MICROBIAL ECOLOGY Microb Ecol (2000) 39:246–262 DOI: 10.1007/s002480000003 © 2000 Springer-Verlag New York Inc. Quantification of Methanosaeta Species in Anaerobic Bioreactors Using Genus- and Species-Specific Hybridization Probes D. Zheng, L. Raskin Department of Civil and Environmental Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA Received: 23 July 1999; Accepted: 8 December 1999; Online Publication: 5 May 2000 A BSTRACT To evaluate the role of Methanosaeta spp. in a variety of anaerobic environments, small-subunit rRNA targeted oligonucleotide hybridization probes were developed and experimentally character- ized. The probes were designed to be genus specific for Methanosaeta and species specific for Methanosaeta concilii and Methanosaeta thermophila. The temperature of dissociation was deter- mined for each probe. Probe specificities were determined using a diverse collection of Archaea and through an evaluation of probe nesting using samples from a variety of anaerobic bioreactors. Cell fixation and hybridization conditions for fluorescence in situ hybridizations were also evaluated. Although permeability of methanogens was variable, M. concilii cells could be permeabilized using a range of paraformaldehyde and ethanol based fixation conditions. Using the newly designed probes together with previously designed probes for methanogens, it was determined that Metha- nosaeta spp. were the dominant aceticlastic methanogens in a variety of anaerobic bioreactors when acetate concentrations were low. Their levels were higher in bioreactors with granular sludge than in those with flocculent sludge. In lab-scale upflow anaerobic sludge blanket reactors, the levels of M. concilii rRNA were as high as 30% of the total rRNA. Introduction than acetate, such as methanol, methylamines, and H2 and CO2 [10]. Methanosaeta spp. have higher affinities for ac- Only two genera of aceticlastic methanogens have been de- etate but lower growth rates than Methanosarcina spp. [73]. scribed, i.e., Methanosaeta and Methanosarcina. Acetate is Methanosaeta spp. are present in many environments, such the only known energy source for Methanosaeta spp., as anaerobic digesters [53, 55], anaerobic biofilms [42, 58], whereas Methanosarcina spp. can utilize substrates other sediments [12], paddy soil samples [24, 33], contaminated aquifers [16], and anaerobic granular sludge found in up- flow anaerobic sludge blanket (UASB) reactors [31, 32]. The taxonomy of the genus Methanosaeta has been some- Correspondence to: L. Raskin; Fax (217) 333-6968; E-mail: [email protected] what controversial [9, 30, 50, 51, 66]. We herein adopt the Oligonucleotide Hybridization Probes for Methanosaeta spp. 247 Table 1. Sequences available in the Ribosomal Database Project (RDP) [40] for Methanosaeta spp.a RDP ID Strain Sequenceb Reference 3Ј CGATCCACAGCCGGTGCCACGCT5Ј M. concilii ||||||||||||||||||||||| Mst.conci1 FE 5Ј GCUAGGUGUCGGCCACGGUGCGA3Ј [56] Mst.conci1 Opfikon . .................. [17] Mst.conci2 Opfikon . ........-......... [30] Mst.conci4 UA .............-......... [30] Mst.conci5 PM .............-......... [30] Mst.conci3 GP6 . ........-......... [30] M. thermophila Mst.thermo CALS-1 . .................. [56] Mst.CALS-1 CALS-1 . ........-......... [30] Mst.thermo2 Z-517 . ........-.....NN.. [30] Mst.sp.2 PT .............-......... [30] a The sequences for probe S-F-Msae-0825-a-A-23 [54] and for its target site are given. b A hyphen (-) indicates a deletion; a dot (.) indicates the same nucleotide as in the preceding sequence. taxonomy proposed by Boone et al. [10], who accepted the A small-subunit (SSU) rRNA targeted oligonucleotide genus name Methanosaeta and recognized two species within probe (S-F-Msae-0825-a-A-23) was previously designed for this genus. One is the mesophilic Methanosaeta concilii, the family Methanosaetaceae [54], which currently contains which has an objective synonym Methanothrix concilii and a only the genus Methanosaeta [10]. Some SSU rRNA se- subjective synonym Methanothrix soehngenii [10]. Currently quences of Methanosaeta spp. have a deletion in the target known M. concilii strains include Opfikon [28, 70], VNBF site of this probe at position 838 (based on Escherichia coli [21], GP6 [49], FE [66], UA and PM [31], and MTKO [47]. numbering) [30, 54]. As shown in Table 1, there is some A new strain of M. concilii, VeAc9, was isolated recently from uncertainty about this deletion since it is not consistent with anoxic rice paddy soil [24]. The other species within the sequences reported by different researchers even for the genus Methanosaeta is the thermophilic Methanosaeta ther- same strains (Opfikon and CALS-1). A specificity study us- mophila, which has an objective synonym Methanothrix ther- ing membrane hybridizations indicated that the deletion mophila and subjective synonyms Methanothrix thermoace- could be real for strain CALS-1 [54]. In this previous study, tophila and Methanosaeta thermoacetophila [10]. Currently the same amounts of RNA extracted from pure cultures of known M. thermophila strains include CALS-1 [74, 75], PT strains CALS-1 and FE were blotted onto hybridization [32], and Z-517 [45]. membranes, but the hybridization signal from strain CALS-1 A variety of methods have been used for the detection was much lower than the signal from strain FE with probe and quantification of Methanosaeta spp. These include (1) S-F-Msae-0825-a-A-23 [54]. However, it cannot be ruled culture-based methods, such as enrichments and most prob- out that the lower signal was due to partial degradation of able number (MPN) estimates (e.g., [69]); (2) morphology- the target site of strain CALS-1. Because of this problem, we based methods, such as light microscopy and scanning or designed a new genus-specific probe for Methanosaeta as transmission electron microscopy (e.g., [37, 69]); (3) immu- well as species-specific probes for M. concilii and M. ther- nostaining with antibody probes (e.g., [7, 67]); (4) lipid mophila. The newly designed probes were used together with component analysis (e.g., [43, 46]), (5) oligonucleotide previously designed probes for methanogens to characterize probe hybridizations (e.g., [23, 53, 55]), and (6) a combi- biomass samples from a variety of anaerobic bioreactors. nation of two or more of these methods (e.g., [26, 36]). In this study, we focus on ribosomal RNA (rRNA) targeted Materials and Methods oligonucleotide probe hybridizations since they can be used Microorganisms and Nucleic Acid Extraction to identify and quantify microorganisms at various levels of The microorganisms used in this study are listed in Fig. 2. These specificity in a complex microbial community without prior microorganisms were obtained from the Deutsche Sammlung von cultivation [5, 52]. Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Ger- 248 D. Zheng, L. Raskin many), the American Type Culture Collection (ATCC, Manassas, tridges (OPC; Applied Biosystems) by the University of Illinois VA), the Oregon Collection of Methanogens (OCM, Portland, Biotechnology Center Genetic Engineering Facility. The probes Ј 32 OR), and various collections at the University of Illinois at Urbana- were 5 -end labeled with P using bacteriophage T4 polynucleotide Champaign. Strains were grown as recommended by the culture kinase and [␥-32P] ATP [54]. Oligonucleotide probes for FISH collections and were harvested in the mid-log growth phase. RNA were synthesized by Operon Technologies, Inc. (Alameda, CA) and was isolated from cell pellets using a low-pH hot-phenol extraction Genosys (The Woodlands, TX). method slightly modified from Stahl et al. [64]. Cells were dis- To determine the post-hybridization wash temperature (Tw), rupted using zirconium beads, instead of glass beads, with a Mini- the temperature of dissociation (Td) was determined for each probe beadbeater (Biospec Products, Bartlesville, OK) for 2 min, followed using an elution method [71]. A variety of RNAs extracted from by incubation at 60°C for 10 min, and bead-beating for another 2 microorganisms with zero, one, two, or three mismatches were min. included in these Td studies. The specificities of the probes were evaluated by applying 25 ng RNAs extracted from 24 microorganisms representing different Environmental Samples phylogenetic groups in the archaeal domain (Fig. 2) to nylon mem- branes (Magna Charge; Micron Separation, Inc., Wesboro, MA). Grab samples were taken from the following anaerobic bioreactors: The membranes were hybridized with 32P labeled oligonucleotide (1) two lab-scale anaerobic digesters treating a mixture of munici- probes [54]. The T values derived from the T study (Table 2) pal solid waste and biosolids [23]; (2) two lab-scale thermophilic w d were used as the final post-hybridization wash temperatures, and anaerobic bioreactors operated at Iowa State University, including membrane images were obtained with a PhosphorImager (Molecu- an anaerobic sequencing batch reactor (ASBR) treating nonfat dry lar Dynamics, Sunnyvale, CA). milk and a temperature phased anaerobic digester (TPAD) fed For quantitative membrane hybridizations, sample RNA and a waste activated sludge collected from a plant treating a mixture of dilution series of pure culture RNA were applied to nylon mem- municipal and paper manufacturing wastewater; (3) a full-scale branes and hybridizations were performed as described previously UASB reactor treating the waste stream of a corn wet milling plant; [52]. The hybridization signal intensities were quantified with the