DOCSLIB.ORG

Quantification of Methanosaeta Species in Anaerobic Bioreactors Using Genus- and Species-Specific Hybridization Probes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantification of Methanosaeta Species in Anaerobic Bioreactors Using Genus- and Species-Specific Hybridization Probes MICROBIAL ECOLOGY Microb Ecol (2000) 39:246–262 DOI: 10.1007/s002480000003 © 2000 Springer-Verlag New York Inc. Quantification of Methanosaeta Species in Anaerobic Bioreactors Using Genus- and Species-Specific Hybridization Probes D. Zheng, L. Raskin Department of Civil and Environmental Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA Received: 23 July 1999; Accepted: 8 December 1999; Online Publication: 5 May 2000 A BSTRACT To evaluate the role of Methanosaeta spp. in a variety of anaerobic environments, small-subunit rRNA targeted oligonucleotide hybridization probes were developed and experimentally character- ized. The probes were designed to be genus specific for Methanosaeta and species specific for Methanosaeta concilii and Methanosaeta thermophila. The temperature of dissociation was deter- mined for each probe. Probe specificities were determined using a diverse collection of Archaea and through an evaluation of probe nesting using samples from a variety of anaerobic bioreactors. Cell fixation and hybridization conditions for fluorescence in situ hybridizations were also evaluated. Although permeability of methanogens was variable, M. concilii cells could be permeabilized using a range of paraformaldehyde and ethanol based fixation conditions. Using the newly designed probes together with previously designed probes for methanogens, it was determined that Metha- nosaeta spp. were the dominant aceticlastic methanogens in a variety of anaerobic bioreactors when acetate concentrations were low. Their levels were higher in bioreactors with granular sludge than in those with flocculent sludge. In lab-scale upflow anaerobic sludge blanket reactors, the levels of M. concilii rRNA were as high as 30% of the total rRNA. Introduction than acetate, such as methanol, methylamines, and H2 and CO2 [10]. Methanosaeta spp. have higher affinities for ac- Only two genera of aceticlastic methanogens have been de- etate but lower growth rates than Methanosarcina spp. [73]. scribed, i.e., Methanosaeta and Methanosarcina. Acetate is Methanosaeta spp. are present in many environments, such the only known energy source for Methanosaeta spp., as anaerobic digesters [53, 55], anaerobic biofilms [42, 58], whereas Methanosarcina spp. can utilize substrates other sediments [12], paddy soil samples [24, 33], contaminated aquifers [16], and anaerobic granular sludge found in up- flow anaerobic sludge blanket (UASB) reactors [31, 32]. The taxonomy of the genus Methanosaeta has been some- Correspondence to: L. Raskin; Fax (217) 333-6968; E-mail: [email protected] what controversial [9, 30, 50, 51, 66]. We herein adopt the Oligonucleotide Hybridization Probes for Methanosaeta spp. 247 Table 1. Sequences available in the Ribosomal Database Project (RDP) [40] for Methanosaeta spp.a RDP ID Strain Sequenceb Reference 3Ј CGATCCACAGCCGGTGCCACGCT5Ј M. concilii ||||||||||||||||||||||| Mst.conci1 FE 5Ј GCUAGGUGUCGGCCACGGUGCGA3Ј [56] Mst.conci1 Opfikon . .................. [17] Mst.conci2 Opfikon . ........-......... [30] Mst.conci4 UA .............-......... [30] Mst.conci5 PM .............-......... [30] Mst.conci3 GP6 . ........-......... [30] M. thermophila Mst.thermo CALS-1 . .................. [56] Mst.CALS-1 CALS-1 . ........-......... [30] Mst.thermo2 Z-517 . ........-.....NN.. [30] Mst.sp.2 PT .............-......... [30] a The sequences for probe S-F-Msae-0825-a-A-23 [54] and for its target site are given. b A hyphen (-) indicates a deletion; a dot (.) indicates the same nucleotide as in the preceding sequence. taxonomy proposed by Boone et al. [10], who accepted the A small-subunit (SSU) rRNA targeted oligonucleotide genus name Methanosaeta and recognized two species within probe (S-F-Msae-0825-a-A-23) was previously designed for this genus. One is the mesophilic Methanosaeta concilii, the family Methanosaetaceae [54], which currently contains which has an objective synonym Methanothrix concilii and a only the genus Methanosaeta [10]. Some SSU rRNA se- subjective synonym Methanothrix soehngenii [10]. Currently quences of Methanosaeta spp. have a deletion in the target known M. concilii strains include Opfikon [28, 70], VNBF site of this probe at position 838 (based on Escherichia coli [21], GP6 [49], FE [66], UA and PM [31], and MTKO [47]. numbering) [30, 54]. As shown in Table 1, there is some A new strain of M. concilii, VeAc9, was isolated recently from uncertainty about this deletion since it is not consistent with anoxic rice paddy soil [24]. The other species within the sequences reported by different researchers even for the genus Methanosaeta is the thermophilic Methanosaeta ther- same strains (Opfikon and CALS-1). A specificity study us- mophila, which has an objective synonym Methanothrix ther- ing membrane hybridizations indicated that the deletion mophila and subjective synonyms Methanothrix thermoace- could be real for strain CALS-1 [54]. In this previous study, tophila and Methanosaeta thermoacetophila [10]. Currently the same amounts of RNA extracted from pure cultures of known M. thermophila strains include CALS-1 [74, 75], PT strains CALS-1 and FE were blotted onto hybridization [32], and Z-517 [45]. membranes, but the hybridization signal from strain CALS-1 A variety of methods have been used for the detection was much lower than the signal from strain FE with probe and quantification of Methanosaeta spp. These include (1) S-F-Msae-0825-a-A-23 [54]. However, it cannot be ruled culture-based methods, such as enrichments and most prob- out that the lower signal was due to partial degradation of able number (MPN) estimates (e.g., [69]); (2) morphology- the target site of strain CALS-1. Because of this problem, we based methods, such as light microscopy and scanning or designed a new genus-specific probe for Methanosaeta as transmission electron microscopy (e.g., [37, 69]); (3) immu- well as species-specific probes for M. concilii and M. ther- nostaining with antibody probes (e.g., [7, 67]); (4) lipid mophila. The newly designed probes were used together with component analysis (e.g., [43, 46]), (5) oligonucleotide previously designed probes for methanogens to characterize probe hybridizations (e.g., [23, 53, 55]), and (6) a combi- biomass samples from a variety of anaerobic bioreactors. nation of two or more of these methods (e.g., [26, 36]). In this study, we focus on ribosomal RNA (rRNA) targeted Materials and Methods oligonucleotide probe hybridizations since they can be used Microorganisms and Nucleic Acid Extraction to identify and quantify microorganisms at various levels of The microorganisms used in this study are listed in Fig. 2. These specificity in a complex microbial community without prior microorganisms were obtained from the Deutsche Sammlung von cultivation [5, 52]. Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Ger- 248 D. Zheng, L. Raskin many), the American Type Culture Collection (ATCC, Manassas, tridges (OPC; Applied Biosystems) by the University of Illinois VA), the Oregon Collection of Methanogens (OCM, Portland, Biotechnology Center Genetic Engineering Facility. The probes Ј 32 OR), and various collections at the University of Illinois at Urbana- were 5 -end labeled with P using bacteriophage T4 polynucleotide Champaign. Strains were grown as recommended by the culture kinase and [␥-32P] ATP [54]. Oligonucleotide probes for FISH collections and were harvested in the mid-log growth phase. RNA were synthesized by Operon Technologies, Inc. (Alameda, CA) and was isolated from cell pellets using a low-pH hot-phenol extraction Genosys (The Woodlands, TX). method slightly modified from Stahl et al. [64]. Cells were dis- To determine the post-hybridization wash temperature (Tw), rupted using zirconium beads, instead of glass beads, with a Mini- the temperature of dissociation (Td) was determined for each probe beadbeater (Biospec Products, Bartlesville, OK) for 2 min, followed using an elution method [71]. A variety of RNAs extracted from by incubation at 60°C for 10 min, and bead-beating for another 2 microorganisms with zero, one, two, or three mismatches were min. included in these Td studies. The specificities of the probes were evaluated by applying 25 ng RNAs extracted from 24 microorganisms representing different Environmental Samples phylogenetic groups in the archaeal domain (Fig. 2) to nylon mem- branes (Magna Charge; Micron Separation, Inc., Wesboro, MA). Grab samples were taken from the following anaerobic bioreactors: The membranes were hybridized with 32P labeled oligonucleotide (1) two lab-scale anaerobic digesters treating a mixture of munici- probes [54]. The T values derived from the T study (Table 2) pal solid waste and biosolids [23]; (2) two lab-scale thermophilic w d were used as the final post-hybridization wash temperatures, and anaerobic bioreactors operated at Iowa State University, including membrane images were obtained with a PhosphorImager (Molecu- an anaerobic sequencing batch reactor (ASBR) treating nonfat dry lar Dynamics, Sunnyvale, CA). milk and a temperature phased anaerobic digester (TPAD) fed For quantitative membrane hybridizations, sample RNA and a waste activated sludge collected from a plant treating a mixture of dilution series of pure culture RNA were applied to nylon mem- municipal and paper manufacturing wastewater; (3) a full-scale branes and hybridizations were performed as described previously UASB reactor treating the waste stream of a corn wet milling plant; [52]. The hybridization signal intensities were quantified with the
Load more

Recommended publications
  • Methanosaeta Pelagica" Sp
    Aceticlastic and NaCl-Requiring Methanogen "Methanosaeta pelagica" sp. nov., Isolated from Marine Tidal Flat Title Sediment Author(s) Mori, Koji; Iino, Takao; Suzuki, Ken-Ichiro; Yamaguchi, Kaoru; Kamagata, Yoichi Applied and Environmental Microbiology, 78(9), 3416-3423 Citation https://doi.org/10.1128/AEM.07484-11 Issue Date 2012-05 Doc URL http://hdl.handle.net/2115/50384 Rights © 2012 by the American Society for Microbiology Type article (author version) File Information AEM78-9_3416-3423.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP Mori et al. Title 2 Aceticlastic and NaCl-requiring methanogen “Methanosaeta pelagica” sp. nov., isolated from marine tidal flat sediment. 4 Authors 6 Koji Mori,1 Takao Iino,2 Ken-ichiro Suzuki,1 Kaoru Yamaguchi1 & Yoichi Kamagata3 1NITE Biological Resource Center (NBRC), National Institute of Technology and Evaluation (NITE), 8 2-5-8 Kazusakamatari, Kisarazu, Chiba 292-0818, Japan 2Japan Collection of Microorganisms, RIKEN BioResource Center, 2-1 Hirosawa, Wako, Saitama 10 351-0198, Japan 3Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology 12 (AIST), Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 400-8511, Japan 14 Corresponding author Koji Mori 16 NITE Biological Resource Center (NBRC), National Institute of Technology and Evaluation (NITE), 2-5-8 Kazusakamatari, Kisarazu, Chiba 292-0818, Japan 18 Tel, +81-438-20-5763; Fax, +81-438-52-2329; E-mail, [email protected] 20 Running title Marine aceticlastic methanogen, Methanosaeta pelagica 22 1 Mori et al. 2 ABSTRACT Acetate is a key compound for anaerobic organic matter degradation, and so far, two genera, 4 Methanosaeta and Methanosarcina, are only contributors for acetate degradation among methanogens.
    [Show full text]
  • Insights Into Archaeal Evolution and Symbiosis from the Genomes of a Nanoarchaeon and Its Inferred Crenarchaeal Host from Obsidian Pool, Yellowstone National Park
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Microbiology Publications and Other Works Microbiology 4-22-2013 Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar University of Tennessee - Knoxville, [email protected] Kira S. Makarova National Institutes of Health David E. Graham University of Tennessee - Knoxville, [email protected] Yuri I. Wolf National Institutes of Health Eugene V. Koonin National Institutes of Health See next page for additional authors Follow this and additional works at: https://trace.tennessee.edu/utk_micrpubs Part of the Microbiology Commons Recommended Citation Biology Direct 2013, 8:9 doi:10.1186/1745-6150-8-9 This Article is brought to you for free and open access by the Microbiology at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Microbiology Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Authors Mircea Podar, Kira S. Makarova, David E. Graham, Yuri I. Wolf, Eugene V. Koonin, and Anna-Louise Reysenbach This article is available at TRACE: Tennessee Research and Creative Exchange: https://trace.tennessee.edu/ utk_micrpubs/44 Podar et al. Biology Direct 2013, 8:9 http://www.biology-direct.com/content/8/1/9 RESEARCH Open Access Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar1,2*, Kira S Makarova3, David E Graham1,2, Yuri I Wolf3, Eugene V Koonin3 and Anna-Louise Reysenbach4 Abstract Background: A single cultured marine organism, Nanoarchaeum equitans, represents the Nanoarchaeota branch of symbiotic Archaea, with a highly reduced genome and unusual features such as multiple split genes.
    [Show full text]
  • Methanogens Diversity During Anaerobic Sewage Sludge Stabilization and the Effect of Temperature
    processes Article Methanogens Diversity during Anaerobic Sewage Sludge Stabilization and the Effect of Temperature Tomáš Vítˇez 1,2, David Novák 3, Jan Lochman 3,* and Monika Vítˇezová 1,* 1 Department of Experimental Biology, Faculty of Science, Masaryk University, 62500 Brno, Czech Republic; [email protected] 2 Department of Agricultural, Food and Environmental Engineering, Faculty of AgriSciences, Mendel University, 61300 Brno, Czech Republic 3 Department of Biochemistry, Faculty of Science, Masaryk University, 62500 Brno, Czech Republic; [email protected] * Correspondence: [email protected] (J.L.); [email protected] (M.V.); Tel.: +420-549-495-602 (J.L.); Tel.: +420-549-497-177 (M.V.) Received: 29 June 2020; Accepted: 10 July 2020; Published: 12 July 2020 Abstract: Anaerobic sludge stabilization is a commonly used technology. Most fermenters are operated at a mesophilic temperature regime. Modern trends in waste management aim to minimize waste generation. One of the strategies can be achieved by anaerobically stabilizing the sludge by raising the temperature. Higher temperatures will allow faster decomposition of organic matter, shortening the retention time, and increasing biogas production. This work is focused on the description of changes in the community of methanogenic microorganisms at different temperatures during the sludge stabilization. At higher temperatures, biogas contained a higher percentage of methane, however, there was an undesirable accumulation of ammonia in the fermenter. Representatives of the hydrogenotrophic genus Methanoliea were described at all temperatures tested. At temperatures up to 50 ◦C, a significant proportion of methanogens were also formed by acetoclastic representatives of Methanosaeta sp. and acetoclastic representatives of the order Methanosarcinales.
    [Show full text]
  • Unexpected Competitiveness of Methanosaetapopulations At
    Unexpected competitiveness of Methanosaetapopulations at elevated acetate concentrations in methanogenic treatment of animal wastewater Authors Authors and affiliations Si Chen Huicai Cheng Jiang Liu Terry C. Hazen Vicki Huang Qiang He o o o o o o o o o 1. 1. 2. 2. 3. 3. 4. 4. 5. 5. Environmental biotechnology First Online: 17 November 2016 2 Shares 354Downloads 3 Citations Abstract Acetoclastic methanogenesis is a key metabolic process in anaerobic digestion, a technology with broad applications in biogas production and waste treatment. Acetoclastic methanogenesis is known to be performed by two archaeal genera, Methanosaeta and Methanosarcina. The conventional model posits that Methanosaeta populations are more competitive at low acetate levels (<1 mM) than Methanosarcina and vice versa at higher acetate concentrations. While this model is supported by an extensive body of studies, reports of inconsistency have grown that Methanosaeta were observed to outnumber Methanosarcina at elevated acetate levels. In this study, monitoring of anaerobic digesters treating animal wastewater unexpectedly identified Methanosaeta as the dominant acetoclastic methanogen population at both low and high acetate levels during organic overloading. The surprising competitiveness of Methanosaeta at elevated acetate was further supported by the enrichment of Methanosaetawith high concentrations of acetate (20 mM). The dominance of Methanosaeta in the methanogen community could be reproduced in anaerobic digesters with the direct addition of acetate to above 20 mM, again supporting the competitiveness of Methanosaeta over Methanosarcina at elevated acetate levels. This study for the first time systematically demonstrated that the dominance of Methanosaeta populations in anaerobic digestion could be linked to the competitiveness of Methanosaeta at elevated acetate concentrations.
    [Show full text]
  • Methanogenic Archaea: Emerging Partners in the Field of Allergic Diseases
    Clinical Reviews in Allergy & Immunology (2019) 57:456–466 https://doi.org/10.1007/s12016-019-08766-5 Methanogenic Archaea: Emerging Partners in the Field of Allergic Diseases Youssouf Sereme1,2 & Soraya Mezouar1,2 & Ghiles Grine1,2 & Jean Louis Mege1,2,3 & Michel Drancourt1,2 & Pierre Corbeau4,5,6 & Joana Vitte1,2,3 Published online: 14 September 2019 # Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract Archaea, which form one of four domains of life alongside Eukarya, Bacteria, and giant viruses, have long been neglected as components of the human microbiota and potential opportunistic infectious pathogens. In this review, we focus on methanogenic Archaea, which rely on hydrogen for their metabolism and growth. On one hand, methanogenic Archaea in the gut are functional associates of the fermentative digestion of dietary fibers, favoring the production of beneficial short-chain fatty acids and likely contributing to the weaning reaction during the neonatal window of opportunity. On the other hand, methanogenic Archaea trigger the activation of innate and adaptive responses and the generation of specific T and B cells in animals and humans. In mouse models, lung hypersensitivity reactions can be induced by inhaled methanogenic Archaea mimicking human professional exposure to organic dust. Changes in methanogenic Archaea of the microbiota are detected in an array of dysimmune conditions comprising inflammatory bowel disease, obesity, malnutrition, anorexia, colorectal cancer, and diverticulosis. At the subcellular level, methanogenic Archaea are activators of the TLR8-dependent NLRP3 inflammasome, modulate the release of antimicrobial peptides and drive the production of proinflammatory, Th-1, Th-2, and Th-17 cytokines.
    [Show full text]
  • Acetate Metabolism in Methanothrix Soehngenii
    ACETATE METABOLISM IN METHANOTHRIX SOEHNGENII CENTRALE LANDBOUWCATALOGUS 0000 0456 8685 Promotor: Dr. A.J . B. Zehnder, hoogleraar in de microbiologic Co-promotor: Dr. Ir. A.J . M. Stams universitair docent bij devakgroe p microbiologic M. S. M. Jetten Acetate metabolism in Methanothrix soehngenii Proefschrift ter verkrijging van de graad van doctor in de landbouw- en milieuwetenschappen op gezag van de rector magnificus, Dr. H. C. van der Plas, in het openbaar te verdedigen op vrijdag 20 december 1991 des namiddags te vier uur in de aula van de Landbouwuniversiteit te Wageningen. LAIN'DBOUWUNIVEuSIXED I WAGEMNGEN Dit promotie onderzoek werd uitgevoerd binnen het Innovatief Onderzoeks Pro- gramma biotechnologie (IOP-b) en begeleid door de Programma Commissie Industriele Biotechnologie van het Ministerie van Economische Zaken. De afronding van de promotie werd tevens mogelijk gemaakt door bijdrages van het LEB Fonds, de Landbouwuniversiteit en de vakgroep Microbiologic X N0l70't >V6> Stellingen 1. Het meten van complexe enzymreacties in cel-vrije extracten levert meer interpretatieproblemen, dan uitkomsten op. Fisher, R. and Thauer, R.K. (1988) Methanogenesis from acetate in cell extracts ofMethano- sarc'ma barken.Arch . Microbiol. 151, 459-465. 2. De bevinding van Fiala en Stetter, dat Pyrococcus furiosus alleen H2 en C02 als eindprodukten maakt, berust op onzorgvuldige analyse metho- den. Fiala, G. and Stetter, K.O (1986) Pyrococcus furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C. Arch. Microbiol. 145, 56-61. 3. Het "herontdekken" van het gave=1.87 signaal in EPR spectra van het CO dehydrogenase van Clostridium thermoaceticum door Lindahl et.
    [Show full text]
  • Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes
    GBE Different Ways of Doing the Same: Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes Dennifier Costa Brandao~ Cruz1, Lenon Lima Santana1, Alexandre Siqueira Guedes2, Jorge Teodoro de Souza3,*, and Phellippe Arthur Santos Marbach1,* 1CCAAB, Biological Sciences, Recoˆ ncavo da Bahia Federal University, Cruz das Almas, Bahia, Brazil 2Agronomy School, Federal University of Goias, Goiania,^ Goias, Brazil 3 Department of Phytopathology, Federal University of Lavras, Minas Gerais, Brazil Downloaded from https://academic.oup.com/gbe/article/11/4/1235/5345563 by guest on 27 September 2021 *Corresponding authors: E-mails: [email protected]fla.br; [email protected]. Accepted: February 16, 2019 Abstract The last two steps of the purine biosynthetic pathway may be catalyzed by different enzymes in prokaryotes. The genes that encode these enzymes include homologs of purH, purP, purO and those encoding the AICARFT and IMPCH domains of PurH, here named purV and purJ, respectively. In Bacteria, these reactions are mainly catalyzed by the domains AICARFT and IMPCH of PurH. In Archaea, these reactions may be carried out by PurH and also by PurP and PurO, both considered signatures of this domain and analogous to the AICARFT and IMPCH domains of PurH, respectively. These genes were searched for in 1,403 completely sequenced prokaryotic genomes publicly available. Our analyses revealed taxonomic patterns for the distribution of these genes and anticorrelations in their occurrence. The analyses of bacterial genomes revealed the existence of genes coding for PurV, PurJ, and PurO, which may no longer be considered signatures of the domain Archaea. Although highly divergent, the PurOs of Archaea and Bacteria show a high level of conservation in the amino acids of the active sites of the protein, allowing us to infer that these enzymes are analogs.
    [Show full text]
  • Distribution of Bathyarchaeota Communities Across Different Terrestrial Settings and Their Potential Ecological Functions
    www.nature.com/scientificreports OPEN Distribution of Bathyarchaeota Communities Across Different Terrestrial Settings and Their Received: 17 October 2016 Accepted: 17 February 2017 Potential Ecological Functions Published: 21 March 2017 Xing Xiang1,*, Ruicheng Wang1,*, Hongmei Wang1,2, Linfeng Gong3, Baiying Man1 & Ying Xu1 High abundance and widespread distribution of the archaeal phylum Bathyarchaeota in marine environment have been recognized recently, but knowledge about Bathyarchaeota in terrestrial settings and their correlation with environmental parameters is fairly limited. Here we reported the abundance of Bathyarchaeota members across different ecosystems and their correlation with environmental factors by constructing 16S rRNA clone libraries of peat from the Dajiuhu Peatland, coupling with bioinformatics analysis of 16S rRNA data available to date in NCBI database. In total, 1456 Bathyarchaeota sequences from 28 sites were subjected to UniFrac analysis based on phylogenetic distance and multivariate regression tree analysis of taxonomy. Both phylogenetic and taxon-based approaches showed that salinity, total organic carbon and temperature significantly influenced the distribution of Bathyarchaeota across different terrestrial habitats. By applying the ecological concept of ‘indicator species’, we identify 9 indicator groups among the 6 habitats with the most in the estuary sediments. Network analysis showed that members of Bathyarchaeota formed the “backbone” of archaeal community and often co-occurred with Methanomicrobia.
    [Show full text]
  • Disentangling the Syntrophic Electron Transfer Mechanisms of Candidatus Geobacter Eutrophica Through Electrochemical Stimulation
    www.nature.com/scientificreports OPEN Disentangling the syntrophic electron transfer mechanisms of Candidatus geobacter eutrophica through electrochemical stimulation and machine learning Heyang Yuan1,2*, Xuehao Wang1, Tzu‑Yu Lin1, Jinha Kim1 & Wen‑Tso Liu1* Interspecies hydrogen transfer (IHT) and direct interspecies electron transfer (DIET) are two syntrophy models for methanogenesis. Their relative importance in methanogenic environments is still unclear. Our recent discovery of a novel species Candidatus Geobacter eutrophica with the genetic potential of IHT and DIET may serve as a model species to address this knowledge gap. To experimentally demonstrate its DIET ability, we performed electrochemical enrichment of Ca. G. eutrophica‑dominating communities under 0 and 0.4 V vs. Ag/AgCl based on the presumption that DIET and extracellular electron transfer (EET) share similar metabolic pathways. After three batches of enrichment, Geobacter OTU650, which was phylogenetically close to Ca. G. eutrophica, was outcompeted in the control but remained abundant and active under electrochemical stimulation, indicating Ca. G. eutrophica’s EET ability. The high‑quality draft genome further showed high phylogenomic similarity with Ca. G. eutrophica, and the genes encoding outer membrane cytochromes and enzymes for hydrogen metabolism were actively expressed. A Bayesian network was trained with the genes encoding enzymes for alcohol metabolism, hydrogen metabolism, EET, and methanogenesis from dominant fermentative bacteria, Geobacter, and Methanobacterium. Methane production could not be accurately predicted when the genes for IHT were in silico knocked out, inferring its more important role in methanogenesis. The genomics‑enabled machine learning modeling approach can provide predictive insights into the importance of IHT and DIET. Anaerobic digestion is widely used to convert high-strength waste streams to biogas.
    [Show full text]
  • International Code of Nomenclature of Prokaryotes
    2019, volume 69, issue 1A, pages S1–S111 International Code of Nomenclature of Prokaryotes Prokaryotic Code (2008 Revision) Charles T. Parker1, Brian J. Tindall2 and George M. Garrity3 (Editors) 1NamesforLife, LLC (East Lansing, Michigan, United States) 2Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) 3Michigan State University (East Lansing, Michigan, United States) Corresponding Author: George M. Garrity ([email protected]) Table of Contents 1. Foreword to the First Edition S1–S1 2. Preface to the First Edition S2–S2 3. Preface to the 1975 Edition S3–S4 4. Preface to the 1990 Edition S5–S6 5. Preface to the Current Edition S7–S8 6. Memorial to Professor R. E. Buchanan S9–S12 7. Chapter 1. General Considerations S13–S14 8. Chapter 2. Principles S15–S16 9. Chapter 3. Rules of Nomenclature with Recommendations S17–S40 10. Chapter 4. Advisory Notes S41–S42 11. References S43–S44 12. Appendix 1. Codes of Nomenclature S45–S48 13. Appendix 2. Approved Lists of Bacterial Names S49–S49 14. Appendix 3. Published Sources for Names of Prokaryotic, Algal, Protozoal, Fungal, and Viral Taxa S50–S51 15. Appendix 4. Conserved and Rejected Names of Prokaryotic Taxa S52–S57 16. Appendix 5. Opinions Relating to the Nomenclature of Prokaryotes S58–S77 17. Appendix 6. Published Sources for Recommended Minimal Descriptions S78–S78 18. Appendix 7. Publication of a New Name S79–S80 19. Appendix 8. Preparation of a Request for an Opinion S81–S81 20. Appendix 9. Orthography S82–S89 21. Appendix 10. Infrasubspecific Subdivisions S90–S91 22. Appendix 11. The Provisional Status of Candidatus S92–S93 23.
    [Show full text]
  • Taxonomy and Ecology of Methanogens
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Horizon / Pleins textes FEMS Microbiology Reviews 87 (1990) 297-308 297 Pubfished by Elsevier FEMSRE 00180 Taxonomy and ecology of methanogens J.L. Garcia Laboratoire de Microbiologie ORSTOM, Université de Provence, Marseille, France Key words: Methanogens; Archaebacteria; Taxonomy; Ecology 1. INTRODUCTION methane from CO2 using alcohols as hydrogen donors; 2-propanol is oxidized to acetone, and More fhan nine reviews on taxonomy of 2-butanol to 2-butanone. Carbon monoxide may methanogens have been published during the last also be converted into methane; most hydro- decade [l-91, after the discovery of the unique genotrophic species (60%) will also use formate. biochemical and genetic properties of these Some aceticlastic species are incapable of oxidiz- organisms led to the concept of Archaebacteria at ing H,. The aceticlastic species of the genus the end of the seventies. Moreover, important Methanosurcina are the most metabolically diverse economic factors have ,placed these bacteria in the methanogens, whereas the obligate aceticlastic limelight [5], including the need to develop alter- Methanosaeta (Methanothrix) can use only acetate. native forms of energy, xenobiotic pollution con- The taxonomy of the methanogenic bacteria trol, the enhancement of meat yields in the cattle has been extensively revised in the light of new industry, the distinction between biological and information based on comparative studies of 16 S thermocatalytic petroleum generation, and the rRNA oligonucleotide sequences, membrane lipid global distribution of methane in the earth's atmo- composition, and antigenic fingerprinting data. sphere. The phenotypic characteristics often do not pro- vide a sufficient means of distinguishing among taxa or determining the phylogenetic position of a 2.
    [Show full text]
  • Genes in Hydrothermal Sediments of the Guaymas Basin Ashita Dhillon,1 Mark Lever,2 Karen G
    APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2005, p. 4592–4601 Vol. 71, No. 8 0099-2240/05/$08.00ϩ0 doi:10.1128/AEM.71.8.4592–4601.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Methanogen Diversity Evidenced by Molecular Characterization of Methyl Coenzyme M Reductase A (mcrA) Genes in Hydrothermal Sediments of the Guaymas Basin Ashita Dhillon,1 Mark Lever,2 Karen G. Lloyd,2 Daniel B. Albert,2 Mitchell L. Sogin,1 and Andreas Teske2* Marine Biological Laboratory, The Josephine Bay Paul Center for Comparative Molecular Biology and Evolution, Woods Hole, Massachusetts,1 and Department of Marine Sciences, University of North Carolina, Chapel Hill, North Carolina2 Received 19 July 2004/Accepted 4 March 2005 The methanogenic community in hydrothermally active sediments of Guaymas Basin (Gulf of California, Mexico) was analyzed by PCR amplification, cloning, and sequencing of methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Members of the Methanomicrobiales and Methanosarcinales dominated the mcrA and 16S rRNA clone libraries from the upper 15 cm of the sediments. Within the H2/CO2- and formate-utilizing family Methanomicrobiales, two mcrA and 16S rRNA lineages were closely affiliated with cultured species of the genera Methanoculleus and Methanocorpusculum. The most frequently recovered mcrA PCR amplicons within the Methanomicrobiales did not branch with any cultured genera. Within the nutritionally versatile family Meth- anosarcinales, one 16S rRNA amplicon and most of the mcrA PCR amplicons were affiliated with the obligately acetate utilizing species Methanosaeta concilii. The mcrA clone libraries also included phylotypes related to the methyl-disproportionating genus Methanococcoides. However, two mcrA and two 16S rRNA lineages within the Methanosarcinales were unrelated to any cultured genus.
    [Show full text]