DOCSLIB.ORG

A Neo-W Chromosome in a Tropical Butterfly Links Colour Pattern, Male Killing And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Neo-W Chromosome in a Tropical Butterfly Links Colour Pattern, Male Killing And ORE Open Research Exeter TITLE A neo-W chromosome in a tropical butterfly links colour pattern, male-killing, and speciation AUTHORS Smith, DAS; Gordon, IJ; Traut, W; et al. JOURNAL Proceedings of the Royal Society B: Biological Sciences DEPOSITED IN ORE 17 November 2016 This version available at http://hdl.handle.net/10871/24481 COPYRIGHT AND REUSE Open Research Exeter makes this work available in accordance with publisher policies. A NOTE ON VERSIONS The version presented here may differ from the published version. If citing, you are advised to consult the published version for pagination, volume/issue and date of publication Submitted to Proceedings of the Royal Society B: For Review Only A neo -W chromosome in a tropical butterfly links colour pattern, male killing and speciation Journal: Proceedings B Manuscript ID Draft Article Type: Research Date Submitted by the Author: n/a Complete List of Authors: Smith, David; Natural History Museum, Eton College Gordon, Ian; Birdlife International Traut, Walther; Universitat zu Lubeck Sektion Naturwissenschaften Herren, Jeremy; International Centre for Insect Physiology and Ecology Collins, Steve; African Butterfly Research Institute Martins, Dino; Turkana Basin Institute, Saitoti, Kennedy; National Museiums of Kenya Ireri, Piera; Kenyatta University ffrench-Constant, Richard; University of Exeter, Subject: Evolution < BIOLOGY, Ecology < BIOLOGY, Genetics < BIOLOGY Keywords: neoW, chromosome, male-killing, Spiroplasma, colour pattern Proceedings B category: Population Genetics http://mc.manuscriptcentral.com/prsb Page 1 of 17 Submitted to Proceedings of the Royal Society B: For Review Only 1 1 A neo-W chromosome in a tropical butterfly links colour pattern, male killing and 2 speciation 3 4 David A. S. Smith 1, Ian J. Gordon 2,3 , Walther Traut 4, Jeremy Herren 5, Steve Collins 6, Dino J. Martins 7, Kennedy 5 Saitoti 3, Piera Ireri 8 and Richard ffrench-Constant 9* 6 1Natural History Museum, Eton College, Windsor SL4 6DW, UK. 2BirdLife International, Africa Partnership 7 Secretariat, Box 3502-00100, Nairobi, Kenya. 3Department of Zoology, National Museums of Kenya, Box 4068- 8 00100, Nairobi, Kenya. 4Institut für Biologie, Zentrum für medizinische Struktur- und Zellbiologie, Universität 9 Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany. 5Emerging Infectious Diseases Lab, ICIPE, Box 10 30772-00506, Nairobi, Kenya. 6African Butterfly Research Institute (ABRI), Box 14308-0800, Nairobi, Kenya. 11 7Insect Committee of Nature Kenya, Box 24467-00100, Nairobi, Kenya. 8Department of Zoological Sciences, 12 Kenyatta University, Nairobi 43844-00100, Kenya. 9Centre for Ecology and Conservation, University of Exeter, 13 Falmouth, TR10 9EZ, UK. 14 *Correspondence: [email protected] 15 http://mc.manuscriptcentral.com/prsb Submitted to Proceedings of the Royal Society B: For Review Only Page 2 of 17 2 16 17 Sexually antagonistic selection can drive both the evolution of sex chromosomes and speciation itself. The 18 tropical butterfly the African Queen, Danaus chrysippus , shows two such sexually antagonistic 19 phenotypes, sex-linked colour polymorphism and susceptibility to a male-killing mollicute Spiroplasma 20 ixodetis . In East Africa male-killing is prevalent in a narrow hybrid zone centred on Nairobi. This hybrid 21 zone separates otherwise allopatric subspecies with different colour patterns. Here we show that a neo-W 22 chromosome, a fusion between the W (female) chromosome and an autosome that controls colour pattern, 23 links susceptibility to male-killing with a change in colour pattern. Studies of the population genetics of 24 the neo-W around Nairobi show that the interaction between colour pattern and male-killer susceptibility 25 restricts gene flow between the two subspecies of D. chrysippus . Our results demonstrate how a complex 26 interplay between sex, colour pattern, male-killing and a neo-W chromosome, has set up a genetic 27 ‘firewall’ that keeps the two subspecies apart. The association between the neo-W and male-killing thus 28 provides a ‘smoking gun’ for an ongoing speciation process. 29 30 Keywords: Danaus chrysippus ; male-killing; neo-W chromosome; colour pattern; speciation; Spiroplasma . 31 32 http://mc.manuscriptcentral.com/prsb Page 3 of 17 Submitted to Proceedings of the Royal Society B: For Review Only 3 33 34 INTRODUCTION 35 Ever since Poulton [1] noted that two butterfly colour morphs could be bred from the same parents, the African 36 Queen, Danaus chrysippus (L.), has been considered ‘polymorphic’. However, our long-term studies at three 37 sites around Nairobi, Kenya (figure S1), have established that in this region the butterfly comprises two 38 essentially parapatric (though migratory) subspecies. D. c. chrysippus and D. c. dorippus (henceforth termed 39 chrysippus and dorippus , figure 1 a-c). Each subspecies has an individual colour pattern controlled by a single 40 autosomal locus C [2-4], dorippus being homozygous for CC and chrysippus homozygous for cc . The F 1 hybrid 41 transiens (the heterozygote Cc ) closely resembles dorippus but is usually phenotypically detectable (figure 1e) 42 [5]. The subspecies make frequent contact across East Africa creating colour polymorphisms within a mosaic of 43 hybrid clines centred on Nairobi but reaching south to Tanzania [2], east into Uganda [6-9], and north to Sudan 44 [8], Ethiopia [10] and Oman [9]. Outside the hybrid zone, both subspecies are monomorphic for the C locus 45 through their separate ranges [figure 1S, 11-12]. 46 Previous investigations have explored relationships between colour pattern, male-killing and sex linkage. 47 Throughout the hybrid zone female-biased sex ratios, driven by male-killing and marked by hybrid excess, 48 predominate [2-4]. Two phenotypes are associated, the first being colour pattern, which may be sex-linked or 49 independent of sex and the second susceptibility to the male-killing intracellular mollicute Spiroplasma ixodetis 50 [13-14]. We have previously found that the c bearing autosome of chrysippus females strictly segregates with the 51 W chromosome within the hybrid zone and have therefore postulated that a W-autosomal fusion (W͞ c) has 52 occurred [11-12], physically linking the female determining W chromosome with the colour pattern locus C. 53 Further, we have also found within the hybrid zone that chrysippus females and their transiens daughters are all 54 infected with the male-killing Spiroplasma and thus produce all-female broods, whereas, in contrast, dorippus 55 females are largely uninfected by Spiroplasma and therefore produce both males and females. The aims of the 56 present study were therefore to look at five specific factors likely to govern the population genetics of the hybrid 57 zone. 1) To demonstrate, using cytogenetics, that an autosome has indeed become fused to the female-specific 58 W-chromosome, as previously postulated. 2) To document the frequency of Spiroplasma infection in the hybrid 59 zone and to try to understand how this fusion maintains the highly female-biased sex ratios found. 3) To 60 investigate any possible relationship between population density and sex ratio. 4) To document, via 61 spermatophore count per female, potentially different rates of mating between hybrids and pure-bred individuals http://mc.manuscriptcentral.com/prsb Submitted to Proceedings of the Royal Society B: For Review Only Page 4 of 17 4 62 in the hybrid population. 5) Finally, to examine whether sexual selection or mate choice (assortative, random or 63 disassortative) within the hybrid zone affects sex ratio. 64 Here, in a cytogenetic analysis using fluorescent in situ hybridisation (FISH) to visualise telomeres, we show 65 that in chrysippus females the W chromosome is fused to an autosome and forms a trivalent with the Z 66 chromosome and the autosome in meiosis, whereas in dorippus females W/Z and autosomes pair independently, 67 as do Z and autosomes in all males. We also show that in a female-dominated hybrid zone site at Kitengela 68 (figure S1) immigrant dorippus males are relatively immune to male-killing and that nearly all females are 69 inseminated despite outnumbering males by around 5:1. Paradoxically, the female-biased hybrid population is an 70 evolutionary stable strategy (or ESS) which can withstand perturbations induced by weather, population density 71 or immigration and reinforces a barrier to gene flow between two nascent species that has endured for at least 40 72 years around Nairobi [2-3]. The extraordinary effectiveness of this barrier is demonstrated by field data, 73 presented here, that shows a rapid return to the prevailing female biased sex ratios after a seasonal influx of 74 males that are Spiroplasma -infected but resistant to male-killing. 75 76 2. MATERIAL AND METHODS 77 (a) Cytogenetics 78 Male metaphase I and II cells were obtained from testis cysts of pupae and last-instar larvae, female pachytene 79 cells from the tips of ovarioles of adult females. Fixation in Carnoy's fluid (ethanol:chloroform:acetic acid, 80 6:3:1) was followed by spreading in 60% acetic acid and staining with 4'6-diamidino-2-phenylindole (DAPI). 81 Female metaphase I was prepared from mature eggs by fixation in Carnoy's fluid, squashing in 60% acetic acid, 82 freezing in liquid N 2, flipping off the coverslip with a scalpel ('dry ice method'), post-fixation in ethanol and 83 staining with DAPI. Telomeres were visualised by FISH with a (TTAGG)n probe generated by substrate-free 84 PCR (primers: TAGGTTAGGTTAGGTTAGGT and CTAACCTAACCTAACCTAAC ) and labelled with Orange- 85 dUTP. 86 87 (b) Spiroplasma screening 88 DNA from D. chrysippus was extracted from a 2 mm 2 piece of thorax tissue using the Puragene DNA 89 purification kit (Quiagen, Valencia, CA). DNA was extracted using three times the suggested volume for a single 90 Drosophila and then hydrated in 70 µL ddH 2O. Previously described ixodetus-clade specific primers (SpixoF http://mc.manuscriptcentral.com/prsb Page 5 of 17 Submitted to Proceedings of the Royal Society B: For Review Only 5 91 and SpixoR) and PCR cycling conditions [15] were used to amplify an 810 bp region of Spiroplasma 16S rDNA 92 to confirm the presence of Spiroplasma .
Load more

Recommended publications
  • Lepidoptera: Nymphalidae)
    14 TROP. LEPID. RES., 23(1): 14-21, 2013 HASSAN ET AL.: Wolbachia and Acraea encedon MORPH RATIO DYNAMICS UNDER MALE-KILLER INVASION: THE CASE OF THE TROPICAL BUTTERFLY ACRAEA ENCEDON (LEPIDOPTERA: NYMPHALIDAE) Sami Saeed M. Hassan1, 2, 3*, Eihab Idris2 and Michael E. N. Majerus4 1 Department of Zoology, Faculty of Science, University of Khartoum, P.O. Box 321, Postal Code 11115, Khartoum, Sudan. 2 Department of Biology, Faculty of Science, University of Hail, P.O. Box 1560, Hail, Kingdom of Saudi Arabia. 3 Department of Genetics, University of Cambridge, CB2 3EH, Cambridge, UK. 4 Deceased – Department of Genetics, University of Cambridge. * Corresponding author: E-mail: [email protected] Abstract - This study aimed to provide field-based assessment for the theoretical possibility that there is a relationship between colour polymorphism and male- killing in the butterflyAcraea encedon. In an extensive, three year study conducted in Uganda, the spatial variations and temporal changes in the ratios of different colour forms were observed. Moreover, the association between Wolbachia susceptibility and colour pattern was analyzed statistically. Two hypotheses were tested: first, morph ratio dynamics is a consequence of random extinction-colonization cycles, caused by Wolbachia spread, and second, particular colour forms are less susceptible to Wolbachia infection than others, implying the existence of colour form-specific resistance alleles. Overall, obtained data are consistent with the first hypothesis but not with the second, however, further research is needed before any firm conclusions can be made on the reality, scale and nature of the presumed association between polymorphism and male-killing in A. encedon.
    [Show full text]
  • Life Cycle and Biology of Danaus Chrysippus (L.) (Plain Tiger) on Asclepias Curassavica (L.) at Andhra University Campus, Visakhapatnam
    IOSR Journal of Pharmacy and Biological Sciences (IOSR-JPBS) e-ISSN:2278-3008, p-ISSN:2319-7676. Volume 11, Issue 3 Ver. III (May - Jun.2016), PP 91-98 www.iosrjournals.org Life Cycle and Biology of Danaus Chrysippus (L.) (Plain Tiger) on Asclepias Curassavica (L.) at Andhra University Campus, Visakhapatnam. K. Ella Rao1, *G. Sujan Chandar2, J.B.Atluri3 1,2,3(Department of Botany, Andhra University, Visakhapatnam- 530003, Andhra Pradesh) *corresponding Author E-mail: [email protected] Abstract: The Danaidae butterfly Danaus Chrysippus (Plain Tiger) it occurs throughout the year. The larval performance and life cycle of Danaus Chrysippus was studied at Andhra University campus using the leaves of Asclepias Curassavica as the larval host both in laboratory and in the natural conditions. The behavior and morphological characters of eggs, caterpillars, pupae and adult emergence were observed in the laboratory at 28o-30oc. The life cycle was completed in 17-18 days, with egg hatching 3 larvae 7-8, and pupae 7-8 days. The values of consumption index (CI), growth rate (GR), and approximate digestibility (AD) across the instars decreased as the larvae aged. The average values of the CI and GR are 0.97, 0.22 respectively, and that of AD is 74.43. But the values of both efficiency of conversion of digested food (ECD) and efficiency of conversion of ingested food (ECI) either increased or decreased from instar to instar. Keywords: Oviposition, Danaidae, Danaus Chrysippus, Instars, Food utilization indices. I. Introduction The phytophagous insects like butterflies are closely related with the plants and provide economic and ecological benefits to the human society.
    [Show full text]
  • (Lepidoptera: Pieridae) Butterflies Are Palatable to Avian Predators
    insects Article Evaluating an Alleged Mimic of the Monarch Butterfly: Neophasia (Lepidoptera: Pieridae) Butterflies are Palatable to Avian Predators Dale A. Halbritter 1,2,* , Johnalyn M. Gordon 3, Kandy L. Keacher 4, Michael L. Avery 4,5 and Jaret C. Daniels 2,6 1 USDA-ARS Invasive Plant Research Laboratory, 3225 College Ave, Fort Lauderdale, FL 33314, USA 2 Entomology and Nematology Department, University of Florida, 1881 Natural Area Dr, Steinmetz Hall, Gainesville, FL 32611, USA; jdaniels@flmnh.ufl.edu 3 Fort Lauderdale Research and Education Center, University of Florida, 3205 College Ave, Davie, FL 33314, USA; johnalynmgordon@ufl.edu 4 Florida Field Station, USDA-APHIS National Wildlife Research Center, 2820 E University Ave, Gainesville, FL 32641, USA; [email protected] (K.L.K.); [email protected] (M.L.A.) 5 2906 NW 14th Pl., Gainesville, FL 32605, USA 6 McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, 3215 Hull Road, Gainesville, FL 32611, USA * Correspondence: dhalb001@ufl.edu or [email protected]; Tel.: +1-661-406-8932 Received: 28 September 2018; Accepted: 22 October 2018; Published: 29 October 2018 Abstract: Some taxa have adopted the strategy of mimicry to protect themselves from predation. Butterflies are some of the best representatives used to study mimicry, with the monarch butterfly, Danaus plexippus (Lepidoptera: Nymphalidae) a well-known model. We are the first to empirically investigate a proposed mimic of the monarch butterfly: Neophasia terlooii, the Mexican pine white butterfly (Lepidoptera: Pieridae). We used captive birds to assess the palatability of N. terlooii and its sister species, N.
    [Show full text]
  • Petition to Protect the Monarch Butterfly (Danaus Plexippus Plexippus) Under the Endangered Species Act
    BEFORE THE SECRETARY OF THE INTERIOR © Jeffrey E. Belth PETITION TO PROTECT THE MONARCH BUTTERFLY (DANAUS PLEXIPPUS PLEXIPPUS) UNDER THE ENDANGERED SPECIES ACT Notice of Petition Sally Jewell, Secretary U.S. Department of the Interior 1849 C Street NW Washington, D.C. 20240 [email protected] Dan Ashe, Director U.S. Fish and Wildlife Service 1849 C Street NW Washington, D.C. 20240 [email protected] Douglas Krofta, Chief Branch of Listing, Endangered Species Program U.S. Fish and Wildlife Service 4401 North Fairfax Drive, Room 420 Arlington, VA 22203 [email protected] Monarch ESA Petition 2 PETITIONERS The Center for Biological Diversity (“Center”) is a nonprofit, public interest environmental organization dedicated to the protection of imperiled species and the habitat and climate they need to survive through science, policy, law, and creative media. The Center is supported by more than 775,000 members and activists throughout the country. The Center works to secure a future for all species, great or small, hovering on the brink of extinction. The Center for Food Safety (“CFS”) is a nonprofit public interest organization established in 1997 whose mission centers on protecting public health and the environment by curbing the adverse impacts of industrial agriculture and food production systems on public health, the environment, and animal welfare, and by instead promoting sustainable forms of agriculture. As particularly relevant here, CFS is the leading nonprofit working on the adverse impacts of genetically engineered crops and neonicotinoid pesticides. CFS and its over half-a-million members are concerned about the impacts of industrial agriculture on biodiversity generally, and on monarch butterflies specifically.
    [Show full text]
  • Danaus Chrysippus and Its Polymorphic Mullerian Mimics in Tropical Africa (Lepidoptera: Nymphalidae: Danainae)
    Vol. 4 No. 2 1993 OWEN and SMITH: African Mimics of Danam chrysippus 77 TROPICAL LEPIDOPTERA, 4(2): 77-81 DANAUS CHRYSIPPUS AND ITS POLYMORPHIC MULLERIAN MIMICS IN TROPICAL AFRICA (LEPIDOPTERA: NYMPHALIDAE: DANAINAE) DENIS F. OWEN AND DAVID A. S. SMITH School of Biological and Molecular Sciences, Oxford Brookes University, Headington, Oxford OX3 OBP, England, UK; Department of Biology, Eton College, Windsor, Berkshire SL4 6EW, England, UK ABSTRACT.- Theoretically, Miillerian mimicry, in which there is convergence of coloration between unrelated unpalatable species, should lead to uniformity in appearance, not polymorphism. Hence the discovery in Africa of polymorphic Miillerian mimics in the Danainae and Acraeinae suggested an evolutionary problem of special interest. Field and laboratory work in Uganda and Sierra Leone in 1964-72 demonstrated a statistical association between the occurrence and relative frequencies of corresponding colour forms in Danaus chrysippus and Acraea encedon which was deemed as confirmation of the Miillerian relationship between the two species. There were, however, certain anomalies which at the time could not be resolved. Later (1976), it was discovered that what had been called A. encedon is in reality two sibling species, A. encedon and a new one, named as A. encedana. The two differ in the structure of both male and female genitalia and in the coloration and the food-plants of the larvae. Some color forms are shared, others are restricted to one species only. The recognition of the additional species has enabled a re-assessment of the polymorphic Miillerian association between D. chrysippus and the two Acraea species. What emerges is that throughout tropical Africa there is a close mimetic association between D.
    [Show full text]
  • Danaus Chrysippus ) Diversity in Union Council Koaz Bahram Dheri
    Available online at www.easletters.com Entomology and Applied Science ISSN No: 2349-2864 Letters, 2014, 1, 3:19-22 Butterfly Lepidoptera ( Danaus Chrysippus ) diversity in union council Koaz Bahram Dheri Haroon *1 , Rooh Ullah 1 and Tauseef Ahmad 2 1Department of Zoology Shaheed Benazir Bhutto University Dir (Upper), Khyber Pakhtunkhwa Pakistan 2Department of Microbiology Hazara University Mansehra, Khyber Pakhtunkhwa Pakistan Correspondence: [email protected] (Received: 8-7-14 ) (Accepted:26-7-14) _____________________________________________________________________________________________ ABSTRACT Butterflies play an important role in ecosystem. The present study was conducted in Union Council Koaz Bahram Dheri Khyber Pakhtunkhwa Pakistan during the period July 2012 to October 2012. The collection of butterflies was done randomly by using the Arial net and neck hand. A total of 73 specimens of Danaus chrysippus were collected from different study sites of the said area. The high number of specimens was collected from Haji Sargund Kally 8 (10.96%), Toor Khat Kally 8 (10.96%), Soor Kamar 8 (10.96%) and Mardhand 8 (10.96%). The wing span is 8.2±0.20 cm and body length 2.5±0.23 cm. From the present investigation it was concluded that the Danaus chrysippus species is common in Union Council Koaz Bahram Dehri. The area has rich fauna of butterflies and recommended further studies. Key words: Butterfly, Danaus chrysippus, wing span, Arial net, Pollinator. _____________________________________________________________________________________________ INTRODUCTION Butterflies are the most important group of insects on the earth which are adapted among the common community and discipline due to their outstanding colors and graceful flight [1]. Butterflies serve as important plant pollinators in the local environment, and help to pollinate more than 50 economically important plants and crops, in ecosystem functioning, including nutrient cycling and pollination, they should be studied as potential biological indicators, and for their conservation [2].
    [Show full text]
  • The Life Cycle of Danaus Chrysippus Linnaeus (Lepidoptera: Nymphalidae) on Calotropis Procera in Bushehr-Iran
    _____________Mun. Ent. Zool. Vol. 4, No. 2, June 2009__________ 451 THE LIFE CYCLE OF DANAUS CHRYSIPPUS LINNAEUS (LEPIDOPTERA: NYMPHALIDAE) ON CALOTROPIS PROCERA IN BUSHEHR-IRAN. Seyed Reza Golestaneh*, Hassan Askary**, Nasser Farar* and AbuFazel Dousti*** * Bushehr Research Center of Agriculture & Natural Resources, IRAN. ** Iran Plant Pests & Diseases research institute, IRAN. *** Jahrom Azad University, IRAN. [Golestaneh, S. R., Askary, H., Farar, N. & Dousti, A. 2009. The life cycle of Danaus chrysippus Linnaeus (Lepidoptera: Nymphalidae) on Calotropis procera in Bushehr-Iran. Munis Entomology & Zoology, 4 (2): 451-456] ABSTRACT: Danaus chrysippus L. (Lep.: Nymphalidae) is the most important pest on Calotropis procera in Bushehr-Iran. The larvae feed on the leaves and make some damages and losses on host. This study carried out on D. chrysippus life cycle in Bushehr from 2006 to 2007. For the life cycle studies, the eggs were collected from the nature and were developed in Petri dishes and 10×12 plastic dishes from egg to adult at under laboratory condition (25±2 ºC and 22±2 ºC, %60±10 RH and 16/8 L:D). The Egg, Larval and Pupal periods were frequently 3.4 ± 0.1 and 4.5 ± 0.1; 12.5 ± 0.2 and 19.1 ± 0.4; 9.8 ± 0.3 and 14.6 ± 0.7 days in 25 ºC and 22 ºC at lab. The total period from egg to adult was 26.07± 0.8 and 37.08± 0.5 days in 25 ºC and 22 ºC at laboratory condition. KEY WORDS: Life cycle, Danaus chrysippus, Calotropis procera, Bushehr, Iran. Calotropis procera is an Asclepias genus that is distributed in tropical and subtropical areas such as Africa, India, Egypt, Pakistan, Iran, Arabic islands and Australia.
    [Show full text]
  • Patterns of Diversity, Abundance and Habitat Associations of Butterfly Communities in Heterogeneous Landscapes of the Department
    International Journal of Biodiversity and Conservation Vol. 2(4), pp. 75-85, April 2010 Available online http://www.academicjournals.org/ijbc ISSN 2141-243X ©2010 Academic Journal Full Length Research Paper Patterns of diversity, abundance and habitat associations of butterfly communities in heterogeneous landscapes of the department of atomic energy (DAE) campus at Kalpakkam, South India T. Ramesh1, K. Jahir Hussain2, M. Selvanayagam1, K. K. Satpathy2* and M. V. R. Prasad2 1Loyola Institute of Frontier Energy (LIFE), Loyola College, Chennai- 600 034, India. 2Environmental and Industrial Safety Section, Safety Group, Indira Gandhi, Centre for Atomic Research, Kalpakkam- 603102, India. Accepted 28 January, 2010 The diversity of butterflies inhabiting the department of atomic energy campus at Kalpakkam was recorded through a modified line transect methodology by setting a permanent line transect of 300m and recoding all species of butterflies observed within a five meter distance around the observer. Five habitats within the campus viz., Garden, Scrub jungle, Riparian woods, Sandy area and Casuarina plantation (Monoculture) were evaluated for analysis of the association of the butterfly species with the habitat. A total of 1908 individuals representing 55 species were observed across the five habitat types. Out of these, members belonging to the family Nymphalidae was the most common with 20 species being recorded accounting for 36.3% of total species and 53.6% of total number of individuals collected. The maximum diversity and abundance was observed in the scrub jungle and garden area; these two habitats sharing 29 species among themselves. The species accumulation curve and rarefaction curves computed indicated the likelihood of encountering more number of species in the campus had inventory been more rigorous and extended.
    [Show full text]
  • A Classification of Danaus Butterflies (Lepidoptera: Nymphalidae)
    Blackwell Science, LtdOxford, UKZOJZoological Journal of the Linnean Society0024-4082The Lin- nean Society of London, 2005? 2005 1442 191212 Original Article CLASSIFICATION OF DANAUSD. A. S. SMITH ET AL. Zoological Journal of the Linnean Society, 2005, 144, 191–212. With 3 figures A classification of Danaus butterflies (Lepidoptera: Nymphalidae) based upon data from morphology and DNA DAVID A. S. SMITH FLS1*, GUGS LUSHAI FLS2 and JOHN A. ALLEN FLS2 1Natural History Museum, Eton College, Windsor SL4 6EW, UK 2Ecology & Biodiversity Division, School of Biological Sciences, University of Southampton SO16 7PX, UK Received September 2003; accepted for publication March 2005 Classification of the cosmopolitan butterfly genus Danaus (Nymphalidae: Danainae) is revised at subgeneric, specific and subspecific levels, combining for the first time mitochondrial and nuclear DNA sequence information with mor- phological data. Tree topologies based on the nuclear genome (allozymes, pheromone components, the morphology of all life history stages and nuclear DNA sequences), on the one hand, and mitochondrial DNA, on the other, are incon- gruent and challenge the current taxonomy of the genus. Although earlier classifications, based on adult morphology alone, are, in general, well supported by an analysis of total evidence, the mitochondrial phylogeny shows that the species D. chrysippus and its subgenus Anosia are deeply paraphyletic. Subspecies dorippus of D. chrysippus is the basal clade of the genus and is reinstated as the species D. dorippus. The former species D. plexaure is demoted to a subspecies of D. eresimus. The specific status of D. erippus, as distinct from D. plexippus, is tentatively supported. On the strength of the new data, division of the monophyletic genus Danaus s.l.
    [Show full text]
  • Agriculture & Horticulture
    Prasad Deshmukh, Agrotechnol 2015, 4:2 http://dx.doi.org/10.4172/2168-9881.S1.016 4th International Conference on Agriculture & Horticulture July 13-15, 2015 Beijing, China Study of Danaus chrysippus & its conservation Prasad Deshmukh Mahatma Phule Krishi Vidyapeeth, India lain tiger or African Monarch or Danaus chrysippus is a one of the well distributed species of Monarch butterfly in the Indian Psubcontinent after Africa, China, Chile, Sri Lanka & other Asian countries including Bangladesh. In college of Agriculture, Baramati, we carried out a study on this well distributed African monarch. Danaus chrysippus feeds on different species of Milkweed (Asclepias). Two most common species Calotropis giganta (purple flowers) & Calotropis procera (white flowers) are commonly found host for Danaus chrysippus. In this study, we collected larvae or caterpillar of plain tiger monarch at different stages & corresponding population of it on different species of its host plant. Different phases of life cyclei.e. caterpillar, chrysalis, and adult of Danaus chrysippus were observed in Natural & lab conditions. Also, we studied about the most preferred species of Milkweed for Danaus chrysippus. Mimicry by other insects & chemical (cardiac fluid) defense mechanisms are some of the distinctive study characteristic’s about monarch butterfly. Hence this study revealed that there are many threats to the population ofDanaus chrysippus as in case of Danaus plexippus species of Monarch butterfly (An endangered Migratory species) found in Mexico & other American countries. Keeping in mind that, study of biodiversity of different species of living organisms on earth is important, we found some conservative practices that can be followed for Danaus chrysippus.
    [Show full text]
  • Studies on Butterfly Diversity in Adichanalloor Village, Kollam
    Journal of Entomology and Zoology Studies 2017; 5(5): 73-81 E-ISSN: 2320-7078 P-ISSN: 2349-6800 JEZS 2017; 5(5): 73-81 Studies on butterfly diversity in Adichanalloor © 2017 JEZS Village, Kollam District, Kerala Received: 11-07-2017 Accepted: 12-08-2017 Lekshmi Priya Lekshmi Priya, Varunprasath Krishnaraj, Janaranjini, Sutharsan and Department of Zoology, PSG Lakeshmanaswamy College of Arts and Science, Coimbatore, Tamil Nadu, India Abstract Varunprasath Krishnaraj The present investigation was carried out to study butterfly diversity in Adichanalloor Village, Kollam Department of Zoology, PSG district in Kerala, for the period of November 2016 to March 2017. Results showed that 79 species of College of Arts and Science, butterflies representing 5 major families were recorded. Family Nymphalidae showed the maximum Coimbatore, Tamil Nadu, India number of species followed by Lycanidae 13 species, Papilionidae 10 species, Pieridae 9 species and Hesperiidae 7 species. Among these families abundance of butterfly species in maximum in garden area Janaranjini (GI) with 21 species, followed by agrifield (GIII) (17 species), pond region (GV) (16 species), grassland Department of Zoology, PSG College of Arts and Science, (GII) (13 species) and shrubs and herbs (GIV) (12 species).Based on IUCN list, 49 species were Coimbatore, Tamil Nadu, India common(C), 27 species, uncommon (UC) and 3 species under rare category. According to monthly wise distribution of butterflies, maximum numbers of butterflies were recorded in November (32 species) Sutharsan followed by a December (21 species), January (12 species) and least in the month of March (8 species). Department of Zoology, PSG College of Arts and Science, Keywords: distribution, butterflies, Adichanalloor village, Kollam district, abundance.
    [Show full text]
  • New Larval Food Plants for the Common Tiger Butterfly in India (Lepidoptera: Nymphalidae: Danainae)
    158 CHATURVEDI and HARIBAL: Danaus genutia Hosts TROPICAL LEPIDOPTERA TROPICAL LEPIDOPTERA, 3(2): 158 NOT] NEW LARVAL FOOD PLANTS FOR THE COMMON TIGER BUTTERFLY IN INDIA (LEPIDOPTERA: NYMPHALIDAE: DANAINAE) NARESH CHATURVEDI and MEENA HARIBAL Bombay Natural History' Society, Hornbill House, Shaheed Bhagat Singh Rd., Bombay 400 023, India During August 1991, while the senior author (NC) was walking along allowing us to work in the closed area of the park, and the Nature a forest path in the Borivli National Park, Bombay, looking for larvae of History Studies Subcommittee, of the Bombay Natural History Society various butterflies, he noticed a few leaves eaten by larvae. On closer Bombay, India, for financial assistance. observation, they were identified as being of the common tiger butterfly Danaus (Sa/atura) genutia (Cramer). The caterpillars were of different LITERATURE CITED stages (2nd-3rd instars). The plant was a woody climber in bloom and flowers were of a purplish colour inside and silvery pinkish white colour Ackery, P. R., and R. I. Vane-Wright outside, arranged in an axillary umbellate cyme, with a mild fragrance. 1984. Milkweed Butterflies: their Cladistics and Biology. Londor The plant was collected and later identified as Holostemma annularis K. Brit. Mus. Nat. Hist. 425pp. Schum (Asclepiadaceae). On plucking leaves of this plant, a white latex Bell, T. R. oozed out which on coming in contact with the air became an elastic 1909. The common butterflies of the plains of India (including thos residue. Subsequently, on several occasions we observed the common met with in the hill stations of the Bombay Presidency), j tiger butterfly laying eggs on the leaves of plant.
    [Show full text]