VIRAL DISEASES OF CROTALARIA IN HAWAII
THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF
HAWAI‘I AT MĀNOA IIN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE
DEGREE OF
MASTER OF SCIENCE
IN
TROPICAL PLANT PATHOLOGY
MAY 2021
By
Alexandra Kong
Thesis Committee:
Michael Melzer, Chairperson
John Hu
Koon-Hui Wang
ACKNOWLEDGEMENTS
I would like to start off by thanking my committee members Dr. Michael Melzer, Dr.
John Hu, and Dr. Koon-hui Wang for their patience and mentorship during my time here at the
University of Hawaii at Manoa. I would also like to thank my family and fellows in tropical plant pathology for their unwavering support during these past couple of years. I’m very thankful for the members of the Agrosecurity lab, past and present, for their kindness and putting up with me for the past 4 years. This includes Dr. Michael Melzer, Dr. Shizu Watanabe, Miriam Long,
Tomie Vowell, Asoka de Silva, Alejandro Olmedo Velarde, Brandi-Leigh Adams, Jarin Loristo,
Cheyenne Barela, Nelson Masang Jr., and Lisa Lowe. The biggest thanks to Dr. Michael Melzer for being an outstanding mentor and giving me the opportunity to work in his lab as both an undergraduate and graduate student; his kindness and leadership being a true inspiration during my years working in his lab.
Thanks to Flora Samis and Dr. Koon-hui Wang for collecting the infected sunn hemp material from the Poamoho Research Station and to the extension agent Alton Aragaki for finding and collecting infected Crotalaria samples from the Big Island. Dr. John Hu, Dr. Wayne
Borth, and the Spring 2019 PEPS602 class that helped with the purification of SHMoV virus particles that were later used in the transmission electron microscopy. Additional thanks to
Miriam Long, a previous member of the Argosecurity Lab, whose work served as a foundation upon which this thesis was built.
ii
ABSTRACT
Sunn hemp (Crotalaria juncea) is a leguminous cover crop valued for its ability to rapidly accumulate biomass and fix nitrogen. In October 2016, farmers in Maui County noticed symptoms of leaf mottle, reduced seed pod numbers, and a reduction in seed yield of their sunn hemp crop. Although these symptoms are indicative of Sunn hemp mosaic virus (SHMV) infection, next generation sequencing of a dsRNA-based library revealed the presence of two viruses not yet reported in Hawaii. The first, Tobacco streak virus (TSV) is Ilarvirus previously reported in the continental United States, but not in Hawaii. The second virus is a novel viral species with notable homology to members of the genus Tobamovirus and most similar in sequence identity to SHMV. In 2018 sunn hemp samples from Poamoho with symptoms of leaf chlorosis were also sampled. Next generation sequencing of a dsRNA-based library revealed the presence of another virus not yet reported in Hawaii, the Fabavirus Broad bean wilt virus 2. A weedy sunn hemp relative, Crotalaria micans was also sampled from the Big Island and was found to be infected with the potyvirus Bean common mosaic virus. The presence of these new viruses could cause potential problems not only to the sunn hemp industry in Hawaii, but may potentially impact local agriculture. The purpose of this study was to identify the pathogen(s) responsible for the observed symptoms on C. juncea and other Crotalaria species as well as better characterize this new tobamovirus.
iii
Table of Contents
Acknowledgements………………………………………………………………………………..ii
Abstract…………………………………………………………………………………………...iii
List of Tables……………………………………...….………………………………………….vii
List of Figures………………………………………………………………………...…………viii
Preface……………………………………………………………………………………………..x
Chapter 1: Literature Review…………………………………………………………………...…1
Crotalaria juncea…………………………..…………………………………………...…1
Tobamoviruses…………………………………………………………………………….5
Sunn-hemp mosaic virus…………………………………………………………………..5
Seed Transmission of Tobamoviruses……………………...……………………………..6
Chapter 2: Molecular and Physical Characterization of a Tobamovirus Infecting Sunn Hemp in
Hawaii……………………………………………………………………………………………..8
Introduction………………………………………………………………………………..8
Materials and Methods…………………………………………………………………...10
Viral Source and Maintenance…………………………………………………...10
Sequencing and Phylogenetic Analyses………..………………………………...11
Molecular Detection of sunn-hemp mottle virus………………………………...12
Transmission Electron Microscopy……………………………………………...14
Results……………………………………………………………………………………15
Sequencing and Phylogenetic Analyses………..………………………………...15
Molecular Detection of sunn-hemp mottle virus……………………………...…26
Transmission Electron Microscopy……………………………………………...29
iv
Discussion………………………………………………………………………………..32
Chapter 3: Biological Characterization of sunn-hemp mottle virus……………………………..34
Introduction………………………………………………………………………………34
Materials and Methods………………………………………………………...…………35
Virus Source and Maintenance……………………………………………..……36
Effects of sunn-hemp mottle virus Infection on Plant Development……….……36
Experimental Host Range……………………………………………………..…37
Seed Contamination and Transmission………………………………………..…37
Plant to Plant Transmission………………………...……………………………38
Results……………………………………………………………………………………41
Effects of sunn-hemp mottle virus Infection on Plant Development………….…41
Experimental Host Range……………………………………………………..…43
Seed Contamination and Transmission………………………………………..…47
Plant to Plant Transmission………………………...……………………………47
Discussion………………………………………………………………………………..52
Chapter 4: Characterization of Other Viruses Infecting Crotalaria………………………...……55
Introduction………………………………………………………………………………55
Materials and Methods…………………………………………………….……………..55
Tobacco streak virus in Crotalaria juncea ‘Tropic Sun’………………………...55
Big Island Crotalaria micans……………………...………….…………………56
Poamoho Crotalaria juncea…………………………………...…………………56
Results……………………………………………………………………………………60
Tobacco streak virus in Crotalaria juncea ‘Tropic Sun’……………….………..60
v
Big Island Crotalaria micans………...……………………………….…………60
Poamoho Crotalaria juncea……………………………………..………………60
Discussion………………………………………………………………..………………61
Chapter 5: Conclusion and Future Studies……………………………………….………………63
Literature Cited……………………………………………………………………..……………65
vi
List of Tables
1. Percent identity matrix of the tobamovirus genomes and proteomes……………………18
2. Primers used in this study……………………………………………………………..…31
3. Inoculation rates and symptoms observed on experimental host range for SHMoV……42
vii
List of Figures
1. Immature sunn hemp (Crotalaria juncea) plants in the field……………………………..2
2. Foliar mottle on sunn hemp plants in Maui County in 2016 and on inoculated sunn hemp
plants grown in the greenhouse……………………………………………………………9
3. Genome organization of sunn-hemp mottle virus (SHMoV), sunn-hemp mosaic virus
(SHMV), and tobacco mosaic virus (TMV)……………………………………………..17
4. Neighbor joining and maximum likelihood trees generated from the amino acid sequence
of the movement and coat proteins………………………………………………………21
5. Amplification plot and standard curve generated from serial 10-fold dilutions of cDNA
made from the total nucleic acids extracted from symptomatic sunn hemp plants grown in
a greenhouse inoculated with sunn-hemp mottle virus…………………………………..28
6. Transmission electron micrograph of purified sunn-hemp mottle virus particles extracted
from Crotalaria juncea leaf and stem tissue……………………………………………..30
7. 98-cone setup used in transmission experiments………………………………………...39
8. Barplots of comparing sunn hemp grown for 90 days in greenhouse conditions
measuring height (A), days till first flower (B), above-ground biomass (C), and below-
ground biomass (D) …………………………………………………………………..….40
9. Symptoms of mottle and shoestringing observed on the leaves of an inoculated C. pallida
plants grown in the greenhouse…………………………………………………………..43
10. Spatial pattern maps of SHMoV transmission in a greenhouse setting with no wind…...44
11. Spatial pattern maps of SHMoV transmission in a greenhouse setting with an average
wind speed of 0.16kph and gusts averaging 0.48kph during the day…………………46
viii
12. Spatial pattern maps of SHMoV transmission in a greenhouse setting with an average
wind speed of 1.28kph and gusts averaging 2.31kph during the day…………………47
13. Line graph showing the average and standard deviations of plants infected (%) over an 8
week period………………………………………………………………………………48
14. Left: Mosaic symptoms on C. micans collected from the Big Island. Right: Chlorosis
seen on infected sunn hemp on Oahu……………………………………………………56
ix
PREFACE
Many species of Crotalaria are considered weeds; however, there is one species of significant agronomical importance, Crotalaria juncea, more commonly known as sunn hemp.
Sunn hemp originates in India where it was commonly cultivated as a fiber crop. In the United
States sunn hemp has gained popularity as a cover crop due to its ability to rapidly accumulate biomass and its ability to fix nitrogen as it grows.
In 2016 a sunn hemp farmer noticed virus-like symptoms of leaf mottle and stunting on his sunn hemp crop. Though these symptoms are reminiscent of infection by SHMV initial sequencing data showed infection by a tobamovirus of about 80% nucleotide homology to
SHMV. Since the cutoff for new tobamovirus species is less than 90% nucleotide homology these results suggest that the virus infecting these sunn hemp plants could be a new species of tobamovirus. Work was done to better characterize this new tobamovirus. Additionally, at
Poamoho Research Station symptoms of leaf chlorosis were observed on cultivated sunn hemp.
These plants were sampled and processed for high throughput sequencing to identify viruses present. On the Big Island Crotalaria micans was found growing on the side of a road and displayed symptoms of leaf mosaic. A lateral flow test revealed that the sample was infected with a potyvirus and work was done to identify the potyvirus responsible for the observed symptoms.
Sunn hemp’s inability to produce seed at latitudes above 28°N limits seed production to
Hawaii and southern parts of Texas and Florida. This characteristic adds to its appeal as a green manure, lowering the chance of sunn hemp becoming a volunteer weed after planting in areas like the midwest. This factor also provides Hawaii a unique opportunity for the cultivation of sunn hemp for seed production purposes.
x
Chapter 1
LITERATURE REVIEW
Crotalaria juncea
Crotalaria is the largest genus in the tribe containing at least 702 species (Rather et al.
2018). This family is known to house a large number of fast-growing, noxious weeds with some members producing toxic amounts of a pyrroline alkaloid responsible for causing livestock poisoning. Within this genus, the most economically and agronomically important species would be Crotalaria juncea L., commonly referred to as sunn hemp (Subramaniam and Pandey, 2013).
In Hawaii, 19 different species of crotalaria have been reported, including C. juncea (Figure 1)
(Wagner et al. 1990; Wagner and Herbst, 1995; Pratt and Bio, 2012).
C. juncea is native to India where it has been grown as a multipurpose crop. This plant has many possible applications including use for fiber production, paper production, green manure, and even animal forage. It is best suited for growth in tropical and subtropical climates, but is capable of being grown during the summer in more temperate regions like the US mainland. Recently, the rising demand for sustainable farming has piqued interest in the use of sunn hemp as a green manure to improve soil health (USDA-NRCS 1999).
Cover crops are plants grown either between cropping cycles or alongside the main crop.
There are many benefits attributed to cover crop use including reducing soil erosion and nutrient leaching. By competing with weeds for nutrients and sunlight cover crops can suppress weed growth and through practices such as trap cropping it is possible to manage a variety of pests such as insects and nematodes. Cover crops can provide the added benefit of attracting beneficial
1
Figure 1. Immature sunn hemp (Crotalaria juncea) plants in the field.
2 insects as well. Cover crops have great potential in improving soil health through both water conservation and preservation of soil nutrients. Leguminous cover crops like sunn hemp are especially valuable for their ability to fix nitrogen (Hartwig and Ammon, 2002).
Sunn hemp is historically tied to the University of Hawaii (UH) through the release of the sunn hemp cultivar ‘Tropic Sun’. Back in 1958, UH acquired sunn hemp seeds from a Kauai farmer growing this plant as a cover crop. These seeds were screened alongside other plants for potential use as a green manure and evaluated for various characteristics including toxicity and nematode resistance. In 1983, the sunn hemp cultivar ‘Tropic Sun’ became a cooperative release by the United States Department of Agriculture, Soil Conservation Service and the UH’s, Hawaii
Institute of Tropical Agriculture and Human Resources, Department of Agronomy and Soil
Science. This cultivar was the product of a direct increase from the seeds obtained back in 1958.
‘Tropic Sun’ is valued for both its rapid growth rate and ability to fix nitrogen as it grows. In just
60 days ‘Tropic Sun’ can grow over 4 feet tall, produce 7 t/ha of dry biomass, and add 150-165 kg/ha of nitrogen into the soil. In addition, sunn hemp also is capable of growing in poor quality soils and is considered safe for use as animal forage, further enhancing its utility (Rotar and Joy,
1983).
Sunn hemp production is important to Hawaii in that our climate is arguably the most suitable place in the US for sunn hemp seed production. Sunn hemp is a short day plant that requires both a short photoperiod paired with warm temperatures in order to successfully set seed. These conditions are typically found at latitudes below 28°N limiting sunn hemp seed production to Hawaii and southern parts of Texas and Florida. Here in Hawaii, sunn hemp can be grown successfully year round at altitudes below 1000m, but on the mainland United States it is grown as a summer crop. This inability of sunn hemp to set seed in areas above 28°N can be
3 potentially helpful in that it reduces the risk of sunn hemp from becoming a volunteer weed, but also severely limits the sunn hemp seed production in the US (USDA-NRCS, 1999).
One of the biggest benefits to sunn hemp use is its classification as a nonhost or poor host to many plant-parasitic nematodes. For this reason, sunn hemp is often recommended as a cover crop to control root-knot nematodes in the field. It is also notable for being a poor host to other types of nematodes including Rotylenchus and Radophilus (McSorley et al. 1994, Wang et. al
2002). Sunn hemp extracts were also found to have allelopathic effects on nematodes such as
Radopholus similis (Jasy and Koshy, 1994) The presence of allelopathic compounds such as monocrotaline has been noted to suppress nematode activity (Wang et al., 2001, Wang et al.
2002).
Like any other plant, there is a menagerie of different pathogens capable of infecting sunn hemp. There are two major fungal pathogens of sunn hemp including, Fusarium udum f. sp. crotalariae, which causes wilt of sunn hemp, and Colletotrichum curvatum that causes anthracnose (Armstrong and Armstrong, 1950, Petch, 1917). In South America Ceratocystis fimbriata is also noted to cause black rot of sunn hemp (Malaguti, 1951). Though they are not the most troublesome pathogens to sunn hemp cultivation, C. juncea has been described as a host to various phytoplasmas from 16Sr groups II, V, and IX (Win et al. 2011; Bianco et al. 2014;
Wulff et al. 2015).
Sunn hemp is host to a variety of viral pathogens including the potyviruses bean common mosaic virus and bean yellow mosaic virus, the comoviruses cowpea mosaic virus and cowpea severe mosaic virus, the tobamoviruses Sunn-hemp mosaic virus (SHMV) and tobacco mosaic virus (TMV), the orthotospovirus tomato spotted wilt virus, the ilarvirus tobacco streak virus,
4 and a begomovirus called Sunn hemp leaf distortion virus (Edwardson, 1991; Ahmad et al.
2011).
Tobamoviruses
Part of the family Virgaviridae, members of the genus Tobamovirus are positive-strand
RNA viruses. Tobamoviruses are among the best studied plant viruses with Tobacco mosaic virus being the first described plant virus and serving as the type species for the genus. TMV served as the starting point for many milestones such as being the first purified virus particle
(Stanley, 1935), being the first RNA virus to be sequenced (Goelet et al. 1982), and later being the first virus observed using electron microscopy (Hull, 2002). Members of this genus are noted to have rod-shaped virus particles that tend to be approximately 300nm long and 20nm wide with the cost proteins assembling in a right-handed helical pattern. Tobamoviruses have a single stranded, monopartite genome that is around 6,300 nucleotides long. At the 5’ end of the genome is a 7-methylguanosine 5′ triphosphate-cap. The 3’ end contains a tRNA-like structure. The genome contains four distinct open reading frames coding for two replicase proteins, a 126k and a 183k, movement protein, and coat protein. The larger 183k replicase is a read through product while the movement and coat proteins are both produced from subgenomic RNAs
Tobamoviruses are not vectored by any arthropods meaning that mechanical transmission is the sole means of infection between plants (Adams et al. 2012).
Sunn-hemp mosaic virus
SHMV was first described in 1948 in India infecting Dolichos lablab. It was noted as causing severe mosaic, enations and occasionally chlorotic streaking. The virus was found to be
5 extremely stable, remaining infective after 10 minutes heating at 90°C and inactivated at 95°C.
When left at room temperature the extracts were still infective after six years (Capoor and
Varma, 1948). In addition to India the virus has also been reported in Australia (Gibbs and
Varma, 1977) and the United States (Toler, 1964). This virus has not been reported in Hawaii.
SHMV was the first tobamovirus infecting primarily leguminous plants to be completely sequenced. The first part of the genome sequence covered the terminal 1,800bp and was published in 1981 (Meshi et al. 1981). The remaining 4,683bp of the genome was published in
1996 (Silver et al. 1996).
Seed Transmission of Tobamoviruses
Tobamoviruses are not considered true seedborne pathogens, but are believed to infect young plants as seed coat contaminants. The virus not infecting the embryo itself. In the case of
Cucumber green mottle mosaic virus (GCMMV) it was found that virus particles are also capable of contaminating the perisperm-endosperm envelope as well. The presence of virus particles in this envelope meant that surface sterilization procedures commonly used to treat seeds for tobamoviruses that remove virus particles from the seed coat are unable to prevent
CGMMV seed transmission. Seedborne diseases pose a threat not only to local agriculture, but could lead to the potential spread of the virus to other parts of the world through the importation of seeds by other regions (Dombrovsky and Smith, 2017).
The potential for seed transmission poses a unique threat to sunn hemp cultivation in that sunn hemp seeds tend to be sown at high densities leading to thick stands of sunn hemp in the field. Though this thick stand is potentially beneficial for suppressing competition from other weeds it also leads to many sunn hemp plants being in close proximity to one another potentially
6 making it easier for one infected plant to spread the virus to the many surrounding sunn hemp plants. Therefore, despite low seed transmission rates for tobamoviruses this virus could still cause significant problems in the field.
7
CHAPTER 2
MOLECULAR AND PHYSICAL CHARACTERIZATION OF A TOBAMOVIRUS INFECTING SUNN HEMP IN
HAWAII
Introduction
Hawaii is one of the few locations in the United States with the climate necessary for sunn hemp (Crotalaria juncea) flowering and seed formation and is therefore suitable for commercial seed production (USDA-NRCS 1999). In October of 2016, sunn hemp ‘Tropic Sun’ plants grown for seed on a commercial farm in Maui County displayed virus-like symptoms, including stunting of the plant, leaf mottling, and a reduction in seed yield (Figure 2A). Initial work to identify the causal agent of the disease was undertaken by Ms. Miriam Long. The sunn hemp samples from Maui County were tested using lateral flow assays (LFAs) designed to detect the presence of tobacco mosaic virus (TMV), cucumber mosaic virus, and potyviruses (Agdia).
Of these, only the TMV LFA tested positive. According to the manufacturer, the TMV LFA can cross react with a variety of tobamoviruses including Sunn-hemp mosaic virus (SHMV), a known pathogen of sunn hemp. PCR-based assays specific for TMV and SHMV detection conducted by Ms. Long were negative, suggesting the possibility of a novel tobamovirus infecting these sunn hemp plants. The potential discovery of a new tobamovirus infecting sunn hemp is concerning due its potentially detrimental effects on sunn hemp growth and seed production. Additionally, shipment of contaminated seeds could lead to dissemination of the new tobamovirus across the world. It is for this reason it is important to characterize the virus and develop new diagnostic methods to help prevent its spread of this new virus. To characterize the virus infecting the sunn hemp, a dsRNA extraction was performed in 2017 by Ms. Long on 5g of symptomatic tissue using CF-11 cellulose column chromatography (Morris and Dodds, 1979).
8
Figure 2. Foliar mottle on sunn hemp plants in Maui County in 2016 (A) and on inoculated sunn hemp plants grown in the greenhouse (B).
9
This dsRNA was then used as the basis for cDNA synthesis (Melzer et al. 2010) and cloned into pGEM-T Easy cloning vector (Promega). Multiple clones were prepared and sequenced at the
University of Hawaii’s Advanced Studies of Genomics, Proteomics, and Bioinformatics
(ASGPB) Laboratory using ABI3730XL capillary-based DNA sequencers. These initial sequencing results showed the presence of a tobamovirus with moderate homology to SHMV.
The dsRNA was then used as template for library construction (Melzer et al. 2010) which was prepared using a Nextera DNA Library Prep kit (Illumina, San Diego, CA), and underwent high throughput sequencing (HTS) using the Miseq platform (Illumina, San Diego, CA) at the
ASGPB Laboratory.
The objectives of this Chapter were to complete the preliminary work done by Ms. Long to characterize this potentially novel tobamovirus infecting sunn hemp in Hawaii which is tentatively named sunn-hemp mottle virus (SHMoV). This was done by deciphering the full viral genome, developing a molecular diagnostic assay to detect this virus, and performing virus purification and electron microscopy to view virus particles.
Materials and Methods
VIRUS SOURCE AND MAINTENANCE
Sunn hemp plants were mechanically inoculated using plant extracts obtained from a symptomatic sunn hemp sample collected in 2016. Leaf tissue was homogenized in a 1:10
(wt/vol) ratio of plant tissue to sodium phosphate buffer (20mM sodium phosphate, pH 7.0) with carborundum. To confirm virus status, these plants were tested using a TMV-specific ELISA
(Agdia) which cross reacts to SHMoV (see Chapter 3). Plants were kept in a greenhouse under
10 natural light and used as a source of positive controls as well as material for the virus purification process.
SEQUENCING AND PHYLOGENETIC ANALYSES
The previously generated data from the Miseq sequencing platform were sent through the
VirFind pipeline to identify viruses present in the plant material (Ho and Tzanetakis, 2014).
Using a VirFind contiguous sequence (contig) as a base, the genome was recovered in an iterative mapping process in Geneious 5.6.5 (Biomatters). To characterize the terminal ends of the viral genome, an RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) was performed using primers designed based on the assembled viral reads as described in Coutts and
Livieratos (2003). The primers used to decipher the ends of the genome were designed to generate products with an approximately 20 nucleotide overlap between the expanded region and the known sequence. Virus specific primers used are given in Table 2. The resulting amplicons were then ligated into pGEM-T Easy (Promega) and plasmids were sequenced in both directions
(Genewiz, La Jolla, CA).
Genome and proteome analysis was done by downloading the genomes of the 10 tobamovirus species most closely related to SHMoV and the type species of the tobamovirus genera tobacco mosaic virus. A global alignment of the genomes and proteomes were performed with Geneious. Phylogenetic analyses were performed by aligning the movement protein (MP) and coat protein (CP) amino acid sequences of SHMoV and tobamovirus homologs available in
Genbank using MUSCLE in MEGA 7.0.21 (Kumar et al. 2016). From these alignments, neighbor joining (NJ) and maximum likelihood (ML) algorithms were used to generate trees to estimate the phylogenetic placement of SHMoV. Trees were tested with 1,000 bootstrap
11 repetitions and branches with less than 60% bootstrap support were collapsed (Kumar et al.
2016).
MOLECULAR DETECTION OF SUNN-HEMP MOTTLE VIRUS:
Total nucleic acids (TNA) were extracted from 0.1g of leaf tissue as described in Li et al.
(2008). The leaf tissue was added to 1.2mL of CTAB extraction buffer [CTAB 10g, PVP-40 10g,
1M Tris-Cl (pH 8) 50mL, NaCl 41g, 0.5M EDTA (pH 8) 20mL, 2-mercaptoethanol 2mL, dH2O to 500mL] and then cooled for 15 minutes in a -20°C freezer. The chilled solution was then twice homogenized using a bead beater (BioSpec) one minute per homogenization run. The solution was then incubated at 65°C for 30 minutes and then centrifuged at 10,000xG for 5 minutes.
Supernatant (720μL) was added to a new microcentrifuge tube along with 720μL of chloroform:iso-amyl alcohol (24:1). The solution was vortexed for 30 seconds and then centrifuged once more at 12,000 x G for 10 minutes. Aqueous phase (600μL) was transferred into a new microcentrifuge tube along with 420μL of isopropanol and vortexed for 30 seconds.
The solution was left to rest at room temperature for 10 minutes and then centrifuged at 12,000 x
G for 10 minutes. The supernatant was discarded and 0.5mL of 70% ethanol was added to wash the pellet and the solution was centrifuged at max speed for 5 minutes. The ethanol was then removed and the pellet left to dry in a biosafety cabinet for 15 minutes. The pellet was then resuspended in 100μL of 20mM Tris-HCL (pH 8) and the tube was left on ice for 15 minutes.
The solution was then gently vortexed and used as the template for RT-PCR.
Synthesis of the first-strand cDNA was done using 2μL of TNA and MMLV-RT
(Promega Corp., Madison, WI) according to the manufacturer's instructions. To a PCR tube
6.5μL of distilled water, 1μL of random primers (50mM), and 2μL of TNA were added. The solution was incubated at 95°C for 8 minutes and then immediately chilled on ice for 5 minutes.
12
Four microliters of 5x MMLV-RT buffer, 5μL of dNTPs (8mM), 0.5μL of RNAsin, and 1μL of
MMLV-RT was added to the chilled solution. The solution was then incubated for 10 minutes at
25°C and then 42°C for 50 minutes. This cDNA was stored at -20°C.
To detect SHMoV infection, a qPCR assay was developed targeting the replicase gene.
Primers and TaqMan probes were designed using Integrated DNA Technologies’ PrimerQuest
Tool (Table 2). Three sets of primers were designed for potential use in a qPCR assay. A gradient PCR was initially performed to evaluate the three primer sets, prior to probe synthesis.
Each reaction contained 10μL of 2x GoTaq Green Master Mix (Promega), 7μL of distilled water,
1μL each forward and reverse primers, and 1μL of cDNA. The solution was incubated for 95°C for 5 minutes, then 35 cycles of 95°C for 45 seconds, an annealing temperature varying between
54°C and 65°C for 30 seconds, and 72°C for 45 seconds, followed by 72°C for seven minutes.
The products were then resolved on a 2% agarose gel for 50 minutes at 60V. Following this preliminary evaluation, primer set 3 was chosen for the assay due to the intensity of the bands produced throughout the varying annealing temperatures. A set of primers targeting the cytochrome oxidase (COX) gene of plants, previously described in Li et al. (2006), was used as an internal control to prevent Type II errors (false negative).
A 25μL qPCR reaction was made using 13.7μL of dH2O, 2.5μL of 10x PCR buffer, 3μL
MgCl2 (50mM), 0.6μL dNTPs (10mM), 0.2μL Platinum Taq (5U/μL) (ThermoFisher), 3μL of primer probe mix, and 2μL of cDNA. Samples underwent thermal cycling using the following program: 1 cycle of 95°C for 5 minutes, 35 cycles of 95°C for 10 seconds and 58°C for 50 seconds in a QuantStudio 6 thermal cycler (Life Technologies). In addition to real-time monitoring of the reaction, amplicons were resolved on a 2% agarose gel with ethidium bromide
13 under a UV light. The virus specific primers were designed to amplify the region between nucleotides 4,827 and 4,949 of the genome producing a product 122 bp in length.
Reaction efficiency was determined using a serial 10-fold dilutions of cDNA in nuclease- free water run in triplicate with an nontemplate control containing nuclease free water. The cDNA was made from TNA extracted from SHMoV infected plant material. Each dilution was run in three replicates containing serial dilutions of cDNA ranging from 10’5-10’2. Sensitivity was determined by finding the lowest cDNA dilution that fell on the standard curve. Four point standard curves were calculated using the QuantStudio 6 real-time PCR software.
TRANSMISSION ELECTRON MICROSCOPY
As part of the Spring 2019 PEPS606L class, SHMoV virus particles were purified from infected tissue for visualization using transmission electron microscopy (TEM). Virus purification was performed using a modified version of Ahlawat et al. (1996). Approximately
60g of leaf and stem tissue was homogenized in 150mL sodium phosphate buffer (0.5mM,
7.2pH) with 0.5% 2-mercaptoethanol (v/v). The extract was then filtered through four layers of cheesecloth and the filtrate emulsified with 150mL chloroform for 20 minutes. The solution was then centrifuged at 10,000 x G for 10 minutes. The aqueous phase was then extracted and for every 90mL of solution recovered 10mL of 5M of NaCl and 10mL of 30% w/w polyethylene glycol was added. The mixture was then left to mix using a magnetic stir bar for an additional 20 minutes before being centrifuged at 10,000 x G for 10 minutes, after which the supernatant was discarded. The pellet was then resuspended in 20mL of EDTA (pH 7.2). The resuspended pellet was then emulsified in 6mL of chloroform and stirred for 10 minutes. The solution was then centrifuged again at 10,000 x G for 5 minutes. The aqueous phase was then transferred into a clean centrifuge tube and topped off with 2mM EDTA (pH 7.2) and ultracentrifuged for 1 hour
14 at 200,000 x G in a Beckman type 70Ti rotor at 10°C. The supernatant was discarded and the pellet resuspended in 0.5mL of 2mM EDTA (pH 7.2) at 4°C overnight.
The following day a gradient of 10-40% sucrose in phosphate buffer was prepared and topped with 0.25mL of the partially purified virus solution. The solution was then spun at 85,000 x G for one hour with a SW 28 rotor. The layer of virus particles was then extracted using a pipette. The extract was then diluted in distilled water and centrifuged at 250,000 x G for one hour. The pellet was then resuspended in 1mL of distilled water. The solution was then suspended on a 300-mesh Formvar-coated copper grid and stained with 2% (w/v) uranyl acetate.
Samples were examined with a HT7700 transmission electron microscope (Hitachi, Japan).
Results
SEQUENCING AND PHYLOGENETIC ANALYSES
A total of 2,543,068 paired-end reads were generated following HTS of the sunn hemp
‘Tropic Sun’ dsRNA library. The reads were then submitted to the VirFind pipeline generating
14 contigs with notable homology to the tobamovirus Sunn-hemp mosaic virus. Using Geneious
5.6.5 (Biomatters, Auckland, New Zealand) a VirFind contig was used as the reference sequence and in an iterative mapping process, 5,986nt of the genome was recovered. A RACE was performed to decipher the terminal ends of the genome which was found to be 6,455nt in length and had a G/C content of 44%. Out of six 5’ RACE clones sequenced, four indicated the 5’ untranslated region (UTR) was 54nt in length, initiating with a cytosine residue. Seven of the eleven 3’ RACE clones supported a 3’ UTR of 200nt, terminating with a guanosine residue. The genome was found to possess four open reading frames (ORFs) with one being a readthrough protein typical of tobamoviruses (Adams et al. 2012). The first ORF was 1,130 amino acids (aa)
15 in length and encoded the RNA-dependent RNA polymerase (RdRp) subunit which has a predicted molecular weight of about 129 kilodaltons (kDa), which is similar in size to homologs in SHMV (129 kDa) and TMV (126 kDa) (Figure 3). The readthrough protein of SHMoV was
1,629 aa in length with a predicted molecular weight of 189 kDa, whereas this readthrough protein is 186 and 183 kDa in for SHMV and TMV, respectively. ORF3 was 434 aa in length and putatively encodes the SHMoV movement protein (MP) with a calculated molecular mass of approximately 26 kDa, making it smaller than the SHMV and TMV MPs which are 31 and 30 kDa, respectively. Similar to the genome organization of SHMV, ORF4 of SHMoV overlaps
ORF3 (Figure 3). SHMoV ORF4 is 177 aa in length and putatively encodes the SHMoV coat protein (CP). Its predicted molecular weight was 20 kDa, making it slightly larger than the 18 kDa CP of SHMV and TMV.
16
Figure 3. Genome organization of sunn-hemp mottle virus (SHMoV), sunn-hemp mosaic virus
(SHMV), and tobacco mosaic virus (TMV). Different shading indicates homologous ORFs.
Rectangles represent open reading frames and the scale gives approximate size in kilobases.
Numbers represent molecular mass in kilodaltons. The genome of SHMoV is most closely related to that of SHMV, sharing 74% nucleotide identity (Table 1).
17
Table 1. Percent identity matrix comparing global alignments of tobamovirus proteomes (top) and genomes (bottom). Table generated using Geneious 5.6.5. Tree contains select tobamovirus species on GenBank including: Tobacco mosaic virus (TMV, NC_001367), Sunn-hemp mosaic virus (SHMV, NC_043384), Clitoria yellow mottle virus (CliYMV, NC_016519), Hibiscus latent Fort Pierce virus (HLFPV, NC_025381), Hibiscus latent Singapore virus (HLSV,
NC_008310.2), Tobacco mild green mosaic virus (TMGMV, NC_001556), Turnip vein-clearing virus (TVCV, NC_001873), Yellow tailflower mild mottle virus (YTMMV, NC_022801),
Tropical soda apple mosaic virus (TSAMV, NC_030229), Ribgrass mosaic virus (RMV,
NC_002792.2 ), Pepper mild mottle virus S strain (PMMoV, NC_003630).
18
To determine the phylogenetic placement of SHMoV, NJ and ML trees were generated using the MP and CP amino acid sequences of 35 of the 37 recognized tobamovirus species that were available on GenBank, with the addition of tobacco rattle virus (TRV) as an outgroup. In all trees, SHMoV was grouped in a clade with SHMV (Figure 4).
19
20
21
22
23
Figure 4. Neighbor joining trees generated from the amino acid sequence of the movement (A) and coat proteins (B). Amino acid sequence used to generate maximum likelihood trees using the movement (C) and coat (D) amino acid sequence. Figure generated using MEGA 7.0.21. Tree contains recognized tobamovirus species whose sequences were available on GenBank including: Cucumber fruit mottle mosaic virus (CFMMV, NC_002633), Cucumber green mottle mosaic virus SH strain (CGMMV, NC_001801), Frangipani mosaic virus (FrMV, NC_014546),
Hibiscus latent Fort Pierce virus (HLFPV, NC_025381), Hibiscus latent Singapore virus
(HLSV, NC_008310.2), Kyuri green mottle mosaic virus (KGMMV, NC_003610), Obuda pepper virus (ObPV, NC_003852), Odontoglossum ringspot virus (ORSV, NC_001728),
Paprika mild mottle virus (PaMMV, NC_004106), Pepper mild mottle virus S strain (PMMoV,
NC_003630), Ribgrass mosaic virus (RMV, NC_002792.2 ), Sunn-hemp mosaic virus (SHMV,
NC_043384), Tobacco latent virus (TLV1, NC_038703), Tobacco mild green mosaic virus
(TMGMV, NC_001556), Tobacco mosaic virus (TMV, NC_001367), Tomato mosaic virus
(ToMV, NC_002692), Tropical soda apple mosaic virus (TSAMV, NC_030229), Turnip vein- clearing virus (TVCV, NC_001873), Wasabi mottle virus (WMoV, NC_003355), Youcai mosaic virus (YoMV, NC_004422), Zucchini green mottle mosaic virus (ZGMMV, NC_003878),
Tomato brown rugose fruit virus (RBRFV, NC_028478), Yellow tailflower mild mottle virus
(YTMMV, NC_022801), Tomato mottle mosaic virus (ToMMV, NC_022230), Maracuja mosaic virus (MarMV, NC_008716), Streptocarpus flower break virus (SFBV, NC_008365), Bell pepper mottle virus (BPeMV, NC_009642), Plumeria mosaic virus (PluMV, NC_026816),
Brugsmansia mild mottle virus (BrMMV, NC_010944), Cucumber mottle virus (CMoV,
NC_008614), Rattail cactus necrosis-associated virus (RCNaV, NC_016442), Passion fruit mosaic virus (PafMV, NC_015552), Clitoria yellow mottle virus (CliYMV, NC_016519), Cactus
24 mild mottle virus (CMMoV, NC_011803), and Rehmannia mosaic virus (RheMV, NC_009041).
Tobacco rattle virus coat and movement proteins (NC_003811 and NC_003805) were used as an outgroup. Significance was generated from 1,000 bootstrap replicates. Branches with less than
60% support were collapsed. This is a rooted tree.
25
MOLECULAR DETECTION OF SUNN HEMP MOTTLE VIRUS
A qPCR assay was designed to detect SHMoV and a series of dilutions were done to calculate the efficiency of the reaction. The virus primers and probe were successfully able to amplify the virus present in infected plants while the COX internal control was able to amplify plant material present in both infected and uninfected plants. Using testing 1:10 dilutions of cDNA, it was found that the qPCR assay developed to detect SHMoV infection was able to detect SHMoV from extracted TNA up to a dilution of 1:10,000. Non template control did not amplify Figure 5.
26
27
Figure 5 . Amplification plot and standard curve generated from serial 10-fold dilutions of cDNA made from the total nucleic acids extracted from symptomatic sunn hemp plants grown in a greenhouse inoculated with sunn-hemp mottle virus. Sensitivity of the primer probe mix specific to sunn-hemp mottle virus in multiplex qPCR with the target primer set, SHMoV (A), and the internal positive control, COX (B).
28
TRANSMISSION ELECTRON MICROSCOPY
Transmission electron microscopy revealed the presence of multiple rod-shaped virus particles approximately 321nm long and 21.6nm wide (Figure 6).
29
Figure 6 . Transmission electron micrograph of purified sunn-hemp mottle virus particles extracted from Crotalaria juncea leaf and stem tissue. Bar = 100nm.
30
Table 2. Primers used in this study.
Primer Sequence 5’ to 3’ Purpose
718 514-CCGCTCTTGTCTTCAAATCT-494 Virus specific primer for
5’ RACE
745 105-GGTCACTTGCAGGGTTAGAT-85 Virus specific primer for
5’ RACE
721 6399-CATCAAGACACGATGGTTAG-6419 Virus specific primer for
3’ RACE
Forward 4827-AGTCGGCAGTCAAGGAAAG-4846 Forward primer for
qPCR assay
Reverse 4949-GACACCTCAGACATCGCTAAA-4928 Reverse primer for
qPCR assay
Probe 4878-/56- Probe for qPCR assay
FAM/AAGCAACATTGCAGCCTTCAGCTC/3BHQ_1/
-4854
31
Discussion
In this Chapter the molecular and physical characterization of a novel tobamovirus infecting sunn hemp ‘Tropic Sun’ is described. Initial lateral flow assays and sequencing performed by Ms. Long lead us to believe the causal agent to be a potentially new tobamovirus.
With this in mind we attempted to characterize the viruses present in the sample. Inoculation of healthy sunn hemp seedlings with extracts from symptomatic tissue collected from Maui County in 2016 resulted in the development of similar symptoms, supporting the idea that this virus might be the cause of the symptoms observed in the field. Morphology of viruses particles purified from symptomatic tissue were consistent with those of tobamoviruses. Using a combination of HTS and RACE, the complete genome of the tobamovirus was recovered. The genome appears to have 4 open reading frames organized in a manner typical of tobamoviruses
(Adams et al. 2012). Genome alignments show the genome of the tobamovirus characterized from sunn hemp is most closely related to that of another sunn hemp-infecting tobamovirus,
SHMV, sharing a 74% nucleotide identity (Table 1.). Phylogenetic analyses using multiple protein sequences show that this tobamovirus clusters most frequently with the tobamoviruses
SHMV and CliYMV. According to the 9th report of the International Committee on Taxonomy of Viruses, one species demarcation criterion for tobamoviruses is <90% sequence identity between genomes (King et al. 2012). The genome organization, sequence homology, and phylogenetic placement of this virus clearly place it in the genus Tobamovirus, while the low nucleotide identity with other tobamoviruses indicate it represents a new species in the genus.
With this mind, the name sunn-hemp mottle virus (SHMoV) is proposed.
Although this virus is capable of being detected via cross-reaction using commercially available serological assays targeting TMV, the development of a specific and efficient qPCR
32 assay for the detection SHMoV would be valuable for diagnostic and biosecurity applications. In this Chapter, the foundational work has been completed for the development of a virus detection assay. Future work examining potential cross-reactivity of this detection assay with other tobamovirus and other viruses commonly infecting sunn hemp need to be completed.
Furthermore, evaluation of the assay on additional isolates of SHMoV, should they exist, must be conducted to ensure variants of the virus do not escape detection.
33
CHAPTER 3
Biological Characterization of Sunn-hemp mottle virus
Introduction
Sunn hemp mottle virus (SHMoV) is a putative new tobamovirus infecting sunn hemp in
Hawaii. As such, there is no information on the biological impact it imparts on its host following infection. Aside from causing severe mosaic symptoms, the closely related sunn hemp mottle virus (SHMV) has been shown to cause stunting and poor seed quality in sunn hemp (Carpoor
1950, 1962). Since sunn hemp is popular due to its ability to rapidly accumulate biomass as it grows, it is important to better understand the potential impact of SHMoV infection on agronomically important traits of sunn hemp plants, such as height, time till first flower, above- ground biomass, and below-ground biomass. In this Chapter, experiments were conducted to better understand these impacts.
Tobamoviruses also form very stable virus particles capable of lasting long periods of time outside of host tissues. Since sunn hemp is commonly used as a green manure, incorporation of infected plant residues into the soil could possibly contaminate fields and future crops. Although there appear to be no studies examining the accumulation of SHMV in the soil after incorporation of sunn hemp residues, there are studies examining the soil persistence of tobacco mosaic virus (TMV). In one such study, infected tobacco waste was incorporated into various soil types and over time tested for the presence of TMV. It was found that persistence of
TMV within the soil varied greatly depending on soil type. More clay-like soils were found to hold the virus best. In the clay-like soil TMV was still detected in the soil up to 18 months after application of infected tobacco waste (Gülser et al. 2008). SHMoV particles present in the soil
34 could potentially pose a threat to future crops as germinating seeds could become infected.
Understanding the experimental host range of this virus will help evaluate this threat.
Although not considered a true seed borne pathogen, tobamovirus seed contamination remains a significant problem for the seed industry (Dombrovsky and Smith, 2017). The tobamovirus cucumber green mild mottle virus (CGMMV) is of particular concern to the cucumber seed industry as past studies have found certain seed treatment techniques ineffective at preventing seed transmission. In one such study, CGMMV virus particles were present not only on the seed endosperm, but the perisperm-endosperm envelope as well. This study of
CGMMV found that surface sterilization alone was unable to prevent CGMMV seed transmission. Microscopy also found that the tobamovirus particles present on the perisperm- endosperm envelope (Reingold et al. 2015, Dombrovsky and Smith, 2017). To test if SHMoV infection could have similar seed transmission, experiments were conducted to determine the rate of seed transmission. Hawaii’s unique location makes it ideal for sunn hemp growth and seed production. Evaluation of seed transmission is important to prevent introduction of this new virus to new environments.
Tobamoviruses have no arthropod vectors and infection is spread solely through mechanical transmission. In the field, sunn hemp is typically grown as a thick stand and at such density, plants are bound to rub up against one another during growth. This contact could serve as a means of plant-to-plant spread of SHMoV. To better understand the factors that contribute to the spread of the virus from plant to plant, greenhouse experiments were conducted to monitor the spread of infection.
Materials and Methods
35
VIRUS SOURCE AND MAINTENANCE
Leaf tissue from SHMoV-infected plants was homogenized in a ratio of 1:10 (wt/vol) with sodium phosphate buffer (20mM sodium phosphate, pH 7.0) with carborundum and used to mechanically inoculate plants. For mock-inoculated plants, only sodium phosphate buffer and carborundum were used.
Plants were tested for SHMoV using a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for TMV (Agdia) which cross-reacts with SHMoV. Leaf tissue were sampled from each plant and macerated in 1100uL of phosphate buffered saline with
Tween (PBS-T) (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, and 0.1%
Tween20, pH 7.4). Samples were then centrifuged and 100uL of supernatant was loaded into an
Immulon 2 ELISA plate coated with a 1:400 dilution of the TMV antibody in coating buffer (35 mM NaHCO3, 15 mM Na2CO3, and 3 mM NaN3, pH 9.6). The plates were then incubated overnight in a humid box at 4°C and then washed three times with PBS-T. The wells were then filled with 100uL of a 1:400 dilution of alkaline phosphatase antibody in PBS-T fortified with polyvinylpyrrolidone (2% wt/vol) and bovine serum albumin (0.2% wt/vol) and incubated for two hours at room temperature in a humid box. The wells were then washed eight times with
PBS-T before adding in 100uL of 1:400 diluted phosphatase substrate (Sigma). Well color was then measured after 2 hours using an Epoch microplate spectrophotometer (BioTek, Winooski,
VT) at a wavelength of 405nm using the Gen5 software. Leaf tissue from infected plants were used as a positive control and leaf tissue from asymptomatic plants were used as a negative control. Wells with fluorescence reading of greater than three times the mean of the negative controls were considered positive.
EFFECTS OF SUNN-HEMP MOTTLE VIRUS INFECTION ON PLANT DEVELOPMENT
36
In order to better understand the impact of SHMoV infection on plant growth and development, sunn hemp ‘Tropic Sun’ seedlings were either SHMoV- or mock-inoculated at the four leaf stage and grown separately in a greenhouse setting. Plants were evaluated for characteristics including i) time to first flowering [evaluated every 14 days post inoculation
(dpi)], and after 90 dpi ii) plant height, iii) above ground biomass, and iv) below ground biomass.
Plants that did not flower before 90 dpi were assigned the maximum time value possible of 90 days. Below ground tissue was hand-washed from a subset of at least 20 plants to remove medium. Both above and below ground tissues for each plant were individually dried for at least
72 hours at 70°C before weighing. A total of three trials were conducted with at least 100 plants per treatment. A student’s t-test was performed to compare treatments. All plants were grown in greenhouse conditions under natural sunlight. Figures were made using the R 3.4.1 software package with the ggplot2 library (R Core Team, 2018, Wickham, 2016). Statistical analysis was done using Microsoft Excel 2007.
EXPERIMENTAL HOST RANGE
To identify experimental hosts of SHMoV, 21 plant species from 8 different families
(Table 3) were grown from seed and mechanically inoculated at the 3-5 true leaf stage. At least
20 plants of each species were evaluated, with half of the plants inoculated with SHMoV and half mock-inoculated. Plants were maintained in a greenhouse under natural light. At three weeks post inoculation the first true fully expanded leaf of each plant were taken and tested for
SHMoV using DAS-ELISA. A subset of plants that tested negative using ELISA were then tested using the RT-qPCR assay with SHMoV specific primers described in Chapter 2.
SEED CONTAMINATION AND TRANSMISSION
37
To determine if SHMoV is a potential seed contaminant and whether a simple bleach treatment would be suitable to devitalize contaminating virus particles, greenhouse-grown sunn hemp ‘Tropic Sun’ plants positive for SHMoV were hand pollinated twice a week using methods described in Krueger et al. (2008). Seed pods were collected twice a week, and seeds were stored at 4°C until use. Seeds were either untreated (250 seeds) or washed for one minute in a 10% bleach solution with 0.5% Tween20 (250 seeds). Seeds from the two treatments were germinated in a sterilized 72 well seedling tray and grown in the greenhouse under natural sunlight. The emerging seedlings were visually examined for symptoms and the first fully expanded true leaf was sampled at the two to four true leaf stage. Samples were evaluated for the presence of
SHMoV as a composite of 10 leaves per sample using DAS-ELISA.
PLANT TO PLANT TRANSMISSION
Tobamoviruses are primarily spread by mechanical transmission, and sunn hemp is often cultivated as a dense stand in the field which may facilitate this spread. To determine the potential of above-ground transmission of SHMoV through plant contact, sunn hemp seeds were surface sterilized in a 10% bleach solution amended with 0.5% Tween20 for 1 minute prior to being sown in a 72 cell germination tray. At the four leaf stage, plants were either inoculated with SHMoV or mock-inoculated, with the two groups being separated. Two weeks post inoculation, the seedlings were then transferred into a 98 cone-tainer tray (Steuwe and Sons) containing 96 mock inoculated plants and two symptomatic inoculated plants configured as depicted in Figure 7. The newest fully expanded leaf was sampled from each plant at the start of the experiment, then every two weeks over a period of eight weeks. Sampling tools were flame sterilized after each leaf was taken to avoid unintentional infection. Plants were grown in greenhouse conditions under natural sunlight and with three artificial wind conditions: 1) no
38 artificial wind, 2) moderate artificial wind (0.06 m/s), and high artificial wind (0.17 m/s). A control group was also setup containing all mock inoculated plants. Wind speed data was collected using a HOBOware U30 wind speed smart sensor (Bourne, MA). Wind data was collected every 10 seconds. At least two temporal replicates were performed for each wind speed. Statistical analyses were performed using Microsoft Excel 2007 using a one-way
ANOVA analysis to compare the virus incidence after the 8 week period.
39
Figure 7. 98-cone setup used in transmission experiments.
40
Results
EFFECTS OF SUNN-HEMP MOTTLE VIRUS INFECTION ON PLANT DEVELOPMENT
A t-test was used to determine if differences observed between infected and uninfected plants were significantly different. Data collected for height, time till first flower, above-ground biomass, and below-ground biomass and plotted as a barplot (Figure 8.). With the exception of time till first flower formation (P=7.557E-06) the observed differences seen in height (P=0.097), above-ground biomass (P=0.685), and below-ground biomass (p=0.494) was not significant
(P<0.05). On average, infection by SHMoV delayed first flowering by about 5 days with inoculated plants having their first flower occurring on average on day 74.27 while on average, mock inoculated plants did not flower until around day 79.35. In total data from 3 separate repetitions were collected. The mean plant height for the inoculated plants were 129.7±49.1cm while mock inoculated plants averaged a height of 134.7±47.5m. On average mock inoculated plants had an average above-ground biomass around 9.71±4.99g and an average below-ground biomass was 1.77±1.12g. Inoculated plants had an average above-ground biomass of 9.06±5.94g and average below-ground biomass was about 1.76±0.98g.
41
Figure 8 . Barplots of comparing sunn hemp grown for 90 days in greenhouse conditions
measuring height (A), days till first flower (B), above-ground biomass (C), and below-
ground biomass (D) . Error bars represent standard error and asterisks indicate significant
difference (p<0.05) between mock inoculated and SHMoV inoculated groups.
42
EXPERIMENTAL HOST RANGE
A total of 21 plant species from 8 families were evaluated for their ability to be infected by SHMoV following mechanical inoculation (Table 3.). In the experimental hosts tested,
SHMoV was found only able to infect members of the families Fabaceae and Solanaceae. No evidence of infection was observed on tested Amaranthaceae, Amaryllidaceae, Apiaceae,
Asteraceae, Brassicaceae, and Cucurbitaceae. SHMoV was found to infect multiple species in
Fabaceae including weedy Crotalaria species and common bean (Phaseolus vulgaris).
Symptoms of mottle and shoestringing developed on both tested Crotalaria weed species C. pallida and C. incana (Figure 9.). Inoculated P. vulgaris tested positive for infection using the
Agdia TMV ELISA kit; however, plants appeared asymptomatic. Of the solanaceous plants tested, only Nicotiana benthamiana tested positive with ELISA despite being asymptomatic.
43
Table 3. Inoculation rates and symptoms observed on experimental host range for SHMoV. - = no infection, AS = infection, but asymptomatic, LD=leaf deformation, and M= mottle.
Number of Infected Plants
Family Species Mock SHMoV Symptoms
Amaranthaceae Amaranthus viridis 0/10 0/11 -
Amaryllidaceae Allium cepa 0/10 0/11 -
Daucus carota subsp.
Apiaceae sativus 0/10 0/12 -
Asteraceae Emilia fosbergii 0/10 0/11 -
Brassica oleracea var.
capitata 0/10 0/12 -
Brassica oleracea var.
Brassicaceae italica 0/10 0/12 -
Cucumis sativus 0/10 0/10 -
Cucurbitaceae Cucumis melo 0/9 0/9 -
Phaseolus vulgaris 0/10 10/11 AS
Chamaecrista nictitans 0/10 0/11 -
Crotalaria incana 0/10 11/11 LD/M
Fabaceae Crotalaria pallida 0/10 11/13 LD/M
44
Mimosa pudica 0/10 0/12 -
Solanum lycopersicum 0/10 0/11 -
Solanum melongena 0/10 0/10 -
Nicotiana benthamiana 0/10 6/10 AS
Nicotiana tabacum 0/10 0/11 -
Datura meteloides 0/10 0/12 -
Solanum americanum 0/10 0/12 -
Solanaceae Capsicum annuum 0/10 0/13 -
Malvaceae Abelmoschus esculentus 0/10 0/10 -
45
Figure 9. Symptoms of mottle and shoestringing observed on the leaves of an inoculated C. pallida plants grown in the greenhouse.
46
SEED CONTAMINATION OF SUNN-HEMP MOTTLE MOSAIC VIRUS
The potential for transmission of SHMoV via seed contamination, and whether a brief treatment with bleach and Tween 20 would mitigate this contamination, was evaluated using seeds collected from SHMoV-infected plants. In the first trial, 2 of the 242 (0.8%) of the seedlings from treated seeds tested positive for SHMoV while 0 of the 222 seedlings that received no treatment as seeds were positive for SHMoV. In the second trial, none of the 220 or
240 treated or untreated seeds germinated into seedlings that were positive for SHMoV.
PLANT TO PLANT TRANSMISSION
When grown in close proximity to SHMoV-infected plants, ‘Tropic Sun’ plants that were initially virus-free became infected after an eight week period, particularly under moderate and high wind conditions. Limited transmission occurred in the absence of wind (Figure 10., Figure
13.). Groups exposed to moderate wind had a disease incidence ranging 16-84% infected at the end of the 8 week period (Figure 11., Figure 13.). No SHMoV-infected plants were observed in control treatments that had no SHMoV-infected plants at the start of the experiment, indicating that transmission was occurring from plant to plant contact, and not from contaminated pots, media, or sampling tools. Statistical analysis of the data found that there was a significant difference in the virus incidence after 8 weeks and average wind speed with replicates kept in areas with high wind showing a higher virus incidence at the end of the 8 week period. The replicates with the highest wind speeds reached over 95% infection by the end of the 8 weeks
(Figure 12., Figure 13.). All plants in the control group tested negative for SHMoV at the end of the 8 week period.
47
Figure 10. Spatial pattern maps of SHMoV transmission in a greenhouse setting with no wind.
Red squares represent infected plants and green squares represent healthy plants.
48
Figure 11. Spatial pattern maps of SHMoV transmission in a greenhouse setting with an average wind speed of 0.16kph and gusts averaging 0.48kph during the day. Red squares represent infected plants and green squares represent healthy plants.
49
Figure 12. Spatial pattern maps of SHMoV transmission in a greenhouse setting with an average wind speed of 1.28kph and gusts averaging 2.31kph during the day. Red squares represent infected plants and green represent healthy plants. White squares with plus signs indicate inoculated plants that did not initially test positive for the virus with ELISA.
50
Figure 13. Line graph showing the average and standard deviations of plants infected (%) over an 8 week period. Blue lines showing replicates in high wind (average wind speed of 1.28kph and gusts averaging 2.31kph during the day), green denoting replicates in light wind (average wind speed of 0.16kph and gusts averaging 0.48kph during the day), and red denoting replicates kept in an area with no wind.
51
Discussion
The objective of this Chapter was to characterize the biological aspects of SHMoV infection, including impact on host growth and development, plant-to-plant spread, experimental host range, and transmission by contaminated seed. Results of this work suggest that SHMoV infection negatively impacts height, biomass, and days until flowering, but with the exception of the latter, not in a statistically significant manner. In the case of days until flowering, this represented only a 5 day delay which may not be large enough to discourage commercial sunn hemp seed production. For the sunn hemp height, there was clear stunting of SHMoV-infected plants in comparison to mock-inoculated controls during the course of the experiment, but at the end of the experiment, the infected plants appeared to “catch up” to the control plants which often appeared to be rootbound and suffering from water and nutrient stress. As such, it is quite likely SHMoV infection has a greater negative impact on its host than the result of these experiments conveyed. Future studies could instead require weekly height measurements and harvesting of plants for biomass measurements, and the use of larger pots. Furthermore, the different seasons should also be taken into account as well for planting. As sunn hemp is a short day plant, they produce flowers sooner and produce less vegetative growth when grown in the winter months when the days are shorter (USDA-NRCS 1999).
The results of the experimental host range shows the potential of sunn hemp and a variety of crotalaria and other species in the bean family to serve as a virus reservoir. In addition, these results suggest that the virus is capable of infecting important fabaceous plants including some important vegetable crops such as common bean. Out of the solanaceous hosts tested only N. benthamiana tested positive for SHMoV infection despite its lack of symptoms. It is surprising that this is the only solanaceous crop infected as SHMV has been described to have a wide host
52 range of more than 40 species across 7 families. SHMV is noted as being able to infect N. tabacum (Varma, 1986) so it was surprising that some of the none of the N. tabacum inoculated in our experiments tested positive for SHMoV infection. Given the increase in demand for organic crops and the potential of sunn hemp as a soil amendment in organic agricultural practices these results hint at the need for further research into the possible impact of viral persistence in sunn hemp plant residues incorporated into the soil and the potential for these virus particles to infect subsequently grown crops. This is especially concerning to farmers growing sunn hemp for use as a green manure in the midwest prior to plantings of crops such as soybean.
Of all the seeds tested only those that were treated with bleach and tween20 solution tested positive during screening with the Agdia TMV ELISA reagents with no germinated seedlings from the control group testing positive for virus infection. This results supports the idea that treatment with a bleach and tween20 solution is unable to prevent seed transmission of
SHMoV as the germinated seedlings still test positive for SHMoV infection.
The results of the seed transmission experiments suggest that seed contamination could be an important factor to the dissemination of this virus across the world and that treatment with a 10% bleach 0.5% Tween20 was unable to eradicate seed transmission serves as potential evidence for the theory that some tobamoviruses are capable of seed transmission and not just the result of seed coat contamination. These results corroborate the findings of (Reingold et al.
2015) that suggest that tobamoviruses contamination of not only the seed coat, but the perisperm-endosperm envelope as well and contrast with the work of McGovern that found
ToMV incapable of seed transmission. This serves as evidence of the potential of tobamoviruses to infect not only the exterior, but also the interior of the seed. However, it is odd that there was
53 no infection observed in the control group. Perhaps this is due to a very low rate of seed transmission (2/924=0.2% of evaluated seedlings were infected) combined with a small sample size (<1000 seedlings) or perhaps even human error. Future research could be done to determine with larger sample sizes to remedy this oversight. Here the slow breakdown of sunn hemp plant residue possibly leading to the gradual release of infected virus particles over time leading to future infections long after termination of the sunn hemp crop.
Our results suggest that wind might play a vital role in the spread of SHMoV out in the field, particularly when planted at high density. As wind speed increased, we observed a significant increase in the rate of infection. Sunn-hemp is typically cultivated as a thick stand and naturally rub against each other as they grow. This close proximity paired with agitation from wind seems to promote virus spread.
54
CHAPTER 4
Characterization of Other Viruses Infecting Crotalaria in Hawaii
Introduction
Virus infection is not always detrimental to plant health. Infection can often be asymptomatic or result in mild symptoms that appear to have minimal effect on plant health.
Such infections are still of concern due to the plants ability to serve as a reservoir for plant viruses. These plants can serve as a source of virus particles that can then be spread to neighboring fields containing more susceptible, agronomically important plants. With this in mind it is important to characterize viruses present in all plants as their presence could threaten local agriculture (Duffus et al. 1971). There are a variety of viruses known to infect sunn hemp including Bean common mosaic virus, bean yellow mosaic virus, Cowpea mosaic virus, Cowpea severe mosaic virus, Sunn-hemp mosaic virus, Tobacco mosaic virus, Tomato spotted wilt virus,
Tobacco streak virus, and Sunn hemp leaf distortion virus (Edwardson, 1991; Ahmad et al.
2011). In Chapter 2, high-throughput sequencing (HTS) was used to characterize a putatively novel tobamovirus infecting sunn hemp ‘Tropic Sun’, tentatively designated sunn hemp mottle virus (SHMoV). The HTS data also indicated the presence of additional viruses in the sample. In order to better understand the viruses present in Hawaii’s crotalaria, the HTS data underwent further examination for viral sequences other than SHMoV. Additionally, plants belonging to various Crotalaria species exhibiting virus-like symptoms were sampled from around the state and evaluated for virus infection.
Materials and Methods
Tobacco streak virus in Crotalaria juncea ‘Tropic Sun’
55
A double stranded RNA (dsRNA) based library made from the 2016 sunn hemp ‘Tropic
Sun’ samples underwent HTS as described in Chapter 2. The resulting reads were sent through the VirFind pipeline which identified not only contigs of the putatively new tobamovirus
SHMoV (Chapter 2), but also contigs similar to tobacco streak virus (TSV; family
Bromoviridae, genus Ilarvirus).
Big Island Crotalaria micans
In 2018 a sample of Crotalaria micans from Big Island was sent by CTAHR Extension
Agent Randall Hamasaki displaying symptoms of leaf mosaic (Figure 14). This sample was tested using an Agdia lateral flow assays for the potyvirus group, tobacco mosaic virus (TMV), and cucumber mosaic virus (CMV), which indicated the presence of a potyvirus. Total nucleic acids were extracted (Li et al. 2008) from the sample and used as a template for RT-PCR with potyvirus primers (5’-GGiVViGTiGGiWSiGGiAARTCiAC-3’) (5’-
ACiCCRTTYTCDATDATRTTiGTiGC-3’) described in (Ha et al. 2008). The resulting amplicons were then ligated into pGEM-T Easy (Promega) and three clones were sent for Sanger sequencing at the University of Hawaii’s Advanced Studies of Genomics, Proteomics, and
Bioinformatics Laboratory using ABI 3730XL capillary-based DNA sequencers. The resulting reads were then sent through the VirFind pipeline (Ho and Tzanetakis, 2014).
Poamoho Crotalaria juncea
10 sunn hemp plants exhibited symptoms of chlorosis were collected and approximately
10g of tissue was used as a composite for a CF-11 cellulose column chromatography dsRNA extraction (Morris and Dodds, 1979, Bar-Joseph et al. 1983, Dodds et al. 1984). 10g of symptomatic sunn hemp leaf and stem tissue was macerated in liquid nitrogen with a mortar and pestle. The powdered tissue was then suspended in 200mL of dsRNA extraction buffer (18 mL
56
10X STE, 30 mL 10% SDS, 2mL β-mercaptoethanol, 60 mg bentonite, 70 mL dH2O, 40 mL saturated phenol, and 40 mL chloroform) and left to stir for 60 minutes at 4°C. The solution was then transferred to a 250 mL bottle and centrifuged for 10 minutes at 8,000 rpm for 12 minutes with a GSA rotor. The aqueous layer was extracted, measured, and placed into a new bottle. To this bottle 0.2 volumes of 95% ethanol was added along with 1.5g of cellulose (Sigma) and 0.5g of CF-11 cellulose (Sigma). The solution was then left to gently shake for overnight at room temperature. The following day the solution was transferred to a column and the flow through discarded. The column was then washed with 100mL of 1x STE with 16.5% (v/v) ethanol. The excess liquid in the column was purged and the dsRNA was eluted into a 50mL centrifuge tube with 5 separate aliquots of 5mL 1x STE, purging the column of liquid after each addition. To the tube 0.2 volumes of 95% ethanol was added along with 1.5g of cellulose (Sigma) and 0.5g of
CF-11 cellulose (Sigma). This solution was left to stir overnight. The solution was then transferred to a column and the flow through discarded. The column was then washed with
100mL of 1x STE with 16.5% (v/v) ethanol. The excess liquid in the column was purged and the dsRNA was eluated into a 15mL centrifuge tube with 3 separate aliquots of 3mL 1x STE, purging the column of liquid after each aliquot. The tube was then centrifuged at 4,000rpm for 8 minutes in a Sorvall SH300 rotor and the supernatant transferred to a 30mL centrifuge tube. To this tube 0.1 volumes of NaAc was added and 0.8 volumes of isopropanol. The tube was covered with parafilm and mixed well. The solution was left to incubate at room temperature for 10 minutes and then -20°C overnight. The next day the solution was centrifuge at 12,000 rpm for
30 minutes with a SS-34 rotor and the supernatant discarded. The pellet was resuspended in 500 uL of RNase-free water. The 500 uL was loaded into a YM-30 column and concentrated according to the manufacturer’s instructions. 10 uL of the solution was then run on a 1% agarose
57 gel (w/v) at 50V for 1 hour and visualized with UV light. The dsRNA was used as a template for library construction (Melzer et al. 2010) and sent for sequencing using the Miseq platform
(Illumina, San Diego, CA) at the University of Hawaii’s Advanced Studies in Genomics,
Proteomics, and Bioinformatics laboratory using a Nextera DNA Library Prep kit (Illumina).
These reads were then sent to the VirFind pipeline for analysis (Ho and Tzanetakis, 2014).
58
Figure 14. Left: Mosaic symptoms on C. micans collected from the Big Island. Right: Chlorosis seen on infected sunn hemp on Oahu.
59
Results
Tobacco streak virus in Crotalaria juncea ‘Tropic Sun’
HTS data submitted to the VirFind pipeline generated 10 contigs (271-2134bp) that had notable homology to Tobacco streak virus, a tripartite member of the genus Ilarvirus. The largest contigs corresponding to TSV RNA 1, RNA 2, and RNA3 were submitted to GenBank
(accessions MH184521, MH184522, and MH184523, respectively). These contigs shared 99% nucleotide identity to TSV isolate 2334 from eastern Australia (JX463337.1, JX463338.1,
JX463339.1). Of the 22 plants originally sampled from Maui County in 2016, three tested positive for TSV infection using TAS-ELISA.
Crotalaria micans
RT-PCR using degenerate primers targeting members of the genus Potyvirus generated amplicons of the expected size from the symptomatic C. micans sample collected from Hawaii
County. When compared to the available sequences in GenBank, the 3 sequenced clones were found to share the highest homology with bean common mosaic virus (BCMV), and were most similar to an isolate from China (MH628437.1) sharing a 94.47% nucleotide identity and a
92.49% amino acid identity.
Pomoho Sunn Hemp
From this sample 2,925,299 paired-end reads were generated. The reads were then submitted to the VirFind pipeline (Ho and Tzanetakis, 2014) generating 5,048 contigs with notable homology to the fabavirus Broad bean wilt virus 2. Using Geneious 5.6.5 the reads were then mapped to reference sequences representing RNA 1 and 2 of Broad bean wilt virus 2 downloaded from Genbank (NC_003003.1 and NC_003004.1). Using this method, 5,846 bp of
RNA 1 and 3,365 bp of RNA 2 were recovered. Blastn results show that RNA 1 is most closely
60 related to Broad bean wilt virus 2 isolated from the United Kingdom in 2017 (MH645159.1), sharing 92.53% nucleotide homology for RNA 1. RNA 2 is most closely related to an isolate of
Broad bean wilt virus 2 from the United Kingdom in 2017 (MH645160.1), sharing 92.51% nucleotide homology.
Discussion
High throughput sequencing is a powerful tool and provides the most comprehensive look into the viruses present in a plant sample. Though virus impact can vary host to host, their presence can still be a major concern to growers as such plants can serve as reservoirs for the virus, allowing the potential for infection of other susceptible plants in the area. It is for this reason it is important to study both agronomically important crops as well as weedy or naturalized species as the latter can potentially serve as a reservoir for the former. In Hawaii,
Crotalaria species can fall into both of these categories: the C. juncea plants studied in Maui
County and Poamoho were it was grown as a cover crop, whereas the C. micans plant from
Hawaii County was a naturalized roadside specimen.
In this chapter, two viruses previously unreported in Hawaii were described: Tobacco streak virus (Kong et al. 2018) and Broad bean wilt virus 2. Furthermore, C. juncea has not been previously reported as a host for these two viruses. Respectively, they also serve as the first viruses of the genera Ilarvirus and Fabavirus to be found infecting C. juncea.
Due to their interest in BCMV, samples of the C. micans plant from Hawaii County were sent to the lab of Dr. Karasev for further analysis. A portion of the C. micans sample was used to inoculate N. benthamiana. Two of the C. micans samples and the inoculated N. benthamiana was subjected to total RNA extraction followed by ribosomal RNA depletion. This ribo-depleted
61
RNA was used as the basis of library construction for high throughput Miseq sequencing. The contigs generated were aligned using BLASTn and BLASTx revealing the presence of bean common mosaic virus, bean yellow mosaic virus, and clover yellow vein virus. Both bean common mosaic virus and bean yellow mosaic virus have been reported in Hawaii in the past
(Green et al. 2017, Wang et al. 2019). However, this served as the first report of clover yellow vein virus in Hawaii. The isolate of ClYVV shared the most homology to an isolate from Korea sharing a 95% identity that was isolated from soybean (KF975894).
In order to confirm the presence of BBWV2 in the sample virus specific primers will have to be ordered and a survey conducted. After which a disease note will be written up and published.
TSV is a member of the genus Ilarvirus and family Bromoviridae. It has a wide host range and is believed to be vectored by thrips. Symptoms include necrotic spots, stunting, and wilt is known to infect crops such as cotton, peppers, sunn hemp, and sunflower (Bhat et al.
2002). In Hawaii the presence of this virus may negatively impact farmers seeking to grow sunflowers. Farming of cut flowers is popular in Hawaii and the necrosis caused by TSV could pose a problem for cut sunflower production. BBWV2 is a member of the genus Fabavirus in the family Comoviridae. The virus is vectored in a non-persistent manner by aphids and has a wide host range. It is capable of infecting crops such as broad bean, spinach, pea, celery, and peppers.
This virus occurs in both single and mixed infections and can interact synergistically with other viruses, such as CMV, leading to enhancing disease symptoms. In peppers BBWV2 causes vein chlorosis and mosaic (Kwak et al. 2013).
62
CHAPTER 5
Conclusions and Future Work
Despite tobamoviruses being one of the first viruses discovered there is still much to learn about the genus. Molecular characterization shows that the tobamovirus isolated from the sunn hemp on Maui county is a potentially novel tobamovirus species sharing a nucleotide identity of 74% with its closest relative SHMV. The viral genome is 6,455bp long and transmission electron microscopy revealed virus particles have rod shaped typical of the genus.
Though we have developed a qPCR assay capable of detecting the virus up to a dilution of
1:10,000 more work could be done to develop additional diagnostic tools that are more applicable in the field.
Though initial reports from farmers in Maui County note symptoms of stunting along with the leaf mosaic our results show that virus infection did not have a significant impact on plant biomass or height. Of the physical characteristics monitored, only the time until first flower was found to be significantly different. Between inoculated and mock inoculated plants mock inoculated plants took on average 5 days longer to flower. Future work could be done to test the virus's effects on other traits most notably seed production rates.
Data from our experiments support this finding in that surface sterilization with 10% bleach and 0.5% Tween20 was unable to prevent seed transmission of SHMoV; however, our control group that received no treatment showed no infection among the more than 400 seeds tested. This result may be due to a combination of factors such as the sample size being too small or the seed transmission rate of SHMoV being very small. Future research could be done with a larger sample size to test this. Other future research options include testing the effects of other seed sterilization methods on SHMoV transmission and possibly microscopy or other diagnostic
63 techniques to test the presence of SHMoV on the perisperm-endosperm envelope or other parts of the seed.
Sunn hemp is often grown as a thick stand leading to plants being grown in close proximity to one another. Our research was done to test the impact plant density and wind on the spread of SHMoV in a greenhouse setting. Our results show that the presence of wind seemed to promote the spread of SHMoV with stronger winds leading to increased infection. In the future more work could be done testing the effects of other factors leading to the spread of the tobamovirus such as sowing density and factors impacting the spread of tobamovirus on other crops cultivated at high seeding rates.
Lastly, a variety of viruses previously not reported in Hawaii were found infecting
Crotalaria. These viruses include the ilarvirus TSV, the fabavirus BBWV2, and the potyvirus
BCMV. Future work could look at the presence of these viruses on the other Hawaiian Islands.
Seeing as there are a variety of different Crotalaria species present in Hawaii more work could also be done looking at the viruses present on the 17 other species of Crotalaria present or the range of these viruses on Crotalaria or other weeds on the different Hawaiian Islands. Such a study would help us better understand the distribution of viruses among the islands. SHMoV was originally found in Maui county; however, its distribution among the different islands is currently unknown, though this gap in knowledge could be remedied with a survey for SHMoV.
64
Literature Cited
Adams, M. J., Adkins, S., Bragard, C., Gilmer, D., Li, D., Macfarlane, S. A., Wong, S.-M., Melcher, U.,
Ratti, C., Ryu, K. H., & Ictv Report Consortium, M. J. 2012. ICTV virus taxonomy profile:
Virgaviridae. The Journal of general virology, 98(8),1999-2000.
https://doi.org/10.1099/jgv.0.000884
Ahlawat, Y. S., Pant, R. P., Lockhart, B. E., Srivastava, M., Chakraborty, N. K., and Varma, A. 1996.
Association of a badnavirus with citrus mosaic disease in India. Plant Dis. 80:590-592.
Ahmad, J., Singh, B., Al-Khedhairy, A. A., Alarifi, S., Khan, J., & Musarrat, J. 2011. Characterization
of Sunn hemp begomovirus and its geographical origin based on in silico structural and
functional analysis of recombinant coat protein. Afr. J. Biotechnol., 10(14), 2600-2610.
doi:10.5897/AJB10.1212
Armstrong, J.K. and Armstrong, C.M. 1950. The Fusarium wilt of Crotalaria. Phytopath. 40:785.
Bianco, L. F., Martins, E. C., Coletti, D. A. B., Toloy, R. S., & Wulff, N. A. 2014. Detection of 16Sr IX
phytoplasma (HLB phytoplasma) in Sunn Hemp (Crotalaria juncea) in São Paulo State, Brazil.
Capoor, S. P. and Varma, P. M. 1948. Enation mosaic of Dolichos lablab Linn., a new virus disease.
Current Science, 17(2), 57-58.
Capoor, S. P. 1950. A mosaic disease of sunn hemp in Bombay. Current Science, 19(1), 22-22.
Coutts, R. H. A. & Livieratos, I. C. 2003. A rapid method for sequencing the 59- and 39 termini of
double-stranded RNA viral templates using RLM-RACE. J Phytopathol 151, 525–527.
Dahan, J., Orellana, G. E., Feng, X., Kong, A. T., Hamasaki, R. T., Melzer, M. J., & Karasev, A. V.
2020. First Report of Clover Yellow Vein Virus in Crotalaria micans in Hawaii. Plant Disease,
104:12, 3276. PDIS-06-20-1195-PDN. https://doi.org/10.1094/pdis-06-20-1195-pdn
65
Dombrovsky, A. and E. Smith. 2017. Seed transmission of tobamoviruses: aspects of global disease
distribution, Advances in Seed Biology, Jose C. Jimenez-Lopez, IntechOpen, DOI:
10.5772/intechopen.70244.
Duffus, J. E. 1971. Role of Weeds in the Incidence of Virus Diseases. Annual Review of
Phytopathology, 9, 319-340. https://doi.org/10.1146/annurev.py.09.090171.001535
Edwardson, J. R. 1991. CRC handbook of viruses infecting legumes. In R. G. Christie (Ed.), Handbook
of viruses infecting legumes. Boca Raton: Boca Raton : CRC Press.
Gibbs, A. J., and Varma, A., 1977, Queensland isolate of sunn-hemp mosaic virus, Unpublished
findings.
Goelet, P., Lomonossoff, G.P., Butler, J.G., Akam, M.E., Gait, M.J., Karn J., 1982. Nucleotide
sequence of Tobacco mosaic virus RNA. Proc. Natl. Acad. Sci. USA. 79, 5818-5822.
Green, J. C., Borth, W. B., Melzer, M. J., Wang, Y. N., Hamim, I., & Hu, J. S. 2017. First
Report of Bean common mosaic virus Infecting Lima Bean in Hawaii. Plant Disease,
101(8), 1557. https://doi.org/10.1094/PDIS-01-17-0125-PDN
Gülser, C., Yılmaz, N., & Candemir, F. 2008. Accumulation of Tobacco mosaic virus (TMV) at
different depths clay and loamy sand textural soils due to tobacco waste application. An
International Journal Devoted to Progress in the Use of Monitoring Data in Assessing
Environmental Risks to Man and the Environment, 146(1), 235-242.
https://doi.org/10.1007/s10661-007-0075-7
Ha, C., Coombs, S., Revill, P. A., Harding, R. M., Vu, M., & Dale, J. L. 2008. Design and application of
two novel degenerate primer pairs for the detection and complete genomic characterization of
potyviruses. Archives of Virology, 153(1), 25-36. https://doi.org/10.1007/s00705-007-1053-7
66
Hartwig, N. L., and Ammon, H. U. 2002. Cover crops and living mulches. Weed Science, 50(6), 688-
699. doi:10.1614/0043-1745(2002)050[0688:AIACCA]2.0.CO;2
Ho, T., & Tzanetakis, I. E. 2014. Development of a virus detection and discovery pipeline using next
generation sequencing. Virology, 471-473, 54-60. https://doi.org/10.1016/j.virol.2014.09.019
Hull, R. 2002. Matthews’ Plant Virology. New York: Academic Press. 1001 p.
Jasy, T. and P. K. Koshy. 1994. Effect of certain leaf extracts and leaves of Gliricidia maculata, (H. B. &
K) Steud. as green manure on Radopholus similis. Indian Journal of Nematology 22: 117–121.
King A. M. Q., Adams M. J., Carstens E. B., Lefkowitz E. J.. Ninth Report of the International
Committee on Taxonomy of Viruses. San Diego, California USA: Elsevier; 2012.
Kong, A., Long, M., Arakaki, A., & Melzer, M. 2018. First Report of Tobacco Streak Virus Infecting
Sunn Hemp ( Crotalaria juncea ) in Hawaii. Plant Disease, 102(12), 2664.
https://doi.org/10.1094/PDIS-04-18-0697-PDN
Krueger R, Wang K, McSorley R, Gallaher RN. 2008. Artificial and natural pollination of sunn hemp in
Florida. Proceedings of the Florida State Horticultural Society 121: 234-237.
Kumar, S., Stecher, G., & Tamura, K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis
Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7), 1870-1874.
https://doi.org/10.1093/molbev/msw054
Li, W., Hartung, J. S., & Levy, L. 2006. Quantitative real-time PCR for detection and identification of
Candidatus Liberibacter species associated with citrus huanglongbing. Journal of microbiological
methods, 66(1), 104-115. https://doi.org/10.1016/j.mimet.2005.10.018
Malaguti, G. 1951. Una podredumbre del tallo de Crotalaria juncea, causada por Ceratostomella
fimbrata. Agronomia Tropical 1:287-292.
67
McSorley, R., D. W. Dickson, J. A. Brito, T. E. Hewlett, and J. J. Frederick. 1994. Effects of tropical
rotation crops on Meloidogyne arenaria population densities and vegetable yields in microplots.
Journal of Nematology 26: 175-181.
Melzer, M. J., Borth, W. B., Sether, D. M., Ferreira, S., Gonsalves, D., and Hu, J. S. 2010. Genetic
diversity and evidence for recent modular recombination in Hawaiian Citrus tristeza virus. Virus
Genes 40:111-118.
Meshi, T., Ohno, T., Iba, H., & Okada, Y. 1981. Nucleotide sequence of a cloned cDNA copy of TMV
(cowpea strain) RNA, including the assembly origin, the coat protein cistron, and the 3′ non-
coding region. Molecular and General Genetics MGG, 184(1), 20-25.
https://doi.org/10.1007/BF00271189
Morris, T. J., & Dodds, J. A. 1979. Isolation and analysis of double-stranded RNA from virus-infected
plant and fungal tissue. Phytopathology, 854-858.
Petch, T. 1917. Ann Royal Botanic Gardens (Perademya) 6:239.
Pratt, L. W. and K. F. Bio. 2012. New plant records from Hawai‘i island. Bishop Museum Occasional
Papers 113: 75–80.
Rather, S. A., Subramaniam, S., Danda, S., & Pandey, A. K. 2018. Discovery of two new species of
Crotalaria (Leguminosae, Crotalarieae) from Western Ghats, India. PloS one, 13:2, 1-20.
e0192226-e0192226. https://doi.org/10.1371/journal.pone.0192226
R Core Team. R: A language and environment for statistical computing. Vienna: R Foundation for
Statistical Computing; 2018.
Reingold, V., Lachman, O., Blaosov, E., & Dombrovsky, A. 2015. Seed disinfection treatments do not
sufficiently eliminate the infectivity of Cucumber green mottle mosaic virus (CGMMV) on
cucurbit seeds. Plant Pathology, 64(2), 245-255. https://doi.org/10.1111/ppa.12260
68
Rotar, P. P., & Joy, R. J. 1983. 'Tropic Sun' Sunn Hemp; Crotalaria juncea L.
Stanley, W. M. 1935. Isolation of a crystalline protein possessing the properties of tobacco
mosaic virus. Science 81, 644-645.
Silver, S., Quan, S., & Deom, C. 1996. Completion of the nucleotide sequence of sunn-hemp mosaic
virus: A tobamovirus pathogenic to legumes. Virus Genes, 13(1), 83-85.
doi:10.1007/BF00576982
Subramaniam, S. and Pandey, A. 2013.Taxonomy and phylogeny of the genus Crotalaria
(Fabaceae): An overview. Acta Biologica Indica. 2:253-264.
Toler, R. W. 1964. Identity of a mosaic virus of cowpea, Phytopathology 54:910.
USDA-NRCS, 1999. Sunn Hemp: A cover crop for southern and tropical farming systems. Soil
Quality—Agronomy Technical Note 10. National Resources Conservation Service.
Varma, A. 1986. Sunn-hemp mosaic virus. Sunn-hemp mosaic virus, 2, 249-266.
Wagner, W. L. 1990. Manual of the flowering plants of Hawaii. (Bishop Museum special publication ;
83)
Wagner, W. L. and D. R. Herbst. 2003. Supplement to the Manual of the Flowering Plants of Hawai‘i,
version 3.1 (12 Dec 2003).
Wang, D., Ocenar, J., Hamim, I., Borth, W. B., Fukada, M. T., Melzer, M. J., Suzuki, J. Y., Wall, M.
M., Matsumoto, T., Sun, G. F., Ko, M., & Hu, J. S. 2019. First Report of Bean Yellow Mosaic
Virus Infecting Nasturtium ( Tropaeolum majus ) in Hawaii. Plant Disease, 103(1), 168.
https://doi.org/10.1094/PDIS-06-18-1082-PDN
Wang, K., Sipes, B. S., & Schmitt, D. 2002. Crotalaria as a cover crop for nematode management: A
review. Nematropica, 32(1), 35-57.
69
Wang, K. H., Sipes, B. S., & Schmitt, D. P. 2001. Suppression of Rotylenchulus reniformis by
Crotalaria juncea, Brassica napus, and Tagetes erecta. Nematropica, 31(2), 237-251.
Wickham H. ggplot2: elegant graphics for data analysis. New York: SpringerVerlag; 2016.
Win, N., Jung, H., & Ohga, S. 2011. Characterization of Sunn Hemp Witches' Broom Phytoplasma in
Myanmar. J. Fac. Agric. Kyushu Univ., 56(2), 217-221.
Wulff, N. A., Teixeira, D. C., Martins, E. C., Toloy, R. S., Bianco, L. F., Colletti, D. A. B., Bové, J. M.
2015. Sunn hemp, a major source-plant of the phytoplasma associated with huanglongbing
symptoms of sweet orange in São Paulo State, Brazil.
70