US 2016.0024496A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0024496 A1 Bennett et al. (43) Pub. Date: Jan. 28, 2016

(54) METHODS FORMONITORING C90RF72 Related U.S. Application Data EXPRESSION (60) Provisional application No. 61/714,142, filed on Oct. (71) Applicants: ISIS PHARMACEUTICALS, INC., 15, 2012. Carlsbad, CA (US): THE JOHNS HOPKINS UNIVERSITY, Baltimore, MD (US) Publication Classification (72) Inventors: C. Frank Bennett, Carlsbad, CA (US); (51) Int. Cl. Susan M. Freier, San Diego, CA (US); CI2N IS/II3 (2006.01) Jeffrey D. Rothstein, Catonsville, MD A613 L/7088 (2006.01) (US); Christopher Donnelly, Newtown (52) U.S. Cl. Square, PA (US); Rita G. Sattler, CPC ...... CI2N 15/I 13 (2013.01); A61K3I/7088 Baltimore, MD (US) (2013.01); C12N 23 10/11 (2013.01); C12N 23 10/11 1 (2013.01); C12N 23 10/341 (2013.01); (73) Assignees: The Johns Hopkins University, CI2N 23.10/315 (2013.01); C12N 23.10/3341 Baltimore, MD (US); Isis (2013.01); C12N 23.10/3231 (2013.01); C12N Pharmaceuticals, Inc., Carlsbad, CA 23.10/321 (2013.01) (US)

(21) Appl. No.: 14/436,039 (57) ABSTRACT (22) PCT Fled: Oct. 15, 2013 Disclosed herein are methods for monitoring expression of (86) PCT NO.: PCT/US13A65131 C9ORF72 mRNA and protein in an animal with C90RF72 S371 (c)(1), specific inhibitors. Such C9CRF72 specific inhibitors include (2) Date: Apr. 15, 2015 antisense compounds. Patent Application Publication Jan. 28, 2016 Sheet 1 of 9 US 2016/0024496 A1

'GGGGCc &epseat

NM_0183252:-- g NP 060795.1 NM 145.0054 - HINP 6591122 Legend: ! s UTR - intron i Y CDs as ASO a 19-20 nt GAPners : - 5'8, 3' 5 nt 2'O-methyl RNA bases 1 10 nt phosphothioate backbones

&uSRimasamanmaauwman

Control 1 2 3 4 5 -RT C90RF72 mRN GAPDH mRNA ::::::::::::::::: Control Fibroblasts

Figure 1 a-b Patent Application Publication Jan. 28, 2016 Sheet 2 of 9 US 2016/0024496 A1

Human Cerebellum

coorf72 as / control / ENPP2 mRNAs Frio fixtixias NP2 sewgis RSPO3 in RNA

GAPDH rRNA

s k peos vs. Gortraitroalasts c s f, p<0.05 vs. CSORF2 fibroblasts

Figure 2 a-b Patent Application Publication Jan. 28, 2016 Sheet 3 of 9 US 2016/0024496 A1

A

si. * 3.

COR2A Ciria is tria in their tria Air

Figure 3 a-b Patent Application Publication Jan. 28, 2016 Sheet 4 of 9 US 2016/0024496 A1

control Fibroblasts 9oRF72 Fibroblast

6 O

O 2 O. O

Figure 4a Patent Application Publication Jan. 28, 2016 Sheet 5 of 9 US 2016/0024496 A1

1 2 O control Aso M o C9 OR72. As 4.26 OoOO O

Figure 4b Patent Application Publication Jan. 28, 2016 Sheet 6 of 9 US 2016/0024496 A1

3 O

2 O

10

Figure 5 Patent Application Publication Jan. 28, 2016 Sheet 7 of 9 US 2016/0024496 A1

-2 5

SABIC DE

Figure 6 Patent Application Publication Jan. 28, 2016 Sheet 8 of 9 US 2016/0024496 A1

x 8: W

s: xxxx N

&

xxxxxxxx N

2 36% x: s

O (O. O. O. O. O. 3 st xsi -Wese o co st (JOS 60 Ol e/\eel) SeNe WN Patent Application Publication Jan. 28, 2016 Sheet 9 of 9 US 2016/0024496 A1

f E. 2 S

N:5&O 8x: 2. XxxxxXXXXXXXX s i

E.Fix

a SeAe WN US 2016/0024496 A1 Jan. 28, 2016

METHODS FORMONITORING C90F72 nearly half of familial ALS and nearly one-quarter of all ALS EXPRESSION cases in a cohort of 405 Finnish patients (Laaksovirta et al. Lancet Neurol., 2010, 9,978-985). SEQUENCE LISTING 0005. A founder haplotype, covering the C9CRF72 gene, 0001. The present application is being filed along with a is present in the majority of cases linked to this region. Sequence Listing in electronic format. The Sequence Listing 0006. There are currently no effective therapies to treat is provided as a file entitled BIOLO215 WOSEQ.txt created Such neurodegenerative diseases. Therefore, it is an object to Oct. 15, 2013, which is 120Kb in size. The information in the provide compositions and methods for the treatment of Such electronic format of the sequence listing is incorporated neurodegenerative diseases. herein by reference in its entirety. SUMMARY FIELD 0007 Disclosed herein are biomarkers and methods for 0002 Provided are methods for reducing expression of moritoring expression of C9CRF72 mRNA and protein in an C9ORF72 mRNA and protein in an animal. Such methods are animal with C90RF72 specific inhibitors. Such C90RF72 useful to treat, prevent, or ameliorate neurodegenerative dis specific inhibitors include antisense compounds. eases, including amyotrophic lateral Sclerosis (ALS), fronto 0008 Provided herein are methods for modulating levels temporal dementia (FTD), corticalbasal degeneration syn of C9CRF72 mRNA and protein in cells, tissues, and ani drome (CBD), atypical Parkinsonian syndrome, and mals. In certain embodiments, C9CRF72 specific inhibitors olivopontocerellar degeneration (OPCD). modulate expression of C9CRF72 mRNA and protein. In certain embodiments, C9CRF72 specific inhibitors are BACKGROUND nucleic acids, proteins, or Small molecules. 0003 Amyotrophic lateral sclerosis (ALS) is a fatal neu 0009. In certain embodiments, modulation can occur in a rodegenerative disease characterized clinically by progres cellor tissue. In certain embodiments, the cellor tissue is in an sive paralysis leading to death from respiratory failure, typi animal. In certain embodiments, the animal is a human. In cally within two to three years of symptom onset (Rowland certain embodiments, C90RF72 mRNA levels are reduced. and Shneider, N. Engl. J. Med., 2001,344, 1688-1700). ALS In certain embodiments, C9CRF72 protein levels are is the third most common neurodegenerative disease in the reduced. In certain embodiments, certain C9CRF72 mRNA Western world (Hintz et al., Neurology, 2007, 68, 326-337), variants are preferentially reduced. In certain embodiments, and there are currently no effective therapies. Approximately the C9CRF72 mRNA variants preferentially reduced are 10% of cases are familial in nature, whereas the bulk of variants containing intron 1. In certain embodiments, intron 1 patients diagnosed with the disease are classified as sporadic contains a hexanucleotide repeat expansion. In certain as they appear to occur randomly throughout the population embodiments, the hexanucleotide repeat expansion is associ (Chio et al., Neurology, 2008, 70,533-537). There is growing ated with a C90RF72 associated disease. In certain embodi recognition, based on clinical, genetic, and epidemiological ments, the hexanucleotide repeat expansion is associated with data, that ALS and frontotemporal dementia (FTD) represent a C9ORF72 hexanucleotide repeat expansion associated dis an overlapping continuum of disease, characterized patho ease. In certain embodiments, the hexanucleotide repeat logically by the presence of TDP-43 positive inclusions expansion comprises at least 30 GGGGCC repeats. In certain throughout the central nervous system (Lillo and Hodges, J. embodiments, the hexanucleotide repeat expansion is associ Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Sci ated with nuclear foci. In certain embodiments, the hexa ence, 2006, 314, 130-133). nucleotide repeat expansion is associated with misregulated 0004 To date, a number of genes have been discovered as expression of various genes. In certain embodiments, the causative for classical familial ALS, for example, SOD1, hexanucleotide repeat expansion is associated with nuclear TARDBP, FUS, OPTN, and VCP (Johnson et al., Neuron, retention of various proteins. In certain embodiments, the 2010, 68,857-864; Kwiatkowski et al., Science, 2009, 323, methods described herein are useful for reducing C9CRF72 1205-1208; Maruyama et al., Nature, 2010, 465, 223-226; mRNA, C90RF72 protein levels, and nuclear foci. Such Rosen et al., Nature, 1993, 362, 59-62: Sreedharan et al., reduction can occur in a time-dependent manner or in a dose Science, 2008, 319, 1668-1672; Vance et al., Brain, 2009, dependent manner. In certain embodiments, the methods 129,868-876). Recently, linkage analysis of kindreds involv described herein are useful for normalizing expression of ing multiple cases of ALS, FTD, and ALS-FTD had sug various genes and reducing nuclear retention of various pro gested that there was an important locus for the disease on the teins. short arm of chromosome 9 (Boxer et al., J. Neurol. Neuro 0010 Also provided are methods useful for preventing, Surg. Psychiatry, 2011, 82, 196-203: Morita et al., Neurology, treating, and ameliorating diseases, disorders, and conditions 2006, 66, 839-844; Pearson et al. J. Nerol., 2011, 258, 647 associated with C90RF72. In certain embodiments, such dis 655: Vance et al., Brain, 2006, 129,868-876). The chromo eases, disorders, and conditions associated with C90RF72 some 9p21 ALS-FTD locus in the last major autosomal-domi are neurodegenerative diseases. In certain embodiments, the nant gene whose mutation is causative of ALS. The ALS-FTD neurodegenerative disease is ALS, FTD, corticalbasal degen causing mutation is a large hexanucleotide (GGGGCC) eration syndrome (CBD), atypical Parkinsonian syndrome, repeat expansion in the first intron of the C9CRF72 gene and olivopontocerellar degeneration (OPCD). (Renton et al., Neuron, 2011, 72,257-268; DeJesus-Hernan 0011 Such diseases, disorders, and conditions can have dez et al., Neuron, 2011, 72,245-256). A founder haplotype, one or more risk factors, causes, or outcomes in common. covering the C9CRF72 gene, is present in the majority of Certain risk factors and causes for development of a neuro cases linked to this region (Renton et al., Neuron, 2011, 72, degenerative disease, and, in particular, ALS and FTD, 257-268). This locus on chromosome 9p21 accounts for include genetic predisposition and older age. US 2016/0024496 A1 Jan. 28, 2016

0012. In certain embodiments, methods of treatment comprising one unit and elements and components that com include administering a C9CRF72 specific inhibitor to an prise more than one subunit, unless specifically stated other individual in need thereof. In certain embodiments, the wise. C9ORF72 specific inhibitor is a nucleic acid. In certain 0026. The section headings used herein are for organiza embodiments, the nucleic acid is an antisense compound. In tional purposes only and are not to be construed as limiting certain embodiments, the antisense compound is a single the subject matter described. All documents, or portions of Stranded antisense oligonucleotide. In certain embodiments, documents, cited in this disclosure, including, but not limited the single-stranded antisense oligonucleotide is complemen to, patents, patent applications, published patent applications, tary to a C90RF72 nucleic acid. articles, books, treatises, and GENBANK Accession Num bers and associated sequence information obtainable through BRIEF DESCRIPTION OF THE FIGURES databases such as National Center for Biotechnology Infor mation (NCBI) and other data referred to throughout in the 0013 FIG.1a is a diagram presenting the targeting regions disclosure herein are hereby expressly incorporated by refer of ASOs 1-5 with respect to the C9CRF72 mRNA variant 1, ence for the portions of the document discussed herein, as GENBANK Accession No. NM 145005.4 (designated well as in their entirety. herein as SEQID NO: 6) and mRNA variant 2, GENBANK Accession No. NM 018325.2 (designated herein as SEQID DEFINITIONS NO: 4). 0027. Unless specific definitions are provided, the nomen 0014 FIG. 1b is a gel showing the total mRNA levels of clature utilized in connection with, and the procedures and C9CRF72. techniques of analytical chemistry, synthetic organic chem 0015 FIG.2a is a graph depicting C9CRF72 expression in istry, and medicinal and pharmaceutical chemistry described treated and untreated cells. herein are those well known and commonly used in the art. 0016 FIG. 2b is a gel showing expression of ENPP2 Standard techniques may be used for chemical synthesis, and mRNA and RSPO3 mRNA in treated and untreated cells. chemical analysis. 0017 FIG.3a is a diagram showing where C90RF72ASO 0028. Unless otherwise indicated, the following terms targets mRNA variant 1, GENBANK Accession No. NM have the following meanings: 145005.4 (designated herein as SEQ ID NO: 6) and mRNA (0029 “2'-O-methoxyethyl group” (also 2'-MOE and variant 2, GENBANK Accession No. NM 018325.2 (desig 2'-OCHCH OCH and MOE) refers to an O-methoxy nated herein as SEQID NO: 4). ethyl modification of the 2' position of a furanosyl ring. A 0018 FIG. 4a is a gel depicting expression of C90RF72 2'-O-methoxyethyl modified Sugar is a modified Sugar. mRNA, C3 mRNA, EDNRB mRNA, and Endothelin mRNA 0030) “2'-MOE nucleoside' (also 2'-O-methoxyethyl in treated and untreated cells in control fibroblasts and nucleoside) means a nucleoside comprising a 2'-O-methoxy C90RF72 fibroblasts. ethyl group. 0019 FIG. 4a is a graph showing nuclear retention of 0031 “5-methylcytosine” means a cytosine modified with ADARB2 in human C9CRF72 fibroblasts and control fibro a methyl group attached to the 5' position. A 5-methylcytosine blasts. is a modified nucleobase. 0032 “About” means within +7% of a value. For example, 0020 FIG. 4b is a graph showing nuclear retention of if it is stated, “the compounds affected at least about 70% ADARB2 in human C9CRF72 fibroblasts after ASO treat inhibition of C9CRF72, it is implied that the C90RF72 ment. levels are inhibited within a range of 63% and 77%. 0021 FIG. 5 is a graph showing reduction of foci in ASO 0033 Administered concomitantly” refers to the co-ad treated cells relative to control. ministration of two pharmaceutical agents in any manner in 0022 FIG. 6 is a graph showing percent change in nuclear which the pharmacological effects of both are manifest in the ADARB2 in ASO treated cells relative to control. patient at the same time. Concomitant administration does not 0023 FIG. 7 is a graph showing RNA levels of NEDD4L. require that both pharmaceutical agents be administered in a FAM3C, CHRDL1, SEPP1, and SERPINE2 after ASO treat single pharmaceutical composition, in the same dosage form, ment relative to control. or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the 0024 FIG. 8 is a graph showing RNA levels of ACSBG1, same time. The effects need only be overlapping for a period AURKB, CRH, and IL6ST after ASO treatment relative to of time and need not be coextensive. control. 0034 Administering means providing a pharmaceutical agent to an animal, and includes, but is not limited to admin DETAILED DESCRIPTION istering by a medical professional and self-administering. 0025. It is to be understood that both the foregoing general 0035 “Amelioration” or “ameliorate' or “ameliorating” description and the following detailed description are exem refers to a lessening of at least one indicator, sign, or symptom plary and explanatory only and are not restrictive of the inven of a disease, disorder, or condition. The severity of indicators tion, as claimed. Herein, the use of the singular includes the may be determined by subjective or objective measures, plural unless specifically stated otherwise. As used herein, the which are known to those skilled in the art. use of “or” means “and/or unless stated otherwise. Addition 0036) “Animal' refers to a human or non-human animal, ally, as used herein, the use of “and” means “and/or unless including, but not limited to, mice, rats, rabbits, dogs, cats, stated otherwise. Furthermore, the use of the term “includ pigs, and non-human primates, including, but not limited to, ing as well as other forms, such as “includes” and monkeys and chimpanzees. “included, is not limiting. Also, terms such as “element” or 0037 “Antibody” refers to a molecule characterized by “component' encompass both elements and components reacting specifically with an antigen in some way, where the US 2016/0024496 A1 Jan. 28, 2016

antibody and the antigen are each defined in terms of the expansion. In certain embodiments, the hexanucleotide other. Antibody may refer to a complete antibody molecule or repeat expansion may comprise GGGGCC, GGGGGG, any fragment or region thereof. Such as the heavy chain, the GGGGGC, or GGGGCG repeated at least 30 times. Such light chain, Fab region, and Fc region. diseases may include a neurodegenerative disease. Such neu 0038 Antisense activity” means any detectable or mea rodegenerative diseases may include ALS and FTD. Surable activity attributable to the hybridization of an anti 0047. “C9ORF72 nucleic acid” means any nucleic acid sense compound to its target nucleic acid. In certain embodi encoding C9CRF72. For example, in certain embodiments, a ments, antisense activity is a decrease in the amount or C9ORF72 nucleic acid includes a DNA sequence encoding expression of a target nucleic acid or protein encoded by Such C9ORF72, an RNA sequence transcribed from DNA encod target nucleic acid. ing C9CRF72 (including genomic DNA comprising introns 0039) “Antisense compound' means an oligomeric com and exons), and an mRNA sequence encoding C9CRF72. pound that is capable of undergoing hybridization to a target “C9ORF72 mRNA' means an mRNA encoding a C90RF72 nucleic acid through hydrogen bonding. Examples of anti protein. sense compounds include single-stranded and double 0048 “C9ORF72 specific inhibitor” refers to any agent Stranded compounds, such as, antisense oligonucleotides, capable of specifically inhibiting the expression of C9CRF72 siRNAs, shRNAs, ssRNAs, and occupancy-based com mRNA and/or C90RF72 protein at the molecular level. For pounds. Antisense mechanisms include, without limitation, example, C9CRF72 specific inhibitors include nucleic acids RNase H mediated antisense; RNAi mechanisms, which uti (including antisense compounds), siRNAS, aptamers, anti lize the RISC pathway and include, without limitation, bodies, peptides, Small molecules, and other agents capable siRNA, ssRNA and microRNA mechanisms; and occupancy of inhibiting the expression of C90RF72 mRNA and/or based mechanisms, including, without limitation uniform C9ORF72 protein. Similarly, in certain embodiments, modified oligonucleotides. Certain antisense compounds C9ORF72 specific inhibitors may affect other molecular pro may act through more than one Such mechanisms and/or cesses in an animal. through additional mechanisms. 0049. “Cap structure' or “terminal cap moiety' means 0040 Antisense inhibition” means reduction of target chemical modifications, which have been incorporated at nucleic acid levels or target protein levels in the presence of an either terminus of an antisense compound. antisense compound complementary to a target nucleic acid 0050 “cEt” or “constrained ethyl means a bicyclic compared to target nucleic acid levels or target protein levels nucleoside having a Sugar moiety comprising a bridge con in the absence of the antisense compound Inhibition may by necting the 4'-carbon and the 2-carbon, wherein the bridge any means including RNase H degradation, Such as with a has the formula: 4'-CH(CH)—O-2'. gapmer, and steric blockage? occupancy based mechanisms, 0051 “Constrained ethyl nucleoside' (also cFt nucleo Such as with a uniformly modified oligonucleotide. side) means a nucleoside comprising a bicyclic Sugar moiety 0041 Antisense oligonucleotide' means a single comprising a 4-CH(CH) O-2' bridge. Stranded oligonucleotide having a nucleobase sequence that 0.052 “Chemically distinct region” refers to a region of an permits hybridization to a corresponding segment of a target antisense compound that is in Some way chemically different nucleic acid. than another region of the same antisense compound. For 0042 “Bicyclic sugar means a furanosyl ring modified example, a region having 2'-O-methoxyethyl nucleosides is by the bridging of two atoms. A bicyclic Sugar is a modified chemically distinct from a region having nucleosides without Sugar. 2'-O-methoxyethyl modifications. 0043 “Bicyclic nucleoside' (also BNA) means a nucleo 0053 "Chimeric antisense compound means an anti side having a Sugar moiety comprising a bridge connecting sense compound that has at least two chemically distinct two carbonatoms of the Sugarring, thereby forming a bicyclic regions. ring system. In certain embodiments, the bridge connects the 0054 “Co-administration” means administration of two 4-carbon and the 2-carbon of the Sugar ring. or more pharmaceutical agents to an individual. The two or 0044 “Biomarker” means a measurable substance in a cell more pharmaceutical agents may be in a single pharmaceuti or animal whose presence is indicative of some phenomenon cal composition, or may be in separate pharmaceutical com Such as disease. In certain embodiments, the Substance is the positions. Each of the two or more pharmaceutical agents RNA or protein expression product of a gene. In certain may be administered through the same or different routes of embodiments, the gene is any of ADARB2, CYP2C9, DPH2, administration. Co-administration encompasses parallel or HMGB2, JARID2, MITF, MPP7, NDST1, NUDT6, sequential administration. ORAOV1, PGA5, PTER, RANGAP1, SOX6, TCL1B, 0055 “Complementarity” means the capacity for pairing TRIM32, WBP11, ZNF695, EDN1, NEDD4L, FAM3C, between nucleobases of a first nucleic acid and a second CHRDL1, CP, SEPP1, SERPINE2, and/or any other gene nucleic acid. described herein. In certain embodiments, the disease is a 0056 “Contiguous nucleobases’ means nucleobases C9CRF72 associated disease and/or a C9CRF72 hexanucle immediately adjacent to each other. otide repeat expansion associated disease. 0057. “Diluent’ means an ingredient in a composition that 0045 “C9ORF72 associated disease” means any disease lacks pharmacological activity, but is pharmaceutically nec associated with any C9CRF72 nucleic acid or expression essary or desirable. For example, the diluent in an injected product thereof. Such diseases may include a neurodegenera composition may be a liquid, e.g. saline Solution. tive disease. Such neurodegenerative diseases may include 0.058 “Dose” means a specified quantity of a pharmaceu ALS and FTD. tical agent provided in a single administration, or in a speci 0046 “C9ORF72 hexanucleotide repeat expansion asso fied time period. In certain embodiments, a dose may be ciated disease' means any disease associated with a administered in one, two, or more boluses, tablets, or injec C9ORF72 nucleic acid containing a hexanucleotide repeat tions. For example, in certain embodiments where subcuta US 2016/0024496 A1 Jan. 28, 2016

neous administration is desired, the desired dose requires a 0067 “Identifying an animal having a C9CRF72 associ Volume not easily accommodated by a single injection, there ated disease' means identifying an animal having been diag fore, two or more injections may be used to achieve the nosed with a C9CRF72 associated disease or predisposed to desired dose. In certain embodiments, the pharmaceutical develop a C9CRF72 associated disease. Individuals predis agent is administered by infusion over an extended period of posed to develop a C9CRF72 associated disease include time or continuously. Doses may be stated as the amount of those having one or more risk factors for developing a pharmaceutical agent per hour, day, week, or month. C9ORF72 associated disease, including, having a personal or 0059) “Effective amount’ means the amount of pharma family history or genetic predisposition of one or more ceutical agent Sufficient to effectuate a desired physiological C9ORF72 associated diseases. Such identification may be outcome in an individual in need of the pharmaceutical agent. accomplished by any method including evaluating an indi The effective amount may vary among individuals depending vidual’s medical history and standard clinical tests or assess on the health and physical condition of the individual to be ments, such as genetic testing. treated, the taxonomic group of the individuals to be treated, 0068. “Immediately adjacent’ means there are no inter the formulation of the composition, assessment of the indi vening elements between the immediately adjacent elements. vidual's medical condition, and other relevant factors. 0069. “Individual” means a human or non-human animal 0060 “Expression” means conversion of the information selected for treatment or therapy. from a C9CRF72 gene into mRNA via transcription and then (0070 “Inhibiting C90RF72” means reducing expression to protein via translation. Expression may result in a pheno of C9CRF72 mRNA and/or protein levels in the presence of typic manifestation of the C9CRF72 gene. a C90RF72 specific inhibitor, including a C90RF72 anti 0061 “Fully complementary” or “100% complementary” sense oligonucleotide, as compared to expression of means each nucleobase of a first nucleic acid has a comple C9ORF72 mRNA and/or protein levels in the absence of a mentary nucleobase in a second nucleic acid. In certain C9ORF72 specific inhibitor, such as a C90RF72 antisense embodiments, a first nucleic acid is an antisense compound oligonucleotide. and a target nucleic acid is a second nucleic acid. 0071 "Internucleoside linkage” refers to the chemical 0062 “Gapmer means a chimericantisense compound in bond between nucleosides. which an internal region having a plurality of nucleosides that 0072 "Linked nucleosides' means adjacent nucleosides support RNase H cleavage is positioned between external which are bonded together. regions having one or more nucleosides, wherein the nucleo 0073 "Mismatch' or “non-complementary nucleobase' sides comprising the internal region are chemically distinct refers to the case when a nucleobase of a first nucleic acid is from the nucleoside or nucleosides comprising the external not capable of pairing with the corresponding nucleobase of a regions. The internal region may be referred to as a 'gap' and second or target nucleic acid. the external regions may be referred to as the “wings.” 0074 “Modified internucleoside linkage” refers to a sub 0063 “Gap-narrowed' means a chimeric antisense com stitution or any change from a naturally occurring inter pound having a gap segment of 9 or fewer contiguous 2'-deox nucleoside bond (i.e., a phosphodiester internucleoside yribonucleosides positioned between and immediately adja bond). cent to 5' and 3' wing segments having from 1 to 6 (0075 “Modified nucleobase' refers to any nucleobase nucleosides. other than adenine, cytosine, guanine, thymidine, or uracil. 0064. “Gap-widened” means a chimeric antisense com An “unmodified nucleobase' means the purine bases adenine pound having a gap segment of 12 or more contiguous (A) and guanine (G), and the pyrimidine bases thymine (T), 2'-deoxyribonucleosides positioned between and immedi cytosine (C), and uracil (U). ately adjacent to 5' and 3' wing segments having from 1 to 6 0076 “Modified nucleotide' means a nucleotide having, nucleosides. independently, a modified Sugar moiety, modified inter 0065. “Hexanucleotide repeat expansion' (also GGGGC nucleoside linkage, or modified nucleobase. A “modified C, RNA repeat) means a series of six bases (for example, nucleoside' means a nucleoside having, independently, a GGGGCC, GGGGGG, GGGGCG, or GGGGGC) repeated modified Sugar moiety or modified nucleobase. at least twice. In certain embodiments, the hexanucleotide 0077. “Modified oligonucleotide' means an oligonucle repeat expansion may be located in intron 1 of a C9CRF72 otide comprising a modified internucleoside linkage, a modi nucleic acid. In certain embodiments, a pathogenic hexa fied Sugar, or a modified nucleobase. nucleotide repeat expansion includes at least 30 repeats of 0078 “Modified sugar refers to a substitution or change GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a from a natural Sugar. C9CRF72 nucleic acid and is associated with disease. In (0079. “Motif' means the pattern of chemically distinct certain embodiments, the repeats are consecutive. In certain regions in an antisense compound. embodiments, the repeats are interrupted by 1 or more 0080 “Naturally occurring internucleoside linkage' nucleobases. In certain embodiments, a wild-type hexanucle means a 3' to 5' phosphodiester linkage. otide repeat expansion includes 23 or fewer repeats of I0081. “Natural sugar moiety” means a sugar found in GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a DNA (2'-H) or RNA (2'-OH). C9ORF72 nucleic acid. In certain embodiments, the repeats I0082 “Nucleic acid refers to molecules composed of are consecutive. In certain embodiments, the repeats are inter monomeric nucleotides. A nucleic acid includes ribonucleic rupted by 1 or more nucleobases. acids (RNA), deoxyribonucleic acids (DNA), single-stranded 0066 “Hybridization” means the annealing of comple nucleic acids, double-stranded nucleic acids, Small interfer mentary nucleic acid molecules. In certain embodiments, ing ribonucleic acids (siRNA), and microRNAs (miRNA). complementary nucleic acid molecules include an antisense I0083 "Nucleobase' means a heterocyclic moiety capable compound and a target nucleic acid. of pairing with a base of another nucleic acid. US 2016/0024496 A1 Jan. 28, 2016

0084 “Nucleobase sequence” means the order of contigu ments, a portion is a defined number of contiguous nucleo ous nucleobases independent of any Sugar, linkage, or nucleo bases of a target nucleic acid. In certain embodiments, a base modification. portion is a defined number of contiguous nucleobases of an 0085 "Nucleoside” means a nucleobase linked to a sugar. antisense compound. 0.086 “Nucleoside mimetic” includes those structures (0098 “Prevent” or “preventing refers to delaying or fore used to replace the Sugar or the Sugar and the base and not stalling the onset or development of a disease, disorder, or necessarily the linkage at one or more positions of an oligo condition for a period of time from minutes to indefinitely. meric compound such as for example nucleoside mimetics Prevent also means reducing risk of developing a disease, having morpholino, cyclohexenyl, cyclohexyl, tetrahydropy disorder, or condition. ranyl, bicyclo, or tricyclo Sugar mimetics, e.g., non furanose 0099. “Prodrug” means a therapeutic agent that is pre Sugar units. Nucleotide mimetic includes those structures pared in an inactive form that is converted to an active form used to replace the nucleoside and the linkage at one or more within the body or cells thereof by the action of endogenous positions of an oligomeric compound Such as for example enzymes or other chemicals or conditions. peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(=O)—O— or other non-phosphodiester link 0100 “Side effects’ means physiological responses attrib age). Sugar Surrogate overlaps with the slightly broader term utable to a treatment other than the desired effects. In certain nucleoside mimetic but is intended to indicate replacement of embodiments, side effects include injection site reactions, the Sugar unit (furanose ring) only. The tetrahydropyranyl liver function test abnormalities, renal function abnormali rings provided herein are illustrative of an example of a Sugar ties, liver toxicity, renal toxicity, central nervous system Surrogate wherein the furanose Sugar group has been replaced abnormalities, myopathies, and malaise. with a tetrahydropyranyl ring system. 0101. “Single-stranded oligonucleotide' means an oligo 0087. “Nucleotide' means a nucleoside having a phos nucleotide which is not hybridized to a complementary phate group covalently linked to the Sugar portion of the Strand. nucleoside. 0102 “Specifically hybridizable' refers to an antisense 0088 “Oligomeric compound' or "oligomer means a compound having a Sufficient degree of complementarity polymer of linked monomeric subunits which is capable of between an antisense oligonucleotide and a target nucleic hybridizing to at least a region of a nucleic acid molecule. acid to induce a desired effect, while exhibiting minimal or no 0089 “Oligonucleotide' means a polymer of linked effects on non-target nucleic acids under conditions in which nucleosides each of which can be modified or unmodified, specific binding is desired, i.e., under physiological condi independent one from another. tions in the case of in vivo assays and therapeutic treatments. 0090 "Parenteral administration” means administration 0103 "Targeting or “targeted means the process of through injection or infusion. Parenteral administration design and selection of an antisense compound that will spe includes Subcutaneous administration, intravenous adminis cifically hybridize to a target nucleic acid and induce a desired tration, intramuscular administration, intraarterial adminis effect. tration, intraperitoneal administration, or intracranial admin 0104 “Target nucleic acid.” “target RNA and “target istration, e.g., intrathecal or intracerebroVentricular RNA transcript' all refer to a nucleic acid capable of being administration. targeted by antisense compounds. 0091 “Peptide' means a molecule formed by linking at 0105. “Target segment’ means the sequence of nucle least two amino acids by amide bonds. Peptide refers to otides of a target nucleic acid to which an antisense com polypeptides and proteins. pound is targeted. “5” target site' refers to the 5'-most nucle 0092 “Pharmaceutical agent’ means the substance or sub otide of a target segment. "3" target site' refers to the 3'-most stances in a pharmaceutical composition that provide a thera nucleotide of a target segment. peutic benefit when administered to an individual. For 0106 “Therapeutically effective amount’ means an example, in certain embodiments an antisense oligonucle amount of a pharmaceutical agent that provides a therapeutic otide targeted to C9CRF72 is a pharmaceutical agent. benefit to an individual. 0093. “Pharmaceutical composition” means a mixture of 0107 “Treat' or “treating refers to administering a phar Substances Suitable for administering to an individual. For maceutical composition to effect an alteration or improve example, a pharmaceutical composition may comprise one or ment of a disease, disorder, or condition. more pharmaceutical agents and a sterile aqueous solution. 0.108 "Unmodified nucleotide' means a nucleotide com 0094 "Pharmaceutically acceptable derivative' encom posed of naturally occurring nucleobases, Sugar moieties, and passes pharmaceutically acceptable salts, conjugates, pro internucleoside linkages. In certain embodiments, an drugs or isomers of the compounds described herein. unmodified nucleotide is an RNA nucleotide (i.e. 3-D-ribo 0095 “Pharmaceutically acceptable salts' means physi nucleosides) or a DNA nucleotide (i.e. B-D-deoxyribo ologically and pharmaceutically acceptable salts of antisense nucleoside). compounds, i.e., salts that retain the desired biological activ ity of the parent oligonucleotide and do not impart undesired toxicological effects thereto. Certain Embodiments 0096 “Phosphorothioate linkage” means a linkage 0.109 Provided herein are biomarkers and methods for between nucleosides where the phosphodiester bond is modi monitoring expression of a C9CRF72 nucleic acid and pro fied by replacing one of the non-bridging oxygen atoms with tein in an animal with C9CRF72 specific inhibitors. Such a Sulfur atom. A phosphorothioate linkage (P=S) is a modi C9ORF72 specific inhibitors include antisense compounds. fied internucleoside linkage. Such biomarkers may include any of ADARB2, CYP2C9, 0097. “Portion' means a defined number of contiguous DPH2, HMGB2, JARID2, MITF, MPP7, NDST1, NUDT6, (i.e., linked) nucleobases of a nucleic acid. In certain embodi ORAOV1, PGA5, PTER, RANGAP1, SOX6, TCL1B, US 2016/0024496 A1 Jan. 28, 2016

TRIM32, WBP11, ZNF695, EDN1, NEDD4L, FAM3C, ARL17A, ARL4D, ARMS2, ARNT2, ARRDC3, ARSE, CHRDL1, CP, SEPP1, SERPINE2, and/or any other gene ARVP6125, ATOH8, ATP2A2, AURKA AURKB, BACH1, described herein. BAMBI, BCL3, BDH2, BICC1, BNC2, BRCA2, BRIP1, 0110 Certain embodiments provide methods for decreas BRWD3, BTF3L4, BUB1, BUB1B, C11orf37, C12orfA8, ing C9CRF72 mRNA and protein expression. C12orf64, C13orf18, C14orf149, C15orf42, C1orf191, 0111 Certain embodiments provide methods for the treat C1orf198, C1orf63, C1OB, C1R, C1S, C2Orf63, C3, ment, prevention, or amelioration of diseases, disorders, and C3orf16, C3orf31, C3orf59, C4orf29, C4orf31, C4orfA9, conditions associated with C90RF72 in an individual in need C5orf13, C5orf23, C60rf105, C6orf223, C1orf63, C9, CA12, thereof. Also contemplated are methods for the preparation of CA13, CACHD1, CADPS, CASC5, CASP10, CBWD1, a medicament for the treatment, prevention, or amelioration CCDC144B, CCDC144C, CCDC15, CCIN, CCL28, CCL8, of a disease, disorder, or condition associated with C90RF72. CCNA2, CCNB1, CCNB2, CCNF, CCNL1, CCRL1, CD4, C9CRF72 associated diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, CD68, CDC20, CDC25B, CDC45, CDC6, CDC7, CDCA2, the neurodegenerative disease may be ALS or FTD. In certain CDCA3, CDCA8, CDH6, CDHR4, CDK1, CDK15, CDK2, embodiments, the neurodegenerative disease may be familial CDON, CELF2, CENPA, CENPE, CENPF, CENPI, CENPK, or sporadic. CEP55, CFB, CGB, CGB1, CGB5, CH25H, CHRDL1, CHRNA5, CKAP2L, CKS2, CLDN11, CLEC2A, CLGN, 0112 Certain embodiments provide for the use of a CLIC2, CLIC6, CLSPN, CMKLR1, CNKSR2, CNN1, C9ORF72 specific inhibitor for treating, preventing, or ame CNR2, CNTNAP3, COL8A1, COLEC12, COMP, CP, CPA4, liorating a C9CRF72 associated disease. Certain embodi CPE, CPLX2, CPM, CPXM1, CRABP2, CRISPLD2, CRY1, ments provide for the use of a C9CRF72 specific inhibitor for CTAGE7P, CTNNBIP1, CTSC, CTSL1, CTSS, CXCL14, treating, preventing, or ameliorating a C9CRF72 hexanucle CXCL6, CXCR7, CYB5A, CYBB, CYP1B1, CYP24A1, otide repeat expansion associated disease. In certain embodi CYP26B1, CYP27A1, CYP3A43, CYP7B1, CYTL1, ments, the hexanucleotide repeat expansion may comprise CYYR1, DBF4, DCDC1, DCN, DDIT3, DDIT4, GGGGCC, GGGGGG, GGGGGC, or GGGGCG. In certain DEFB109P1B, DENND1B, DEPDC1, DES, DGCR14, embodiments, C9CRF72 specific inhibitors are nucleic acids DHRS3, DIRC1, DKFZp566F0947, DKFZp667F0711, (including antisense compounds), peptides, antibodies, Small DKK1, DKK3, DLGAP5, DLX2, DMKN, DNA2, DPP4, molecules, and other agents capable of inhibiting the expres DPT, DSEL, DTX3L, DTYMK, E2F8, EDN1, EDNRB, sion of C90RF72 mRNA and/or C90RF72 protein. EFEMP1, EFNA5, ELL2, EMCN, EMP1, ENKUR, ENPEP. 0113 Provided herein are methods comprising adminis ENPP2, ENPP5, EPB41L4A, EPSTI1, ERCC6, ERCC6L, tering a C9CRF72 antisense compound to an animal for treat EREG, ESM1, ETFDH, F10, F2R, F2RL2, F3, FABP3, ing a C9CRF72 associated disease and thereby normalizing FAM101B, FAM11 OB, FAM156A, FAM20A, FAM3C, expression of any of EDN1, NEDD4L, FAM3C, CHRDL1, FAM43A, FAM46C, FAM59A, FAM71A, FAM75C1, CP, SEPP1, and SERPINE2. FAM83D, FBLN1, FCER1G, FCGR2A, FDPSL2A, FER, 0114 Described herein are methods comprising adminis FGD4, FIBIN, FKBP14, F11 10038, FLJ31356, FLJ39095, tering a C9CRF72 antisense compound to an animal for treat FLJ39739, FLJ41170, FLRT3, FMN1, FOLR2, FOLR3, ing a C9CRF72 associated disease and thereby normalizing FOSL2, FOXC2, FOXE1, FOXP2, FRRS1. FTLP10, FUT9, expression of any of C3, EDNRB2, and Endothelin. FYN, GOS2, GABRE, GABRO, GEMC1, GFRA1, GLDN, 0115 Provided herein are methods comprising adminis GLIPR2, GLIS3, GOLGA6B, GPNMB, GPR133, GPR31, tering a C9CRF72 antisense compound to an animal for treat GPR65, GPRC5B, GRB14, GSTT1, GSTT2, GTPBP8, ing a C9CRF72 associated disease and thereby normalizing GTSE1, GUCY1B3, HAS2, HAUS3, HECW2, HELLS, expression of any of EDN1, NEDD4L, FAM3C, CHRDL1, HIST1H1B, HIST1H2AE, HIST1H2AJ, HIST1H2BF, CP, SEPP1, and SERPINE2. HIST1H2BM, HIST1H3B, HIST1H3.J., HIST1H4A, 0116. Described herein are methods comprising adminis HIST1H4C, HIST1H4D, HIST1H4L, HIST2H2BC, tering a C9CRF72 antisense compound to an animal for treat HIST2H3A, HJURP, HMGB2, HMMR, HNRNPK, HOXB2, ing a C9CRF72 associated disease and thereby normalizing HOXD10, HOXD11, HSD17B7P2, HTR1B. HUNK, JARS, expression of any of ABCA6, ACVR2A, ADAMTS5, ICAM1, IDH1, IFI16, IFITM1, IFITM3, IGF1, IGSF10, C11orf87, C3, CCL8, CCNL1, CD44, CELF2, CFB, IL13RA2, IL17RA, IL17RD, IL18R1, IL1R1, IL1RN, CHRDL1, CLU, CP, CXCL6, DCN, DKK3, EDN1, EDNRB, IL20RB, IL4R, IL6ST, IQGAP3, IRS1, ITGA6, ITGA8, EFNA5, ENPP2, F10, F3, FAM3C, FOXP2, FYN, IARS, ITGB3, ITGBL1, JAG1, JAM2, KCNJ2, KCNJ8, KCNK15, IGSF10, IL6ST, LPAR1, MLXIPL, NEDD4L, ORC4, KIAA0509, KIAA0802, KIAA1199, KIAA1324L, PDE10, PPAP2B, PRPS1, REV3L, RSPO3, SCUBE3, KIAA1524, KIF 11, KIF 14, KIF 15, KIF 16B, KIF18B, SEPP1, SERPINE2, SESTD1, SPON1, TBC1D15, KIF20A, KIF2OB, KIF23, KIF2C, KIF4A, KIFC1, KIT, TGFBR3, TNFSF10, TNFSF13B, and WDR52. KRT19, KRT34, KRTAP1-1, KRTAP1-5, KRTAP2-2, 0117 Described herein are methods comprising adminis KRTAP2-4, KRTAP4-11, KRTAP4-12, KRTAP4-5, tering a C9CRF72 antisense compound to an animal for treat KRTAP4-7, LAMA1, LAMA4, LANCL3, LAP3, LAPTM5, ing a C9CRF72 associated disease and thereby normalizing LARP7, LBR, LGI1, LHX5, LHX9, LMCD1, LMNB1, expression of any of ABCA6, ABCA9, ABCB4, ABCC3, LMO4, LOC100.127980, LOC100128001, LOC1001281.07, ABCC9, ABO, ACAN, ACOT13, ACSM2A, ACSS3, LOC100128.191, LOC1001284.02, LOC100129029, ACVR2A, ACVR2B, ADAMDEC1, ADAMTS5, ADH1A, LOC100.130000, LOC100.132167, LOC100132292, ADH1B, ADH1C, ADM, AFF3, AGBL3, AHNAK2, AK4, LOC100132891, LOC100216479, LOC100287877, ALDH1A3, ALDH1 L2, ALMS1P, ALOX5AP, AMOT, LOC100288069, LOC100288560, LOC100505808, AMPH, ANKRD32, ANLN, ANO3, ANO4, AOX1, LOC100505813, LOC100505820, LOC100506165, APCDD1, APLNR, APOBEC3B, APOL6, APOLD1, AR, LOC100506335, LOC100506456, LOC100507128, ARHGAP1 1A, ARHGAP28, ARHGAP29, ARHGEF35, LOC100507163, LOC100507425, LOC116437,

US 2016/0024496 A1 Jan. 28, 2016

istering a C9CRF72 antisense compound; and monitoring the 0146 In certain embodiments, the single-stranded anti level of any of ADARB2, NDST1, MITF, DPH2, NUDT6, sense oligonucleotide comprises at least one modified TCL1B, PGA5, TRIM32, CYP2C9, MPP7, PTER, WBP11, nucleoside comprising a bicyclic Sugar. HMGB2, ORAOV1, RANGAP1, ZNF695, SOX6, JARID2, 0.147. In certain embodiments, the bicyclic sugar com and DAZ2 as a measure of the amount of C90RF72 nucleic prises a 4 to 2 bridge selected from among: 4'-(CH2)n-O-2 acid containing a hexanucleotide repeat expansion is present bridge, wherein n is 1 or 2; and 4'-CH O CH-2'. in a cell. 0.148. In certain embodiments, the bicyclic sugar com 0126. In certain embodiments, the level of any of prises a 4-CH(CH)—O-2' bridge. ADARB2, NDST1, MITF, DPH2, NUDT6, TCL1B, PGA5, 0149. In certain embodiments, the at least one modified TRIM32, CYP2C9, MPP7, PTER, WBP11, HMGB2, nucleoside having a modified Sugar comprises a non-bicyclic ORAOV1, RANGAP1, ZNF695, SOX6, JARID2, and DAZ2 2-modified modified Sugar moiety. increases after administration of an effective amount of a 0150. In certain embodiments, the 2'-modified sugar moi C9ORF72 antisense compound. ety comprises a 2'-O-methoxyethyl group. 0127. In certain embodiments, the level of any of 0151. In certain embodiments, the 2'-modified sugar moi ADARB2, NDST1, MITF, DPH2, NUDT6, TCL1B, PGA5, ety comprises a 2'-O-methyl group. TRIM32, CYP2C9, MPP7, PTER, WBP11, HMGB2, 0152. In certain embodiments, the at least one modified ORAOV1, RANGAP1, ZNF695, SOX6, JARID2, and DAZ2 nucleoside having a modified Sugar comprises a Sugar Surro decreases after administration of an effective amount of a gate. C9ORF72 antisense compound. 0153. In certain embodiments, the sugar surrogate is a 0128. In certain embodiments, the cell is in vitro. morpholino. 0129. In certain embodiments, the cell is in an animal. 0130. In certain embodiments, the animal is a human. 0154 In certain embodiments, Sugar Surrogate is a peptide 0131. In certain embodiments, the antisense compound nucleic acid. comprises a single-stranded antisense oligonucleotide 0.155. In certain embodiments, each nucleoside is modi complementary to a C9CRF72 nucleic acid. fied. (0132. In certain embodiments, the C9CRF72 nucleic acid 0156. In certain embodiments, the single-stranded anti is a human C90RF72 nucleic acid. sense oligonucleotide comprises at least one modified 0133. In certain embodiments, the C9CRF72 associated nucleobase. disease is a C9CRF72 hexanucleotide repeat expansion asso 0157. In certain embodiments, the modified nucleobase is ciated disease. a 5'-methylcytosine. 0134. In certain embodiments, the C9CRF72 associated 0158. In certain embodiments, the single-stranded anti disease is amyotrophic lateral Sclerosis (ALS) or frontotem sense oligonucleotide comprises: poral dementia (FTD). 0159 a gap segment consisting of linked deoxynucleo 0135. In certain embodiments, the C9CRF72 hexanucle sides; otide repeat expansion associated disease is amyotrophic lat 0160 a 5' wing segment consisting of linked nucleosides: eral sclerosis (ALS) or frontotemporal dementia (FTD). 0.161 a 3' wing segment consisting of linked nucleosides; 0136. In certain embodiments, the amyotrophic lateral 0162 wherein the gap segment is positioned immediately sclerosis (ALS) is familial ALS or sporadic ALS. adjacent to and between the 5' wing segment and the 3' wing 0.137 In certain embodiments, the single-stranded anti segment and wherein each nucleoside of each wing segment sense oligonucleotide comprises at least one modification. comprises a modified Sugar. 0.138. In certain embodiments, the single-stranded anti 0163. In certain embodiments, the single-stranded anti sense oligonucleotide is specifically hybridizable to a human sense oligonucleotide comprises: C9CRF72 nucleic acid. 0.164 a gap segment consisting often linked deoxynucleo 0.139. In certain embodiments, the single-stranded anti sides; sense oligonucleotide is at least 75%, at least 80%, at least 0.165 a 5' wing segment consisting of five linked nucleo 85%, at least 90%, or at least 95% complementary to an equal sides; length portion of a human C9CRF72 nucleic acid. 0166 a 3' wing segment consisting of five linked nucleo 0140. In certain embodiments, the single-stranded anti sides; sense oligonucleotide is 100% complementary to an equal 0.167 wherein the gap segment is positioned immediately length portion of a human C9CRF72 nucleic acid. adjacent and between the 5' wing segment and the 3' wing 0141. In certain embodiments, the single-stranded anti segment, wherein each nucleoside of each wing segment sense oligonucleotide comprises at least one modified inter comprises a 2'-O-methoxyethyl Sugar, and wherein each nucleoside linkage. internucleoside linkage is a phosphorothioate linkage. 0142. In certain embodiments, each internucleoside link 0.168. In certain embodiments, the single-stranded anti age of the single-stranded antisense oligonucleotide is a sense oligonucleotide consists of 15 or 16 linked nucleosides. modified internucleoside linkage. 0169. In certain embodiments, the single-stranded anti 0143. In certain embodiments, the modified internucleo sense oligonucleotide consists of 17 linked nucleosides. side linkage is a phosphorothioate internucleoside linkage. 0170 In certain embodiments, the single-stranded anti 0144. In certain embodiments, the single-stranded oligo sense oligonucleotide consists of 18 linked nucleosides. nucleotide comprises at least one modified nucleoside. 0171 In certain embodiments, the single-stranded anti 0145. In certain embodiments, the single-stranded anti sense oligonucleotide consists of 19 linked nucleosides. sense oligonucleotide comprises at least one modified 0172. In certain embodiments, the single-stranded anti nucleoside having a modified Sugar. sense oligonucleotide consists of 20 linked nucleosides. US 2016/0024496 A1 Jan. 28, 2016

0173. In certain embodiments, the single-stranded anti CBWD1, CCDC144B, CCDC144C, CCDC15, CCIN, sense oligonucleotide consists of 21, 22, 23, 24, or 25 linked CCL28, CCL8, CCNA2, CCNB1, CCNB2, CCNF, CCNL1, nucleosides. CCRL1, CD4, CD68, CDC20, CDC25B, CDC45, CDC6, 0.174. In certain embodiments, the administering is CDC7, CDCA2, CDCA3, CDCA8, CDH6, CDHR4, CDK1, parenteral administration. CDK15, CDK2, CDON, CELF2, CENPA, CENPE, CENPF, 0.175. In certain embodiments, the parenteral administra CENPI, CENPK, CEP55, CFB, CGB, CGB1, CGB5, tion is any of injection or infusion. CH25H, CHRDL1, CHRNA5, CKAP2L, CKS2, CLDN11, 0176). In certain embodiments, the parenteral administra CLEC2A, CLGN, CLIC2, CLIC6, CLSPN, CMKLR1, tion is any of intrathecal administration or intracerebroven CNKSR2, CNN1, CNR2, CNTNAP3, COL8A1, COLEC12, tricular administration. COMP, CP, CPA4, CPE, CPLX2, CPM, CPXM1, CRABP2, 0177. In certain embodiments, at least one symptom of a CRISPLD2, CRY1, CTAGE7P, CTNNBIP1, CTSC, CTSL1, C9ORF72 associated disease is ameliorated or prevented. CTSS, CXCL14, CXCL6, CXCR7, CYB5A, CYBB, 0178. In certain embodiments, at least one symptom of a CYP1B1, CYP24A1, CYP26B1, CYP27A1, CYP3A43, C9ORF72 hexanucleotide repeat associated disease is ame CYP7B1, CYTL1, CYYR1, DBF4, DCDC1, DCN, DDIT3, liorated or prevented. DDIT4, DEFB109P1B, DENND1B, DEPDC1, DES, 0179. In certain embodiments, progression of at least one DGCR14, DHRS3, DIRC1, DKFZp566F0947, symptom of a C9CRF72 associated disease is slowed. DKFZp667F0711, DKK1, DKK3, DLGAP5, DLX2, 0180. In certain embodiments, progression of at least one DMKN, DNA2, DPP4, DPT, DSEL, DTX3L, DTYMK, symptom of a C9CRF72 hexanucleotide repeat associated E2F8, EDN1, EDNRB, EFEMP1, EFNA5, ELL2, EMCN, disease is slowed. EMP1, ENKUR, ENPEP ENPP2, ENPP5, EPB41L4A, 0181. In certain embodiments, the at least one symptom is EPSTI1, ERCC6, ERCC6L, EREG, ESM1, ETFDH, F10, any of muscle weakness, fasciculation and cramping of F2R, F2RL2, F3, FABP3, FAM101B, FAM110B, muscles, difficulty in projecting the Voice, shortness of FAM156A, FAM20A, FAM3C, FAM43A, FAM46C, breath, difficulty in breathing and Swallowing, inappropriate FAM59A, FAM71A, FAM75C1, FAM83D, FBLN1, Social behavior, lack of empathy, distractibility, changes in FCER1G, FCGR2A, FDPSL2A, FER, FGD4, FIBIN, food preferences, agitation, blunted emotions, neglect of per FKBP14, FLJ10038, FLJ31356, FLJ39095, FLJ39739, Sonal hygiene, repetitive or compulsive behavior, and FLJ41170, FLRT3, FMN1, FOLR2, FOLR3, FOSL2, decreased energy and motivation. FOXC2, FOXE1, FOXP2, FRRS1, FTLP10, FUT9, FYN, 0182 Described herein are methods comprising adminis GOS2, GABRE, GABRO, GEMC1, GFRA1, GLDN, tering a C9CRF72 antisense compound to a cell or tissue GLIPR2, GLIS3, GOLGA6B, GPNMB, GPR133, GPR31, containing a C9CRF72 hexanucleotide repeat expansion and GPR65, GPRC5B, GRB14, GSTT1, GSTT2, GTPBP8, thereby normalizing expression of any of C3, EDNRB2, and GTSE1, GUCY1B3, HAS2, HAUS3, HECW2, HELLS, Endothelin. HIST1H1B, HIST1H2AE, HIST1H2AJ, HIST1H2BF, 0183. Described herein are methods comprising adminis HIST1H2BM, HIST1H3B, HIST1H3.J., HIST1H4A, tering a C9CRF72 antisense compound to a cell or tissue HIST1H4C, HIST1H4D, HIST1H4L, HIST2H2BC, containing a C9CRF72 hexanucleotide repeat expansion and HIST2H3A, HJURP, HMGB2, HMMR, HNRNPK, HOXB2, thereby normalizing expression of any of ABCA6, ACVR2A, HOXD10, HOXD11, HSD17B7P2, HTR1B. HUNK, IARS, ADAMTS5, C11orf&7, C3, CCL8, CCNL1, CD44, CELF2, ICAM1, IDH1, IFI16, IFITM1, IFITM3, IGF1, IGSF10, CFB, CHRDL1, CLU, CP, CXCL6, DCN, DKK3, EDN1, IL13RA2, IL17RA, IL17RD, IL18R1, IL1R1, IL1RN, EDNRB, EFNA5, ENPP2, F10, F3, FAM3C, FOXP2, FYN, IL20RB, IL4R, IL6ST, IQGAP3, IRS1, ITGA6, ITGA8, IARS, IGSF10, IL6ST, LPAR1, MLXIPL, NEDD4L, ORC4, ITGB3, ITGBL1, JAG1, JAM2, KCNJ2, KCNJ8, KCNK15, PDE10, PPAP2B, PRPS1, REV3L, RSPO3, SCUBE3, KIAA0509, KIAA0802, KIAA1199, KIAA1324L, SEPP1, SERPINE2, SESTD1, SPON1, TBC1D15, KIAA1524, KIF 11, KIF 14, KIF 15, KIF 16B, KIF18B, TGFBR3, TNFSF10, TNFSF13B, and WDR52. KIF20A, KIF2OB, KIF23, KIF2C, KIF4A, KIFC1, KIT, 0184. Described herein are methods comprising adminis KRT19, KRT34, KRTAP1-1, KRTAP1-5, KRTAP2-2, tering a C9CRF72 antisense compound to a cell or tissue KRTAP2-4, KRTAP4-11, KRTAP4-12, KRTAP4-5, containing a C9CRF72 hexanucleotide repeat expansion and KRTAP4-7, LAMA1, LAMA4, LANCL3, LAP3, LAPTM5, thereby normalizing expression of any of ABCA6, ABCA9, LARP7, LBR, LGI1, LHX5, LHX9, LMCD1, LMNB1, ABCB4, ABCC3, ABCC9, ABO, ACAN, ACOT13, LMO4, LOC100.127980, LOC100128001, LOC1001281.07, ACSM2A, ACSS3, ACVR2A, ACVR2B, ADAMDEC1, LOC100128.191, LOC100128402, LOC100129029, ADAMTS5, ADH1A, ADH1B, ADH1C, ADM, AFF3, LOC100.130000, LOC100.132167, LOC100132292, AGBL3, AHNAK2, AK4, ALDH1A3, ALDH1L2, ALMS1P, LOC100132891, LOC100216479, LOC100287877, ALOX5AP, AMOT, AMPH, ANKRD32, ANLN, ANO3, LOC100288069, LOC100288560, LOC100505808, ANO4, AOX1, APCDD1, APLNR, APOBEC3B, APOL6, LOC100505813, LOC100505820, LOC100506165, APOLD1, AR, ARHGAP11A, ARHGAP28, ARHGAP29, LOC100506335, LOC100506456, LOC100507128, ARHGEF35, ARL17A, ARL4D, ARMS2, ARNT2, LOC100507163, LOC100507425, LOC116437, ARRDC3, ARSE, ARVP6125, ATOH8, ATP2A2, AURKA, LOC144438, LOC153910, LOC157503, LOC256374, AURKB, BACH1, BAMBI, BCL3, BDH2, BICC1, BNC2, LOC283868, LOC285944, LOC338667, LOC339822, BRCA2, BRIP1, BRWD3, BTF3L4, BUB1, BUB1B, LOC348120, LOC349408, LOC38.9332, LOC399884, C11orf87, C12orf48, C12Orf64, C13orf18, C14orf149, LOC400684, LOC401022, LOC642006, LOC643551, C15orf42, C1orf191, C1orf198, C1orf63, C1OB, C1R, CIS, LOC646743, LOC646804, LOC727820, LOC728264, C2Orf63, C3, C3orf16, C3orf31, C3orf59, C4orf29, C4orf31, LOC728640, LOC729420, LOC729978, LOH3CR2A, C4orfA9, C5orf13, C5orf23, C60rf105, C60rf223, C1orf63, LOXL4, LPAR1, LRCH2, LRIG3, LRRC37A4, LRRTM1, C9, CA12, CA13, CACHD1, CADPS, CASC5, CASP10, LYPD6B, MAB21L1, MAFB, MAOA, MAPK13, MARS, US 2016/0024496 A1 Jan. 28, 2016 11

MASP1, MASTL, MBD2, MBNL3, MC4R, MCM8, ME2. CYP2C9, DPH2, HMGB2, JARID2, MITF, MPP7, NDST1, MEIS3P1, MEST, METTL8, MEX3A, MFAP4, MFGE8, NUDT6, ORAOV1, PGA5, PTER, RANGAP1, SOX6, MGC16121, MGC24103, MGP, MIA3, MIER1, MIR125A, TCL1B, TRIM32, WBP11, and ZNF695. MIR 138-1, MIR145, MIR199A2, MIRLET7I, MKI67, 0186. In certain embodiments, the cell or tissue is human MLF2, MMD, MME, MMP10, MMP12, MMP27, fibroblast cells. MOBKL1B, MRAP2, MRPL9, MRPS11, MSC, MST4, 0187. In certain embodiments, the cell or tissue is human MSTN, MTMR7, MTSS1L, MTUS2, MYBL2, MYCT1, COrteX. MYOCD, MYPN, MZT2A, NACA2, NAIP, NAMPT, 0188 In certain embodiments, the antisense compound NAP1L3, NBEA, NBPF10, NCAPG, NCAPG2, NCAPH, comprises a single-stranded antisense oligonucleotide NCRNA00182, NCRNA00205, NCRNA00219, complementary to a C9CRF72 nucleic acid. NCRNA00256A, NDC80, NEDD4L, NEK2, NETO2, (0189 In certain embodiments, the C9CRF72 nucleic acid NEU4, NEUROD6, NFIB, NFIL3, NFKBIZ, NGFR, NKX2 is a human C90RF72 nucleic acid. 2, NKX2-6, NNMT, NOC2L, NOG, NOTCH3, NOVA1, 0190. In certain embodiments, the single-stranded anti NOX4, NPTX2, NR2F2, NR4A3, NR5A2, NTN4, NUCKS1, sense oligonucleotide comprises at least one modification. NUF2, NUSAP1, NUTF2, OAS2, OAS3, OBFC2A, OCLM, 0191 In certain embodiments, the single-stranded anti ODZ2, OGFRL1, OLFML2B, OLR1, OR10O1, OR14J1, sense oligonucleotide is specifically hybridizable to a human OR1 J2, OR1O1, OR2A1, OR2A7, OR2A9P, OR2B3, C9CRF72 nucleic acid. OR4D10, OR4L1, OR51A2, OR52W1, OR5AU1, OR5L2, 0.192 In certain embodiments, the single-stranded anti OR6B1, ORC4, OSMR, OSR2, OXTR, P2RX7, PACSIN2, sense oligonucleotide is at least 75%, at least 80%, at least PAPPA, PARP14, PBK, PCDHB13, PCDHB14, PCDHB16, 85%, at least 90%, or at least 95% complementary to an equal PCDHB2, PCDHB3, PCDHB4, PCYT2, PDE 1G, PDE4DIP, length portion of a human C9CRF72 nucleic acid. PDE5A, PDGFA, PDGFD, PDPN, PDZRN3, PEG10, 0193 In certain embodiments, the single-stranded anti PHACTR3, PHF11, PHLDB2, PIM1, PITPNM3, PKD2L1, sense oligonucleotide is 100% complementary to an equal PKDCC, PLA2G4A, PLEKHA3, PLK1, PLK4, PLSCR1, length portion of a human C9CRF72 nucleic acid. PLXNA2, PLXNC1, PM2OD2, PMAIP1, PPAP2B, PPL, 0194 In certain embodiments, the single-stranded anti PPP1R12B, PRAMEF2, PRC1, PRDM1, PRDM15, PRG4, sense oligonucleotide comprises at least one modified inter PRICKLE1, PRICKLE2, PRKAA2, PRKG2, PRPS1, nucleoside linkage. PRUNE2, PRY, PSIP1, psiTPTE22, PTBP2, PTGS1, 0.195. In certain embodiments, each internucleoside link PTPRC, PTPRN, PYGO1, RAB12, RAD51AP1, RASA4, age of the single-stranded antisense oligonucleotide is a RASGRF2, RBMS1, RBMX2, RCVRN, RERGL REV3L, modified internucleoside linkage. RGPD1, RGPD2, RGPD6, RGS4, RHBDF1, RHOJ, RIMS1, 0196. In certain embodiments, the modified internucleo RIPK2, RNASE2, RNF122, RNU2-1, RPL22L1, RPL8, side linkage is a phosphorothioate internucleoside linkage. RPRD1A, RPRM, RPS26P11, RPS6KA6, RPS8, RPSAP52, 0.197 In certain embodiments, the antisense oligonucle RRP15, RSPO3, RUNX1T1, S100A8, S1PR1, SCIN, otides comprises at least one modified nucleoside. SCN2A, SCUBE3, SEPP1, SERPINB3, SERPINB4, SER 0.198. In certain embodiments, the single-stranded anti PINB9, SERPINE2, SERPINF1, SERPING1, SESTD1, sense oligonucleotide comprises at least one modified SFRP1, SFRP4, SGK1, SGOL1, SGOL2, SHCBP1, SHMT1, nucleoside having a modified Sugar. SKA1, SKA3, SKIL, SLC1A3, SLC39A8, SLC40A1, 0199. In certain embodiments, the single-stranded anti SLC43 A3, SLC6A15, SLFN11, SLITRK4, SMAD4, SMC4, sense oligonucleotide comprises at least one modified SNHG1, SNORD32B, SOCS5, SPC24, SPC25, SPDYE8P. nucleoside comprising a bicyclic Sugar. SPON1, SRD5A1P1, SRGAP1, SRGN, SRSF10, SSPN, 0200. In certain embodiments, the bicyclic sugar com SSTR1, SSX5, ST6GALNAC5, ST8SIA2, STC1, STEAP1, prises a 4 to 2 bridge selected from among: 4'-(CH2)n-O-2 STEAP2, STEAP4, STOM, SV2A, SVEP1, SYNPR, bridge, wherein n is 1 or 2; and 4'-CH O CH-2'. TACC2, TAGLN, TAS2R10, TBC1D15, TBC1D2, TBX3, 0201 In certain embodiments, the bicyclic sugar com TEK, TES, TFAP2A, TFPI, TFPI2, TGFBR3, TGOLN2, prises a 4'-CH(CH)—O-2' bridge. THAP2, THEBS2, THRB, THSD7A, TINAGL1, TLE3, 0202. In certain embodiments, the at least one modified TLE4, TLN2, TLR1, TLR4, TLR5, TLR6, TLR7, TM4SF18, nucleoside having a modified Sugar comprises a non-bicyclic TMEM119, TMEM135, TMEM155, TMEM30B, TMEM49, 2-modified modified Sugar moiety. TMEM65, TMTC1, TNC, TNFAIP3, TNFRSF10C, 0203. In certain embodiments, the 2'-modified sugar moi TNFRSF11B, TNFSF10, TNFSF13B, TNIK, TOP2A, ety comprises a 2'-O-methoxyethyl group. TOR1AIP1, TOX, TPI1, TPM2, TPM3, TPX2, TRA2B, 0204. In certain embodiments, the 2'-modified sugar moi TRAF3IP2, TRIM24, TRIM36, TRIM43, TRIM64, TROAP, ety comprises a 2'-O-methyl group. TSIX, TTC22, TTK, UBE2C, UHRF1, UNC5B, USP8, 0205. In certain embodiments, the at least one modified VEGFA, VGLL3, VTI1B, VTRNA1-3, VWA5A, WDR17, nucleoside having a modified Sugar comprises a Sugar Surro WDR52, WEE1, WISP1, WISP2, WNT16, WNT2, WWC1, gate. XAGE3, XPO4, ZC3H11A, ZC3H7B, ZDHHC15, ZFP36, 0206. In certain embodiments, the Sugar Surrogate is a ZFP82, ZMYM2, ZNF135, ZNF 207, ZNF28, ZNF280B, morpholino. ZNF284, ZNF285, ZNF322A, ZNF462, ZNF506, ZNF595, 0207. In certain embodiments, the sugar surrogate is a ZNF678, ZNF714, ZNF717, ZNF737, ZNF808, ZNHIT2, peptide nucleic acid. and ZWINT. 0208. In certain embodiments, each nucleoside is modi 0185. Described herein are methods comprising adminis fied. tering a C9CRF72 antisense compound to a cell or tissue 0209. In certain embodiments, the single-stranded anti containing a C9CRF72 hexanucleotide repeat expansion and sense oligonucleotide comprises at least one modified thereby reducing nuclear retention of any of ADARB2, nucleobase. US 2016/0024496 A1 Jan. 28, 2016

0210. In certain embodiments, the modified nucleobase is compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or a 5'-methylcytosine. 20 linked subunits. In certain embodiments, the antisense 0211. In certain embodiments, the single-stranded anti compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, sense oligonucleotide comprises: a gap segment consisting of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, linked deoxynucleosides; 38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 0212 a 5' wing segment consisting of linked nucleosides; 55, 56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, 0213 a 3' wing segment consisting of linked nucleosides; 72, 73,74, 75, 76, 77, 78,79, or 80 linked subunits in length, 0214 wherein the gap segment is positioned immediately or a range defined by any two of the above values. In some adjacent to and between the 5' wing segment and the 3' wing embodiments the antisense compound is an antisense oligo segment and wherein each nucleoside of each wing segment nucleotide, and the linked Subunits are nucleosides. comprises a modified Sugar. 0230. In certain embodiments antisense oligonucleotides 0215. In certain embodiments, the single-stranded anti targeted to a C9CRF72 nucleic acid may be shortened or sense oligonucleotide comprises: truncated. For example, a single Subunit may be deleted from 0216 a gap segment consisting often linked deoxynucleo the 5' end (5' truncation), or alternatively from the 3' end (3' sides; truncation). A shortened or truncated antisense compound 0217 a 5' wing segment consisting of five linked nucleo targeted to a C9CRF72 nucleic acid may have two subunits sides; deleted from the 5' end, or alternatively may have two sub 0218 a 3' wing segment consisting of five linked nucleo units deleted from the 3' end, of the antisense compound. sides; Alternatively, the deleted nucleosides may be dispersed 0219 wherein the gap segment is positioned immediately throughout the antisense compound, for example, in an anti adjacent and between the 5' wing segment and the 3' wing sense compound having one nucleoside deleted from the 5' segment, wherein each nucleoside of each wing segment end and one nucleoside deleted from the 3' end. comprises a 2'-O-methoxyethyl Sugar; and wherein each 0231 When a single additional subunit is present in a internucleoside linkage is a phosphorothioate linkage. lengthened antisense compound, the additional subunit may 0220. In certain embodiments, the single-stranded anti be located at the 5' or 3' end of the antisense compound. When sense oligonucleotide consists of 15 linked nucleosides. two or more additional subunits are present, the added sub 0221. In certain embodiments, the single-stranded anti units may be adjacent to each other, for example, in an anti sense oligonucleotide consists of 16 linked nucleosides. sense compound having two subunits added to the 5' end (5' 0222. In certain embodiments, the single-stranded anti addition), or alternatively to the 3' end (3' addition), of the sense oligonucleotide consists of 17 linked nucleosides. antisense compound. Alternatively, the added subunits may 0223) In certain embodiments, the single-stranded anti be dispersed throughout the antisense compound, for sense oligonucleotide consists of 18 linked nucleosides. example, in an antisense compound having one subunit added 0224. In certain embodiments, the single-stranded anti to the 5' end and one subunit added to the 3' end. sense oligonucleotide consists of 19 linked nucleosides. 0232. It is possible to increase or decrease the length of an 0225. In certain embodiments, the single-stranded anti antisense compound, Such as an antisense oligonucleotide, sense oligonucleotide consists of 20 linked nucleosides. and/or introduce mismatch bases without eliminating activ 0226. In certain embodiments, wherein the single ity. For example, in Woolfetal. (Proc. Natl. Acad. Sci. USA stranded antisense oligonucleotide consists of 12 to 30 linked 89:7305-7309, 1992), a series of antisense oligonucleotides nucleosides and comprises a nucleobase sequence compris 13-25 nucleobases in length were tested for their ability to ing at least 8, at least 9, at least 10, at least 11, at least 12, at induce cleavage of a target RNA in an oocyte injection model. least 13, at least 14, at least 15, at least 16, at least 17, at least Antisense oligonucleotides 25 nucleobases in length with 8 or 18, at least 19, or at least 20 contiguous nucleobases of SEQ 11 mismatch bases near the ends of the antisense oligonucle ID NO 20-24 or 28-30. otides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucle Antisense Compounds otides that contained no mismatches. Similarly, target spe 0227 Oligomeric compounds include, but are not limited cific cleavage was achieved using 13 nucleobase antisense to, oligonucleotides, oligonucleosides, oligonucleotide ana oligonucleotides, including those with 1 or 3 mismatches. logs, oligonucleotide mimetics, antisense compounds, anti 0233 Gautschi et al (J. Natl. Cancer Inst. 93:463-471, sense oligonucleotides, and siRNAs. An oligomeric com March 2001) demonstrated the ability of an oligonucleotide pound may be “antisense' to a target nucleic acid, meaning having 100% complementarity to the bcl-2 mRNA and hav that is capable of undergoing hybridization to a target nucleic ing 3 mismatches to the bcl-XL mRNA to reduce the expres acid through hydrogen bonding. sion of both bcl-2 and bcl-XL in vitro and in vivo. Further 0228. In certain embodiments, an antisense compound has more, this oligonucleotide demonstrated potent anti-tumor a nucleobase sequence that, when written in the 5' to 3’ direc activity in vivo. tion, comprises the reverse complement of the target segment 0234) Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, of a target nucleic acid to which it is targeted. In certain Such 1988) tested a series of tandem 14 nucleobase antisense oli embodiments, an antisense oligonucleotide has a nucleobase gonucleotides, and a 28 and 42 nucleobase antisense oligo sequence that, when written in the 5' to 3' direction, comprises nucleotides comprised of the sequence of two or three of the the reverse complement of the target segment of a target tandem antisense oligonucleotides, respectively, for their nucleic acid to which it is targeted. ability to arrest translation of human DHFR in a rabbit reticu 0229. In certain embodiments, an antisense compound tar locyte assay. Each of the three 14 nucleobase antisense oli geted to a C9CRF72 nucleic acid is 12 to 30 subunits in gonucleotides alone was able to inhibit translation, albeit at a length. In other words, Suchantisense compounds are from 12 more modest level than the 28 or 42 nucleobase antisense to 30 linked subunits. In certain embodiments, the antisense oligonucleotides. US 2016/0024496 A1 Jan. 28, 2016

Antisense Compound Motifs 0240. In certain embodiments, antisense compounds tar geted to a C9CRF72 nucleic acid possess a 5-10-4 gapmer 0235. In certain embodiments, antisense compounds tar motif. geted to a C9CRF72 nucleic acid have chemically modified 0241. In certain embodiments, antisense compounds tar Subunits arranged in patterns, or motifs, to confer to the geted to a C9CRF72 nucleic acid possess a 4-10-4 gapmer antisense compounds properties such as enhanced inhibitory motif. activity, increased binding affinity for a target nucleic acid, or 0242. In certain embodiments, antisense compounds tar resistance to degradation by in vivo nucleases. geted to a C9CRF72 nucleic acid possess a 4-10-3 gapmer 0236 Chimericantisense compounds typically contain at motif. least one region modified so as to confer increased resistance 0243 In certain embodiments, antisense compounds tar to nuclease degradation, increased cellular uptake, increased geted to a C9CRF72 nucleic acid possess a 5-9-5 gapmer binding affinity for the target nucleic acid, and/or increased motif. inhibitory activity. A second region of a chimeric antisense 0244. In certain embodiments, an antisense compound tar compound may optionally serve as a Substrate for the cellular geted to a C9ORF72 nucleic acid has a gap-narrowed motif. endonuclease RNase H, which cleaves the RNA strand of an In certain embodiments, a gap-narrowed antisense oligo RNA:DNA duplex. nucleotide targeted to a C9CRF72 nucleic acid has a gap 0237 Antisense compounds having a gapmer motif are segment of 9,8,7, or 62'-deoxynucleotides positioned imme considered chimeric antisense compounds. In a gapmer an diately adjacent to and between wing segments of 5, 4.3.2. or internal region having a plurality of nucleotides that Supports 1 chemically modified nucleosides. In certain embodiments, RNaseH cleavage is positioned between external regions hav the chemical modification comprises a bicyclic Sugar. In cer ing a plurality of nucleotides that are chemically distinct from tain embodiments, the bicyclic Sugar comprises a 4" to 2 the nucleosides of the internal region. In the case of an anti bridge selected from among: 4'-(CH2)-0-2'bridge, whereinn sense oligonucleotide having a gapmer motif, the gap seg is 1 or 2; and 4'-CH, O CH-2. In certain embodiments, ment generally serves as the Substrate for endonuclease cleav the bicyclic sugar is comprises a 4'-CH(CH)—O-2 bridge. age, while the wing segments comprise modified nucleosides. In certain embodiments, the chemical modification com In certain embodiments, the regions of a gapmer are differ prises a non-bicyclic 2'-modified Sugar moiety. In certain entiated by the types of Sugar moieties comprising each dis embodiments, the non-bicyclic 2'-modified Sugar moiety tinct region. The types of Sugar moieties that are used to comprises a 2'-O-methylethyl group or a 2'-O-methyl group. differentiate the regions of a gapmer may in some embodi 0245. In certain embodiments, an antisense compound tar ments include B-D-ribonucleosides, B-D-deoxyribonucleo geted to a C9CRF72 nucleic acid is uniformly modified. In sides. 2'-modified nucleosides (such 2'-modified nucleosides certain embodiments, the antisense compound comprises 12, may include 2'-MOE, and 2'-O-CH, among others), and 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides. bicyclic Sugar modified nucleosides (such bicyclic Sugar In certain embodiments, each nucleoside is chemically modi modified nucleosides may include those having a 4'-(CH)n- fied. In certain embodiments, the chemical modification com O-2' bridge, where n=1 or n=2 and 4'-CH, O CH-2). prises a non-bicyclic 2'-modified Sugar moiety. In certain Preferably, each distinct region comprises uniform Sugar embodiments, the 2'-modified Sugar moiety comprises a 2'-O- moieties. The wing-gap-wing motif is frequently described as methoxyethyl group. In certain embodiments, the 2'-modified “X Y-Z’, where “X” represents the length of the 5' wing Sugar moiety comprises a 2'-O-methyl group. In certain region, “Y” represents the length of the gap region, and “Z” embodiments, uniformly modified antisense compound may represents the length of the 3' wing region. As used herein, a target C9CRF72, or any portion thereof, such as a hexanucle gapmer described as "X-Y-Z’ has a configuration such that otide repeat expansion. In certain embodiments, targeting the the gap segment is positioned immediately adjacent to each of hexanucleotide repeat expansion with a uniformly modified the 5' wing segment and the 3' wing segment. Thus, no inter antisense compound reduced the repeat RNA by blocking the vening nucleotides exist between the 5' wing segment andgap interaction with RNA binding proteins. In certain embodi segment, or the gap segment and the 3' wing segment. Any of ments, this results in the toxic RNA being absent from foci the antisense compounds described herein can have a gapmer and being degraded instead. motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Target Nucleic Acids, Target Regions and Nucleotide Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1. Sequences 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 0246 Nucleotide sequences that encode C90RF72 25, 30 or more nucleotides. Thus, gapmers described herein include, without limitation, the following: the complement of include, but are not limited to, for example 5-10-5, 5-10-4, GENBANK Accession No. NM 001256054.1 (incorpo 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, rated herein as SEQID NO: 1), GENBANK Accession No. 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4. NT 008413.18 truncated from nucleobase 27535000 to 0238. In certain embodiments, the antisense compound 27565000 (incorporated herein as SEQ ID NO: 2), GEN has a “wingmer motif, having a wing-gap or gap-wing con BANK Accession No. BQ068108.1 (incorporated herein as figuration, i.e. an X-Y or Y-Z configuration as described SEQID NO:3), GENBANKAccession No. NM 018325.3 above for the gapmer configuration. Thus, wingmer configu (incorporated herein as SEQID NO: 4), GENBANKAcces rations described herein include, but are not limited to, for sion No. DN993.522.1 (incorporated herein as SEQID NO: example 5-10, 8–4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 5), GENBANKAccession No. NM 145005.5 (incorporated 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8. herein as SEQ ID NO: 6), GENBANK Accession No. 0239. In certain embodiments, antisense compounds tar DB079375.1 (incorporated herein as SEQID NO: 7), GEN geted to a C9CRF72 nucleic acid possess a 5-10-5 gapmer BANK Accession No. BU194591.1 (incorporated herein as motif. SEQID NO: 8), Sequence Identifier 4141 014 A (incorpo US 2016/0024496 A1 Jan. 28, 2016

rated herein as SEQ ID NO: 9), and Sequence Identifier antisense compounds within a target region. In certain 4008 73 A (incorporated herein as SEQID NO: 10). embodiments, reductions in C90RF72 mRNA levels are 0247. It is understood that the sequence set forth in each indicative of inhibition of C9CRF72 expression. Reductions SEQID NO in the Examples contained herein is independent in levels of a C9CRF72 protein are also indicative of inhibi of any modification to a Sugar moiety, an internucleoside tion of target mRNA expression. Reduction in the presence of linkage, or a nucleobase. As such, antisense compounds expanded C90RF72 RNA foci are indicative of inhibition of defined by a SEQID NO may comprise, independently, one C9ORF72 expression. Further, phenotypic changes are or more modifications to a Sugar moiety, an internucleoside indicative of inhibition of C9CRF72 expression. For linkage, or a nucleobase. Antisense compounds described by example, improved motor function and respiration may be Isis Number (Isis No) indicate a combination of nucleobase indicative of inhibition of C9CRF72 expression. sequence and motif. 0248. In certain embodiments, a target region is a struc Hybridization turally defined region of the target nucleic acid. For example, 0254. In some embodiments, hybridization occurs a target region may encompass a 3' UTR, a 5' UTR, an exon, between an antisense compound disclosed herein and a an intron, an exon/intronjunction, a coding region, a transla C9CRF72 nucleic acid. The most common mechanism of tion initiation region, translation termination region, or other hybridization involves hydrogen bonding (e.g., Watson defined nucleic acid region. The structurally defined regions Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) for C9CRF72 can be obtained by accession number from between complementary nucleobases of the nucleic acid mol sequence databases such as NCBI and Such information is ecules. incorporated herein by reference. In certain embodiments, a 0255 Hybridization can occur under varying conditions. target region may encompass the sequence from a 5' target Stringent conditions are sequence-dependent and are deter site of one target segment within the target region to a 3" target mined by the nature and composition of the nucleic acid site of another target segment within the same target region. molecules to be hybridized. 0249 Targeting includes determination of at least one tar get segment to which an antisense compound hybridizes, 0256 Methods of determining whether a sequence is spe such that a desired effect occurs. In certain embodiments, the cifically hybridizable to a target nucleic acid are well known desired effect is a reduction in mRNA target nucleic acid in the art. In certain embodiments, the antisense compounds levels. In certain embodiments, the desired effect is reduction provided herein are specifically hybridizable with a of levels of protein encoded by the target nucleic acid or a C9CRF72 nucleic acid. phenotypic change associated with the target nucleic acid. Complementarity 0250) A target region may contain one or more target segments. Multiple target segments within a target region 0257 Anantisense compoundanda target nucleic acid are may be overlapping. Alternatively, they may be non-overlap complementary to each other when a sufficient number of ping. In certain embodiments, target segments within a target nucleobases of the antisense compound can hydrogen bond region are separated by no more than about 300 nucleotides. with the corresponding nucleobases of the target nucleic acid, In certain emodiments, target segments within a target region Such that a desired effect will occur (e.g., antisense inhibition are separated by a number of nucleotides that is, is about, is no of a target nucleic acid, such as a C9CRF72 nucleic acid). more than, is no more than about, 250, 200, 150, 100, 90, 80, 0258 Non-complementary nucleobases between an anti 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic sense compound and a C9CRF72 nucleic acid may be toler acid, or is a range defined by any two of the preceeding values. ated provided that the antisense compound remains able to In certain embodiments, target segments within a target specifically hybridize to a target nucleic acid. Moreover, an region are separated by no more than, or no more than about, antisense compound may hybridize over one or more seg 5 nucleotides on the target nucleic acid. In certain embodi ments of a C9CRF72 nucleic acid such that intervening or ments, target segments are contiguous. Contemplated are tar adjacent segments are not involved in the hybridization event get regions defined by a range having a starting nucleic acid (e.g., a loop structure, mismatch or hairpin structure). that is any of the 5' target sites or 3' target sites listed herein. 0259. In certain embodiments, the antisense compounds 0251 Suitable target segments may be found within a 5' provided herein, or a specified portion thereof, are, or are at UTR, a coding region, a 3' UTR, an intron, an exon, or an least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, exon/intron junction. Target segments containing a start 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% codon or a stop codon are also Suitable target segments. A complementary to a C9CRF72 nucleic acid, a target region, Suitable target segment may specifically exclude a certain target segment, or specified portion thereof. Percent comple structurally defined region Such as the start codon or stop mentarity of an antisense compound with a target nucleic acid codon. can be determined using routine methods. 0252. The determination of suitable target segments may 0260 For example, an antisense compound in which 18 of include a comparison of the sequence of a target nucleic acid 20 nucleobases of the antisense compound are complemen to other sequences throughout the genome. For example, the tary to a target region, and would therefore specifically BLAST algorithm may be used to identify regions of simi hybridize, would represent 90 percent complementarity. In larity amongst different nucleic acids. This comparison can this example, the remaining noncomplementary nucleobases prevent the selection of antisense compound sequences that may be clustered or interspersed with complementary nucleo may hybridize in a non-specific manner to sequences other bases and need not be contiguous to each other or to comple than a selected target nucleic acid (i.e., non-target or off mentary nucleobases. As such, an antisense compound which target sequences). is 18 nucleobases in length having 4 (four) noncomplemen 0253) There may be variation in activity (e.g., as defined tary nucleobases which are flanked by two regions of com by percent reduction of target nucleic acid levels) of the plete complementarity with the target nucleic acid would US 2016/0024496 A1 Jan. 28, 2016 have 77.8% overall complementarity with the target nucleic 0265. The antisense compounds provided herein also acid and would thus fall within the scope of the present include those which are complementary to a portion of a invention. Percent complementarity of an antisense com target nucleic acid. As used herein, "portion” refers to a pound with a region of a target nucleic acid can be determined defined number of contiguous (i.e. linked) nucleobases routinely using BLAST programs (basic local alignment within a region or segment of a target nucleic acid. A "por search tools) and PowerBLAST programs known in the art tion' can also refer to a defined number of contiguous nucleo (Altschulet al., J. Mol. Biol., 1990,215, 403410; Zhang and bases of an antisense compound. In certain embodiments, the Madden, Genome Res., 1997, 7, 649656). Percent homology, antisense compounds, are complementary to at least an 8 sequence identity or complementarity, can be determined by, nucleobase portion of a target segment. In certain embodi for example, the Gap program (Wisconsin Sequence Analysis ments, the antisense compounds are complementary to at Package, Version 8 for Unix, Genetics Computer Group, Uni least a 9 nucleobase portion of a target segment. In certain versity Research Park, Madison Wis.), using default settings, embodiments, the antisense compounds are complementary which uses the algorithm of Smith and Waterman (Adv. Appl. to at least a 10 nucleobase portion of a target segment. In Math., 1981, 2, 482 489). certain embodiments, the antisense compounds, are comple 0261. In certain embodiments, the antisense compounds mentary to at least an 11 nucleobase portion of a target seg provided herein, or specified portions thereof, are fully ment. In certain embodiments, the antisense compounds, are complementary (i.e., 100% complementary) to a target complementary to at least a 12 nucleobase portion of a target nucleic acid, or specified portion thereof. For example, an segment. In certain embodiments, the antisense compounds, antisense compound may be fully complementary to a are complementary to at least a 13 nucleobase portion of a C9ORF72 nucleic acid, or a target region, or a target segment target segment. In certain embodiments, the antisense com or target sequence thereof. As used herein, “fully comple pounds, are complementary to at least a 14 nucleobase por mentary' means each nucleobase of an antisense compound tion of a target segment. In certain embodiments, the anti is capable of precise base pairing with the corresponding sense compounds, are complementary to at least a 15 nucleobases of a target nucleic acid. For example, a 20 nucleobase portion of a target segment. Also contemplated nucleobase antisense compound is fully complementary to a are antisense compounds that are complementary to at least a target sequence that is 400 nucleobases long, so long as there 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase is a corresponding 20 nucleobase portion of the target nucleic portion of a target segment, or a range defined by any two of acid that is fully complementary to the antisense compound. these values. Fully complementary can also be used in reference to a speci fied portion of the first and/or the second nucleic acid. For Identity example, a 20 nucleobase portion of a 30 nucleobase anti sense compound can be “fully complementary’ to a target 0266 The antisense compounds provided herein may also sequence that is 400 nucleobases long. The 20 nucleobase have a defined percent identity to a particular nucleotide portion of the 30 nucleobase oligonucleotide is fully comple sequence, SEQ ID NO, or compound represented by a spe mentary to the target sequence if the target sequence has a cific Isis number, or portion thereof. As used herein, an anti corresponding 20 nucleobase portion wherein each nucleo sense compound is identical to the sequence disclosed herein base is complementary to the 20 nucleobase portion of the if it has the same nucleobase pairing ability. For example, a antisense compound. At the same time, the entire 30 nucleo RNA which contains uracil in place of thymidine in a dis base antisense compound may or may not be fully comple closed DNA sequence would be considered identical to the mentary to the target sequence, depending on whether the DNA sequence since both uracil and thymidine pair with remaining 10 nucleobases of the antisense compound are also adenine. Shortened and lengthened versions of the antisense complementary to the target sequence. compounds described herein as well as compounds having 0262 The location of a non-complementary nucleobase non-identical bases relative to the antisense compounds pro may be at the 5' end or 3' end of the antisense compound. vided herein also are contemplated. The non-identical bases Alternatively, the non-complementary nucleobase or nucleo may be adjacent to each other or dispersed throughout the bases may be at an internal position of the antisense com antisense compound. Percent identity of an antisense com pound. When two or more non-complementary nucleobases pound is calculated according to the number of bases that are present, they may be contiguous (i.e., linked) or non have identical base pairing relative to the sequence to which it contiguous. In one embodiment, a non-complementary is being compared. nucleobase is located in the wing segment of a gapmer anti 0267 In certain embodiments, the antisense compounds, sense oligonucleotide. or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 0263. In certain embodiments, antisense compounds that 95%, 96%, 97%, 98%, 99% or 100% identical to one or more are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleo of the antisense compounds or SEQ ID NOS, or a portion bases in length comprise no more than 4, no more than 3, no thereof, disclosed herein. more than 2, or no more than 1 non-complementary nucleo base(s) relative to a target nucleic acid, such as a C9CRF72 0268. In certain embodiments, a portion of the antisense nucleic acid, or specified portion thereof. compound is compared to an equal length portion of the target 0264. In certain embodiments, antisense compounds that nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no portion is compared to an equal length portion of the target more than 6, no more than 5, no more than 4, no more than 3, nucleic acid. no more than 2, or no more than 1 non-complementary 0269. In certain embodiments, a portion of the antisense nucleobase(s) relative to a target nucleic acid, such as a oligonucleotide is compared to an equal length portion of the C9ORF72 nucleic acid, or specified portion thereof. target nucleic acid. In certain embodiments, an 8, 9, 10, 11, US 2016/0024496 A1 Jan. 28, 2016

12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 Such Sugar modified nucleosides may impart enhanced nucleobase portion is compared to an equal length portion of nuclease stability, increased binding affinity, or some other the target nucleic acid. beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically Modifications modified ribofuranose ring moieties. Examples of chemically 0270. A nucleoside is a base-sugar combination. The modified ribofuranose rings include without limitation, addi nucleobase (also known as base) portion of the nucleoside is tion of Substitutent groups (including 5' and 2 substituent normally a heterocyclic base moiety. Nucleotides are nucleo groups, bridging of non-geminal ring atoms to form bicyclic sides that further include a phosphate group covalently linked nucleic acids (BNA), replacement of the ribosyl ring oxygen to the Sugar portion of the nucleoside. For those nucleosides atom with S. N(R), or C(R)(R) (R, R and R are each that include a pentofuranosyl Sugar, the phosphate group can independently H, C-C alkyl or a protecting group) and be linked to the 2',3' or 5’ hydroxyl moiety of the sugar. combinations thereof. Examples of chemically modified Sug Oligonucleotides are formed through the covalent linkage of ars include 2'-F-5'-methyl substituted nucleoside (see PCT adjacent nucleosides to one another, to form a linear poly International Application WO 2008/101157 Published on meric oligonucleotide. Within the oligonucleotide structure, Aug. 21, 2008 for other disclosed 5',2'-bis substituted nucleo the phosphate groups are commonly referred to as forming sides) or replacement of the ribosyl ring oxygenatom with S the internucleoside linkages of the oligonucleotide. with further substitution at the 2'-position (see published U.S. 0271 Modifications to antisense compounds encompass Patent Application US2005-0130923, published on Jun. 16, Substitutions or changes to internucleoside linkages, Sugar 2005) or alternatively 5'-substitution of a BNA (see PCT moieties, or nucleobases. Modified antisense compounds are International Application WO 2007/134181 Published on often preferred over native forms because of desirable prop Nov. 22, 2007 wherein LNA is substituted with for example a erties such as, for example, enhanced cellular uptake, 5'-methyl or a 5'-vinyl group). enhanced affinity for nucleic acid target, increased stability in 0277 Examples of nucleosides having modified sugar the presence of nucleases, or increased inhibitory activity. moieties include without limitation nucleosides comprising 0272 Chemically modified nucleosides may also be 5'-vinyl, 5'-methyl (R or 5), 4-S, 2'-F, 2'-OCH, employed to increase the binding affinity of a shortened or 2'-OCHCH, 2'-OCHCHF and 2'-O(CH)O CH, sub truncated antisense oligonucleotide for its target nucleic acid. stituent groups. The Substituent at the 2' position can also be Consequently, comparable results can often be obtained with selected from allyl, amino, azido, thio. O-allyl, O—C-Co shorter antisense compounds that have such chemically alkyl, OCF. OCHF, O(CH)SCHO(CH), O N(R) modified nucleosides. (R), O—CH2—C(=O) N(R)(R), and O CH C (=O)—N(R)-(CH2) N(R)(R), where each R. R. Modified Internucleoside Linkages and R is, independently, H or substituted or unsubstituted C-C alkyl. 0273. The naturally occurring internucleoside linkage of 0278. As used herein, “bicyclic nucleosides’ refer to RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense modified nucleosides comprising a bicyclic Sugar moiety. compounds having one or more modified, i.e. non-naturally Examples of bicyclic nucleosides include without limitation occurring, internucleoside linkages are often selected over nucleosides comprising a bridge between the 4' and the 2 antisense compounds having naturally occurring internucleo ribosyl ring atoms. In certain embodiments, antisense com side linkages because of desirable properties such as, for pounds provided herein include one or more bicyclic nucleo example, enhanced cellular uptake, enhanced affinity for tar sides comprising a 4" to 2' bridge. Examples of Such 4" to 2 get nucleic acids, and increased Stability in the presence of bridged bicyclic nucleosides, include but are not limited to nucleases. one of the formulae: 4'-(CH)—O-2 (LNA); 4'-(CH)—S-2: 0274 Oligonucleotides having modified internucleoside 4'-(CH), O-2 (ENA); 4'-CH(CH) O-2' and 4'-CH linkages include internucleoside linkages that retain a phos (CHOCH)—O-2 (and analogs thereof see U.S. Pat. No. phorus atom as well as internucleoside linkages that do not 7,399,845, issued on Jul. 15, 2008): 4'-C(CH)(CH) O-2 have a phosphorus atom. Representative phosphorus contain (and analogs thereof see published International Application ing internucleoside linkages include, but are not limited to, WO/2009/006478, published Jan. 8, 2009): 4'-CH N phosphodiesters, phosphotriesters, methylphosphonates, (OCH)-2' (and analogs thereof see published International phosphoramidate, and phosphorothioates. Methods of prepa Application WO/2008/150729, published Dec. 11, 2008): ration of phosphorous-containing and non-phosphorous-con 4'-CH O N(CH)-2' (see published U.S. Patent Applica taining linkages are well known. tion US2004-0171570, published Sep. 2, 2004); 4'-CH N 0275. In certain embodiments, antisense compounds tar (R)-O-2', wherein R is H. C-C alkyl, or a protecting geted to a C9CRF72 nucleic acid comprise one or more group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); modified internucleoside linkages. In certain embodiments, 4'-CH C(H)(CH)-2' (see Chattopadhyaya et al., J. Org. the modified internucleoside linkages are interspersed Chem., 2009, 74, 118-134); and 4'-CH C (=CH-)-2' throughout the antisense compound. In certain embodiments, (and analogs thereof see published International Application the modified internucleoside linkages are phosphorothioate WO 2008/154401, published on Dec. 8, 2008). linkages. In certain embodiments, each internucleoside link 0279. Further reports related to bicyclic nucleosides can age of an antisense compound is a phosphorothioate inter also be found in published literature (see for example: Singh nucleoside linkage. et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Modified Sugar Moieties Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638: Kumar et al., 0276 Antisense compounds can optionally contain one or Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. more nucleosides wherein the Sugar group has been modified. Org. Chem., 1998, 63, 1.0035-10039; Srivastava et al., J. Am. US 2016/0024496 A1 Jan. 28, 2016

Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr: CH N(R)—O-2) BNA, and (F) methyl(methyleneoxy) Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., (4'-CH(CH)–O-2) BNA, (G) methylene-thio (4'-CH S Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr: Opinion Mol. 2) BNA, (H) methylene-amino (4'-CH N(R)-2') BNA, (I) Ther, 2001, 3, 239-243: U.S. Pat. Nos. 6,268,490; 6,525, 191; methyl carbocyclic (4-CH CH(CH)-2') BNA, and (J) 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; propylenecarbocyclic (4'-(CH)-2') BNA as depicted below. 7,399,845; 7,547,684; and 7,696.345; U.S. Patent Publication No. US2008-0039618: US2009-0012281; U.S. Patent Ser. Nos. 60/989,574: 61/026,995: 61/026,998: 61/056,564: 61/086,231: 61/097,787; and 61/099,844; Published PCT (A) O International applications WO 1994/014226; WO 2004/ OS Bx 106356; WO 2005/021570, WO 2007/134181; WO 2008/ 150729; WO 2008/154401; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical Sugar configurations including for example C-L-ribofuranose and B-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226). 0280. In certain embodiments, bicyclic sugar moieties of (B) BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl Sugar moiety wherein Such bridges inde O Bx pendently comprises 1 or from 2 to 4 linked groups indepen dently selected from —C(R)(R), , —C(R)=C(R)—, —C(R)=N , —C(=O)— —C(=NR)— —C(=S)—, NO O— —Si(R) , —S(=O)—, and —N(R)—: 0281 wherein: 0282 x is 0, 1, or 2: 0283 n is 1, 2, 3, or 4: 0284 each R, and R is, independently, H, a protecting (C) group, hydroxyl, C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Substituted C-C alkenyl, C-C alkynyl, Substituted C-C alkynyl, Cs-Co aryl. Substituted Cs-Co O Bx aryl, heterocycle radical, substituted heterocycle radical, het eroaryl, Substituted heteroaryl, Cs-C, alicyclic radical, Sub stituted Cs-C, alicyclic radical, halogen, OJ, NJJ, S.J., N. NC COOJ, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)-J), or sulfoxyl (S(=O)-J); and 0285 each J and J is, independently, H, C-C alkyl, (D) Substituted C-C alkyl, C-C alkenyl, Substituted C-C2 alkenyl, C-C alkynyl. Substituted C-C alkynyl, Cs-Co aryl, Substituted Cs-Co aryl, acyl (C(=O)—H), Substituted acyl, a heterocycle radical, a Substituted heterocycle radical, C-C aminoalkyl, substituted C-C aminoalkyl or a pro tecting group. 0286. In certain embodiments, the bridge of a bicyclic Sugar moiety is —C(R) (R), , —C(R)(R), O—, C(RR)—N(R)—O— or —C(RR)—O N(R)—. In (E) certain embodiments, the bridge is 4'-CH-2',4'-(CH)-2',4'- (CH)-2',4'-CH O-2',4'-(CH), O-2',4'-CH O N (R)-2' and 4'-CH N(R)—O-2'-wherein each Ris, indepen dently, H, a protecting group or C-C alkyl. 0287. In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the C-L configuration or in the B-D configuration. Previ ously, C-L-methyleneoxy (4'-CH O-2) BNA’s have been (F) incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). 0288. In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) C-L-methyleneoxy (4'- CH-O-2) BNA, (B) B-D-methyleneoxy (4'-CH O-2) BNA, (C) ethyleneoxy (4'-(CH), O-2) BNA, (D) ami nooxy (4'-CH2—O N(R)-2') BNA, (E) oxyamino (4'- US 2016/0024496 A1 Jan. 28, 2016 18

-continued wherein: (G) 0290 Bx is a heterocyclic base moiety;

O 0292 R is C-C alkyl oranamino protecting group; and 0293 T and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus NS group, a phosphorus moiety or a covalent attachment to a Support medium. 0294. In certain embodiments, bicyclic nucleosides are provided having Formula II: (H)

II O Ta -O O Bx

NN V R Zd is, Ti,

wherein: (I) 0295 Bx is a heterocyclic base moiety; 0296 T and T, are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support medium; 0297 Z is C-C alkyl, C-C alkenyl, C-C alkynyl, Substituted C-C alkyl, Substituted C-C alkenyl, Substi CH tuted C-C alkynyl, acyl, substituted acyl, Substituted amide, thiol or substituted thio. 0298. In one embodiment, each of the substituted groups is, independently, mono or poly Substituted with Substituent (J) groups independently selected from halogen, oxo, hydroxyl, OJ, NJ.J. S.J., N, OC(=X).J., and NJC(=X)NJJ wherein each JJ and J is, independently, H. C-C alkyl, or substituted C-C alkyl and X is O or NJ. 0299. In certain embodiments, bicyclic nucleosides are g provided having Formula III: III Ta O wherein Bx is the base moiety and R is independently H, a O Bx protecting group or C-C alkyl. Zi. 0289. In certain embodiments, bicyclic nucleosides are provided having Formula I:

Ti, S.

wherein: 0300 Bx is a heterocyclic base moiety; 0301 T, and T, are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support medium; 0302 Z, is C-C alkyl, C-C alkenyl, C-C alkynyl, Substituted C-C alkyl, Substituted C-C alkenyl, Substi tuted C-C alkynyl or substituted acyl (C(=O)—). US 2016/0024496 A1 Jan. 28, 2016 19

0303. In certain embodiments, bicyclic nucleosides are 3630). BNAS and preparation thereof are also described in provided having Formula IV: WO 98/39352 and WO 99/14226. 0315 Analogs of methyleneoxy (4'-CH2—O-2) BNA and 2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg.

IV Med. Chem. Lett., 1998, 8,2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as Substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2-amino- and 2'-methylamino BNA’s have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has wherein: been previously reported. 0304 Bx is a heterocyclic base moiety; 0316. In certain embodiments, bicyclic nucleosides are 0305 T and T, are each, independently H, a hydroxyl provided having Formula VI: protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support medium; VI (0306 R is C-C alkyl, substituted C-C alkyl, C-C, T-O O Bx alkenyl, Substituted C-C alkenyl, C-C alkynyl or Substi O-Ti, tuted C-C alkynyl: Ci 0307 each q, q, q and q is, independently, H., halogen, 9i C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Substi C tuted C-C alkenyl, C-C alkynyl or substituted C-C alky Ck nyl, C-C alkoxyl. Substituted C-C alkoxyl, acyl, Substi tuted acyl, C-C aminoalkyl or Substituted C-C, aminoalkyl; wherein: 0308. In certain embodiments, bicyclic nucleosides are 0317 Bx is a heterocyclic base moiety; provided having Formula V: 0318 T and T, are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a V Support medium; Ca Cb I0319 each q, q, q and q, is, independently, H, halogen, T-O C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Sub O Bx stituted C-C alkenyl, C-C alkynyl. Substituted C-C2 O-T, alkynyl, C-C, alkoxyl, substituted C-C alkoxyl, OJ, SJ, Ce SOJ SO.J., NJ.J., N, CN, C(=O)CJ, C(=O)NJ.J., C(=O), O C(=O)N.J., N(H)C(=NH)NJ.J., N(H)C Clf O (=O)N.J., or N(H)C(=S)NJ.J.; and 10320 q, and q, or q, and q together are =C(q)(q). wherein: wherein q and q, are each, independently, H, halogen, 0309. Bx is a heterocyclic base moiety: C-C alkyl or Substituted C-C alkyl. 0310 T and T, are each, independently H, a hydroxyl 0321 One carbocyclic bicyclic nucleoside having a 4'- protecting group, a conjugate group, a reactive phosphorus (CH2)-2' bridge and the alkenyl analog bridge group, a phosphorus moiety or a covalent attachment to a 4'-CH=CH-CH-2 have been described (Freier et al., Support medium; Nucleic Acids Research, 1997. 25(22), 4429-4443 and Albaek 0311) q q. q and q are each, independently, hydrogen, et al., J. Org. Chem., 2006, 71,7731-7740). The synthesis and halogen, C-C alkyl, Substituted C-C alkyl, C-C alk preparation of carbocyclic bicyclic nucleosides along with enyl, Substituted C-C alkenyl, C-C alkynyl. Substituted their oligomerization and biochemical studies have also been C-C alkynyl, C-C alkoxy, Substituted C-C alkoxy, described (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), OJ, S.J., SOJ, SO.J., NJ.J., N, CN, C(=O)CJ C(=O) 8362-8379). NJ.J., C(=O).J., O C(=O)NJ.J., N(H)C(=NH)NJ.J., 0322. As used herein, “4'-2' bicyclic nucleoside' or “4” to N(H)C(=O)NJ.J. or N(H)C(=S)NJ.J.; 2' bicyclic nucleoside' refers to a bicyclic nucleoside com 0312 or q and q together are =C(q)(q): prising a furanose ring comprising a bridge connecting two 0313 q and q, are each, independently, H, halogen, carbonatoms of the furanose ring connects the 2 carbonatom C-C alkyl or Substituted C-C alkyl. and the 4' carbon atom of the Sugar ring. 0314. The synthesis and preparation of the methyleneoxy 0323. As used herein, "monocylic nucleosides' refer to (4'-CH2—O-2) BNA monomers adenine, cytosine, guanine, nucleosides comprising modified Sugar moieties that are not 5-methyl-cytosine, thymine and uracil, along with their oli bicyclic Sugar moieties. In certain embodiments, the Sugar gomerization, and nucleic acid recognition properties have moiety, or Sugar moiety analogue, of a nucleoside may be been described (Koshkin et al., Tetrahedron, 1998, 54,3607 modified or Substituted at any position. US 2016/0024496 A1 Jan. 28, 2016 20

0324. As used herein, “2'-modified sugar means a fura T, and T is H, a hydroxyl protecting group, a linked conju nosyl Sugar modified at the 2' position. In certain embodi gate group or a 5' or 3'-terminal group; ments, such modifications include Substituents selected from: 0328 q1, q2, qs, q1, qs, q6 and q.7 are each independently, a halide, including, but not limited to Substituted and unsub H, C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Sub stituted alkoxy, substituted and unsubstituted thioalkyl, sub stituted C-C alkenyl, C-C alkynyl or Substituted C-C, stituted and unsubstituted amino alkyl, Substituted and alkynyl; and each of R and R is selected from hydrogen, unsubstituted alkyl, substituted and unsubstituted allyl, and hydroxyl, halogen, Substituted or unsubstituted alkoxy, substituted and unsubstituted alkynyl. In certain embodi NJJ, S.J., N, OC(—X).J., OC(—X)NJJ, NJC(=X) ments, 2" modifications are selected from Substituents includ NJJ, and CN, wherein X is O.S or NJ and each J.J. and J. ing, but not limited to: O(CH), OCH, O(CH) NH, is, independently, H or C-C alkyl. O(CH), CH, O(CH),F, O(CH)ONH, OCHC(=O)N 0329. In certain embodiments, the modified THP nucleo (H)CH, and O(CH), ONI(CH2)CH, where n and mare sides of Formula VII are provided wherein q1, q2, q, q, qs, q from 1 to about 10. Other 2'-substituent groups can also be and q, are each H. In certain embodiments, at least one of q, selected from: C-C alkyl, Substituted alkyl, alkenyl, alky q, q, q, qs, q and q, is other than H. In certain embodi nyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCHOCN, ments, at least one of q1, q2, qs, q1, qs, q6 and q7 is methyl. In Cl, Br, CN, F, CF, OCF, SOCH, SOCHONO, NO, N, certain embodiments, THP nucleosides of Formula VII are NH, heterocycloalkyl, heterocycloalkaryl, aminoalky provided wherein one of R and R is fluoro. In certain lamino, polyalkylamino, Substituted silyl, an RNA cleaving embodiments, R is fluoro and R is H; R is methoxy and R group, a reporter group, an intercalator, a group for improving is H, and R is H and R is methoxyethoxy. pharmacokinetic properties, or a group for improving the 0330. As used herein, “2'-modified’ or “2'-substituted pharmacodynamic properties of an antisense compound, and refers to a nucleoside comprising a Sugar comprising a Sub other Substituents having similar properties. In certain stituent at the 2' position other than H or OH. 2'-modified embodiments, modified nucleosides comprise a 2-MOE side nucleosides, include, but are not limited to, bicyclic nucleo chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). sides wherein the bridge connecting two carbon atoms of the Such 2-MOE substitution have been described as having Sugar ring connects the 2" carbon and another carbon of the improved binding affinity compared to unmodified nucleo Sugar ring; and nucleosides with non-bridging2' substituents, sides and to other modified nucleosides, such as 2'-O-methyl, Such as allyl, amino, azido, thio, O-allyl, O—C-Co alkyl, O-propyl, and O-aminopropyl. Oligonucleotides having the —OCF, O—(CH)—O—CH, 2'-O(CH)SCH, 2'-MOE substituent also have been shown to be antisense O—(CH), O N(RR), or O CH, C(=O) N(R) inhibitors of gene expression with promising features for in (R), where each R, and R, is, independently, H or substi vivo use (Martin, Helv. Chian. Acta, 1995, 78, 486-504; Alt tuted or unsubstituted C-C alkyl. 2'-modified nucleosides mann et al., Chimia, 1996, 50, 168-176: Altmann et al., Bio may further comprise other modifications, for example at chem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., other positions of the Sugar and/or at the nucleobase. Nucleosides Nucleotides, 1997, 16,917-926). 0331. As used herein, “2'-F refers to a nucleoside com 0325 As used herein, a “modified tetrahydropyran prising a Sugar comprising a fluoro group at the 2' position. nucleoside' or “modified THP nucleoside' means a nucleo 0332. As used herein, “2'-OMe” or “2'-OCH or “2'-O- side having a six-membered tetrahydropyran “Sugar Substi methyl each refers to a nucleoside comprising a Sugar com tuted in for the pentofuranosyl residue in normal nucleosides prising an —OCH group at the 2' position of the Sugar ring. (a sugar surrogate). Modified THP nucleosides include, but 0333. As used herein, “MOE” or “2'-MOE” or “2'- are not limited to, what is referred to in the art as hexitol OCHCHOCH or “2'-O-methoxyethyl each refers to a nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleoside comprising a Sugar comprising a nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., —OCH2CH2OCH group at the 2' position of the Sugar ring. 2002, 10, 841-854), fluoro HNA (F-HNA) or those com 0334. As used herein, “oligonucleotide' refers to a com pounds having Formula VII: pound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide com VII prises one or more ribonucleosides (RNA) and/or deoxyribo nucleosides (DNA). 0335. Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional Substitutions to enhance activity. 0336 Methods for the preparations of modified sugars are well known to those skilled in the art. wherein independently for each of said at least one tetrahy 0337. In nucleotides having modified sugar moieties, the dropyran nucleoside analog of Formula VII: nucleobase moieties (natural, modified or a combination 0326 Bx is a heterocyclic base moiety; thereof) are maintained for hybridization with an appropriate 0327 T, and T are each, independently, an internucleo nucleic acid target. side linking group linking the tetrahydropyran nucleoside 0338. In certain embodiments, antisense compounds com analog to the antisense compound or one of T, and T, is an prise one or more nucleosides having modified Sugar moi internucleoside linking group linking the tetrahydropyran eties. In certain embodiments, the modified Sugar moiety is nucleoside analog to the antisense compound and the other of 2'-MOE. In certain embodiments, the 2'-MOE modified US 2016/0024496 A1 Jan. 28, 2016

nucleosides are arranged in a gapmer motif. In certain well known in the art and include, for example, inverted embodiments, the modified Sugar moiety is a bicyclic nucleo deoxy a basic caps. Further 3' and 5'-stabilizing groups that side having a (4'-CH(CH)—O-2) bridging group. In certain can be used to cap one or both ends of an antisense compound embodiments, the (4'-CH(CH)—O-2) modified nucleosides to impart nuclease stability include those disclosed in WO are arranged throughout the wings of a gapmer motif. 03/004602 published on Jan. 16, 2003. Compositions and Methods for Formulating Pharmaceutical Cell Culture and Antisense Compounds Treatment Compositions 0345 The effects of antisense compounds on the level, 0339 Antisense oligonucleotides may be admixed with activity or expression of C9CRF72 nucleic acids can be tested pharmaceutically acceptable active or inert Substances for the in vitro in a variety of cell types. Cell types used for such preparation of pharmaceutical compositions or formulations. analyses are available from commercial vendors (e.g. Ameri Compositions and methods for the formulation of pharma can Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., ceutical compositions are dependent upon a number of crite Research Triangle Park, NC; Clonetics Corporation, Walk ria, including, but not limited to, route of administration, ersville, Md.) and are cultured according to the vendors extent of disease, or dose to be administered. instructions using commercially available reagents (e.g. 0340 An antisense compound targeted to a C9CRF72 nucleic acid can be utilized in pharmaceutical compositions Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative by combining the antisense compound with a suitable phar cell types include, but are not limited to, HepG2 cells, Hep3B maceutically acceptable diluent or carrier. A pharmaceuti cells, and primary hepatocytes. cally acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be In Vitro Testing of Antisense Oligonucleotides delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceuti 0346. Described herein are methods for treatment of cells cal composition comprising an antisense compound targeted with antisense oligonucleotides, which can be modified to a C9CRF72 nucleic acid and a pharmaceutically accept appropriately for treatment with other antisense compounds. able diluent. In certain embodiments, the pharmaceutically 0347 In general, cells are treated with antisense oligo acceptable diluent is PBS. In certain embodiments, the anti nucleotides when the cells reach approximately 60-80% con sense compound is an antisense oligonucleotide. fluency in culture. 0341 Pharmaceutical compositions comprising antisense 0348 One reagent commonly used to introduce antisense compounds encompass any pharmaceutically acceptable oligonucleotides into cultured cells includes the cationic lipid salts, esters, or salts of Such esters, or any other oligonucle transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, otide which, upon administration to an animal, including a Calif.). Antisense oligonucleotides are mixed with LIPO human, is capable of providing (directly or indirectly) the FECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to biologically active metabolite or residue thereof. Accord achieve the desired final concentration of antisense oligo ingly, for example, the disclosure is also drawn to pharma nucleotide and a LIPOFECTIN concentration that typically ceutically acceptable salts of antisense compounds, prodrugs, ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide. pharmaceutically acceptable salts of such prodrugs, and other 0349 Another reagent used to introduce antisense oligo bioeduivalents. Suitable pharmaceutically acceptable salts nucleotides into cultured cells includes LIPOFECTAMINE include, but are not limited to, Sodium and potassium salts. (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is 0342 A prodrug can include the incorporation of addi mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced tional nucleosides at one or both ends of an antisense com serum medium (Invitrogen, Carlsbad, Calif.) to achieve the pound which are cleaved by endogenous nucleases within the desired concentration of antisense oligonucleotide and a body, to form the active antisense compound. LIPOFECTAMINE concentration that typically ranges 2 to Conjugated Antisense Compounds 12 ug/mL per 100 nM antisense oligonucleotide. 0350 Another technique used to introduce antisense oli 0343 Antisense compounds may be covalently linked to gonucleotides into cultured cells includes electroporation. one or more moieties or conjugates which enhance the activ ity, cellular distribution or cellular uptake of the resulting 0351 Cells are treated with antisense oligonucleotides by antisense oligonucleotides. Typical conjugate groups include routine methods. Cells are typically harvested 16-24 hours cholesterol moieties and lipid moieties. Additional conjugate after antisense oligonucleotide treatment, at which time RNA groups include carbohydrates, phospholipids, biotin, phena or protein levels of target nucleic acids are measured by Zine, folate, phenanthridine, anthraquinone, acridine, fluores methods known in the art and described herein. In general, ceins, rhodamines, coumarins, and dyes. when treatments are performed in multiple replicates, the data 0344 Antisense compounds can also be modified to have are presented as the average of the replicate treatments. one or more stabilizing groups that are generally attached to 0352. The concentration of antisense oligonucleotide used one or both termini of antisense compounds to enhance prop varies from cell line to cell line. Methods to determine the erties such as, for example, nuclease stability. Included in optimal antisense oligonucleotide concentration for aparticu stabilizing groups are cap structures. These terminal modifi lar cell line are well known in the art. Antisense oligonucle cations protect the antisense compound having terminal otides are typically used at concentrations ranging from 1 nM nucleic acid from exonuclease degradation, and can help in to 300 nM when transfected with LIPOFECTAMINE. Anti delivery and/or localization within a cell. The cap can be sense oligonucleotides are used at higher concentrations present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- ranging from 625 to 20,000 nM when transfected using elec cap), or can be present on both termini. Cap structures are troporation. US 2016/0024496 A1 Jan. 28, 2016 22

RNA Isolation ety of ways well known in the art, Such as immunoprecipita tion, Western blot analysis (immunoblotting), enzyme-linked 0353 RNA analysis can be performed on total cellular immunosorbent assay (ELISA), quantitative protein assays, RNA or poly(A)--mRNA. Methods of RNA isolation are well protein activity assays (for example, caspase activity assays), known in the art. RNA is prepared using methods well known immunohistochemistry, immunocytochemistry or fluores in the art, for example, using the TRIZOL Reagent (Invitro cence-activated cell sorting (FACS). Antibodies directed to a gen, Carlsbad, Calif.) according to the manufacturers rec target can be identified and obtained from a variety of sources, ommended protocols. such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional Analysis of Inhibition of Target Levels or Expression monoclonal or polyclonal antibody generation methods well 0354) Inhibition of levels or expression of a C90RF72 known in the art. Antibodies useful for the detection of nucleic acid can be assayed in a variety of ways known in the mouse, rat, monkey, and human C9CRF72 are commercially art. For example, target nucleic acid levels can be quantitated available. by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA In Vivo Testing of Antisense Compounds analysis can be performed on total cellular RNA or poly(A)-- mRNA. Methods of RNA isolation are well known in the art. 0360 Antisense compounds, for example, antisense oli Northern blot analysis is also routine in the art. Quantitative gonucleotides, are tested in animals to assess their ability to real-time PCR can be conveniently accomplished using the inhibit expression of C9CRF72 and produce phenotypic commercially available ABI PRISM 7600, 7700, or 7900 changes, such as, improved motor function and respiration. In Sequence Detection System, available from PE-Applied Bio certain embodiments, motor function is measured by rotarod, systems, Foster City, Calif. and used according to manufac grip strength, pole climb, open field performance, balance turers instructions. beam, hindpaw footprint testing in the animal. In certain embodiments, respiration is measured by whole body plethysmograph, invasive resistance, and compliance mea Quantitative Real-Time PCR Analysis of Target RNA Levels Surements in the animal. Testing may be performed in normal 0355 Quantitation of target RNA levels may be accom animals, or in experimental disease models. For administra plished by quantitative real-time PCR using the ABIPRISM tion to animals, antisense oligonucleotides are formulated in 7600, 7700, or 7900 Sequence Detection System (PE-Ap a pharmaceutically acceptable diluent, Such as phosphate plied Biosystems, Foster City, Calif.) according to manufac buffered saline. Administration includes parenteral routes of turer's instructions. Methods of quantitative real-time PCR administration, Such as intraperitoneal, intravenous, and Sub are well known in the art. cutaneous. Calculation of antisense oligonucleotide dosage 0356. Prior to real-time PCR, the isolated RNA is sub and dosing frequency is within the abilities of those skilled in jected to a reverse transcriptase (RT) reaction, which pro the art, and depends upon factors such as route of adminis duces complementary DNA (cDNA) that is then used as the tration and animal body weight. Following a period of treat substrate for the real-time PCR amplification. The RT and ment with antisense oligonucleotides, RNA is isolated from real-time PCR reactions are performed sequentially in the CNS tissue or CSF and changes in C90RF72 nucleic acid same sample well. RT and real-time PCR reagents are expression are measured. obtained from Invitrogen (Carlsbad, Calif.). RT real-time PCR reactions are carried out by methods well known to those Targeting C90RF72 skilled in the art. 0361 Antisense oligonucleotides described herein may 0357 Gene (or RNA) target quantities obtained by real hybridize to a C9CRF72 nucleic acid in any stage of RNA time PCR are normalized using either the expression level of processing. For example, described herein are antisense oli a gene whose expression is constant, Such as cyclophilin A, or gonucleotides that are complementary to a pre-mRNA or a by quantifying total RNA using RIBOGREEN (Invitrogen, mature mRNA. Additionally, antisense oligonucleotides Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified described herein may hybridize to any element of a C9CRF72 by real time PCR, by being run simultaneously with the nucleic acid. For example, described herein are antisense target, multiplexing, or separately. Total RNA is quantified oligonucleotides that are complementary to an exon, an using RIBOGREEN RNA quantification reagent (Invetro intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucle gen, Inc. Eugene, Oreg.). Methods of RNA quantification by otide repeat expansion, a splice junction, an exon: exon splice RIBOGREEN are taught in Jones, L. J., et al. (Analytical junction, an exonic splicing silencer (ESS), an exonic splicing Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 enhancer (ESE), exon 1a, exon lb., exon lic, exon ld, exon le. instrument (PE Applied Biosystems) is used to measure exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon RIBOGREEN fluorescence. 9, exon 10, exon 11, intron 1, intron 2, intron3, intron 4, intron 0358 Probes and primers are designed to hybridize to a 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C9ORF72 nucleic acid. Methods for designing real-time C9CRF72 nucleic acid. PCR probes and primers are well known in the art, and may include the use of Software such as PRIMER EXPRESS 0362. In certain embodiments, antisense oligonucleotides Software (Applied Biosystems, Foster City, Calif.). described herein hybridize to all variants of C90RF72. In certain embodiments, the antisense oligonucleotides Analysis of Protein Levels described herein selectively hybridize to certain variants of C9ORF72. In certain embodiments, the antisense oligonucle 0359 Antisense inhibition of C9CRF72 nucleic acids can otides described herein selectively hybridize to variants of be assessed by measuring C9CRF72 protein levels. Protein C9ORF72 containing a hexanucleotide repeat expansion. In levels of C9CRF72 can be evaluated or quantitated in a vari certain embodiments, such variants of C9CRF72 containing a US 2016/0024496 A1 Jan. 28, 2016

hexanucleotide repeat expansion include SEQ ID NO: 1-3 C9COFF72 Features and 6-10. In certain embodiments, such hexanucleotide repeat expansion comprises at least 30 repeats of any of 0365 Antisense oligonucleotides described herein may GGGGCC, GGGGGG, GGGGGC, or GGGGCG. hybridize to any C9CRF72 variant at any state of processing within any element of the C9CRF72 gene. For example, 0363. In certain embodiments, the antisense oligonucle antisense oligonucleotides described herein may hybridize to otides described herein inhibit expression of all variants of an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a C9ORF72. In certain embodiments, the antisense oligonucle hexanucleotide repeat expansion, a splice junction, an exon: otides described herein inhibit expression of all variants of C9ORF72 equally. In certain embodiments, the antisense exon splice junction, an exonic splicing silencer (ESS), an oligonucleotides described herein preferentially inhibit exonic splicing enhancer (ESE), exon 1a, exon lb, exon lic, expression of certain variants of C9CRF72. In certain exon ld, exon 1e, exon 2, exon3, exon 4, exon 5, exon 6, exon embodiments, the antisense oligonucleotides described 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron herein preferentially inhibit expression of variants of 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or C9ORF72 containing a hexanucleotide repeat expansion. In intron 10. For example, antisense oligonucleotides may target certain embodiments, such variants of C9CRF72 containing a any of the exons characterized below in Tables 1-5 for the hexanucleotide repeat expansion include SEQ ID NO: 1-3 various C9CRF72 variants described below. Antisense oligo and 6-10. In certain embodiments, such hexanucleotide nucleotides described herein may also target variants not repeat expansion comprises at least 30 repeats of any of characterized below and Such variants are characterized in GGGGCC, GGGGGG, GGGGGC, or GGGGCG. In certain GENBANK. Moreover, antisense oligonucleotides described embodiments, the hexanucleotide repeat expansion forms herein may also target elements other than exons and Such nuclear foci. In certain embodiments, antisense oligonucle elements are characterized in GENBANK. otides described herein are useful for reducing nuclear foci. Nuclear foci may be reduced in terms of percent of cells with TABLE 1 foci as well as number of foci per cell. In certain embodi Functional Segments for NM 001256054.1 (SEQID NO: 1) ments, the hexanucleotide repeat expansion causes various expression of various genes to be misregulated. In certain Start site Stop site embodiments, antisense oligonucleotides described herein in in are useful for normalizing expression of various misregulated mRNA mRNA reference reference genes. In certain embodiments, the hexanucleotide repeat Exon Start stop to SEQ to SEQ expansion causes nuclear retention of various proteins. In Number site site ID NO: 2 ID NO: 2 certain embodiments, the antisense oligonucleotides exon 1C 1 158 1137 1294 described herein are useful for reducing nuclear retention of exon 2 159 646 7839 8326 various proteins. exon 3 647 706 9413 9472 exon 4 707 802 12527 12622 0364 Based on earlier studies directed to repeat expan exon 5 803 867 13354 13418 sions, it is not possible to predict if antisense oligonucleotides exon 6 868 940 14704 14776 targeting C9CRF72 outside of the hexanucleotide repeat exon 7 941 1057 16396 16512 expansion would successfully inhibit expression of exon 8 1058 1293 182O7 18442 C9ORF72 for two reasons. First, the C9CRF72 repeat expan exon 9 1294 1351 24296 24353 sion is located in an intron and it is not known if the RNA in exon 10 1352 1461 26337 26446 the foci contains only the repeats or also the flanking intronic exon 11 1462 3339 26581 28458 sequence. For example, an earlier study on myotonic dystro phy type 2 (DM2), which is a disease caused by a CCTG expansion mutation in intron 1 of the ZNF9 gene, determined that large DM2 expansions did not prevent allele-specific TABLE 2 pre-mRNA splicing, nuclear export of the transcripts, or Functional Segments for NM 018325.3 (SEQ ID NO. 4 steady-state mRNA or protein levels. The study further dem onstrated that the ribonuclear inclusions found associated Start site Stop site in in with the disease are enriched for the CCUG expansion, but mRNA mRNA reference reference not the flanking intronic sequences. These data Suggest that Exon Start stop to SEQ to SEQ the downstream molecular effects of the DM2 mutation may Number site site ID NO: 2 ID NO: 2 be triggered by the accumulation of CCUG repeat tract alone. exon 1B 1 63 1510 1572 Therefore, this study implies that targeting the CCUG repeat exon 2 64 551 7839 8326 exon 3 552 611 9413 9472 expansion alone would lead to amelioration of the disease, exon 4 612 707 12527 12622 since targeting the flanking sequences, especially the region exon 5 708 772 13354 13418 downstream of the repeat expansion, would not affect the exon 6 773 845 14704 14776 formation of ribonuclear inclusions (Margolis et al. Hum. exon 7 846 962 16396 16512 exon 8 963 1198 182O7 18442 Mol. Genet., 2006, 15:1808-1815). Second, it is not known exon 9 11.99 12S6 24296 24353 how fast intron 1 of C9CRF72, which contains the repeats, is exon 10 1257 1366 26337 26446 excised and accumulates in foci. Thus, it is not possible to exon 11 1367 3244 26581 28458 predictiftargeting the pre-mRNA would result in elimination of the repeat RNA and foci. US 2016/0024496 A1 Jan. 28, 2016 24

TABLE 3 a C9CRF72 nucleic acid is accompanied by monitoring of C9CRF72 levels in an individual, to determine an individu Functional Segments for NM 145005.5 (SEQ ID NO: 6 als response to administration of the antisense compound. Start site Stop site An individual’s response to administration of the antisense in in compound may be used by a physician to determine the mRNA mRNA reference reference amount and duration of therapeutic intervention. Start stop to SEQ to SEQ 0368. In certain embodiments, administration of an anti Exon Number site site ID NO: 2 ID NO: 2 sense compound targeted to a C9CRF72 nucleic acid results exon 1A 1 8O 1137 1216 in reduction of C90RF72 expression by at least 15, 20, 25.30, exon 2 81 568 7839 8326 exon 3 569 628 9413 9472 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85,90, 95 or 99%, or a exon 4 629 724 12527 12622 range defined by any two of these values. In certain embodi exon 5B (exon 5 into 725 1871 13354 14SOO ments, administration of an antisense compound targeted to a intron 5) C9ORF72 nucleic acid results in improved motor function and respiration in an animal. In certain embodiments, admin istration of a C9CRF72 antisense compound improves motor TABLE 4 function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55,60, 65,70, 75,80, 85,90, 95 or 99%, or a range defined Functional Segments for DB07.9375.1 (SEQ ID NO: 7 by any two of these values. Start site Stop site 0369. In certain embodiments, pharmaceutical composi in in tions comprising an antisense compound targeted to mRNA mRNA reference reference C9ORF72 are used for the preparation of a medicament for Start stop to SEQ to SEQ treating a patient Suffering or Susceptible to a neurodegenera Exon Number site site ID NO: 2 ID NO: 2 tive disease including ALS and FTD. exon 1E 1 35 1135 1169 exon 2 36 524 7839 8326 Certain Combination Therapies exon 3 (EST ends before end 525 S62 9413 9450 of full exon) 0370. In certain embodiments, one or more pharmaceuti cal compositions described herein are co-administered with one or more other pharmaceutical agents. In certain embodi TABLE 5 ments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as Functional Segments for BU194591.1 (SEQ ID NO: 8 the one or more pharmaceutical compositions described Start site Stop site herein. In certain embodiments, such one or more other phar in in maceutical agents are designed to treat a different disease, mRNA mRNA reference reference disorder, or condition as the one or more pharmaceutical Start stop to SEQ to SEQ compositions described herein. In certain embodiments. Such Exon Number site site ID NO: 2 ID NO: 2 one or more other pharmaceutical agents are designed to treat exon 1D 1 36 1241 1279 an undesired side effect of one or more pharmaceutical com exon 2 37 524 7839 8326 positions described herein. In certain embodiments, one or exon 3 525 S84 9413 9472 exon 4 585 68O 12527 12622 more pharmaceutical compositions described herein are co exon 5B (exon 5 into 681 798 13354 1346S administered with another pharmaceutical agent to treat an intron 5) undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions described herein are co-administered with another pharma ceutical agent to produce a combinational effect. In certain Certain Indications embodiments, one or more pharmaceutical compositions 0366. In certain embodiments, provided herein are meth described herein are co-administered with another pharma ods of treating an individual comprising administering one or ceutical agent to produce a synergistic effect. more pharmaceutical compositions described herein. In cer 0371. In certain embodiments, one or more pharmaceuti tain embodiments, the individual has a neurodegenerative cal compositions described herein and one or more other disease. In certain embodiments, the individual is at risk for pharmaceutical agents are administered at the same time. In developing a neurodegenerative disease, including, but not certain embodiments, one or more pharmaceutical composi limited to, ALS or FTD. In certain embodiments, the indi tions described herein and one or more other pharmaceutical vidual has been identified as having a C9CRF72 associated agents are administered at different times. In certain embodi disease. In certain embodiments, the individual has been ments, one or more pharmaceutical compositions described identified as having a C9CRF72 hexanucleotide repeat herein and one or more other pharmaceutical agents are pre expansion associated disease. In certain embodiments, pro pared together in a single formulation. In certain embodi vided herein are methods for prophylactically reducing ments, one or more pharmaceutical compositions described C9ORF72 expression in an individual. Certain embodiments herein and one or more other pharmaceutical agents are pre include treating an individual in need thereof by administer pared separately. ing to an individual a therapeutically effective amount of an 0372. In certain embodiments, pharmaceutical agents that antisense compound targeted to a C9CRF72 nucleic acid. may be co-administered with a pharmaceutical composition 0367. In one embodiment, administration of a therapeuti described herein include Riluzole (Rilutek), Lioresal (Liore cally effective amount of an antisense compound targeted to sal), and Dexpramipexole. US 2016/0024496 A1 Jan. 28, 2016 25

0373) In certain embodiments, pharmaceutical agents that accordance with certain embodiments, the following may be co-administered with a C9CRF72 specific inhibitor examples serve only to illustrate the compounds described described herein include, but are not limited to, an additional herein and are not intended to limit the same. Each of the C9CRF72 inhibitor. In certain embodiments, the co-admin references recited in the present application is incorporated Stered pharmaceutical agent is administered prior to admin herein by reference in its entirety. istration of a pharmaceutical composition described herein. In certain embodiments, the co-administered pharmaceutical agent is administered following administration of a pharma Example 1 ceutical composition described herein. In certain embodi ments the co-administered pharmaceutical agent is adminis Effect of Antisense Inhibition of Human C9CRF72 tered at the same time as a pharmaceutical composition in Human Primary Fibroblasts described herein. In certain embodiments the dose of a co administered pharmaceutical agent is the same as the dose 0376 Antisense oligonucleotides were designed targeting that would be administered if the co-administered pharma ceutical agent was administered alone. In certain embodi various regions of the C9CRF72 gene (the complement of ments the dose of a co-administered pharmaceutical agent is GENBANK Accession No. NT 008413.18 truncated from lower than the dose that would be administered if the co nucleotides 27535000 to 27565000, designated herein as administered pharmaceutical agent was administered alone. SEQ ID NO: 2). The target start site, target region, and In certain embodiments the dose of a co-administered phar description of each antisense oligonucleotide are specified in maceutical agentis greater than the dose that would be admin Table 6 below. The italicized and underlined nucleosides istered if the co-administered pharmaceutical agent was denote 2'-O-methyl RNA bases; the bolded nucleosides indi administered alone. cate a DNA phosphorothioate backbone. As observed from 0374. In certain embodiments, the co-administration of a the Table, several of the antisense oligonucleotides target second compound enhances the effect of a first compound, intron 1 and, therefore, target the pre-mRNA sequence of Such that co-administration of the compounds results in an C9CRF72. Intron 1 of C9CRF72 contains the hexanucleotide effect that is greater than the effect of administering the first repeat. compound alone. In other embodiments, the co-administra tion results in effects that are additive of the effects of the 0377 Additional antisense oligonucleotides were compounds when administered alone. In certain embodi designed targeting various regions of the C9CRF72 gene. The ments, the co-administration results in effects that are Supra antisense oligonucleotides in Table 7 were designed as 5-10-5 additive of the effects of the compounds when administered MOE gapmers. The gapmers are 20 nucleosides in length, alone. In certain embodiments, the first compound is an anti wherein the central gap segment comprises ten 2'-deoxy sense compound. In certain embodiments, the second com nucleosides and is flanked by wing segments on both the 5' pound is an antisense compound. end and on the 3' end comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the EXAMPLES 3' wing segment has a MOE modification. The internucleo Non-Limiting Disclosure and Incorporation by side linkages throughout each gapmer are phosphorothioate Reference linkages. All cytosine residues throughout each gapmer are 0375 While certain compounds, compositions, and meth 5-methylcytosines. Each antisense oligonucleotide listed in ods described herein have been described with specificity in Table 7 is targeted to the SEQID NO: 2. TABLE 6 Antisense oligonucleotides targeting SEQ ID NO: 2 Target Start Target Stop SEQ Sequence ID Site Site Target Region ID NO

CCCAUTCCAGTTTCCAUCA 8179 8197 Exon 2 2O

GCGGCUTGTTTCCCTCCUUGU 1398 1417 Intron 1 W1 RNA 21

GCCCCGGCCCCTAGCGCGCG 1448 1467 Intron 1 & Repeat 22

CCCGACCACGCCCCGGCCCC 1469 1488 Intron 1 & Repeat 23

AGCCACCTTCTCCAACCUG 325 O 3268 Intron 1 24

TABLE F Antisense oligonucleotides targeting SEQ ID NO: 2 Target Start Target Stop SEQ Sequence ISIS No Site Site Target Region ID NO

GCCTTACTCTAGGACCAAGA 577816 799 O 8009 Exon 2 28

GGTAACTTCAAACTCTTGGG 577 OS3 34.52 34.71 Intron 1 29

TACAGGCTGCGGTTGTTTCC 77O61 14 O6 1425 Intron 1 3 O US 2016/0024496 A1 Jan. 28, 2016 26

0378. The antisense oligonucleotides were tested in the C9CRF72 fibroblasts when compared to the ALS mutant human primary fibroblasts. Human primary fibroblasts were SOD1 fibroblasts. The gene expression profile of the plated at 20,000 cells/well and transfected using Cytofectin C9ORF72 fibroblasts was compared with healthy control reagent with 100 nM of antisense oligonucleotide. After an fibroblasts. incubation period of 3 days, C90RF72 total mRNA levels 0384. To confirm that the data from C9CRF72 fibroblasts were measured by RT-qPCR (FIG. 1b). The figure presents simulated events in vivo, postmortem brain tissue was the total mRNA levels of C9CRF72. GAPDH mRNA levels obtained from C9CRF72 ALS patients and analyzed. The are also presented to show equal RNA loading of the gel. The dysregulated genes discovered in the human fibroblast analy data indicates that treatment with ASOs 1, 4, and 5 produce ses were similarly altered in the cerebellar tissue of ALS the strongest knockdown of C9CRF72 total mRNA. Table 8 C9ORF72 patients. The expression of one of the genes, also presents the results of treatment of the cells with ISIS ENPP2, which was observed to be upregulated in C90RF72 577816, ISIS 577083, and ISIS 577061. fibroblasts, was similarly upregulated in human cerebellar 0379 FIG. 1a also presents the targeting regions of ASOs tissue. The expression of another gene, RSPO3, which was 1-5 with respect to the C90RF72 mRNA variant 1, GEN not significantly altered in the C9CRF72 fibroblasts, was not BANK Accession No. NM 145005.4 (designated herein as altered in human cerebellar tissue either. The results are pre SEQID NO: 6) and mRNA variant 2, GENBANKAccession sented in FIG.2b. Table 9 provides a comprehensive listing of No. NM 018325.2 (designated herein as SEQ ID NO: 4). all aberrantly expressed genes that are either upregulated or The percent expression levels of the total mature mRNA downregulated in C9CRF72 fibroblasts as well as the motor levels of each variant (V1 and V2), as well as the expression cortex from ALS patient brain tissue, compared to healthy levels of the pre-mRNA levels of each variant is presented in controls. The data suggests that the C9CRF72 cell lines may Table 8. The individual RNA levels were measured with the NanoString nGounterTM gene expression system (NanoS be a suitable surrogate to define human CNS relevant biom tring R Technologies). arkers and to monitor response to ASOtherapy. TABLE 9 TABLE 8 Dysregulated Genes % expression of C9CRF72 mRNA variants 1 and 2 after ASO treatment Fibroblasts Human Motor Cortex % W1 96 V2 % W1 96 V2 ID # mRNA mRNA pre-mRNA pre-mRNA ABCA6 ABO ABCB4 ACOT13 1 -30 -25 -20 -30 ABCC3 ACSM2A 2 66 174 -47 -10 ABCC9 ACSM2A 3 124 142 -35 -42 ACAN ACVR2B 4 35 -46 -28 -25 ACSS3 AGBL3 5 -49 -23 -6 -15 ADAMTSS ALMS1P 577816 -68 -83 -17 -15 ADAMTSS ALOXSAP 577083 -SS -20 -15 -10 ADM ANKRD32 577061 30 -11 60 -12 AHNAK2 APOLD1 AK4 ARL17A ALDH1A3 ARL4D AMOT ARMS2 Example 2 AMPH ARSE ANLN ARVP612S ANO3 ATOH8 Effect of Antisense Inhibition of Human C9CRF72 ANO4 BACH1 on Aberrant Gene Expression in ALS/FTD Patient APCDD1 BDH2 Fibroblast APLNR BRWD3 APOBEC3B BTF3L4 0380. To examine the effects of C9CRF72 mutation on APOL6 C12Orf64 AR C1QB gene expression and potential splicing events, several ALS/ AR C1orf191 FTD-derived fibroblast cell lines were propagated and gene ARHGAP11A C2Orf63 array analyses were performed. ARHGAP11A C3orf16 0381 Gene array analyses were performed using Human ARHGAP28 C3orf59 ARHGAP29 C4orf29 Exon 1.0 ST array (Affymetrix). Induced pluripotent cell ARHGAP29 C6orf105 lines (iPSC) line 34, iPSC#850 (expansion copy number ARHGEF35 C6orf223 916); line 50 iPSC#816 (copy number 1,150); and line 75, ARL17A C9 ARNT2 CASP10 iPSC#1280 (copy number 950) were used. ARRDC3 CBWD1 0382 C9orf75 line 50 was compared with cell line 75. ATP2A2 CD68 Patient-derived cell lines showed a very similar gene expres AURKA CDHR4 sionprofile (R-0.991), eventhough the patients, from whom AURKB CH2SH BAMBI CNR2 the fibroblasts were derived, were not related to each other. BCL3 CNTNAP3 Hence, the data suggests that different patient-derived fibro BICC1 CNTNAP3 blasts exhibit a similar transcriptome, Supporting a BNC2 CPLX2 C9ORF72-specific ASOtherapeutic intervention approach. BNC2 CRY1 BNC2 CTAGE7P 0383. The gene expression profile of the C90RF72 fibro BRCA2 CTNNBIP1 blasts was compared with fibroblasts obtained from ALS BRIP1 CTSC patients carrying a different familial gene mutation for SOD1 BUB1 CTSS (SOD1'). There was very little overlap of altered genes in

US 2016/0024496 A1 Jan. 28, 2016 30

TABLE 9-continued TABLE 9-continued

Dysregulated Genes Dysregulated Genes Fibroblasts Human Motor Cortex Fibroblasts Human Motor Cortex TMEM49 TMEM6S C C TNC ADAMDEC1 TNFAIP3 CXCL6 TNFRSF10C TNFRSF11B NFIL3 TNIK FAM11OB TOP2A ACVR2A TOX TPX2 TPX2 TRA2 B TRAF3IP2 L TBC1D15 LOC72782O ORC4 ABCA6 CCNL1 OSR2 PDZRN3 WTRNA1-3 LOC10O132891 WWASA OSMR WDR17 WEE1 ENKUR WISP1 TMTC1 WISP2 C7orf63 WNT16 RSPO3 WNT2 1 PDE1C ZDHHC15 LOC642006 ZDHHC15 IARS ZFP36 AFF3 ZNF28OB ZNF462 TAGLN ZNF714 SSTR1 ZWINT TPM2 ADH A. ADH B CFB ADH C

F10 PITPNM3 PLSCR1 RPS26P11 PT OXTR HOXB2 2782O SRDSA1P1 DIP C11orf37 KRTAP1-5 PDE4 DIP F10 GOS2 CHRDL1 RGPD2 SEST PLA2G4A FOXP2 0385. Of these genes, the most highly differentially LOC72782O expressed genes known to be expressed in the CNS were FYN selected and are Summarized in Table 10. These genes express DCN CCL8 secreted proteins and may therefore be considered as biom ABCA9 arker candidate genes for ALS/FTD. Treatment of fibroblasts CA12 with a mixture of ASOs 1-5 and the ISIS oligonucleotides at PPAP2B a final concentration of 100 nM resulted in normalization of EFNAS AOX1 the gene expression of a large number of these genes. For instance, treatment of C9CRF72 fibroblasts with ASO reduced the expression of ENPP2 expression from a ~50% increase (p<0.05 vs. control fibroblasts) in C90RF72 fibro blasts compared to healthy fibroblasts to a 50% decrease SERPINE2 (p<0.05 vs. C90RF72 fibroblasts) after ASO treatment (FIG. 2a). US 2016/0024496 A1 Jan. 28, 2016 31

TABLE 10 List of genes upregulated or downregulated in C9CRF72 fibroblasts compared to control fibroblasts and effect of ASO treatment

Aberrant Human Aberrant Human Motor Cortex Cerebellum Rescued with Expression Expression ASO Treatment Aberrant Fibroblast Expression (t25% Change vs. (+25% Change (+2 5% Change

Accession # Gene Symbol Control) vs. Control) WS. Control ASO) Secreted NM 080284 ABCA6 No ND ND No NM OO1616 ACVR2A Yes ND ND No NM 207645 C11orf7 No ND ND NA NM 003739.5 C3 No Yes Yes Yes NM OO5623 CCL8 No No Yes NM 020307 CCNL1 Yes Yes No NM OOO610.3 CD44 Yes No No NM 001025077 CELF2 No No No NM OO1710 CFB No No Yes NM 145234 CHRDL1 Yes No Yes NM OO1831.3 CLU Yes Yes Yes NM OOOO96 CP Yes Yes Yes NM OO2993 CXCL6 Yes No Yes NM OO1920 DCN No Yes Yes NM O15881 DKK3 No No Yes NM OOO610.3 EDN1 Yes Yes Yes NM OOO115.3 EDNRB No Yes No NM OO1962 EFNAS No Yes No NM OO6209.4 ENPP2 No Yes Yes NM 000504 F10 Yes Yes Yes NM OO1993.4 Yes No Yes NM O14888 FAM3C No Yes O Yes NR 033766 FOXP2 Yes ND No NM 002037 FYN No ND No NM 013417 ARS No ND No NM 178822 GSF10 Yes Yes Yes NM 002184 L6ST No No Yes NM 057159 LPAR1 No ND No NM 032951.2 MLXIPL No ND No NM 001144966 NEDD4L No No I No NM 181741 ORC4 No ND No NM OO1191059 PDE1C No ND ND NM 003713 PPAP2B No ND No NM OO2764 PRPS1 No ND ND NM OO2912 REV3L No No No NM 032784 RSPO3 Yes No Yes NM 152753 SCUBE3 Yes ND Yes NM 005410.2 SEPP1 No No e S Yes NM OO6216 SERPINE2 No No Yes NM 178123 SESTD1 Yes ND ND NM OO6108 SPON1 Yes Yes Yes NR 027449 TBC1D15 No ND No NM OO3243 TGFBR3 No No No NM OO3810 TNFSF10 Yes No Yes NM OO6573 TNFSF13B Yes Yes Yes NM OO1164496 WDR52 No ND ND NM 007038 ADAMTSS Yes ND R Yes

0386 The effect of treatment with another gapmer ASO, gene, GAPDH, is shown as a loading control. The data ASO#1, was assessed in C9CRF72 fibroblasts. C9CRF72 strongly suggest that knocking down C9CRF72 mRNA may fibroblasts were plated at 20,000 cells/well and transfected be successful in normalization of aberrant gene expression using Cytofectin reagent with 100 nM of ASO#1. After an events induced by the C9CRF72 repeat expansion. incubation period of 3 days, mRNA levels of C90RF72, as well as some of the above mentioned potential biomarker Example 3 genes were measured by RT-qPCR. The data is presented in FIG. 3. The results indicate that treatment with ASO#1 sig Effect of Antisense Inhibition of Human C9CRF72 nificantly reduced C90RF72 mRNA levels. Furthermore, on Nuclear Retention of RNA-Binding Proteins in there was normalization of the altered gene expression of all ALS/FTD Patient Fibroblast the tested genes, complement component C3, endothelin (0387. The effect of C9CRF72 mutation on the binding of receptor 2 (EDNRB2), and endothelin. Endothelin has been RNA-binding proteins to the repeat expansion, a proteome previously implicated in ALS-FTD (Lederer, C. W. et al., array analysis, was examined. The effect of treatment with BMC Genomics 2007. 8:26; Rabin, S.J., et al., Hum. Mol. ISIS 576816 targeting C9CRF72 on this binding was also Genet. 2010. 19:313-28). The expression of the housekeeping investigated. US 2016/0024496 A1 Jan. 28, 2016 32

0388 C90RF72 fibroblasts were analyzed by proteome of nucleoside 33704 on the murine C90RF72 genomic array analysis (method adapted from Hu, S. et al., Cell. 2009. sequence, designated herein as SEQID NO: 11 (the comple 139: 610-22). The results of the analysis revealed significant ment of GENBANKAccession No. NT 166289.1 truncated interactions between numerous RNA- and DNA-binding pro from nucleosides 3587000 to 3625000). teins, as presented in Table 11 Immunostaining with an 0392 ISIS 603538 was designed as a 5-10-5 MOE gap ADARB2 antibody using the protocol described in Donnelly mer, 20 nucleosides in length, wherein the central gap seg etal (Donnelly, C.J. et al., EMBO.J. 2011.30: 4665-4677) of ment comprises ten 2'-deoxynucleosides and is flanked by one of the candidate proteins, ADARB2, in human C9CRF72 wing segments on both the 5' end and on the 3' end comprising fibroblasts revealed increased nuclear retention of the protein five nucleosides each. Each nucleoside in the 5' wing segment when compared with healthy control fibroblasts. There was a and each nucleoside in the 3' wing segment has a MOE ~40% increase in nuclear retention in C90RF72 fibroblasts modification. The internucleoside linkages are either phos compared to the control (FIG. 4A). This data Suggest that phorothioate linkages orphosphate ester linkages (GSAo Co RNA-binding proteins and splicing proteins have a high affin CoGs Cs TsTs Gs AS GSTs TsTs Gs CoCo Ao CSA; wherein ity to the hexanucleotide repeat expansion in C9CRF72 s’ denotes a phosphorothioate internucleoside linkage, 'o' patient cells. denotes a phosphate ester linkage; and A, G, C, T denote the 0389. To test whether treatment with ISIS 576816 target relevant nucleosides). All cytosine residues throughout the ing C9CRF72 would rescue human fibroblasts from this phe gapmer are 5-methylcytosines. ISIS 603538 has a target start notype, C90RF72 fibroblasts were plated at 20,000 cells/well site of nucleoside 2872 on the rat C9CRF72 mRNA and transfected using Cytofectin (Isis) reagent with 100 nM sequence, designated herein as SEQID NO: 12 (GENBANK of ISIS 576816. The cells were then stained for ADARB2. Accession No. NM 001007702.1). The results are presented in FIG. 4B. The data indicates that antisense inhibition of C9CRF72 mRNA reduced the nuclear Mouse Experiment 1 staining of ADARB2 back to levels observed in control 0393 Groups of 4 C57BL/6 mice each were injected with healthy fibroblasts. 50 ug, 100 g, 300 g, 500 ug, or 700 ug of ISIS 571883 TABLE 11 List of genes of RNA- and DNA-binding proteins from proteone array analysis of C9CRF72 fibroblasts Symbol Name Accession # NDST1 Heparan Sulfate-glucosamine N-sulfotransferase 1 NM OO1543.4 MITF Microphthalmia-associated transcription factor NM 198159.2 DPH2 Diphthamide biosynthesis protein 2 NM OO1039589.1 NUDT6 Nudix (nucleoside diphosphate linked moiety X) - type motif 6 NM 007083.4 TCL1B T-Cell leukemia/lyphoma protein 1B NMOO4918.3 PGAS Pepsinogen 5 Group1 (pepsinogen A) XM 002821692.2 TRIM32 tripartite motif-containing protein 32/E3 ubiquitin-protein ligase NM 001099679.1 CYP2C9 Cytochrome P450, family 2, subtype family C, polypeptide 9/(S)-limonene NM 000771.3 7-monooxygenase MPP7 Membrane protein, palmitoylated 7/MAGUK p55 subfamily member NM 173496.3 PTER Phosphotriesterase related protein NM 001001484.1 WBP11 WW domain binding protein 11/Nwp-38 NM 016312.2 HMGB2 High mobility group box 2 NM OO1130688.1 ORAOV1 Oral cancer overexpressed 1 NM 153451.2 RANGAP1 Ran GTPase-activating protiein 1 NM 002883.2 ZNF695 Zinc finger protein 695 NM 001204221.1 SOX6 SRY (sex determining region Y)-box 6 NM 001145811.1 JARID2 umonji NMOO4973.2 ADARB2 adenosine deaminase RNA-specific, B2 NM 018702.3

Example 4 administered via an intracerebroventricular bolus injection. A control group of four C57/BL6 mice were similarly treated In Vivo Rodent Inhibition and Tolerability with with PBS. Animals were anesthetized with 3% isofluorane Treatment of C9CRF72 Antisense Oligonucleotides and placed in a stereotactic frame. After sterilizing the Surgi cal site, each mouse was injected -0.2 mm anterio-posterior 0390. In order to assess the tolerability of inhibition of from the bregma nad 3 mm dorsoventral to the bregma with C9ORF72 expression in vivo, antisense oligonucleotides tar the above-mentioned doses of ISIS 571883 using a Hamilton geting a murine C9CRF72 nucleic acid were designed and Syringe. The incision was closed with Sutures. The mice were assessed in mouse and rat models. allowed to recover for 14 days, after which animals were 0391) ISIS 571883 was designed as a 5-10-5 MOE gap euthanized according to a humane protocol approved by the mer, 20 nucleosides in length, wherein the central gap seg Institutional Animal Care and Use Committee. Brain and ment comprises ten 2'-deoxynucleosides and is flanked by spinal cord tissue were harvested and Snap frozen in liquid wing segments on both the 5' end and on the 3' end comprising nitrogen. Prior to freezing, brain tissue was cut transversely five nucleosides each. Each nucleoside in the 5' wing segment five sections using a mouse brain matrix. and each nucleoside in the 3' wing segment has a MOE modification. The internucleoside linkages are phospho RNA Analysis rothioate linkages. All cytosine residues throughout the gap 0394 RNA was extracted from a 2-3 mm brain section mer are 5-methylcytosines. ISIS 571883 has a target start site posterior to the injection site, from brain frontal cortex and US 2016/0024496 A1 Jan. 28, 2016

from the lumbar section of the spinal cord tissue for analysis TABLE 1.4 of C90RF72 mRNA expression. C90RF72 mRNA expres sion was measured by RT-PCR. The data is presented in Table Latency to fall (Sec) in the rotarod assay 12. The results indicate that treatment with increasing doses of ISIS 571883 resulted in dose-dependent inhibition of Weeks after ISIS C9ORF72 mRNA expression. injection PBS 571883 0395. The induction of the microglial marker AIF-1 as a measure of CNS toxicity was also assessed. The data is pre 66 66 sented in Table 13. The results indicate that treatment with 4 91 70 increasing doses of ISIS 571883 did not result in significant 94 84 increases in AIF-1 mRNA expression. Hence, the injection of ISIS 571883 was deemed tolerable in this model.

TABLE 12 TABLE 1.5 Mean hindlimb grip strength (g) in the grip strength assay Percentage inhibition of C9CRF72 mRNA expression compared to the PBS control Weeks after ISIS injection PBS 571883 Posterior Spinal O 57 63 1 65 51 Dose (Ig) brain Cortex cord 2 51 52 3 51 51 50 22 8 46 4 59 72 5 60 64 100 22 12 47 6 61 72 300 55 47 67 7 67 68 500 61 56 78 8 66 70 9 63 61 700 65 65 79 10 48 46

TABLE 13 Rat Experiment Percentage expression of AIF-1 mRNA expression compared to the PBS control 0398 Groups of 4 Sprague-Dawley rats each were injected with 700 ug, 1,000 ug, or 3,000 ug of ISIS 603538 Posterior Spinal administered via an intrathecal bolus injection. A control Dose (Ig) brain cord group of four Sprague-Dawley rats were similarly treated 50 102 89 with PBS. Animals were anesthetized with 3% isofluorane 100 105 111 300 107 98 and placed in a stereotactic frame. After sterilizing the Surgi 500 131 124 cal site, each rat was injected with 30 uL of ASO solution 700 122 116 administered via 8 cm intrathecal catheter 2 cm into the spinal canal with a 50LL flush. The rats were allowed to recover for 4 weeks, after which animals were euthanized according to a humane protocol approved by the Institutional Animal Care Mouse Experiment 2 and Use Committee. 0396 Groups of 4 C57BL/6 mice each were injected with 500 g of ISIS 571883 administered via an intracerebroven RNA Analysis tricular bolus injection in a procedure similar to that described above. A control group of four C57/BL6 mice were 0399 RNA was extracted from 2-3 mm brain section pos similarly treated with PBS. The mice were tested at regular terior to the injection site, from brain frontal cortex and from time points after ICV administration. the cervical and lumbar sections of the spinal cord tissue for analysis of C90RF72 mRNA expression. C9CRF72 mRNA expression was measured by RT-PCR. The data is presented Behavior Analysis in Table 16. The results indicate that treatment with increas 0397. Two standard assays to assess motor behavior were ing doses of ISIS 603538 resulted in dose-dependent inhibi employed; the rotarodassay and grip strength assay. In case of tion of C90RF72 mRNA expression. the rotarod assays, the time of latency to fall was measured. 0400. The induction of the microglial marker AIF-1 as a The data for the assays is presented in Tables 14 and 15. The measure of CNS toxicity was also assessed. The data is pre results indicate that there were no significant changes in the sented in Table 17. The results indicate that treatment with motor behavior of the mice as a result of antisense inhibition increasing doses of ISIS 603538 did not result in significant of ISIS 571883 or due to the ICV injection. Hence, antisense increases in AIF-1 mRNA expression. Hence, the injection of inhibition of C9CRF72 was deemed tolerable in this model. ISIS 603538 was deemed tolerable in this model. US 2016/0024496 A1 Jan. 28, 2016 34

TABLE 16 TABLE 1.8 Body weights of the rats (% initial body weight Percentage inhibition of C9CRF72 mRNA expression compared to the PBS control Dose (g) Week 1 Week 2 Week 3 Week 4 Week 5 Dose Brain (1 mm Spinal cord Spinal cord PBS 1OO 94 103 105 109 (Ig) Section) Cortex (lumbar) (cervical) ISIS 700 1OO 94 98 103 107 6O3S38 1OOO 1OO 95 97 101 103 3OOO 1OO 92 98 102 105 700 21 4 86 74 1OOO 53 49 88 82 3OOO 64 62 88 8O Example 5 RNA Binding Protein ADARB2 Interacts with GGGGCC RNA TABLE 17 0402. A proteome array was utilized to identify protein binding partners for the GGGGCC hexanucleotide repeat Percentage expression of AIF-1 mRNA expression compared to the expansion. A 5'Cy5-labeled GGGGCC, RNA was synthe PBS control sized and hybridized to a proteome array containing nearly Dose Brain (1 mm Spinal cord Spinal cord two-thirds of the annotated human proteome as yeast-ex (Ig) Section) Cortex (lumbar) (cervical) pressed, full-length ORFs with N-terminal GST-His fusion proteins (a total of 16,368 full length human proteins repeated 700 97 119 98 89 2-3 time per chip). See, JEONG et al., “Rapid Identification of 1OOO 105 113 122 96 Monospecific Monoclonal Antibodies Using a Human Pro 3OOO 109 141 156 115 teome Microarray.” Mol. Cell. Proteomics (2012) 11(6): O111.016253-1 to 0111.016253-10. A 5'Cy5-labeled scrambled RNA of the same G:C content as the 5'Cy5-labeled GGGGCC, RNA was used as a negative control. For each Body Weight Analysis RNA sequence, 3 proteome arrays were hybridized in parallel as technical replicates. Using this method, 19 ORFs were 0401 Body weights of the rats were measured at regular identified (see Table 19) that consistently exhibited high time point intervals. The data is presented in Table 18. The affinity for the GGGGCC, RNA as compared to the results indicate that treatment with increasing doses of ISIS scrambled RNA determined via the AZ-score GGGGCCs 603538 did not have any significant changes in the body RNA Z-score —G:C scrambled RNA Z-score. Among this weights of the rats. list, ADARB2 was studied further. TABLE 19 Proteins that Interact with GGGGCC RNA sequence using proteone array.

Symbol Name Accession # Loci Scrambled GGGGCC AZ NDST1 Heparan Sulfate NM OO1543.4 8.06 37.08 29.03 glucosamine N sulfotransferase 1 MITF Microphthalmia NM 198159 3p14.2- 6.71 22.49 15.78 associated p14.1 transcription factor DPH2 Diphthamide NM OO1039589.1 1p34 3.43 14.04 10.61 biosynthesis protein 2 NUDT6 Nudix (nucleoside NM 007083.4 8.38 16.66 8.28 diphosphate linked moiety X) - type motif 6 T-Cell NM 004918 14q32.1 S.42 12.91 7.49 leukemia lyphoma protein 1B PGAS PGA5 pepsinogen NM O14224.2 11q13 2.96 8.93 5.97 5, group I TRIM32 Tripartite motif NM 001099679.1 9p33.1 4.63 10.25 S.62 containing protein 32/E3 ubiquitin protein ligase CYP2C9 Cytochrome P450, NM 000771.3 10q24 1.49 5.83 4.34 family 2, Subtype family C, polypeptide 9/(S)- limonene 7 monooxygenase US 2016/0024496 A1 Jan. 28, 2016 35

TABLE 19-continued Proteins that Interact with GGGGCC RNA sequence using proteone array.

Z-GC Z Symbol Name Accession # Loci Scrambled GGGGCC AZ MPP7 Membrane NM 173496.3 10p21.1 O.30 4.43 4.13 protein, palmitoylated 7/MAGUK p55 Subfamily member PTER Phosphotriesterase NM 001001484.1 10p12 4.09 7.45 3.36 related protein WBP11 WW domain NM 016312.2 12p12.3 -0.17 2.84 3.02 binding protein 1/Nwp-38 HMGB2 High mobility NM 001130688.1 4q3 1.23 4.35 3.12 group box2 ORAOV1 Oral cancer NM 153451.2 11 q13.3 O41 3.23 2.83 overexpressed 1 RANGAP1 Ran GTPase- NM 002883.2 22d 13 1.21 3.38 2.17 activating protiein 1 ZNF695 Zinc finger NM 001204221.1 1d44 2.18 4.76 2.58 protein 695 SOX6 SRY (sex NM 001145811.1 11p15.3 1.16 3.68 2.51 determining region Y)-box 6 JARID2 Jumonji NM 004973.2 6p24-p23 O.64 3.01 2.37 ADARB2 Adenosine NM 018702.3 10p15.3 -0.20 2.09 2.29 deaminase RNA specific, B2 DAZ2 Deleted in NM 001005785.2 Yd 11.223 7.8O 1312 5.33 aZoospermia 2

0403 Z scores are generated by hybridizing a Cy5-la- cortex of C9CRF72 ALS patients, while there is no nuclear belled GC-scrambled or GGGGCCx6.5 RNA to a proteome accumulation or colocalization in non-C9 ALS tissue. array and quantifying the average signal intensity of a single (0406 ADARB2 interacts with endogenous C90RF72 spot on the proteome array that corresponds to a full length RNA through the GGGGCC repeat sequence. To determine if ORF (n=3 arrays). High signal intensity indicates a strong ADARB2 is required for RNA foci formation, iPSNs were binding between the ORF and the labeled RNA. (AZ=Z- treated with siRNA against ADARB2 and performed RNA GGGGCC-Z-GC Scrambled). A positive AZ indicates spe FISH for the nuclear GGGGCC RNA foci. siRNA-mediated cific affinity for the GGGGCC RNA as compared to the knockdown of ADARB2 resulted in a statistically significant scrambled RNA of the same GC content. 48.99% reduction in the number of iPSNs with RNA foci. 04.04 Simultaneous RNAFISH and RBP immunofluores These studies suggest that an interaction between ADARB2 cence (RNA FISH-IF) studies in C9CRF72 iPSNs revealed and the C9CRF72 RNA expansion plays a role in the forma that ADARB2 protein colocalizes with the nuclear GGGGCC tion or maintenance of the RNA foci in vitro supporting the RNA foci, with unchanged levels of mRNA. In addition, hypothesis that interactions of RBPs with the GGGGCC RBP:RNA coimmunoprecipitation (RNA co-IP) studies were repeat may play a role in C9ORF72-RNA toxicity. More used to isolate C90RF72 RNA from the RNA co-IP using over, ADARB2 statistically accumulates in the nucleus of primers to exon 1a and the intronic region 5' of the GGGGCC C9ORF72 iPSN by immunostaining and this was recapitu expanded repeat indicating that ADARB2 interacts with lated in C9CRF72 ALS post-mortem tissue. endogenous C9CRF72 RNA in living cells. Finally, an elec trophoretic gel shift assay (EMSA) was performed with Example 6 recombinant ADARB2 purified from E. coli. Titrating ADARB2 shows depletion of free RNA and shift to slower Identification of Pharmacodynamic Biomarkers to mobility or a well shift, the latter of which is presumably due Monitor C90RF72 Therapy in Human CSF and/or to multimerization of the protein RNA complexes. Taken Blood together, these data indicate that both biochemically and in 04.07 Sequestration of RBPs and the presence of nuclear living cells, ADARB2 protein interacts with C9CRF72 RNA foci Suggest that the hexanucleotide repeat expansion may and has a high binding affinity for the GGGGCC repeat RNA alter the cellular transcriptome which provide a readout for sequence, which could be useful as a readout to monitor therapeutic intervention. Using five C9CRF72 ALS fibro C9ORF72-specific drug efficacy. blast lines, unique gene expressions changes (p<0.05) were 04.05 To determine if these in vitro observations are reca identified as compared to healthy controls, and accounted for pitulated in vivo, the colocalization of ADARB2 protein to significantly altered genes from SOD1" fibroblasts. Using 4 GGGGCC RNA foci in human postmortem C90RF72 iPSN lines, a unique population of genes were identified that patient tissue was examined. RNA FISH-IF confirmed that were dysregulated as compared to control, Subtracting the ADARB2 colocalizes with GGGGCC RNA foci in motor aberrantly expressing genes from SOD''' iPSN lines. US 2016/0024496 A1 Jan. 28, 2016 36 iPSNs that carry a SOD1' mutation exhibited a large num (up or down) when compared to iPSNs: EDN1, NEDD4L. ber of dysregulated genes when compared to control cells, FAM3C, CHRDL1, CP, SEPP1, and SERPINE2. These genes although a Subset of expression abnormalities were common 7 genes can be used as pharmacodynamic biomarkers to between C9CRF72 and SOD1''' iPSNs. Taken together, monitor C9CRF72 therapy in human CSF and/or blood. these data indicate that the C9CRF72 transcriptome is differ ent from the SOD1" transcriptome in both fibroblasts and Example 7 iPSNs. This can be visualized when comparing the expres sion levels of statistically significant genes in C9CRF72 Antisense Oligonucleotides Reduce Nuclear iPSNs to that of SOD1''' iPSNs. ADARB2 Protein Signals in C90RF72 iPSNs and 0408 Commonalities between C9CRF72 iPS-derived Normalize C90RF72 Gene Expression Pattern neurons and post-mortem motor cortex (n-3) were examined 0410 Antisense oligonucleotides were designed targeting to evaluate if cultured iPSNs recapitulate the C90RF72 ALS various regions of the C9CRF72 gene (the complement of human brain transcriptome and can, therefore, be used to GENBANK Accession No. NT 008413.18 truncated from evaluate future therapeutics. A large number of aberrantly nucleotides 27535000 to 27565000, designated herein as expressed genes (p<0.05) were identified in C9CRF72 ALS SEQ ID NO: 2). The antisense oligonucleotides are either motor cortex (compared to control) of which a subset over 2'-O-methyl modified oligonucleotides (denoted “2'OMe') lapped with genes aberrantly expressed in C9CRF72 iPSNs, or 2-MOE antisense oligonucleotides (denoted "2"MOE). including those expressed concordantly. When comparing The oligonucleotides are either 5-10-5MOE gapmers, 5-10-5 C9ORF72 fibroblasts to C9CRF72 iPSN and motor cortex, 2O-methyl gapmers, or full MOE oligonucleotides. The fewer genes were found to be common Suggesting that these 5-10-5 MOE gapmers are 20 nucleosides in length, wherein cell types are not very similar. Only a population of altered the central gap segment comprises ten 2'-deoxynucleosides genes is shared between the postmortem C9CRF72 human and is flanked by wing segments on both the 5' end and on the motor cortex and the C90RF72 iPSNs, most likely due to the 3' end comprising five nucleosides each. Each nucleoside in cellular heterogeneity of the human motor cortex as com the 5' wing segment and each nucleoside in the 3' wing seg pared to a neuron-enriched iPSN culture system. All ment has a MOE modification. The 5-10-52'OMegapmers C9ORF72 cell and tissue gene arrays consistently showed a are 20 nucleosides in length, wherein the central gap segment larger number of downregulated genes than upregulated comprises ten 2'-deoxynucleosides and is flanked by wing genes, which was not observed in the SOD1" samples. segments on both the 5' end and on the 3' end comprising five 04.09. With the goal of identifying genes that might be nucleosides each. Each nucleoside in the 5' wing segment and utilized as therapeutic biomarkers, genes that exhibited each nucleoside in the 3' wing segment has a 2'OMe modifi altered expression in C90RF72 iPSNs, fibroblasts, or human cation. The full MOE oligonucleotide is 20 nucleotides in motor cortex via exon microarray were selected. Also length, wherein each nucleoside has a MOE modification. selected, were genes coding for proteins that are expressed in The internucleoside linkages throughout each oligonucle the CNS and, the majority of which, are secreted as this would otide are phosphorothioate linkages (denoted “PT back allow for quantification of the protein levels in patient cere bone'). All cytosine residues throughout each MOE gapmer brospinal fluid (CSF). Twenty-six target genes were selected are 5-methylcytosines. The target start site, target region, and and tested their expression in C9CRF72 autopsied CNS tis function (RNase Horblocking) of each antisense oligonucle Sue against non-ALS control tissue using nanostring gene otide are specified in Table 20 below. The blocking ASO binds expression methodologies. Sixteen of the target genes tested the GGGGCC, RNA repeat to block any RBP interaction were also aberrantly expressed in C9CRF72 ALS patient but does not degrade the transcript. Each antisense oligo tissue, of which 7 showed the same direction of dysregulation nucleotide listed in Table 7 is targeted to the SEQID NO: 2. TABL E Antisense oligonucleotides targeting SEQ ID NO: 2 Target Target Oligo ISIS Start Stop Chemical SEQ Sequence ID NO Site Site Modifications Function ID NO

GCCCCGGCCCCTAGCGCGCG A. NAA 1448 1467 5-10-5 RNase H 22 2 OMe PT backbone

CCGGCCCCGGCCCCGGCCCC B 57.3674 1457 1476 Full MOE Block 31 PT backbone

CCGGCCCCGGCCCCGGCCCC C 573716 1457 1476 5-10-5 RNase H 31 2' OME PT backbone

GGTAACTTCAAACTCTTGGG D sff O.83 34.52 3471 5-10-5 RNase H 29 2' OME PT backbone

GCCTTACTCTAGGACCAAGA E 576816 799 O 8 OO 9 5-10-5 RNase H 28 2' OME PT backbone US 2016/0024496 A1 Jan. 28, 2016 37

0411 RNase H-mediated antisense oligonucleotides sig 0412 ASO treatment also normalized the dysregulated nificantly reduced both the percentage of cells that contain gene expression of our candidate biomarker genes NEDD4L. GGGGCC, RNA foci and the number of foci percellin both FAM3C, CHRDL1, SEPP1, and SERPINE2 in C9CRF72 fibroblasts and iPSN cultures regardless of the ASO target iPSNs (FIG.9) independent of the ASO target region. These location or effect on C90RF72 RNA levels (FIG. 7). In an ADARB2:RNA foci colocalization study, ASOs A, B, C, D, genes can serve as biomarkers to monitor ASOtherapy effi and E reduced the nuclear ADARB2 protein signals in cacy. Genes that were not altered between control and C9ORF72 iPSNs as determined by immunostaining (FIG.8), C9ORF72 iPSNs did not change when treated with ASOs, suggesting that ADARB2 colocalization with RNA foci is Suggesting that ASO treatment does not have untoward due to protein:GGGGCC, RNA interaction. effects on general gene transcription (FIG. 10).

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 31

SEO ID NO 1 LENGTH 3339 TYPE: DNA ORGANISM: Homo sapiens FEATURE; NAME/KEY: CDS LOCATION: (2O3) . . (1648)

<4 OOs SEQUENCE: 1

acgta acct a cqgtgtc.ccg ctaggaaaga gaggtgcgt.c aaac agcgac aagttcc.gc.c 60

cacgtaaaag atgacgcttg gtgttgtcagc cgt.ccctgct gcc.cggttgc titct cittittg 12O

gggg.cggggt Ctagcaa.gag Caggtgttggg tittaggagat atct Coggag catttggata 18O

atgtgacagt tdgaatgcag td atgtcg act citt togc cca ccg cca tot coa 232 Met Ser Thr Lieu. Cys Pro Pro Pro Ser Pro 1. 5 10

gct gtt gcc aag aca gag att gct tta agt ggc a.a.a. to a cott tta tta 28O Ala Wall Ala Lys Thir Glu Ile Ala Lell Ser Gly Lys Ser Pro Lell Lell 15 2O 25

gca gct act titt gct tac tgg gac aat att citt ggt cott aga gta agg 328 Ala Ala Thir Phe Ala Trp Asp Asn Ile Luell Gly Pro Arg Wall Arg 3O 35 4 O

CaC att tgg gct CC a aag aca gaa Cag gta citt citc. agt gat gga gaa 376 His Ile Trp Ala Pro Lys Thir Glu Glin Wall Luell Luell Ser Asp Gly Glu 45 SO 55

ata act titt citt gcc aac CaC act Cta aat gga gala at C citt cga aat 424 Ile Thir Phe Luell Ala Asn His Thir Lell Asn Gly Glu Ile Tell Arg Asn 6 O 65 70

gca gag agt ggt gct at a gat gta aag titt titt gt C ttg tot gaa aag 472 Ala Glu Ser Gly Ala Ile Asp Wall Lys Phe Phe Wall Luell Ser Glu Lys 7s 8O 85 90

gga gtg att att gtt to a tta atc. titt gat gga aac tgg aat 999 gat Gly Wall Ile Ile Wall Ser Luell Ile Phe Asp Gly Asn Trp ASn Gly Asp 95 1OO 105

cgc agc a Ca tat gga Cta toa att ata citt CC a cag aca gaa citt agt 568 Arg Ser Thir Tyr Gly Luell Ser Ile Ile Lell Pro Glin Thir Glu Lell Ser 11 O 115 12O

titc tac citc. CC a citt Cat aga gtg gtt gat aga tta aca Cat ata 616 Phe Lell Pro Luell His Arg Wall Cys Wall Asp Arg Luell Thir His Ile 125 13 O 135

atc. cgg a.a.a. gga aga at a tgg atg Cat aag gala aga Cala gaa aat gtc 664 Ile Arg Gly Arg Ile Trp Met His Lys Glu Arg Glin Glu Asn Wall 14 O 145 15 O

cag aag att at C tta gala ggc a Ca gag aga atg gala gat cag ggit Cag 712 Glin Ile Ile Luell Glu Gly Thir Glu Arg Met Glu Asp Glin Gly Glin 155 16 O 1.65 17 O

US 2016/0024496 A1 Jan. 28, 2016 39

- Continued cga gat gtt cta atg act ttt taa atgtgtaact taataagcct attc catcac 1678 Arg Asp Val Lieu Met Thr Phe 47s 48O aatcatgatc gctggtaaag tagct cagtg gtgtggggala acgttcc cct ggat catact 1738 ccagaattct gct ct cagca attgcagtta agtaagttac act acagttct cacaagagc 1798

Ctgtgagggg atgtcaggtg cat cattaca ttgggtgtct Cttitt CC tag atttatgctt 1858 ttgggataca gacctatott tacaatataa taaat attat togctatottt taaagatata 1918 ataataggat gtaaacttga ccacaactac tdtttittittgaaatacatga t t catggittt 1978 acatgtgtca aggtgaaatc tdagttggct tttacagata gttgactitt c tat cittittgg 2O38 cattctittgg tdtgtagaat tactgtaata cittctgcaat caactgaaaa citagagc citt 2098 taaatgattt Caattic caca gaaagaaagt gagcttgaac at aggatgag Ctttagaaag 215.8 aaaattgatc aag cagatgt ttaattggaa ttgattatta gatcc tactt tdtggattta 2218 gtcc ct ggga titcagt ctdt agaaatgtct aatagttctic tatagt cctt gttcc tiggtg 2278 aaccacagtt agggtgttitt gtttattitta ttgttcttgc tattgttgat attctatgta 2338 gttgagct ct gtaaaaggaa attgt attitt atgttittagt aattgttgcc aactttittaa 2398 attaattittc attatttittg agccalaattgaaatgtgcac citcctgtgcc titttittcticc 2.458 ttagaaaatc taattacttg gaacaagttc agattt cact ggit cagt cat titt catc.ttg 2518 ttitt cittctt gctaagttctt accatgtacc tdotttggca at cattgcaa citctgagatt 2578 ataaaatgcc ttagagaata tactalactaa taagatc.ttt ttitt cagaaa cagaaaatag 2638 titcc ttgagt act tcc ttct togcatttctg cctatgttitt togaagttgtt gctgtttgcc 2698 tgcaat aggc tataaggaat agcaggagaa attitt actga agtgctgttt toctaggtgc 2758 tactittggca gagctaagtt atc.ttttgtt ttcttaatgc gtttggacca ttittgctggc 281.8 tataaaataa citgattaata taattictaac acaatgttga cattgtagtt acacaaacac 2878 aaataaat at tittatttaaa attctggaag taatataaaa goggaaaatat atttataaga 2938 aagggataaa gotaatagag ccc.ttctgcc ccccacccac caaatttaca caacaaaatg 2998 acatgttctga atgtgaaagg tdataatagc titt cocatca taat Cagala agatgtggac 3 O58 agcttgatgt tittaga caac cactgaacta gatgactgtt gtact.gtagc ticagt cattt 31.18 aaaaaatata taaatactac Cttgtagt git cocatactgt gtttitttaca togg tagattic 31.78 ttatttaagt gctaactggit tattittctitt ggctggittta ttgtactgtt atacagaatg 3.238 taagttgtac agtgaaataa gtt attaaag catgtgtaaa cattgttata tat cittittct 3.298 cctaaatgga gaattittgaa taaaatatat ttgaaattitt g 3339

<210s, SEQ ID NO 2 &211s LENGTH: 3 OOO1 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 2 caaagaaaag ggggaggttt tittaaaaaa gagaaatgtt acatagtgct Ctttgagaaa 6 O att cattggc act attalagg atctgaggag Ctggtgagtt toaactggtg agtgatggtg 12 O gtagataaaa ttagagctgc agcagg to at tittagcaact attagataaa actggtc.t.ca 18O ggtcacaacg ggcagttgca gcagctggac ttggagagaa ttacactgtg ggagcagtgt 24 O

US 2016/0024496 A1 Jan. 28, 2016 42

- Continued gtattaaaaa cagtggat at tittaaagaag citgitacggct tatat ctagt gctgtct citt 486 O aagact atta aattgataca acatatttaa aagtaaatat tacctaaatgaatttittgaa 492 O attacaaata cacgtgttaa aactgtcgtt gtgttcaacc atttctgtac atact tagag 498O ttaactgttt togc.caggctic td tatgccta ct cataatat gataaaag.ca ct catctaat 5040 gctctgtaaa tagaagt cag togctitt coat cagactgaac tot cittgaca agatgtggat 51OO gaaattctitt aagtaaaatt gtt tactttgtcatacattt acagatcaaa tottagcticc 516 O caaa.gcaatc atatggcaaa gataggtata t catagitttg cct attagct gctttgtatt 522 O gctatt atta taaatagact t cacagttitt agacittgctt aggtgaaatt gcaattctitt 528 O ttactitt cag tottagataa caagt citt.ca attatag tac aat cacacat togcttaggaa 534 O tgcatcatta gg.cgattittg to attatgca aacat catag agtgtactta cacaaac cta 54 OO gatagtatag cctittatgta cctagg.ccgt atggtatagt ctdttgctic c taggccacaa 546 O acct gtacaa citgttact.gt actgaatact ataga cagtt gtaacacagt gigtaaatatt 552O tatictaaata tatgcaaaca gagaaaaggt acagtaaaag tatggtataa aagataatgg 558 O tatacctgtg taggcc actt accacgaatg gagcttgcag gactagaagt totctgggt 564 O gagt cagtgagtgagtggtgaattaatgtg aaggcctaga acactgtaca C cactgtaga st OO ctataaacac agtacgctga agctacacca aattitat citt aac agtttitt cittcaataaa 576. O aaattataac tttitta actt td taalactitt ttaattittitt aacttittaaa atact tagct 582O tgaaacacaa atacattgta tagctataca aaaat attitt ttctttgtat cottatt cita 588 O gaagctttitt totattitt ct attittaaatt tttittttitta cittgttagtic gttitttgtta 594 O aaaactaaaa cacacacact ttcaccitagg catagacagg attaggat.ca toagitat cac 6 OOO t ccct tccac ct cact gcct tccacctic ca catcttgtcc cactggaagg tttittagggg 6 O6 O caataacaca catgtagctg. t caccitatga taa.ca.gtgct ttctgttgaa tacct cotga 612 O aggacttgcc taggctgtt ttacatttaa cittaaaaaaa aaaaaagtag aaggagtgca 618O ctictaaaata acaataaaag goat agtata gtgaatacat aaaccagcaa totag tagtt 624 O tatt at caag togttgtacac totaataatt g tatgtgcta tactittaaat aacttgcaaa 63 OO atag tact aa gacct tatga tiggittacagt gtcactaagg caatagdata ttitt caggit c 636 O cattgtaatc taatgggact accat catat atgcagticta ccattgactgaaacgttaca 642O tggcacataa citg tatttgc aagaatgatt tdttttacat taatat caca taggatgtac 648 O Ctttittagag titatgttt atgtggatta agatgtacaa gttgagcaag gggaccalaga 654 O gcc.ctgggitt ctdtcttgga tigtgagcgtt tatgttctitc. tcc ticatgtc. tdttittctica 66OO ttaa attcaa aggcttgaac giggcc ctatt tagcc cittct gttittctacg togttctaaat 666 O aactaaagct tittaaattct agc catttag tdtagaactic tictittgcagt gatgaaatgc 672 O tg tattggitt tottggctag cat attaaat atttittatct ttgtc.ttgat acttcaatgt 678 O. cgttittaaac at caggat.cg ggctt cagta ttct cataac cagagagttc actgaggata 6840 caggactgtt togcc catttt ttgttatggc ticcagacittg togg tattitcc atgtc.tttitt 69 OO tttitttittitt ttttittgacc ttittagcggc tittaaagtat ttctgttgtt aggtgttgta 696 O ttacttitt ct aagattactt aacaaag.cac cacaaactgagtggctittaa acaacagdaa 7 O2O tittatt ct ct cacaatticta gaagctagaa gtc.cgaaatc aaagttgttga cagggg.catg 708 O US 2016/0024496 A1 Jan. 28, 2016 43

- Continued atct tcaaga gagaag actic titt cottgcc tict tcctggc titctggtggit taccagdaat 714. O cctgagtgtt cotttcttgc cittgtag titt caacaatcca gitatctgcct tttgtc.ttca f2OO catggctgtc. taccatttgt citctgtgtct c caaatctot citccittataa acacagoagt 726 O tattggatta ggc.cccactic taatccagta tdaccc.catt tta acatgat tacact tatt 732O tctagataag gtcacattca cqtacaccala gggittaggaa ttgaacatat Ctttittgggg 7380 gacacaattic aaccolacaag togt cagt ct c tagctgagcc titt coct tcc tdtttittctic 744. O Ctttittagtt gctatogggitt aggggccaaa tot coagtica tactagaatt gcacatggac 75OO tggatatttg ggaatactgc ggg to tatt c tatgagctitt agtatgtaac atttaatatic 756 O agtgtaaaga agc cctttitt taagttattt ctittgaattt ctaaatgitat gcc ct gaata 762O taagtaacaa gttaccatgt cittgtaaaat gat catat ca acaaacattt aatgtgcacc 768 O tact.gtgcta gttgaatgtc tittatcctga taggagataa caggatt coa catctittgac 774. O ttaa.gaggac aaaccaaata tdtctaaatc atttggggitt ttgatggata t ctittaaatt 78OO gctgaaccta at cattggitt toatatgtca ttgtttagat atcto cqgag catttggata 786 O atgtgacagt tdaatgcag tatgtcgac totttgcc.ca cc.gc.catct C Cagctgttgc 7920 caagacagag attgctittaa gtggcaaatc acctittatta gcago tactt ttgct tactg 798 O ggacaatatt Cttggit cota gagta aggca catttgggct C caaaga cag aac aggtact 804 O t ct cagtgat ggagaaataa cittitt cittgc caaccacact ctaaatggag aaatcct tcg 81OO aaatgcagag agtggtgcta tagatgtaaa gtttitttgtc. ttgtctgaaa agggagtgat 816 O tattgttt cattaatctittg atggaaactg gaatggggat cqcagcacat atggactatic 822 O aattatactt coacagacag aact tagttt ctacctic cca citt catagag tdtgtgttga 828O tagattaa.ca catataatcc ggaaaggaag aatatggatg catalaggtaa gtgatttitt C 834 O agct tattaa totatgttaac citatctgttgaaagcttatt ttctggtaca tataaat citt 84 OO attitttittaa ttatatgcag togalacatcaa acaataaatgttatttattt togcatttacc 846 O ctattagata caaata catc toggtotgata cct gt catct t catattaac tdtggaaggit 852O acgaaatggit agcticcacat tatagatgaa aagctaaagc titaga caaat aaagaaactt 858 O ttagaccctg gattcttctt gggagcctitt gactictaata cct tttgttt coctitt catt 864 O gcacaattct gtc.ttittgct tactactato td taagtata acagttcaaa gtaatag titt 87OO cataagctgt toggtcatgta gcc tittggtc. tctittaacct ctittgccaag titcc.caggitt 876O Cataaaatga ggaggttgaa tigaatggitt cccaa.gagaa titcCttittaa ticttacagaa 882O attattgttt toctaaatcc td tagttgaa tatataatgc tatttacatt toagtatagt 888 O tittgatgitat ctaaagaa.ca cattgaattic ticct tcc tigt gttccagttt gatactalacc 894 O tgaaagttcca ttaa.gcatta ccagttittaa aaggcttittg cccaatagta aggaaaaata 9 OOO atat cittitta aaagaataat ttitt tact at gtttgcaggc titact tcctt ttittct caca 906 O titatgaaact cittaaaatca ggagaatctt ttaaacaa.ca toataatgtt taatttgaaa 912 O agtgcaagtic attcttitt cotttittgaaac tatgcagatgttacattgac tdttittctgt 918O gaagttatct ttttitt cact gcagaataaa gottgttittg attittattitt gtattgttta 924 O tgagaacatg catttgttgg gttaatttico taccc ctdcc cc catttitt t c cctaaagta 93 OO gaaagtattt ttcttgttgaa citaaattact acacaagaac atgtc. tattgaaaaataagc 936 O

US 2016/0024496 A1 Jan. 28, 2016 45

- Continued catatttgag acactttaca tttgttgatgt gttatactga attitt cagtt tdattictata 17OO gact acaa at ttcaaaatta caatttcaag atgtaataag tagtaatatic titgaaatago 1760 tctaaaggga atttittctgt tittattgatt cittaaaatat atgtgctgat tittgatttgc 182O atttgggtag attatactitt tatgagtatg gaggittaggit attgattcaa gttitt cotta 188O cctatttggit aaggattitca aagtc.tttitt gtgcttggitt titcct cattt ttaaatatga 1940 aatatattga tigacctittaa caaatttittt titatic to aaa ttittaaagga gat cittittct 2 OOO aaaagaggca tdatgacitta at cattgcat gtaac agitaa acgataaac caatgatt coa 2O6 O tact ct ctaa agaataaaag tagdtttag ggc.cgggcat ggt cagaaat ttgacaccala 212 O

Cctggccaac atggcgaaac Cccgt.cticta Ctaaaaatac aaaaatcagc C9ggcatggit 218O ggcggCacct at agtc.ccag Ctacttggga ggatgagaca ggagagt cac ttgaacctgg 224 O gaggagaggit to agtgagc tigagat cacg C cattgcact C cagcct gag caatgaaagc 23 OO aaaact coat citcaaaaaaa aaaaaagaaa agaaagaata aaagtgagct ttggattgca 2360 tataaatcct ttagacatgt agtag acttig tittgatactg togtttgaaca aattacgaag 242 O tattitt catc aaagaatgtt attgtttgat gttatttitta tttitt tattg cccagcttct 248O ct catattac gtgattittct t cactitcatgtcactittatt gtgcagggit c agagtattat 254 O tccaatgctt actggagaag tdatt cotgt aatggaactg ctitt catcta tdaaatcaca 26 OO cagtgttcct gaagaaatag atgtaagttt aaatgagagc aattatacac tittatgagtt 266 O ttittggggitt at agtatt at tatgtatatt attaatatto taattittaat agtaaggact 272 O ttgt cataca tact attcac atacagtatt agccactitta gcaaataagc acacacaaaa 2780 t cct ggattt tatggcaaaa cagaggcatt tttgat cagt gatgacaaaa ttaaatt cat 284 O tttgtttatt to attactitt tataattic ct aaaagtggga gcatcc.cagc ticittatagga 29 OO gcaattaata tittaatgtag togt cittittga aacaaaactg tdtgccaaag tagtaac cat 296 O taatggaagt ttacttgtag to acaaattt agttt cotta at catttgtt gaggacgttt 3O2O tgaat cacac actatogagtg ttaagagata cctittaggaa act attcttg ttgttittctg 3O8O attttgtcat ttaggittagt citcctgattic tdacagotca gaagaggaag ttgttcttgt 314 O aaaaattgtt taacctgctt gaccagottt cacatttgtt cittctgaagt titatgg tagt 32OO gcacagagat tittttittgg ggagt cttga ttcticggaaa taaggcagt gtgttatatt 326 O gaatccagac titc.cgaaaac ttgtatatta aaagtgttat ttcaacact a tigttacago c 332O agactaattt ttt tatttitt tdatgcattt tagatagctg atacagtact caatgatgat 3380 gatattggtg acagotgtca toga aggctitt cittct caagt aagaatttitt cittitt cataa 344 O aagctggatg aag Cagatac Catct tatgc ticaccitatga Caagatttgg aagaaagaaa 3500 ataacagact gtc tact tag attgttctag giga cattacg tatttgaact gttgcttaaa 3560 tttgttgtt at ttitt cactica ttatatttct atatatattt ggtgttatt c catttgctat 362O ttaaagaaac cqagtttcca toccagacaa gaaat catgg ccc.cttgctt gattctggitt 3 680 t cittgttitta cittct catta aagctaacag aatcc titt.ca tattaagttg tactgtagat 37.4 O gaacttaagt tatttaggcg tagaacaaaa ttatt catat ttatactgat citttitt ccat 38OO c cagcagtgg agtttagtac ttaagagttt gtgcc cittaa accagacitcc ctdgattaat 386 O gctgttgtacc cqtgggcaag gtgcc tigaat tctictataca cct attt colt catctgtaaa 392 O US 2016/0024496 A1 Jan. 28, 2016 46

- Continued atggcaataa tagtaatagt acctaatgtg tagggttgtt ataag cattg agtaagataa 398 O ataatataaa gcacttagaa cagtgcctgg alacataaaaa cacttaataa tagct catag 404 O ctaacatttic ctatttacat ttcttctaga aatagocagt atttgttgag togcctacatg 41OO ttagttcc tt tact agttgc titt acatgita titat cittata ttctgttitta aagtttcttic 416 O acagttacag attitt catga aattt tactt ttaataaaag agaagtaaaa gtataaagta 422 O ttcacttitta tott cacagt cittitt cottt aggct catga tiggagtatica gaggcatgag 428O tgttgtttaac ctaagagcct taatggcttgaat cagaagc actittagt cc tdt atctgtt 434 O cagtgtcago ctitt cataca toattittaaa toccatttga ctittaagtaa gtcacttaat 44 OO citct ctacat gtcaatttct t cagotataa aatgatggta tittcaataaa taaatacatt 4 460 aattaaatga tattatactg actaattggg ctgttittaag gct caataag aaaatttctg 452O tgaaaggit ct c tagaaaatg taggttcc ta tacaaataaa agata acatt gtgcttatag 458 O citt.cggtgtt tat catataa agctatt ctd agittatttga agagct cacc tacttitttitt 464 O tgtttittagt ttgttaaatt gttittatagg caatgtttitt aatctgttitt ctitta actta 47 OO Cagtgc catc agcticacact tcaaacctg tdgctgttcc gttgtag tag gtagcagtgc 476 O agagaaagta aataaggtag tittatttitat aatctagoaa atgatttgac totttaagac 482O tgatgatata t catggattg to atttaaat gig taggttgc aattaaaatg atc tagtagt 488 O ataaggaggc aatgtaat ct catcaaattig citaagacacic ttgttggcaac agtgagtttg 494. O aaataaactgagtaagaatc atttatcagt ttattittgat agctic ggaaa taccagtgtc 5 OOO agtag togt at aaatggittitt gagaatatat taaaatcaga tatataaaaa aaattactict 5060 tctattitc cc aatgttatct ttaacaaatc tdaagatagt catgtactitt togg tagtagt 512 O tccaaagaaa tottatttgt ttatt catct tdattt catt gtc.tt cqct t t ccttctaaa 518O tctgtc. cct t c tagggagct attgggatta agtggtcatt gattattata ctittatt cag 524 O taatgtttct gaccctitt cott cagtgcta cittgagttaa ttaaggatta atgaacagtt 53 OO acattt coaa gcattagcta ataaactaaa gcattttgca cittittct tca citgac catta 536 O gttagaaaga gttcagagat aag tatgtgt atc.tttcaat titcagcaaac ctaattittitt 542O aaaaaaagtt ttacatagga aatatgttgg aaatgatact ttacaaagat att cataatt 548 O tttittttgta at cago tact ttgtatattt acatgagcct taatttatat ttct catata 554. O accatttatg agagct tagt atacctgtgt cattatattg catctacgaa citagt gacct 5 6.OO tatt cottct gttacct caa acaggtggct titc catctgt gat ct coaaa gocttaggitt 566. O gcacagagtg actg.ccgagc tigctt tatga agggagaaag got coat agt tagtgttt 572 O tttitttittitt ttittaaac at ttitt.cccatc ctic catcctic titgagggaga atagottacc 578 O. tttitat cittgttittaatttg agaaagaagt togccaccact c taggttgaa aaccact cot 584 O ttaa cataat aactgtggat atggtttgaa tittcaagata gttacatgcc tttittattitt 59 OO t cctaataga gctgtagg to aaat attatt agaat cagat ttctaaatcc cacccaatga 596 O cctgct tatt ttaaatcaaa ttcaataatt aattctic titc tttittggagg atctgga cat 6O20 t ctittgat at ttcttacaac gaattt catg tdtag accca citaaacagaa gottataaaag 608 O ttgcatggtc. aaataagttct gagaaagttct gcagatgata taatt Cacct galagagt cac 614 O agtatgtagc caaatgttaa aggttittgag atgccataca gtaaatttac caa.gcattitt 62OO US 2016/0024496 A1 Jan. 28, 2016 47

- Continued ctaaattitat ttgaccacag aatcc ctatt ttaa.gcaa.ca actgttacat cocatggatt 626 O c caggtgact aaagaatact tattt cittag gatatgttitt attgataata acaattaaaa 632O titt cagatat ctitt cataag caaat cagtg gtc.tttittac tt catgttitt aatgctaaaa 638O tattitt ctitt tatagatagt cagaacatta tdoctttittctgacticcagc agagagaaaa 644. O tgct coaggit tatgtgaagc agaat catca tttaaatatgagt cagggct citttgtacaa 65OO ggcc togctaa aggtatagitt totagittatc acaagtgaaa ccacttittct aaaat cattt 656. O ttgagactict ttatagacaa at cittaaata ttagcattta atgitat citca tattgacatg 662O cc.ca.gagact gacttic ctitt acacagttct gcacatagac tatatgtc.tt atggattitat 668O agittagtatic at cagtgaaa caccatagaa taccc.tttgt gttcc aggtg ggit coctdtt 674 O cctacatgtc. tagcct cagg acttittttitt ttitta acaca togcttaaatc aggttgcaca 68OO tcaaaaataa gat catttct ttittalactaa atagatttga attittattga aaaaaaattit 6860 taaa catctt taagaa.gctt at aggattta agcaatticct atgitatgtgt actaaaatat 692 O atatatttct atatataata tat attagaa aaaaattgta tttittcttitt atttgagtict 698 O actgtcaagg agcaaaacag agaaatgtaa attagcaatt atttataata cittaaaggga 704 O agaaagttgttcaccittgtt gaatct atta ttgttatttic aattatagtic ccaagacgtg 71OO aagaaatago ttt cotaatg gttatgtgat tdt ct catag togact actitt cittgaggatg 716 O tagccacggc aaaatgaaat aaaaaaattit aaaaattgtt gcaaatacaa gttat attag 722 O gcttttgttgc attittcaata atgtgctgct atgaact cag aatgatagta tittaaatata 7280 gaaact agtt aaaggaaacg tagtttct at ttgagttata catat citta aattagaact 734 O tctic ctdtta aaggcataat aaagtgctta at actitttgt titcct cago a ccct ct catt 74 OO taattatata attittagttctgaaagggac ctataccaga tigcctagagg aaatttcaaa 746 O actatogatct aatgaaaaaa tatttaatag ttct c catgc aaatacaaat catatag titt 752O tccagaaaat acctittgaca ttatacaaag atgattatca cagcattata at agtaaaaa 758 O aatggaaata gcct ctittct tctgttctgt toatagdaca gtgcct cata cqcagtaggit 764 O tatt attaca tdgtaactgg ctaccc.caac tdattaggaa agaagtaaat ttgttittata 77OO aaaatacata ct cattgagg togcatagaat aattaagaaa ttaaaagaca cittgtaattit 776 O. tgaatccagt gaatacccac tdttaatatt tdgtatat ct ctittctagt c ttitttitt coc 782O ttittgcatgt attittctitta agact cocac ccc cactgga t catctotgc atgttctaat 788 O ctgcttttitt cacagoagat t ctaa.gc.ctic tittgaat atc aacacaaact tcaacaactt 794 O catctataga tigccaaataa taaatt catt tittatttact taaccacttic ctittggatgc 8 OOO ttaggit catt ctdatgttitt gctattgaaa ccaatgctat actgaac act tctgtcacta 806 O aaactittgca cacact catgaatagcttct taggataaat ttittagagat ggatttgcta 812 O aatcagagac catttitttaa aattaaaaaa caattatt ca tat cqtttgg catgtaagac 818O agtaaattitt cottt tattt togacaggatt caactggaag citttgttgct g c ctitt coggc 824 O aagt catgta togcticcatat cocaccacac acatagatgt gigatgtcaat actgtgaagic 83OO agatgccacc ctdt catgaa catatttata at cagogtag atacatgaga t cc.gagctga 8360

Cagcct tctg gaga.gc.cact t cagaagaag acatggctica ggatacgat C atctacactg 842O acgaaagctt tacticcitgat ttgtacgitaa tdctctgcct gctgg tact.g. tagt caa.gca 848 O US 2016/0024496 A1 Jan. 28, 2016 48

- Continued atatgaaatt gtgtc.ttitta cqaataaaaa caaaacagaa gttgcattta aaaagaaaga 854 O aat attacca gcagaattat gcttgaagaa acatttaatc aag catttitt ttcttaaatg 86OO ttctitc.ttitt to catacaat tdtgtttacc ctaaaatagg taagattaac cct taaagta 866 O aatatttaac tatttgttta ataaatatat attgagcticc taggcactgt totagg tacc 872O gggcttaata gtggccalacc agacagcc cc agc.cccagcc cct acattgt gtatagt ct a 878 O. titatgtaa.ca gttattgaat gigacittatta acaaaac caa agaagtaatt ctaagtic titt 884. O tttittcttga catatgaata taaaatacag caaaactgtt aaaatatatt aatggaacat 89 OO tttitt tactt togcatttitat attgttatt c acttct tatt ttitttittaaa aaaaaaag.cc 896 O tgaacagtaa attcaaaagg aaaagtaatgata attaatt gttgagcatg gacccaactt 9 O2O gaaaaaaaaa atgatgatga taaatctata atcctaaaac cctaagtaaa cacttaaaag 908 O atgttctgaa at caggaaaa gaattatagt at actitttgt gtttct ctitt tat cagttga 914 O aaaaaggcac agtagct cat gcct talaga acagagctitt gggagtgcaa ggCaggcgga 92OO t cacttgagg C caggagttc Cagaccagcc tiggcaa.cat agtgaaaccc Catct ct aca 926 O aaaaataaaa aagaattatt ggaatgtgtt totgttgttgcc totaatcct a gct attcc.ga 932 O aagctgaggc aggaggat.ct tttgagcc.ca ggagtttgag gttac aggga gtt atgatgt 93.8 O gccagtgtact coagcctgg ggaac accoa gactctgtct tatttaaaaa aaaaaaaaaa 944 O aaaatgcttg caataatgcc togg cacatag aaggtaacag taagttgttaa citgitaataac 95OO cCaggit ct aa gtgttgtaagg caatagaaaa attggggcaa ataagcctga Cctatgt at C 956 O tacagaatca gtttgagctt agg talacaga Cctgtggagc accagtaatt acacagtaag 962O tgttaaccaa aag catagaa taggaatat c ttgttcaagg gacccc.cagc cittatacatc 968 O t caaggtgca gaaagatgac ttaatatagg acccatttitt toctagttct c cagagttitt 974. O tattggttct tagaaagta gtaggggaat gttittagaaa atgaattggit C caactgaaa 98OO ttacatgtca gtaagtttitt atatattggit aaattittagt agacatgtag aagttittcta 986 O attaatctgt gcc titgaaac attitt cittitt titcctaaagt gct tag tatt ttitt.ccgttt 992 O tittgattggit tacttgggag ctitttittgag galaatttagt gaactgcaga atgggtttgc 998 O aaccatttgg tattitttgtt ttgttttitta gaggatgitat gtg tattitta acatttctta 2004 O at catttitta gccago tatgtttgttittgc tigatttgaca aactacagtt agacagot at 2010 O t ct cattttg citgat catga caaaataata t cotgaattt ttaaattittg catccagotc 2016 O taaattitt ct aaa.cataaaa ttgtc.caaaa aatag tattt to agccact a gattgttgttgt 2022 O taagtic tatt gtcacagagt cattt tactt ttalagtatat gtttittacat gttaattatg 2028O tttgttattt ttaattittaa citttittaaaa taatticcagt cactgccaat acatgaaaaa 2034 O ttgg to actg gaattitttitt tttgacttitt attittaggitt catgtgtaca totgcaggtg 204 OO tgttatacag gtaaattgcg tdt catgagg gtttggtgta Caggtgattt CattaccCag 20460 gtaataagca tag tacccaa tagg tagttt tttgatcctic acc ctitcticc caccct caag 2052O taggcc ct gg togttgctgtt to cittctttgttgtc.catgta tacticagtgt ttagctic cca 2058 O cittagaagtg agaacatgcg gtagttggitt ttctgttcct ggattagttc act taggata 2064 O atgaccticta gct coatctg gttitt tatgg ctgcatagta t t c catggtg tatatgtat c 2.07OO acatttitctt tat coagt ct accattgata ggcatttagg ttgattic cct gtc.tttgtta 2076 O US 2016/0024496 A1 Jan. 28, 2016 49

- Continued t catgaatag togctgtgatgaacatacaca tdcatgtgtc tittatgg tag aaaaatttgt 2082O attic ctittag gtacatatag aataatgggg ttgctagggit gaatggtag t t ct attitt ca 2088O gttatttgag aaatcttcaa actgcttitt cataatagota alactaattta cagt ccc.gcc 2094. O agcagtgitat aagttgttc.cc ttitt citccac aaccttgcca acatctgttga titttittgact 21 OOO ttittaataat agc cattcct agaga attga tittgcaattic tictattagtg at attaa.gca 2106 O ttttitt cata togctttittag ctgtctgt at at attcttct gaaaaattitt catgtcc titt 2112 O gcc.cagtttg tagtggggtg ggttgtttitt togcttgttaa ttagttittaa gttcc titcca 2118O gattctgcat atc cctttgt toggatacatg gtttgcagat atttittct c c cattgttgtag 2124 O gttgtc.ttitt actictdttga tagtttcttt togc catgcag gagct cqtta ggit co cattt 213 OO gtgtttgttt ttgttgcagt togcttittggc gtc.tt catca taaaatctgt gcc agggcct 21360 atgtccagaa togg tatttico taggttgtct tcc agggittt ttacaattitt agattittacg 2142O tittatgtc.tt taatcCatct tdagttgatt tttgtatatg gcacaaggaa gogggit coagt 21480 ttcact coaa titcctatogc tag caattat cocagolacca tittattgaat acggagt cct 2154 O titc.cccattg cittgttttitt gttcaactttgttgaagat.ca gatggttgta agtgtgtggc 216OO tittatttctt ggct ct citat t ct coattgg totatgtgtc. tdtttittata acagtaccct 21660 gctgttcagg titcctatago cittittagt at aaaatcggct aatgtgatgc ctic cagottt 21720 gttctttittg cittaggattig citttggct at ttgggct cot ttittggg to c at attaattit 21780 taaaac agitt ttittctggitt ttgttgaagga tat cattggit agtttatagg aatagcattg 2184 O aatctgtaga ttgctittggg cagtatggcc attittaacaa tattaattct tcc tat citat 219 OO gaatatggaa tdtttitt.cca totgtttgttgtcatctottt atacctgatg tataaagaaa 21960 agctgg tatt attcct actic aatctgttcc aaaaaattga goaggaggaa citct tcc ct a 22 O2O atgaggc.cag cat cattctg. ataccaaaac ctdgcagaga cacaacagaa aaaagaaaac 22 O8O ttcaggccaa tat cottgat gaatatagat gcaaaaatcc ticaacaaaat act agcaaac 2214 O caaatc.ca.gc agcacatcaa aaa.gctgatc tactittgatc aagtaggctt tat coctdgg 222 OO atgcaaggitt ggttcaac at acacaaatca ataagtgtga titcat cacat aaacagagct 2226 O aaaaacaaaa accacaagat tat ct caata ggtagagaaa aggttgtcaa taaaatttaa 2232O catcct coat gttaaaaacc titcagtaggit caggtgtagt gacticacacic totaatcc.ca 2238 O gcactittggg aggcca aggc gggcatat ct cittaa.gc.cca ggagttcaag acgagcc tag 2244. O gcagoatggit gaalacc cc at citctacaaaa aaaaaaaaaa aaaaaaatta gcttgg tatg 225 OO gtgacatgca Cctatagt cc cagct attca ggaggttgag gtgggaggat ttittgagcc 22560 cgggaggcag aggttggcag cagotgaga t catgccacc gcact coagc Ctgggcaacg. 2262O gagtgaga cc ctdtct caaa aaagaaaaat cacaaacaat cotaaacaaa citaggcattg 22 680 aaggaacatg cct caaaaaa ataagaac catctatgacag acccatagoc aatat cittac 2274. O caaatgggca aaa.gctggaa gtatt citcct tagaac.cgit aacaaga caa ggatgtcCaC 228OO t ct caccact c cttitt cago at agttctgg aagtic ctago cagagcaatic aggaaagaga 2286 O aagaaagaaa gacatt Caga taggalagaga agaagttcaaa ctatttctgt ttgcaggcag 2292O tata attctg tacctagaaa atctoatagt citctgcc cag aaact cotaa atctgttaaa 2298 O aattitcagca aagttittggc attctictata citccaac acc titccaaagtg agagcaaaat 23 O4 O US 2016/0024496 A1 Jan. 28, 2016 50

- Continued caagaacaca gtcc cattca caatagocgc aaaacgaata aaatacctag gaatc.ca.gct 231 OO alaccagggag gtgaaagatc tictatgagaa ttacaaaaca Ctgctgaaag aaatcagaga 2316 O tgacacaaac aaatggaaat gttcttttitt alacaccittgc tittatctaat t cact tatga 2322 O tgaagatact cattcagtgg aac aggtata ataagtic cac togattaaat ataagcc tita 2328O ttct ctitt co agagcc caag aagggg.cact at cagtgc.cc agt caataat gacgaaatgc 2334 O taat atttitt coccitttacg gtttctittct tctgtag tdt ggtacacticg titt cittaaga 234 OO taaggaaact togalactacct tcc tdtttgc titctacacat acccattctic tittttittgcc 2346 O actctggit caggtataggat gatcc ctacc actitt cagtt aaaaact cot cotct tact a 2352O aatgttct ct taccct ctdg cotgagtaga acctagggaa aatggaagag aaaaagatga 2.358 O aagggaggtggggcctggga agggaataag tagt cctgtt titttgttgttg tittgctt tag 23 64 O cacctgctat atcc taggtg ctgtgttagg cacacattat tittaagtggc cattatatta 237OO c tact actica citctggtcgt togccalaggta ggtag tact t t cittggatag ttggttcatg 23760 ttacttacag atggtgggct tttgaggca aacccagtgg ataat catcg gagtgtgttc 2382O tctaatctica citcaaattitt tott cacatt ttittggitttgttittggittitt tdatgg tagt 2388O ggct tattitt tdttgctggit ttgtttitttgtttittttittg agatggcaag aattgg tagt 2394 O tittatttatt aattgcctaa goggtotctac tittttittaaa agatgagagt agtaaaatag 24 OOO attgatagat a catacatac cct tactggg gactgctitat attctittaga gaaaaaatta 24O6 O catattagcc togacaaacac cagtaaaatg taalatatat c ctitgagtaaa taaatgaatg 24.12 O tatattttgt gtc.t.ccaaat atatatat ct at attcttac aaatgtgttt atatgtaata 2418O t caatttata agaacttaaa atgttggctic aagtgaggga ttgtggaagg tag cattata 2424 O tggc catttic aacatttgaa ctitttittctt ttctt cattt tottcttitt c titcaggaata 243 OO tttittcaaga tigt cittacac agaga cactic tagtgaaag.c ctitcc tiggat caggtaaatg 24360 ttgaacttga gattgtcaga gtgaatgata tdacatgttt tottttittaa tatat cotac 2442O aatgcc tigtt ctatatattt atatt cocct ggat catgcc ccagagttct gct cagdaat 2448 O tgcagttaag titagttacac tacagttct c agaagagtct gtgagggcat gtcaagtgca 24.54 O t cattacatt ggttgcct ct tdtcc tag at titatgctitcg ggaattcaga cctttgttta 24 6OO caatataata aat attattg citat cittitta aagatataat aataagatat aaagttgacc 24 660 acaact actg ttttittgaaa catagaattic ctdgtttaca totat caaag tdaaatctga 2472 O cittagotttt acagatataa tatatacata tatatat cott gcaatgcttg tactatatat 2478O gtag tacaag tatatatata totttgttgttg tdtatatata tatagitacga gcatatatac 24840 at attaccag cattgtagga tatatatatgtttatatatt aaaaaaaagt tataaactta 249 OO aaac cc tatt atgttatgta gagtatatgt tatatatgat atgtaaaata tataa catat 2496 O actic tatgat agagtgtaat at atttittta tatatattitt aacatttata aaatgataga 25 O2O attaagaatt gag toctaat ctdttittatt aggtgcttitt togtag tdtct ggit ctitt cita 2508O aagtgtctaa atgatttitt c ctitttgactt attaatgggg aagagcctgt at attaacaa 2514 O ttaa.gagtgc agcatt coat acgtcaaaca acaaacattt taattcaagc attaaccitat 252OO aacaagtaag titttittttitt ttttittgaga aagggaggitt gtttatttgc ctdaaatgac 2526 O tcaaaaat at ttittgaaaca tagtgtactt atttaaataa catctittatt gttt cattct 2532O US 2016/0024496 A1 Jan. 28, 2016 51

- Continued tittaaaaaat atc tacttaa ttacacagtt gaaggaaatc gtagattata toggaactitat 25380 ttcttaatat attacagttt gttataataa cattctgggg at caggc.cag gaaactgtgt 2544 O catagataaa gctittgaaat aatgagat co titatgtttac tagaaattitt ggattgagat 255OO citat gagg to tdtgacat at togcgaagttcaaggaaaatt cqtaggcct g gaattt catg 2556 O cittct caa.gc tigacataaaa tocct cocac tot coacctic at catatgca cacattctac 25 620 t cct acccac ccactic cacc ccctgcaaaa gtacaggitat atgaatgtct caaaaccata 2568 O ggct catct t c taggagctt caatgttatt tdaagatttg ggcagaaaaa attaagtaat 2574 O acgaaataac titatgtatga gttittaaaag tdaagtaaac atggatgitat tctgaagtag 258OO aatgcaaaat ttgaatgcat ttittaaagat aaattagaaa acttctaaaa actgtcagat 2586 O tgtctgggcc tigtggctta to ctgtaat CCC agcactt togagt ccg aggtgggtgg 2592O at caca aggt caggagat.cg agaccatcct gccaa.catgg toga aaccc.cg totctactaa 25.980 gtatacaaaa attagctggg C9tggcagcg tdtgcctgta atcc.ca.gct a cctgggaggc 2604 O tgaggcagga gaatcgcttgaac coaggag gtgtaggttg cagtgagtica agat.cgc.gcc 261OO actgcactitt agcctggtga cagagctaga citcc.gtc. tca aaaaaaaaaa aaaatat cag 2616 O attgttccta caccitagtgc titctatacca cactic ctdtt aggggggat.c agtggaaatg 2622 O gttaaggaga tigtttagtgt gtattgtctg ccaag cactg. tcaac actgt catagaaact 2628O tctgtacgag tagaatgtga gcaaattatgtgttgaaatg gttcc to tcc ctdcaggtot 2634 O ttcagotgaa acctggctta t ct ct cagaa gtactitt cott togcacagttt c tacttgtcc 264 OO ttcacagaaa agccttgaca ctaataaaat atatagaaga cqatacgtga gtaaaactic c 2646 O tacacggaag aaaaac ctitt gtacattgtt tttttgttitt gtttc ctittg tacatttitct 2652O atat cataat ttttgcgctt cittttitttitt tttittttittt tttittitt coa ttattitt tag 2658O gcagaaggga aaaaag.ccct ttaaatct ct tcggaac ctd aagatagacc ttgatttaac 26.64 O agcagagggc gat cittaa.ca taataatggc tictoggctgag aaaattaaac caggcctaca 267OO citcttittatc tittggaagac ctittctacac tagtgtgcaa gaacgagatgttctaatgac 2676 O tttittaaatg totaacttaa taa.gc.ctatt coat cacaat catgatcgct ggtaaagtag 2682O cticagtggtg toggggaaacg titc.ccctgga t catact coa gaattctgct citcagcaatt 2688O gcagttalagt aagttacact acagttctica Caagagcctg. taggggatgtcaggtgcat 26940 cattacattg ggtgtc.tc.tt titcctagatt tatgcttittg ggatacagac ctatotttac 27 OOO aatataataa at attattgc tat cittittaa agatataata ataggatgta aacttgacca 27O6 O caac tact.gt ttttittgaaa tacatgattic atggtttaca totgtcaagg tdaaatctga 2712 O gttggcttitt acagatagitt gactittctat cittittgg cat t ctittggtgt gtagaattac 2718O tgtaat actt ctdcaatcaa citgaaaacta gagcc tittaa atgatttcaa titccacagaa 2724 O agaaagtgag Cttgaacata ggatgagctt tagaaagaaa attgat Caag Cagatgttta 273OO attggaattig attattagat cotactttgt gigatttagtic cct gggattic agtctgtaga 2736 O aatgtctaat agttct citat agt cottgtt cotggtgaac cacagttagg gtgttttgtt 2742O tattittattgttcttgct at tdttgatatt citatgtagtt gagctctgta aaaggaaatt 2748 O gtattt tatgttt tagtaat tdttgccaac tttittaaatt aattitt catt atttittgagc 2754 O caaattgaaa totgcacctic ctdtgccttt tttct cotta gaaaatctaa ttacttggaa 276OO US 2016/0024496 A1 Jan. 28, 2016 52

- Continued caagttcaga titt cactggit cagt catttt catcttgttt tottcttgct aagtc.ttacc 2766 O atgtacctgc tittggcaatc attgcaactic tdagattata aaatgccitta gagaatatac 2772O taactaataa gat cittttitt to agaaacag aaaatagttc ctitgagtact tcc ttcttgc 2778O atttctgcct atgtttittga agttgttgct gtttgcc tigc aataggctat aaggaatagc 2784 O aggagaaatt ttactgaagit gctgttitt co taggtgctac tittggcagag ctaagttat c 279 OO ttttgtttitc ttaatgcgtt toggaccattt togctggctat aaaataact g attaatataa 2796 O ttctaacaca atgttgacat td tagttaca caaacacaaa taaat attitt atttaaaatt 28 O2O ctggaagtaa tataaaaggg aaaatatatt tataagaaag ggataaaggit aatagagcc c 28O8O ttctg.ccc cc cacccaccaa atttacacaa caaaatgaca togttctgaatg togaaagg to a 2814 O taatagctitt cocatcatga at cagaaaga tigtggacago ttgatgttitt agacaac cac 282OO tgaact agat gactgttgta citgtagctica gtcatttaaa aaatatataa atactacctt 2826 O gtag togtocc at actgtgtt ttitta catgg tagatt citta tittaagtgct aactggittat 2832O tittctittggc tiggitttattg tactgttata cagaatgtaa gttgtacagt gaaataagtt 2838O attaaag.cat gtgtaaac at tdttatatat cittitt ct colt aaatggagaa ttittgaataa 28440 aatatatttgaaattittgcc tictitt cagtt gttcatt cag aaaaaaatac tatgatattt 285OO gaag actgat cagcttctgt toagctgaca gtcatgctgg atctaaactt tttittaaaat 2856 O taattttgtc. ttittcaaaga aaaaatattt aaagaagctt tataatataa tot tatgtta 28 62O aaaaaactitt ctdcttaact citctggattt cattttgatt tttcaaatta tat attaata 2868 O tittcaaatgt aaaatact at ttagataa at tdtttittaaa cattct tatt attataatat 2874 O taatataacc taaactgaag titatt catcc caggitaticta atacatgitat coaaagtaaa 288OO aatccaagga atctgaacac titt catctgc aaa.gctagga at aggtttga cattitt cact 2886 O c caagaaaaa gtttittttitt gaaaatagaa tagttgggat gagaggtttic tittaaaagaa 2892O gactaactga t cacattact atgattctica aagaagaaac caaaact tca tataatact a 2898O taaagtaaat ataaaatagt to cittctata gtatatttct ataatgctac agitttaalaca 2904 O gat cact citt atataatact attittgattt tdatgtagaa ttgcacaaat tdatatttct 291OO cctatogatct gcagggtata gcttaaagta acaaaaacag tdalaccacct c catttalaca 29160 cacagtaa.ca citatgggact agttitt atta citt coattitt acaaatgagg aaactaaagc 2922O ttaaagatgt gtaatacacc gcc caagg to acacagotgg taaaggtgga titt catcc.ca 2928O gacagttaca gtcattgcca togggcacago toctaactta gtaactic cat gtaactggta 2934 O Ctcagtgtag ctgaattgaa aggagagtaa ggaag caggit tttac aggt c tacttgcact 294 OO attcagagcc cqagtgttgaa tocctgctgt gctgcttgga gaagttactt aacctatgca 2.9460 aggttcattt totaaatatt ggaaatggag tdataatacg tactt cacca gaggatttaa 2952O tgag acctta tacgatcc tt agttcagtac ctdactagtg citt cataaat gotttitt cat 2958O c caatctgac aatcto cago ttgtaattgg ggcatttaga acatttaata tdattattgg 2964 O catgg taggit taaagctgtc atc.ttgctgt tttct atttgttcttitttgt tttct cotta 297OO cittittggatt tttittatt ct actatgtc.tt ttctattgtc. ttattaact a tactic tittga 2976 O tittattittag toggttgttitt agggittatac ct ctittctaa tttaccagtt tataaccagt 2982O ttatatacta cittgacatat agcttaagaa act tactgtt gttgtc.ttitt togctgttatg 2988 O

US 2016/0024496 A1 Jan. 28, 2016 54

- Continued Ile Lieu. Gly Pro Arg Val Arg His Ile Trp Ala Pro Llys Thr Glu Glin 4 O 45 SO gta citt ct c agit gat giga gaa ata act titt citt gcc aac cac act cta 3O8 Val Lieu. Lieu. Ser Asp Gly Glu Ile Thr Phe Lieu Ala Asn His Thir Lieu 55 60 65 aat gga gala at C Ctt cqa aat gca gag agt ggit gct at a gat gta aag 356 Asn Gly Glu Ile Lieu. Arg Asn Ala Glu Ser Gly Ala Ile Asp Wall Lys 70 7s 8O titt titt gtc ttgtct gaa aag gga gtg att att gtt to a tta atc titt 4O4. Phe Phe Val Lieu Ser Glu Lys Gly Val Ile Ile Val Ser Lieu. Ile Phe 85 9 O 95 gat gga aac tog aat ggg gat cqc agc aca tat gga cta to a att at a 452 Asp Gly Asn Trp Asn Gly Asp Arg Ser Thr Tyr Gly Lieu. Ser Ile Ile 1 OO 105 11O 115 citt coa cag aca gaa citt agt titc tac ct c cca citt cat aga gtg tdt SOO Lieu Pro Gln Thr Glu Lieu Ser Phe Tyr Lieu Pro Leu. His Arg Val Cys 12O 125 13 O gtt gat aga tta aca Cat ata at C cqg aaa gga aga at a tigg atg cat 548 Val Asp Arg Lieu. Thir His Ile Ile Arg Lys Gly Arg Ile Trp Met His 135 14 O 145 aag gala aga caa gaa aat gtc. cag aag att atc tta gaa ggc aca gag 596 Lys Glu Arg Glin Glu Asn Val Glin Lys Ile Ile Lieu. Glu Gly Thr Glu 15 O 155 16 O aga atg gala gat Cag ggt cag agt att att coa atg Ctt act gga gala 644 Arg Met Glu Asp Gln Gly Glin Ser Ile Ile Pro Met Lieu. Thr Gly Glu 1.65 170 175 gtg att cot gta atg gaa citg citt to a tot atgaaa to a cac agt gtt 692 Val Ile Pro Val Met Glu Lieu. Leu Ser Ser Met Lys Ser His Ser Val 18O 185 190 195 cct gala gaa at a gat at a gct gat aca gta citc aat gat gat gat att 74 O Pro Glu Glu Ile Asp Ile Ala Asp Thr Val Lieu. Asn Asp Asp Asp Ile 2 OO 2O5 21 O ggit gac agc tigt cat gaa gogo titt citt ct c aat gcc atc agc tica cac 788 Gly Asp Ser Cys His Glu Gly Phe Lieu. Lieu. Asn Ala Ile Ser Ser His 215 22 O 225 ttg caa acc tit ggc tigt to C gtt gta gta ggit agc agt gca gag aaa 836 Lieu Gln Thr Cys Gly Cys Ser Val Val Val Gly Ser Ser Ala Glu Lys 23 O 235 24 O gta aat aag at a gtc aga aca tta tdc citt titt ctd act coa gca gag 884 Val Asn Lys Ile Val Arg Thr Lieu. Cys Lieu. Phe Lieu. Thr Pro Ala Glu 245 250 255 aga aaa toc toc agg tta tdt gala gca gaa tota t cattt aaa tat gag 932 Arg Lys Cys Ser Arg Lieu. Cys Glu Ala Glu Ser Ser Phe Llys Tyr Glu 26 O 265 27 O 27s t ca ggg ct c titt gta Caa ggc ctg cta aag gat tca act gga agc titt 98 O Ser Gly Lieu Phe Val Glin Gly Lieu. Leu Lys Asp Ser Thr Gly Ser Phe 28O 285 29 O gtg citg cct titc cqg caa gtc atg tat gct coa tat coc acc aca cac 1028 Val Lieu Pro Phe Arg Glin Val Met Tyr Ala Pro Tyr Pro Thr Thr His 295 3OO 305 ata gat gtg gat gtc. aat act gtg aag cag atg cca CCC tit cat gala 1076 Ile Asp Val Asp Val Asn Thr Val Lys Gln Met Pro Pro Cys His Glu 31 O 315 32O cat att tat aat cag cqt aga tac atgaga toc gag citg aca gcc titc 1124 His Ile Tyr Asn Glin Arg Arg Tyr Met Arg Ser Glu Lieu. Thir Ala Phe 3.25 330 335 tgg aga gcc act tca gaa gaa gac atg gct cag gat acg at C at C tac 1172 US 2016/0024496 A1 Jan. 28, 2016 55

- Continued Trp Arg Ala Thir Ser Glu Glu Asp Met Ala Glin Asp Thir Ile Ile Tyr 34 O 345 350 355 act gac gaa agc titt act c ct gat ttgaat att titt caa gat gtc tta 22 O Thr Asp Glu Ser Phe Thr Pro Asp Lieu. Asn Ile Phe Glin Asp Val Lieu. 360 365 37 O cac aga gac act cta gtg aaa gcc ttic ctg gat cag gtc titt cag Ctg 268 His Arg Asp Thir Lieu Val Lys Ala Phe Lieu. Asp Glin Val Phe Glin Lieu. 37s 38O 385 aaa cct ggc tita t ct citc aga agt act titc ctit gca cag titt cita citt 316 Llys Pro Gly Lieu. Ser Lieu. Arg Ser Thr Phe Lieu Ala Glin Phe Lieu. Lieu. 390 395 4 OO gtc. citt cac aga aaa goc titg aca cita ata aaa tat at a gaa gac gat 364 Val Lieu. His Arg Lys Ala Lieu. Thir Lieu. Ile Llys Tyr Ile Glu Asp Asp 405 410 415 acg cag aag gga aaa aag CCC titt aaa tot ctt cq9 aac Ctg aag at a 412 Thr Glin Lys Gly Llys Llys Pro Phe Llys Ser Lieu. Arg Asn Lieu Lys Ile 42O 425 43 O 435 gac Ctt gat tta aca gca gag ggc gat Ctt aac ata ata atg gct ctg 460 Asp Lieu. Asp Lieu. Thir Ala Glu Gly Asp Lieu. Asn. Ile Ile Met Ala Lieu 4 4 O 445 450 gct gag aaa att aaa cca ggc cta cac tot titt atc titt gga aga cct 508 Ala Glu Lys Ile Llys Pro Gly Lieu. His Ser Phe Ile Phe Gly Arg Pro 45.5 460 465 titc tac act agt gtg caa gaa cqa gat gtt cta atg act ttt taa 553 Phe Tyr Thr Ser Val Glin Glu Arg Asp Val Lieu Met Thr Phe 47 O 475 480 atgtgtaact taataagcct attic catcac aat catgatc gctgg taaag tagct cagtg 613 gtgtggggaa acgttc.ccct ggat catact C caga attct gct ct cagca attgcagtta 673 agtaagttac act acagttct cacalaga.gc ctgtgagggg atgtcaggtg cat cattaca 733 ttgggtgtct cittitt.cctag atttatgctt ttgggataca gacctatgtt tacaatataa 793 taaatatt at tdctat ctitt taaagatata ataataggat gtaaacttga ccacaactac 853 tgtttittittgaaatacatga t t catggttt acatgtgtca aggtgaaatc tdagttggct 913 tttacagata gttgactitt c tat cittittgg cattctittgg togtgtagaat tactgtaata 973 cittctgcaat caactgaaaa citagagcctt taaatgattt caatticcaca gaaagaaagt 2O33 gaggttgaac at aggatgag Ctttagaaag aaaattgat C aag Cagatgt ttaattggaa 2093 ttgatt atta gatcct actt tdtggattta gtc.cctggga titcagtctgt agaaatgtct 2153 aatagttctic tatagt cctt gttcc tiggtg aaccacagtt agggtgttitt gtttattitta 2213 ttgttcttgc tattgttgat attctatota gttgagctct gtaaaaggaa attgt attitt 2273 atgttt tagt aattgttgcc aactttittaa attaattittc attatttittg agccaaattg 2333 aaatgtgcac ctic ctdtgcc titttittct cottagaaaatc taattactitg gaacaagttc 23.93 agattt cact ggit cagt cat titt catcttgttittcttctt gctaagt citt accatgtacc 2453 tgctittggca at cattgcaa citctgagatt ataaaatgcc ttagagaata tactalactaa 2513 taagat ctitt ttitt cagaaa cagaaaatag titccttgagt act tcct tct togcatttctg 2573

Cctatgttitt taagttgtt gctgtttgcc ticaataggc tataaggaat agcaggagaa 2633 attt tact ga agtgctgttt toctaggtgc tactittggca gagctaagtt atc.ttttgtt 2693 ttcttaatgc gtttggacca ttittgctggc tataaaataa citgattaata taattictaac 2753 acaatgttga cattgtagtt acacaaacac aaataaatat tittatttaaa attctggaag 2.813 US 2016/0024496 A1 Jan. 28, 2016 56

- Continued taatataaaa gggaaaat at atttataaga aagggataaa ggtaatagag ccCttctgcc 2873 c cccacccac caaatttaca caacaaaatg acatgttcga atgtgaaagg toataatagc 2.933 titt.cccatca tdaatcagaa agatgtggac agcttgatgt tittagacaac cactgaacta 2993 gatgactgtt gtactgtagc ticagt cattt aaaaaatata taaatactac Cttgtag tdt 3 O53 cc catact.gt gtttitt taca togg tagattic titatttalagt gctaactggit tattittctitt 31.13 ggctggittta ttgtactgtt atacagaatg taagttgtac agtgaaataa gtt attaaag 3173 catgtgtaaa cattgttata tat cittitt ct c ctaaatgga gaattittgaa taaaatatat 3233 ttgaaattitt g 3244

<210s, SEQ ID NO 5 &211s LENGTH: 761 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (693 ) . . (693) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (.722) . . (722) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 5 Cacgaggctt tatatttct tacaacga at ttcatgtgta gaccCactala acagaagct a 60 taaaagttgc atggtcaaat aagttctgaga aagttctgcag atgatataat it cacctgaag 12 O agt cacagta totago caaa tdttaaaggt tttgagatgc catacagtaa atttaccaag 18O cattttctaa atttatttga ccacagaatc cct attittaa gcaacaactg ttacatcc.ca 24 O tggatticoag gtgactaaag aatact tatt tottaggata tottt tattgataataacaa 3OO ttaaaatttic agatat ctitt cataa.gcaaa toagtggtct ttt tact tca tdttittaatg 360 ctaaaatatt ttcttittata gatagt caga acattatgcc tttittctgac tocagcagag 42O agaaaatgct c caggittatg togaagicagaa toat cattta aatatgagtic agggctic titt 48O gtacaaggcc tictaaagga ttcaactgga agctttgttgc tigc ctitt cog gcaagt catg 54 O tatgct coat atc.ccaccac acacatagat gtggatgtca atact.gtgaa goagatgc.ca 6OO c cct gt catgaacatattta taatcagogt agata catga gatcc.gagct gacagcc titc 660 tggaga.gc.ca citt Cagaaga agacatggct Cangatacga t catctacac tacgaaagc 72 O tntact cotg atttgaat at ttittcaagat gtc.ttacaca g 761

<210s, SEQ ID NO 6 &211s LENGTH: 1901 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (125) . . (793)

<4 OOs, SEQUENCE: 6 acgtaaccta C9gtgtc.ccg Ctaggaaaga gaggtgcgt.c aaa.ca.gcgac aagttcc.gc.c 6 O cacgtaaaag atgacgcttg at at Ctc.cgg agcatttgga taatgtgaca gttggaatgc 12 O agtg atgtcg act citt togc cca ccg cca tot coa gct gtt gcc aag aca 169 Met Ser Thr Lieu. Cys Pro Pro Pro Ser Pro Ala Val Ala Lys Thr US 2016/0024496 A1 Jan. 28, 2016 57

- Continued

1. 5 1O 15 gag att got tta agt gigo aaa to a cct tta tta gca gct act titt got 217 Glu Ile Ala Lieu. Ser Gly Llys Ser Pro Lieu. Lieu Ala Ala Thr Phe Ala 2O 25 3O tac tog gac aat att Ctt ggit cot aga gta agg cac att tog gCt cca 265 Tyr Trp Asp Asn. Ile Lieu. Gly Pro Arg Val Arg His Ile Trp Ala Pro 35 4 O 45 aag aca gaa cag gta citt citc agit gat gga gaa ata act titt citt go c 313 Llys Thr Glu Glin Val Lieu Lleu Ser Asp Gly Glu Ile Thr Phe Lieu Ala SO 55 60 aac cac act cta aat gga gaa at C Ctt ca aat gca gag agt ggit gct 361 Asn His Thir Lieu. Asn Gly Glu Ile Lieu. Arg Asn Ala Glu Ser Gly Ala 65 70 7s ata gat gta aag titt titt gtc ttgtct gala aag giga gtg att att gtt 4O9 Ile Asp Val Llys Phe Phe Val Lieu. Ser Glu Lys Gly Val Ile Ile Val 8O 85 9 O 95 t ca tta at C titt gat gga aac tog aat ggg gat CC agc aca tat gga 457 Ser Lieu. Ile Phe Asp Gly Asn Trp Asn Gly Asp Arg Ser Thr Tyr Gly 1 OO 105 11 O cta toa att at a citt coa cag aca gaa citt agt titc tac ct c cca citt 505 Lieu. Ser Ile Ile Leu Pro Gln Thr Glu Lieu Ser Phe Tyr Lieu. Pro Leu 115 12 O 125

Cat aga gtg tdt gtt gat aga tta aca cat ata atc. c99 aaa gga aga 553 His Arg Val Cys Val Asp Arg Lieu. Thir His Ile Ile Arg Lys Gly Arg 13 O 135 14 O ata tig atg cat aag gaa aga caa gala aat gtc. Cag aag att at C tta 6O1 Ile Trp Met His Lys Glu Arg Glin Glu Asn Val Glin Lys Ile Ile Lieu. 145 150 155 gaa ggc aca gag aga atg gaa gat cag ggit cag agt att att coa atg 649 Glu Gly Thr Glu Arg Met Glu Asp Glin Gly Glin Ser Ile Ile Pro Met 16 O 1.65 17O 17s citt act gga gaa gtg att cot gta atg gaa citg citt to a tot atgaaa 697 Lieu. Thr Gly Glu Val Ile Pro Val Met Glu Lieu Lleu Ser Ser Met Lys 18O 185 19 O tca cac agt gtt colt gaa gaa at a gat at a got gat aca gta ct c aat 74. Ser His Ser Val Pro Glu Glu Ile Asp Ile Ala Asp Thr Val Lieu. Asn 195 2OO 2O5 gat gat gat att ggit gac agc tigt cat gala ggc titt Ctt ct c aag tala 793 Asp Asp Asp Ile Gly Asp Ser Cys His Glu Gly Phe Lieu. Lieu Lys 21 O 215 22O gaatttittct titt cataaaa gctggatgaa goagatacca tot tatgctic accitatgaca 853 agatttggaa gaaagaaaat a acagactgt Ctact tagat tittctaggg acattacgta 913 tittgaactgt togcttaaatt tdtgttattt tt cact catt at atttctat atatatttgg 973 tgttatt cca tttgct attt aaagaaac cq agttt coat c ccagacaaga aat catggcc O33 ccttgcttga ttctggitt to ttgttt tact tct cattaaa gctaacagaa toctitt cata O93 ttaagttgta citgtagatga acttaagtta tittagg.cgta gaacaaaatt att catattt 153 at actgat ct tttitccatcc agcagtggag tittag tactt aagagtttgt gcc cittaaac 213

Cagact coct ggattaatgc tigtgt acccg tdggcaaggit gcctgaattic tictatacacc 273 tattitcct catctgtaaaat gigcaataata gtaatag tac ctaatgtgta gggttgttat 333 aagcattgag taagataaat aatataaag.c acttagaaca gtgcc tiggaa cataaaaa.ca 393 cittaataata gct catagct aacatttic ct atttacattt cittctagaaa tagcc agitat 453 US 2016/0024496 A1 Jan. 28, 2016 58

- Continued ttgttgagtg cct acatgtt agttc ctitta ctagttgctt tacatgitatt atc.ttatatt 1513 ctgttittaaa gtttctt cac agittacagat titt catgaaa titt tacttitt aataaaagag 1573 aagtaaaagt ataaagtatt cacttittatgttcacagtct titt cott tag got catgatg 1633 gagtat caga ggcatgagtg tdtttalacct aagagcctta atggcttgaa t cagalagcac 1693 tittagt cctd tatctgttca gtgtcago: ct tt catacatc attittaaatc ccatttgact 1753 ttaagtaagt cacttaatct citctacatgt caatttctitc agctataaaa tdatgg tatt 1813 t caataaata aatacattaa ttaaatgata ttatactgac taattgggct gttittaaggc 1873 aaaaaaaaaa aaaaaaaaaa aaaaaaaa. 1901

<210s, SEQ ID NO 7 &211s LENGTH: 562 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (166) ... (166) <223> OTHER INFORMATION: n is a, c, g, or t <4 OO > SEQUENCE: 7 agacgtaacc tacggtgtcc cqctaggaaa gagagat atc. tcc.ggagcat ttggataatg 6 O tgacagttgg aatgcagtga tigt cqact ct ttgcc caccq ccatc to cag ctgttgccaa 12 O gacagagatt gctittaagtg gcaaatcacc titt attagoa gctacnttitt gct tactggg 18O acaat attct tdtcc taga gta aggcaca tttgggcticc aaagacagala Cagg tacttic 24 O t cagtgatgg agaaataact tttcttgcca accacactict aaatggagaa atc ctitcgaa 3OO atgcagagag tdtgctata gatgtaaagt tttttgtctt gtctgaaaag ggagtgatta 360 ttgttt catt aatctttgat ggaaactgga atggggat.cg cagcacatat ggact at Caa 42O ttatact tcc acagacagaa cittagtttct acctic cc act t catagagtg tdtgttgata 48O gattalacaca tataatc.cgg aaaggaagaa tatggatgca taaggaaaga Caagaaaatg 54 O tccagaagat tat cittagaa gg 562

<210s, SEQ ID NO 8 &211s LENGTH: 798 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (81) . . (590)

<4 OOs, SEQUENCE: 8 gggctictott ttggggggggggit ct agdala gag cagatat Ctc.cggagca tttggataat 6 O gtgacagttg gaatgcagtg atgtcg act Ctt to cca cc.g. cca tot coa gct 113 Met Ser Thr Lieu. Cys Pro Pro Pro Ser Pro Ala 1. 5 1O gtt gcc aag aca gag att gct tta agt ggc aaa to a cct tta tta gca 161 Val Ala Lys Thr Glu Ile Ala Lieu. Ser Gly Lys Ser Pro Lieu. Lieu Ala 15 2O 25 gct act titt got tac togg gac aat att citt ggit cot aga gta agg cac 209 Ala Thr Phe Ala Tyr Trp Asp Asn. Ile Lieu. Gly Pro Arg Val Arg His 3O 35 4 O att tog gct coa aag aca gaa cag gta Ctt citc agt gat gga gala at a 257 Ile Trp Ala Pro Llys Thr Glu Glin Val Lieu. Lieu. Ser Asp Gly Glu Ile 45 SO 55

US 2016/0024496 A1 Jan. 28, 2016 71

- Continued c ctittggagg tottitt cagt acccttgttgt ccagagccaa ccagaga cag caattaccca 2526 O atatggagtt ctdaaatgaa agt cagttitt atttic ctdtt aatggcagaa ataagaacaa 2532O aacgaalacag cagaag catt ttggaagctt gcttgtttct cagtgatggg agcaa.cattt 25380 ttctgagcca gataatagitt tttcaaacac giggtgggaca tttctgcatt tttacgtgat 2544 O gcataaacag tagctaaatt taatc.cccat tatatactta gcactttaca aagtictagoc 255OO agacaataaa goatgaagica agtgctat ct tcatttic cat gig tatgggta cittctaggat 2556 O caccaatcto caac catcac catgttgctgaacttgttgta aaattgagca gtaacacaca 2562O ctgacatttic taccattcat acact acagg taagtacaca citcaagagcg tagataatag 2568 O taaactgtaa taaaatgagt taggaaatta ataagcgtgg ctatttgtta catttgttitt 2574 O tagt cattga gctgcaa.gca taaagagttgaaattittaat aatagittata tittaaaacca 258OO ggtc. cacaag totgaagaac ttaataactglaccataatct ggtttgatct ggttctatot 2586 O agtacaccac cagtgtgtgt gtgcgtgtgt gct cotatgc at acttatac attaaaaaaa 2592 O aaaaagatat cotatgctitc aatttittaac ataaaataac cittctgacag ctgggtggtg 25.980 gtggtggtgc atgtctittaa ttgcagcact Caggaggcag gggcaggtgg gtc.tctgggt 2604 O t caaggc.ca.g. tctggitttac agagc.cagtt Ctaggacagc Cagggctaca cagagaalacc 261OO ttgtttcaag acaaaacgaa acaaaacaac cacaaataaa aaatatat ct ttittgatgtt 2616 O tccaaatcag caggtgtata taact ctitta actittaatag taa.ca.gtgta tttacct cag 2622O tittgg tagcc tdggat.cc at tdagctgttt ct cactaagc agtgttittgg ttgttggittt 2628O tttitttittitt tttitttitttt ttttgtattt agttcatagt ttcaacact g attgtcc titg 2634 O gaat cittctt cagagtttitt ttttittttitt ttttittaaag atttattitat ttatt attitt 264 OO atttaagtac actittagctg actitcagaca caccagaaga goggtgtcaga t ct cattacg 2646 O gatgttagtg agccaccatg tdgttgctgg gatttgaact Ctggaccttic ggaagaacag 2652O tcqgtgct ct taaccactga gcc at citctic cagc.cccaga gttittctaaa tagaactatg 2658O agt caatticc tatctgtgga ttgctgtatic aaagaacatg tdagttttgt attgctg.cgc 26.64 O tgcttittcta aaggggattic ctdatgaaac gag tigtttac togctctgat c tictdgtgaac 267OO agtggaaagg tta accqaaa tagaaggcca citgtttgttc taaagctitta acatttgtaa 2676 O gccttittgca aaatgct citc tatttgcaga aaaactagag gaattagaaa aagtttic cag 2682O ggat.cccago: aatgagaatc ctaaactaag agacctic tac ttggit cittac aagaagagta 2688O c cacttaaag ccagagacca agaccattct citt cqtgaag accagagcac togtggatgt 2694. O aagtgttgttgt gtttacagat tagctictagt ttattgaaaa gottgc.ccgt tott cactgc 27 OOO cittataatca agtatic cata catgtgtgga cct gttctga tigatttgttc ttacaccaat 27O6 O tgtcattgtt totattgacc cacagttata agt cittgg to ctatagagga agc cctdcat 2712 O c ctittittaaa aatttaaaat titccact tcc agt catcctg. taggittittga ttaatgact a 2718O atgtgtc.tta tatacct cac agittatctitc at atcatctt ttaaaaataa titt acticaga 2724 O ttittaaaaac cagttittaaa attgggcaat giggctggaga tacagct caa tdgtoaaatg 273 OO cittgttcago atgcatgact ttaatcc.cca gttctggaaa aagatagata t ct citctgtt 2736 O tatgtagaat gcc titgagtic toggccacago goctocct cit gtt tatgtag aatgcctgca 2742O ttgtttctgc tigagtagtag attacccata gagccagagg cagaaaaagt caa.gctittat 2748 O

US 2016/0024496 A1 Jan. 28, 2016 79

- Continued gcatcCtaag gacago agga gaact ctdac cc.cagtgcta titt ct citagg togctattgttg 2875 gcaaacticaa goggtc.cgtc tctgtc.cctg taacgttcgt. accttgctgg Ctgtgaagta 2935

Ctgactggta aagctic.cgtg ctacagoagt gtagggtata cacaaacaca agtaagtgtt 2995 ttatttaaaa citgtgg actt agcataaaaa gggagacitat atttatttitt tacaaaaggg ataaaaatgg aaccctitt co to accoacca gatttagtica gaaaaaaa.ca ttctatt citg 31.15 aaaggt caca gtggittittga catgacacat Cagaacaacg cacactgtcc atgatggctt 31.75 atgaacticca agt cacticca t catggtaaa tgggtagatc cct cottcta gtgtgccaca 3235 c cattgct tcc cacagtaga at Cttattta agtgctaagt gttgttct ctd citggtttact 3.295 ctgttgttitt agagaatgta agttgtatag tgaataagtt attgaag cat gtgtaaacac 3355 tgttatacat cittittctoct agatggggala tittggaataa aatacct tta aaatt Caaaa. 3415 aaaaaaaaaa aaaaaaaaaa. 3435

SEQ ID NO 13

SEQUENCE: 13

OOO

SEQ ID NO 14

SEQUENCE: 14

OOO

SEO ID NO 15

SEQUENCE: 15

OOO

SEQ ID NO 16

SEQUENCE: 16

OOO

SEO ID NO 17

SEQUENCE: 17

OOO

SEQ ID NO 18

SEQUENCE: 18

OOO

SEQ ID NO 19

SEQUENCE: 19

OOO

SEQ ID NO 2 O LENGTH 19 TYPE: DNA ORGANISM: Artificial sequence US 2016/0024496 A1 Jan. 28, 2016 80

- Continued

FEATURE: OTHER INFORMATION: Synthetic oligonucleotide FEATURE: NAMEAKEY: misc feature LOCATION: 1, 2, 3, 4, 5, 15, 16, 17, 18, 19 OTHER INFORMATION: bases at these positions are RNA SEQUENCE: 2O cc cauticcag titt coauca 19

SEQ ID NO 21 LENGTH: 21 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide FEATURE: NAMEAKEY: misc feature LOCATION: 1, 2, 3, 4, 5, 6, 17, 18, 19, 20, 21 OTHER INFORMATION: bases at these positions are RNA SEQUENCE: 21 gcggcutgtt t cc ctic culug lu. 21

SEQ ID NO 22 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide FEATURE: NAMEAKEY: misc feature LOCATION: 1, 2, 3, 4, 5, 16, 17, 18, 19, 20 OTHER INFORMATION: bases at these positions are RNA SEQUENCE: 22 gcc.ccggc cc ctagdgcgcg

SEQ ID NO 23 LENGTH: 2O TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide FEATURE: NAMEAKEY: misc feature LOCATION: 1, 2, 3, 4, 5, 16, 17, 18, 19, 20 OTHER INFORMATION: bases at these positions are RNA SEQUENCE: 23 cc.cgaccacg ccc.cggcc cc

SEQ ID NO 24 LENGTH 19 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide FEATURE: NAMEAKEY: misc feature LOCATION: 1, 2, 3, 4, 5, 16, 17, 18, 19 OTHER INFORMATION: bases at these positions are RNA

SEQUENCE: 24 agccacct tc. tccaac clug 19 US 2016/0024496 A1 Jan. 28, 2016 81

- Continued

<210s, SEQ ID NO 25

<4 OOs, SEQUENCE: 25

OOO

<210s, SEQ ID NO 26

<4 OOs, SEQUENCE: 26

OOO

<210s, SEQ ID NO 27

<4 OOs, SEQUENCE: 27

OOO

<210s, SEQ ID NO 28 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 28 gcct tact ct aggaccaaga 2O

<210s, SEQ ID NO 29 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 29 ggta acttica aacticttggg 2O

<210s, SEQ ID NO 3 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 30 tacaggctgc ggttgttt Co 2O

<210s, SEQ ID NO 31 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 31 ccggcc.ccgg ccc.cggcc cc 2O US 2016/0024496 A1 Jan. 28, 2016

1.-99. (canceled) 116. The method of claim 108, wherein at least one nucleo 100. A method comprising normalizing expression of any base of the modified oligonucleotide is a modified nucleo of EDN1, NEDD4L, FAM3C, CHRDL1, CP, SEPP1, SER base. PINE2, C3, EDNRB2, or Endothelin in a cell by administer 117. The method of claim 109, wherein at least one nucleo ing to the cell an amount of a compound comprising an base of the modified oligonucleotide is a modified nucleo oligonucleotide consisting of 12 to 30 linked nucleosides, base. wherein the oligonucleotide is at least 90% complementary to 118. The method of claim 116, wherein the modified a C9CRF72 nucleic acid. nucleobase is a 5-methylcytosine. 101. A method comprising reducing nuclear retention of 119. The method of claim 117, wherein the modified any of ADARB2, CYP2C9, DPH2, HMGB2, JARID2, MITF, nucleobase is a 5-methylcytosine. MPP7, NDST1, NUDT6, ORAOV1, PGA5, PTER, RAN GAP1, SOX6, TCL1B, TRIM32, WBP11, or ZNF695 in a 120. The method of claim 108, wherein at least one nucleo cell by administering to the cell an amount of a compound side of the modified oligonucleotide comprises a modified comprising an oligonucleotide consisting of 12 to 30 linked Sugar. nucleosides, wherein the oligonucleotide is at least 90% 121. The method of claim 109, wherein at least one nucleo complementary to a C9CRF72 nucleic acid. side of the modified oligonucleotide comprises a modified 102. The method of claim 100, wherein the cell is in an Sugar. animal. 122. The method of claim 120, wherein the modified sugar 103. The method of claim 101, wherein the cell is in an is a bicyclic Sugar. animal. 123. The method of claim 121, wherein the modified sugar 104. The method of claim 100, wherein the C9CRF72 is a bicyclic Sugar. nucleic acid has the nucleobase sequence of any of SEQID 124. The method of claim 122, wherein the bicyclic sugar Nos: 1-10. comprises a chemical bridge between the 4' and 2' positions of 105. The method of claim 101, wherein the C9CRF72 the Sugar, wherein the chemical bridge is selected from: nucleic acid has the nucleobase sequence of any of SEQID 4'-CH(R)—O-2 and 4'-(CH2)2-O-2', wherein R is indepen Nos: 1-10. dently H, C1-C6 alkyl, and C1-C6 alkoxy. 106. The method of claim 104, wherein the oligonucleotide 125. The method of claim 124, wherein the chemical is a modified oligonucleotide. bridge is 4'-CH(R) O-2' and wherein R is methyl. 107. The method of claim 105, wherein the oligonucleotide is a modified oligonucleotide. 126. The method of claim 124, wherein the chemical 108. The method of claim 106, wherein the modified oli bridge is 4'-CH(R) O-2' and wherein R is H. gonucleotide is a single-stranded oligonucleotide. 127. The method of claim 124, wherein the chemical 109. The method of claim 107, wherein the modified oli bridge is 4'-CH(R)-O-2' and wherein Ris-CH2-O CH3. gonucleotide is a single-stranded oligonucleotide. 128. The method of claim 123, wherein the bicyclic sugar 110. The method of claim 108, wherein the single-stranded comprises a chemical bridge between the 4' and 2' positions of modified oligonucleotide is a gapmer. the Sugar, wherein the chemical bridge is selected from: 111. The method of claim 109, wherein the single-stranded 4'-CH(R)—O-2 and 4'-(CH2)2-O-2', wherein R is indepen modified oligonucleotide is a gapmer. dently H, C1-C6 alkyl, and C1-C6 alkoxy. 112. The method of claim 110, wherein at least one inter 129. The method of claim 128, wherein the chemical nucleoside linkage of the modified oligonucleotide is a modi bridge is 4'-CH(R) O-2' and wherein R is methyl. fied internucleoside linkage. 130. The method of claim 128, wherein the chemical 113. The method of claim 111, wherein at least one inter bridge is 4'-CH(R) O-2' and wherein R is H. nucleoside linkage of the modified oligonucleotide is a modi 131. The method of claim 128, wherein the chemical fied internucleoside linkage. bridge is 4'-CH(R)-O-2' and wherein Ris-CH2-O CH3. 114. The method of claim 112, wherein the modified inter nucleoside linkage is a phosphorothioate internucleoside 132. The method of claim 120, wherein the modified sugar linkage. comprises a 2'-O-methoxyethyl group. 115. The method of claim 113, wherein the modified inter 133. The method of claim 121, wherein the modified sugar nucleoside linkage is a phosphorothioate internucleoside comprises a 2'-O-methyoxyethyl group. linkage. k k k k k