein coding, have been found for this gene. Applications WB Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 9167 O14548 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 1-114 of human COX7A2L (NP_004709.2). Synonyms COX7A2L;COX7AR;COX7RP;EB1;SIG81 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3.
    [Show full text]
  • Mouse Cox7a2l Conditional Knockout Project (CRISPR/Cas9)
    http://www.alphaknockout.com/ Mouse Cox7a2l Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cox7a2l conditional knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cox7a2l gene (NCBI Reference Sequence: NM_001159529 ; Ensembl: ENSMUSG00000024248 ) is located on Mouse chromosome 17. 4 exons are identified , with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000167741). Exon 2~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cox7a2l gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-183D2 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele exhibit decreased running capacity, decrease in metabolic rate and mitochondrial oxidative capacity, whitened brown adipose tissue and severe cold sensitivity. Mice homozygous for an allele encoding the short isoform exhibit higher succinate or pyruvate and malate-driven respiration rates Exon 2~4 is not frameshift exon, and covers 82.2% of the coding region. The size of intron 1 for 5'-loxP site insertion: 9975 bp. The size of effective cKO region: ~3065 bp. The cKO region does not have any other known gene. Page 1 of 7 http://www.alphaknockout.com/ Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cox7a2l Homology arm cKO region loxP site Page 2 of 7 http://www.alphaknockout.com/ Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear Expression Correlation of Respiratory Genes
    Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Research Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad, Amit Blumberg, Tal Cohen, and Dan Mishmar Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq exper- iments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes’ co-expression across human tissues. Nevertheless, negative mtDNA- nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain re- gions, collectively termed the “primitive” brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neu- rons and nonneuronal cells) and by their spatial brain location. As the “primitive” brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found “primitive” brain-specific up-regula- tion of lactate dehydrogenase B (LDHB), which associates with high OXPHOS activity, at the expense of LDHA, which pro- motes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena.
    [Show full text]
  • CREB-Dependent Transcription in Astrocytes: Signalling Pathways, Gene Profiles and Neuroprotective Role in Brain Injury
    CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Tesis doctoral Luis Pardo Fernández Bellaterra, Septiembre 2015 Instituto de Neurociencias Departamento de Bioquímica i Biologia Molecular Unidad de Bioquímica y Biologia Molecular Facultad de Medicina CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado en Neurociencias del Instituto de Neurociencias de la Universidad Autónoma de Barcelona, llevado a cabo por Luis Pardo Fernández bajo la dirección de la Dra. Elena Galea Rodríguez de Velasco y la Dra. Roser Masgrau Juanola, en el Instituto de Neurociencias de la Universidad Autónoma de Barcelona. Doctorando Directoras de tesis Luis Pardo Fernández Dra. Elena Galea Dra. Roser Masgrau In memoriam María Dolores Álvarez Durán Abuela, eres la culpable de que haya decidido recorrer el camino de la ciencia. Que estas líneas ayuden a conservar tu recuerdo. A mis padres y hermanos, A Meri INDEX I Summary 1 II Introduction 3 1 Astrocytes: physiology and pathology 5 1.1 Anatomical organization 6 1.2 Origins and heterogeneity 6 1.3 Astrocyte functions 8 1.3.1 Developmental functions 8 1.3.2 Neurovascular functions 9 1.3.3 Metabolic support 11 1.3.4 Homeostatic functions 13 1.3.5 Antioxidant functions 15 1.3.6 Signalling functions 15 1.4 Astrocytes in brain pathology 20 1.5 Reactive astrogliosis 22 2 The transcription
    [Show full text]
  • Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
    International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M.
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear Expression Correlation of Respiratory Genes
    Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Research Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad, Amit Blumberg, Tal Cohen, and Dan Mishmar Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq exper- iments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes’ co-expression across human tissues. Nevertheless, negative mtDNA- nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain re- gions, collectively termed the “primitive” brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neu- rons and nonneuronal cells) and by their spatial brain location. As the “primitive” brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found “primitive” brain-specific up-regula- tion of lactate dehydrogenase B (LDHB), which associates with high OXPHOS activity, at the expense of LDHA, which pro- motes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena.
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad1, Amit Blumberg1, Tal Cohen1 and Dan Mishmar1* 1 Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel *Corresponding author Address: Dan Mishmar, PhD Department of Life Sciences Ben-Gurion University of the Negev Beer Sheva 8410501, Israel Tel: +972-86461355 FAX: 972-86461356 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA) and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic co-regulation is poorly understood. To address this question, we analyzed ~8,500 RNA-seq experiments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity and morphology, we found overall positive mtDNA-nDNA OXPHOS genes' co-expression across human tissues. Nevertheless, negative mtDNA-nDNA gene expression was identified in the hypothalamus, basal ganglia and amygdala (sub-cortical brain regions, collectively termed the 'primitive' brain). Single cell RNA-seq analysis of mouse and human brains, revealed that this phenomenon is evolutionarily conserved, and both associate with brain cell types (involving excitatory/inhibitory neurons and non-neuronal cells) and by their spatial brain location. As the 'primitive' brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co- expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring towards glycolysis.
    [Show full text]
  • COX7A2L (NM 004718) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC117225 COX7A2L (NM_004718) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX7A2L (NM_004718) Human Untagged Clone Tag: Tag Free Symbol: COX7A2L Synonyms: COX7AR; COX7RP; EB1; SCAF1; SCAFI; SIG81 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC117225 sequence for NM_004718 edited (data generated by NextGen Sequencing) ATGTACTACAAGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCC TATAGCCCGCAGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCC ACACCAACTAAACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTT CCAGAGCTACAAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGC CTGCCTGACCAAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTAC TGCCTGATCGCCCTCTACATGGCTTCGCAGCCCAAAAACAAATGA Clone variation with respect to NM_004718.2 5' Read Nucleotide >OriGene 5' read for NM_004718 unedited Sequence: AAGTCAGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGTCCTTCT CTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACTACA AGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCCTATAGCCCGC AGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCCACACCAACTA AACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTTCCAGAGCTAC AAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGCCTGCCTGACC AAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTACTGCCTGATCG CCCTCTACATGGCTTCGCAGCCCAAAAACAAATGAGTTAGGCTGCAGAGGACTGGTTTGT
    [Show full text]
  • Mouse Cox7a2l Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Cox7a2l Knockout Project (CRISPR/Cas9) Objective: To create a Cox7a2l knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cox7a2l gene (NCBI Reference Sequence: NM_001159529 ; Ensembl: ENSMUSG00000024248 ) is located on Mouse chromosome 17. 4 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000167741). Exon 2~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for an allele encoding the short isoform exhibit higher succinate or pyruvate and malate-driven respiration rates with failure of an additive effect of pyruvate and malate in fed mice or an increase in succinate respiration in fasted mice. Exon 2 starts from about 18.16% of the coding region. Exon 2~3 covers 49.25% of the coding region. The size of effective KO region: ~298 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 Legends Exon of mouse Cox7a2l Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix.
    [Show full text]
  • 1 1 Full Title 2 PRMT1 Is Required for the Maintenance of Mature Β Cell
    Page 1 of 72 Diabetes 1 Full title 2 PRMT1 is required for the maintenance of mature β cell identity 3 4 Short running title 5 Essential role of PRMT1 in β cell identity 6 7 Authors 8 Hyunki Kim1, #, young-Ha Yoon2, 3, #, Chang-Myung Oh4, #, Joonyub Lee1, #, Kanghoon Lee1, Heein 9 Song1, Eunha Kim5, Kijong Yi1, Mi-Young Kim6, Hyeongseok Kim1, Yong Kyung Kim7, Eun-Hye 10 Seo2, 3, Haejeong Heo2, 3, Hee-Jin Kim2, Junguee Lee8, Jae Myoung Suh1, Seung-Hoi Koo9, Je Kyung 11 Seong6,10, Seyun Kim5, Young Seok Ju1, Minho Shong7, Mirang Kim2, 3, * and Hail Kim1, 11, * 12 13 Affiliations 14 1Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and 15 Technology, Daejeon 34141, Republic of Korea 16 2Personalized Genomic Medicine Research Center, Korea Research Institute of Bioscience and 17 Biotechnology, Daejeon 34141, Republic of Korea 18 3Department of Functional Genomics, University of Science and Technology, Daejeon 34113, 19 Republic of Korea 20 4Department of Biomedical Science and Engineering, Gwangju Institute of Science and Technology, 21 Gwangju 61005, Republic of Korea 22 5Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 23 34141, Republic of Korea 24 6Laboratory of Developmental Biology and Genomics, Research Institute for Veterinary Science, 25 BK21 PLUS Program for Creative Veterinary Science Research, College of Veterinary Medicine, 1 Diabetes Publish Ahead of Print, published online December 17, 2019 Diabetes Page 2 of 72 26 Seoul National University, and Korea Mouse Phenotyping Center (KMPC), Seoul 08826, Republic 27 of Korea 28 7Research Center for Endocrine and Metabolic Diseases, Chungnam National University School of 29 Medicine, 282 Munhwaro, Daejeon 35015, Republic of Korea 30 8Department of Pathology, Daejeon St.
    [Show full text]
  • Downloaded from Ensembl Biomart Martview Application to Perform the GO Enrichment Analysis
    life Article Regulatory Potential of Long Non-Coding RNAs (lncRNAs) in Boar Spermatozoa with Good and Poor Freezability Leyland Fraser 1,* , Łukasz Paukszto 2 , Anna Ma ´nkowska 1, Paweł Brym 3, Przemysław Gilun 4 , Jan P. Jastrz˛ebski 2 , Chandra S. Pareek 5 , Dibyendu Kumar 6 and Mariusz Pierzchała 7 1 Department of Animal Biochemistry and Biotechnology, Faculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] 2 Department of Plant Physiology, Genetics and Biotechnology, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] (Ł.P.); [email protected] (J.P.J.) 3 Department of Animal Genetics, Faculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] 4 Department of Local Physiological Regulations, Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Bydgoska 7, 10-243 Olsztyn, Poland; [email protected] 5 Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences, Nicolaus Copernicus University, 87-100 Toru´n,Poland; [email protected] 6 Waksman Institute of Microbiology, Rutgers, The State University of New Jersey, Piscataway, NJ 08554, USA; [email protected] 7 Institute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrz˛ebiec, 05-552 Magdalenka, Poland; [email protected] * Correspondence: [email protected] Received: 27 October 2020; Accepted: 19 November 2020; Published: 21 November 2020 Abstract: Long non-coding RNAs (lncRNAs) are suggested to play an important role in the sperm biological processes.
    [Show full text]