DOCSLIB.ORG

Mouse Cox7a2l Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Cox7a2l Conditional Knockout Project (CRISPR/Cas9) http://www.alphaknockout.com/ Mouse Cox7a2l Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cox7a2l conditional knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cox7a2l gene (NCBI Reference Sequence: NM_001159529 ; Ensembl: ENSMUSG00000024248 ) is located on Mouse chromosome 17. 4 exons are identified , with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000167741). Exon 2~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cox7a2l gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-183D2 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele exhibit decreased running capacity, decrease in metabolic rate and mitochondrial oxidative capacity, whitened brown adipose tissue and severe cold sensitivity. Mice homozygous for an allele encoding the short isoform exhibit higher succinate or pyruvate and malate-driven respiration rates Exon 2~4 is not frameshift exon, and covers 82.2% of the coding region. The size of intron 1 for 5'-loxP site insertion: 9975 bp. The size of effective cKO region: ~3065 bp. The cKO region does not have any other known gene. Page 1 of 7 http://www.alphaknockout.com/ Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cox7a2l Homology arm cKO region loxP site Page 2 of 7 http://www.alphaknockout.com/ Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8795bp) | A(25.78% 2267) | C(21.1% 1856) | G(24.88% 2188) | T(28.24% 2484) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 http://www.alphaknockout.com/ BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr17 - 83504479 83507478 3000 browser details YourSeq 199 1605 1861 3000 95.9% chr4 - 83341112 83341581 470 browser details YourSeq 196 1671 2248 3000 90.9% chr7 - 30802683 30803162 480 browser details YourSeq 194 1605 1861 3000 96.3% chr4 - 129296934 129297454 521 browser details YourSeq 193 1646 1861 3000 94.0% chr1 + 173383761 173383960 200 browser details YourSeq 192 1621 1857 3000 98.5% chrX - 60636291 60636578 288 browser details YourSeq 191 1620 1861 3000 97.1% chr9 - 106259412 106259715 304 browser details YourSeq 191 1598 1858 3000 97.1% chr12 - 76258084 76258744 661 browser details YourSeq 190 1672 1861 3000 100.0% chr2 + 60494900 60495089 190 browser details YourSeq 189 1672 2124 3000 88.3% chr5 - 105765605 105765856 252 browser details YourSeq 188 1673 1860 3000 100.0% chr2 - 18088188 18088375 188 browser details YourSeq 187 1671 1861 3000 99.0% chr17 - 60461811 60462001 191 browser details YourSeq 187 1672 1864 3000 98.5% chr1 - 171873700 171873892 193 browser details YourSeq 187 1672 1867 3000 98.0% chr5 + 144081756 144081963 208 browser details YourSeq 186 1672 1861 3000 99.0% chr5 - 103641491 103641680 190 browser details YourSeq 186 1671 1860 3000 99.0% chrX + 166055876 166056065 190 browser details YourSeq 186 1671 1864 3000 98.0% chr7 + 41454155 41454348 194 browser details YourSeq 186 1672 1861 3000 99.0% chr2 + 70997981 70998170 190 browser details YourSeq 185 1672 1860 3000 99.0% chr7 - 57101389 57101577 189 browser details YourSeq 185 1672 2029 3000 91.1% chr12 - 86182885 86183216 332 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr17 - 83498934 83501933 3000 browser details YourSeq 493 529 1270 3000 92.1% chr4 - 32810917 32811518 602 browser details YourSeq 486 529 1638 3000 90.6% chr9 - 22186850 22187871 1022 browser details YourSeq 480 529 1272 3000 90.5% chr12 - 28681654 28682252 599 browser details YourSeq 480 529 1270 3000 91.3% chr1 - 33816376 33816975 600 browser details YourSeq 472 524 1268 3000 91.4% chr11 + 5844496 5845060 565 browser details YourSeq 469 529 1273 3000 90.0% chrX + 8120115 8120717 603 browser details YourSeq 465 529 1270 3000 90.8% chr17 - 16911336 16911926 591 browser details YourSeq 465 529 1270 3000 90.4% chr15 + 82432656 82433252 597 browser details YourSeq 465 529 1270 3000 90.5% chr13 + 120213915 120214503 589 browser details YourSeq 464 529 1270 3000 91.3% chr18 - 38357179 38357761 583 browser details YourSeq 460 529 1270 3000 91.2% chr7 - 11717646 11718223 578 browser details YourSeq 460 529 1270 3000 90.8% chr12 - 3203128 3203717 590 browser details YourSeq 457 529 1270 3000 88.1% chrX - 110266420 110267018 599 browser details YourSeq 457 529 1270 3000 90.3% chr6 + 37804896 37805499 604 browser details YourSeq 455 529 1270 3000 90.6% chr17 - 23642472 23643057 586 browser details YourSeq 454 529 1268 3000 90.5% chr4 - 20302077 20302661 585 browser details YourSeq 453 529 1270 3000 91.2% chr19 + 21321365 21321950 586 browser details YourSeq 449 529 1270 3000 89.8% chrX - 144303075 144303672 598 browser details YourSeq 447 529 1270 3000 90.2% chr18 + 6416925 6417512 588 Note: The 3000 bp section downstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 http://www.alphaknockout.com/ Gene and protein information: Cox7a2l cytochrome c oxidase subunit 7A2 like [ Mus musculus (house mouse) ] Gene ID: 20463, updated on 27-Aug-2019 Gene summary Official Symbol Cox7a2l provided by MGI Official Full Name cytochrome c oxidase subunit 7A2 like provided by MGI Primary source MGI:MGI:106015 See related Ensembl:ENSMUSG00000024248 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as EB1; SIG81; COX7AR; COX7RP; SIG-81; Silg81 Expression Ubiquitous expression in bladder adult (RPKM 103.0), heart adult (RPKM 81.6) and 28 other tissues See more Orthologs human all Genomic context Location: 17; 17 E4 See Cox7a2l in Genome Data Viewer Exon count: 4 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 17 NC_000083.6 (83501917..83514333, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 17 NC_000083.5 (83901257..83913673, complement) Chromosome 17 - NC_000083.6 Page 5 of 7 http://www.alphaknockout.com/ Transcript information: This gene has 4 transcripts Gene: Cox7a2l ENSMUSG00000024248 Description cytochrome c oxidase subunit 7A2 like [Source:MGI Symbol;Acc:MGI:106015] Gene Synonyms COX7AR, COX7RP, EB1, SIG-81, SIG81 Location Chromosome 17: 83,501,918-83,517,330 reverse strand. GRCm38:CM001010.2 About this gene This gene has 4 transcripts (splice variants), 240 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 1 phenotype. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Cox7a2l- ENSMUST00000167741.8 1129 134aa ENSMUSP00000131584.1 Protein coding CCDS50194 E9PZS8 TSL:1 202 GENCODE basic Cox7a2l- ENSMUST00000025095.8 1076 111aa ENSMUSP00000025095.7 Protein coding CCDS28995 Q3UDK5 TSL:1 201 Q61387 GENCODE basic APPRIS P1 Cox7a2l- ENSMUST00000235085.1 903 No - Retained - - - 204 protein intron Cox7a2l- ENSMUST00000234258.1 592 No - lncRNA - - - 203 protein 35.41 kb Forward strand 83.50Mb 83.51Mb 83.52Mb Contigs < AC164634.3 Genes (Comprehensive set... < Cox7a2l-201protein coding < Cox7a2l-202protein coding < Cox7a2l-204retained intron < Cox7a2l-203processed transcript Regulatory Build 83.50Mb 83.51Mb 83.52Mb Reverse strand 35.41 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Non-Protein Coding processed transcript Page 6 of 7 http://www.alphaknockout.com/ Transcript: ENSMUST00000025095 < Cox7a2l-201protein coding Reverse strand 12.41 kb ENSMUSP00000025... Transmembrane heli... Superfamily Cytochrome c oxidase, subunit VIIa superfamily Pfam Cytochrome c oxidase subunit VII PIRSF Cytochrome c oxidase subunit VIIa-related, mitochondrial PANTHER Cytochrome c oxidase subunit VIIa-related, mitochondrial Cytochrome c oxidase subunit VIIa, metazoa Gene3D Cytochrome c oxidase, subunit VIIa superfamily CDD Cytochrome c oxidase subunit VIIa, metazoa All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend inframe insertion missense variant splice region variant synonymous variant Scale bar 0 10 20 30 40 50 60 70 80 90 100 111 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC, VectorBuilder. Page 7 of 7.
Load more

Recommended publications
  • Human Blastocysts of Normal and Abnormal Karyotypes Display Distinct Transcriptome Profles Received: 16 March 2018 Frederick Licciardi1, Tenzin Lhakhang2, Yael G
    www.nature.com/scientificreports OPEN Human blastocysts of normal and abnormal karyotypes display distinct transcriptome profles Received: 16 March 2018 Frederick Licciardi1, Tenzin Lhakhang2, Yael G. Kramer3, Yutong Zhang4, Adriana Heguy4,5,6 & Accepted: 26 September 2018 Aristotelis Tsirigos 2,5,6 Published: xx xx xxxx Unveiling the transcriptome of human blastocysts can provide a wealth of important information regarding early embryonic ontology. Comparing the mRNA production of embryos with normal and abnormal karyotypes allows for a deeper understanding of the protein pathways leading to viability and aberrant fetal development. In addition, identifying transcripts specifc for normal or abnormal chromosome copy number could aid in the search for secreted substances that could be used to non- invasively identify embryos best suited for IVF embryo transfer. Using RNA-seq, we characterized the transcriptome of 71 normally developing human blastocysts that were karyotypically normal vs. trisomic or monosomic. Every monosomy and trisomy of the autosomal and sex chromosomes were evaluated, mostly in duplicate. We frst mapped the transcriptome of three normal embryos and found that a common core of more than 3,000 genes is expressed in all embryos. These genes represent pathways related to actively dividing cells, such as ribosome biogenesis and function, spliceosome, oxidative phosphorylation, cell cycle and metabolic pathways. We then compared transcriptome profles of aneuploid embryos to those of normal embryos. We observed that non-viable embryos had a large number of dysregulated genes, some showing a hundred-fold diference in expression. On the contrary, sex chromosome abnormalities, XO and XXX displayed transcriptomes more closely mimicking those embryos with 23 normal chromosome pairs.
    [Show full text]
  • COX7A2L Rabbit Pab
    Leader in Biomolecular Solutions for Life Science COX7A2L Rabbit pAb Catalog No.: A8298 Basic Information Background Catalog No. Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory A8298 chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by Observed MW mitochondrial genes and multiple structural subunits encoded by nuclear genes. The 13KDa mitochondrially-encoded subunits function in electron transfer, and the nuclear- encoded subunits may function in the regulation and assembly of the complex. This Calculated MW nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C- 12kDa terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen Category treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several Primary antibody transcript variants, some protein-coding and others non-protein coding, have been found for this gene. Applications WB Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 9167 O14548 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 1-114 of human COX7A2L (NP_004709.2). Synonyms COX7A2L;COX7AR;COX7RP;EB1;SIG81 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3.
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear Expression Correlation of Respiratory Genes
    Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Research Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad, Amit Blumberg, Tal Cohen, and Dan Mishmar Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq exper- iments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes’ co-expression across human tissues. Nevertheless, negative mtDNA- nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain re- gions, collectively termed the “primitive” brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neu- rons and nonneuronal cells) and by their spatial brain location. As the “primitive” brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found “primitive” brain-specific up-regula- tion of lactate dehydrogenase B (LDHB), which associates with high OXPHOS activity, at the expense of LDHA, which pro- motes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena.
    [Show full text]
  • CREB-Dependent Transcription in Astrocytes: Signalling Pathways, Gene Profiles and Neuroprotective Role in Brain Injury
    CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Tesis doctoral Luis Pardo Fernández Bellaterra, Septiembre 2015 Instituto de Neurociencias Departamento de Bioquímica i Biologia Molecular Unidad de Bioquímica y Biologia Molecular Facultad de Medicina CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado en Neurociencias del Instituto de Neurociencias de la Universidad Autónoma de Barcelona, llevado a cabo por Luis Pardo Fernández bajo la dirección de la Dra. Elena Galea Rodríguez de Velasco y la Dra. Roser Masgrau Juanola, en el Instituto de Neurociencias de la Universidad Autónoma de Barcelona. Doctorando Directoras de tesis Luis Pardo Fernández Dra. Elena Galea Dra. Roser Masgrau In memoriam María Dolores Álvarez Durán Abuela, eres la culpable de que haya decidido recorrer el camino de la ciencia. Que estas líneas ayuden a conservar tu recuerdo. A mis padres y hermanos, A Meri INDEX I Summary 1 II Introduction 3 1 Astrocytes: physiology and pathology 5 1.1 Anatomical organization 6 1.2 Origins and heterogeneity 6 1.3 Astrocyte functions 8 1.3.1 Developmental functions 8 1.3.2 Neurovascular functions 9 1.3.3 Metabolic support 11 1.3.4 Homeostatic functions 13 1.3.5 Antioxidant functions 15 1.3.6 Signalling functions 15 1.4 Astrocytes in brain pathology 20 1.5 Reactive astrogliosis 22 2 The transcription
    [Show full text]
  • Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
    International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M.
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear Expression Correlation of Respiratory Genes
    Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Research Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad, Amit Blumberg, Tal Cohen, and Dan Mishmar Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq exper- iments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes’ co-expression across human tissues. Nevertheless, negative mtDNA- nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain re- gions, collectively termed the “primitive” brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neu- rons and nonneuronal cells) and by their spatial brain location. As the “primitive” brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found “primitive” brain-specific up-regula- tion of lactate dehydrogenase B (LDHB), which associates with high OXPHOS activity, at the expense of LDHA, which pro- motes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena.
    [Show full text]
  • Universidad Autónoma De Madrid Programa De Doctorado En Biociencias Moleculares
    Universidad Autónoma de Madrid Programa de Doctorado en Biociencias Moleculares IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Tesis Doctoral Teresa Lobo Jarne Madrid 2018 DEPARTAMENTO DE BIOQUÍMICA FACULTAD DE MEDICINA UNIVERSIDAD AUTÓNOMA DE MADRID IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Memoria presentada por la Licenciada en Biotecnología Teresa Lobo Jarne para optar al grado de Doctor por la Universidad Autónoma de Madrid Directora de Tesis: Dra. Cristina Ugalde Bilbao Instituto de Investigación Hospital 12 de Octubre (i+12) DEPARTAMENTO DE BIOQUÍMICA FACULTAD DE MEDICINA UNIVERSIDAD AUTÓNOMA DE MADRID Doña Cristina Ugalde Bilbao, Doctora en Ciencias, como Directora de Tesis, CERTIFICA: Que Doña Teresa Lobo Jarne, con DNI 72996109-C, licenciada en Biotecnología, ha realizado bajo mi dirección en el Instituto de Investigación Hospital 12 de Octubre (i+12) de Madrid, el trabajo titulado: IMPACT OF COX7A2L IN THE BIOGENESIS OF HUMAN MITOCHONDRIAL RESPIRATORY CHAIN SUPERCOMPLEXES Una vez supervisado el trabajo, considero que cumple con éxito todos los requisitos necesarios en cuanto a originalidad y calidad para ser presentado como Tesis Doctoral con el objeto de optar al título de Doctor por la Universidad Autónoma de Madrid. Madrid, a 25 de Enero del 2018 Dra. Cristina Ugalde Bilbao Directora de Tesis Laboratorio de Enfermedades Raras: Mitocondriales y Neuromusculares Instituto de Investigación Hospital 12 de Octubre (i+12) Avenida de Córdoba
    [Show full text]
  • Human Primitive Brain Displays Negative Mitochondrial-Nuclear
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad1, Amit Blumberg1, Tal Cohen1 and Dan Mishmar1* 1 Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel *Corresponding author Address: Dan Mishmar, PhD Department of Life Sciences Ben-Gurion University of the Negev Beer Sheva 8410501, Israel Tel: +972-86461355 FAX: 972-86461356 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA) and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic co-regulation is poorly understood. To address this question, we analyzed ~8,500 RNA-seq experiments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity and morphology, we found overall positive mtDNA-nDNA OXPHOS genes' co-expression across human tissues. Nevertheless, negative mtDNA-nDNA gene expression was identified in the hypothalamus, basal ganglia and amygdala (sub-cortical brain regions, collectively termed the 'primitive' brain). Single cell RNA-seq analysis of mouse and human brains, revealed that this phenomenon is evolutionarily conserved, and both associate with brain cell types (involving excitatory/inhibitory neurons and non-neuronal cells) and by their spatial brain location. As the 'primitive' brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co- expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring towards glycolysis.
    [Show full text]
  • COX7A2L (NM 004718) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC117225 COX7A2L (NM_004718) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX7A2L (NM_004718) Human Untagged Clone Tag: Tag Free Symbol: COX7A2L Synonyms: COX7AR; COX7RP; EB1; SCAF1; SCAFI; SIG81 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC117225 sequence for NM_004718 edited (data generated by NextGen Sequencing) ATGTACTACAAGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCC TATAGCCCGCAGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCC ACACCAACTAAACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTT CCAGAGCTACAAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGC CTGCCTGACCAAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTAC TGCCTGATCGCCCTCTACATGGCTTCGCAGCCCAAAAACAAATGA Clone variation with respect to NM_004718.2 5' Read Nucleotide >OriGene 5' read for NM_004718 unedited Sequence: AAGTCAGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGTCCTTCT CTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACTACA AGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCCTATAGCCCGC AGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCCACACCAACTA AACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTTCCAGAGCTAC AAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGCCTGCCTGACC AAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTACTGCCTGATCG CCCTCTACATGGCTTCGCAGCCCAAAAACAAATGAGTTAGGCTGCAGAGGACTGGTTTGT
    [Show full text]
  • Mouse Cox7a2l Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Cox7a2l Knockout Project (CRISPR/Cas9) Objective: To create a Cox7a2l knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cox7a2l gene (NCBI Reference Sequence: NM_001159529 ; Ensembl: ENSMUSG00000024248 ) is located on Mouse chromosome 17. 4 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000167741). Exon 2~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for an allele encoding the short isoform exhibit higher succinate or pyruvate and malate-driven respiration rates with failure of an additive effect of pyruvate and malate in fed mice or an increase in succinate respiration in fasted mice. Exon 2 starts from about 18.16% of the coding region. Exon 2~3 covers 49.25% of the coding region. The size of effective KO region: ~298 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 Legends Exon of mouse Cox7a2l Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix.
    [Show full text]
  • 1 1 Full Title 2 PRMT1 Is Required for the Maintenance of Mature Β Cell
    Page 1 of 72 Diabetes 1 Full title 2 PRMT1 is required for the maintenance of mature β cell identity 3 4 Short running title 5 Essential role of PRMT1 in β cell identity 6 7 Authors 8 Hyunki Kim1, #, young-Ha Yoon2, 3, #, Chang-Myung Oh4, #, Joonyub Lee1, #, Kanghoon Lee1, Heein 9 Song1, Eunha Kim5, Kijong Yi1, Mi-Young Kim6, Hyeongseok Kim1, Yong Kyung Kim7, Eun-Hye 10 Seo2, 3, Haejeong Heo2, 3, Hee-Jin Kim2, Junguee Lee8, Jae Myoung Suh1, Seung-Hoi Koo9, Je Kyung 11 Seong6,10, Seyun Kim5, Young Seok Ju1, Minho Shong7, Mirang Kim2, 3, * and Hail Kim1, 11, * 12 13 Affiliations 14 1Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and 15 Technology, Daejeon 34141, Republic of Korea 16 2Personalized Genomic Medicine Research Center, Korea Research Institute of Bioscience and 17 Biotechnology, Daejeon 34141, Republic of Korea 18 3Department of Functional Genomics, University of Science and Technology, Daejeon 34113, 19 Republic of Korea 20 4Department of Biomedical Science and Engineering, Gwangju Institute of Science and Technology, 21 Gwangju 61005, Republic of Korea 22 5Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 23 34141, Republic of Korea 24 6Laboratory of Developmental Biology and Genomics, Research Institute for Veterinary Science, 25 BK21 PLUS Program for Creative Veterinary Science Research, College of Veterinary Medicine, 1 Diabetes Publish Ahead of Print, published online December 17, 2019 Diabetes Page 2 of 72 26 Seoul National University, and Korea Mouse Phenotyping Center (KMPC), Seoul 08826, Republic 27 of Korea 28 7Research Center for Endocrine and Metabolic Diseases, Chungnam National University School of 29 Medicine, 282 Munhwaro, Daejeon 35015, Republic of Korea 30 8Department of Pathology, Daejeon St.
    [Show full text]
  • Downloaded from Ensembl Biomart Martview Application to Perform the GO Enrichment Analysis
    life Article Regulatory Potential of Long Non-Coding RNAs (lncRNAs) in Boar Spermatozoa with Good and Poor Freezability Leyland Fraser 1,* , Łukasz Paukszto 2 , Anna Ma ´nkowska 1, Paweł Brym 3, Przemysław Gilun 4 , Jan P. Jastrz˛ebski 2 , Chandra S. Pareek 5 , Dibyendu Kumar 6 and Mariusz Pierzchała 7 1 Department of Animal Biochemistry and Biotechnology, Faculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] 2 Department of Plant Physiology, Genetics and Biotechnology, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] (Ł.P.); [email protected] (J.P.J.) 3 Department of Animal Genetics, Faculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] 4 Department of Local Physiological Regulations, Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Bydgoska 7, 10-243 Olsztyn, Poland; [email protected] 5 Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences, Nicolaus Copernicus University, 87-100 Toru´n,Poland; [email protected] 6 Waksman Institute of Microbiology, Rutgers, The State University of New Jersey, Piscataway, NJ 08554, USA; [email protected] 7 Institute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrz˛ebiec, 05-552 Magdalenka, Poland; [email protected] * Correspondence: [email protected] Received: 27 October 2020; Accepted: 19 November 2020; Published: 21 November 2020 Abstract: Long non-coding RNAs (lncRNAs) are suggested to play an important role in the sperm biological processes.
    [Show full text]