Bloom Events of Hydromedusae

Bloom events of hydromedusae

Blackfordia virginica, an introduced hydromedusa species

Jinho Chae1, 3, ByeongHo Kim1, Changgyun Yu1, Gunhee Sung1, Yong Kim, Jang-Seu Ki2, Wonduk Yoon3

1Marine Environmental Research & Information Laboratory (MERIL), Gunpo 15850, Korea 2Department of Life Science, Sangmyung University, Seoul 03016, Korea 3Human and Marine Ecosystem Research Laboratory (HuMER), Gunpo 15850, Korea Hydromedusa blooms

The most widespread and diverse representatives of gelatinous plankton

Often neglected in plankton ecology ▪ be inconspicuous; escape direct observation ▪ seasonal occurrence; standard plankton sampling techniques easily overlook the blooms ▪ under-reporting (Hamner & Dawson 2009)

Bloom examples and their impacts ▪ Predation of fish larvae and eggs by Aequorea victoria (Purcell 1989) ▪ Feeding of Moerisia lyonsi (introduced, Purcell et al 1999) ▪ Reviews on hydromedusae (Mills 2001) ▪ Blooms with upwelling events in Bay of Panama (Miglietta & Collin 2008) ▪ Collapse of zooplankton stocks during Liriope tetraphylla blooms (Yilmaz 2014)

Feeding behavior ▪ Diversity of swimming behavior related to feeding and space utilization (Mills 1981) ▪ In situ feeding behavior of 8 co-occurring hydromedusae (Colin et al 2003) Predation of Nemopsis bachei in biological thin layers (Frost et al 2010)

Invasions (and domination) ▪ Blackfordia virginica, Maeotias marginata, and Moerisia sp. (for example, Nowaczyk et al 2016 ) World distribution of Blackfordia 1 Mayer (1910) 2 Thiel (1935) 3 Richards (1938) 4 Logvinenko (1959) 5 Kramp (1961) 6 Cronin et al. (1962) 7 Chen-tsu and Chin (1962) 8 Naumov (1969) 9 Ferrante (1970) 10 Santhakumari and Dos santos(1970) 2,8,17,21,22,24 11 Denayer (1973) 11 12 Calder and Hester (1978) 13,32 4 17,18,23, 13 Moore (1987) 27,30,33 1,3,6,8,9,12 14 Bouillon et al(1988) 15 15 Dai et al. (1991) 34,36 7 22 16 Patrick (1994) 19 17 Mills and Sommer (1995) 12 5,13 This study 20 18 Cohen and Carlton (1995) 14 19 Santhakumari et al. (1997) 10 20 Alvarez (1999) 21 Ruiz et al. (2000) 22 Shardin (2000) 13,35 23 Mills and Rees (2000) 24 Gomiou et al. (2002) 16 25 Alvarez-silva s et al.(2003) 28,29,31 26 Buecher et al. (2005) 27 Wonham and Carlton (2005) Blackfordia virginica (Mayer,1910) 28 Genzano et al.(2006) 29 Nogueira and Oliveira (2006) Polyps were found 30 Schroeter (2008) Blackfordia polytentaculata (Hsu & Chin,1962) 31 Bardi and Marques (2009) 32 Chicharo et al. (2009) Blackfordia manhattensis (Mayer,1910) 33 Chang (2009) 34 Wintzer et al. (2011) Blackfordia sp. 35 Freire et al.(2013) 36 Wintzer et al. (2013)

- Blackfordia virginica & B. manhattensis are identical (Moore 1987). - B. polytentaculata in South China Sea (Hsu & Chin 1962) was the first and last record of the species. - Broad thermal & salinity tolerances allow it to be easily transported in the ballast water (Kramp 1958); non-native species, marine pest (Molnar et al. 2008, Hayes & Sliwa 2003, Hayes et al. 2005, McDonald et al. 2015, Genzano et al. 2006 and etc.). - Low genetic diversity suggests that it is an introduced species (Harrison 2010, Genelle et al. 2012, Harrison et al. 2013, Meek et al. 2013). - Abnormally large impacts on zooplankton communities (Marques et al. 2015) Studies on Blackfordia virginica

1. Taxonomy ▪ morphological ▪ molecular

2. Population dynamics in Sihwa Lake ▪ Spatio-temporal variation of the density ▪ Individual growths (bell diameter) ▪ Optimal TS condition

3. Impact on zooplankton community (2018) ▪ In situ feeding rate (from gut contents in 24h) ▪ Stable isotope ratio analysis on zooplankton (prey) & Blackfordia virginica (predator) ▪ Phytoplankton composition in studied area ▪ Zooplankton composition in studied area ▪ Zooplankton & jellyfish carbon amount ▪ Bell diameter (bell shrinkage concerned to zooplankton (prey) depletion)

4. Is the species dispersed in other estuaries? ▪ Daecheon-cheon, Sumgingang, Kumgang, Nakdonggang and others in 2018 (?) Morphological taxonomy

First record of Blackfordia virginica in Korean waters in 2013 Morphological taxonomy

Sihwa 2013 Genzano et al. 2006

First record of Blackfordia virginica in Korean waters in 2013

Mills and Sommer 1995

Blackfordia virginica in Sihwa Lake

Sihwa 2013 Molecular taxonomy

18S rDNA NJ tree Clustering in

100 HM194811-Chrysaora melanaster 28S rDNA of 28S rDNA AY039208-Aurelia aurita Out groups 93 EU27601-Aurelia sp.1 Blackfordia EU247811-Microhydrula limopsicola 98 FJ897543-Craspedacusta sowerbyi virginica100 AY920780-Chrysaora melanaster 96 AY920755-Limnocnida tanganyicae AY920754-Aglauropsis aeora EU27601-Aurelia sp 100 60 AY920752-Monobrachium parasiticum EU272545-Anthohebella parasitica 73 EU247814-Olindias sambaquiensis FJ550431-Hebella venusta 73 AY789778-Stegella lobata 98 99 AZ3-1Blackfordia virginica (Korean) AY920757-Melicertum octocostatum 66 AY789779-Billardia subrufa AY920800-Blackfordia virginica 27 FJ550535-Staurodiscus gotoi AY920799-Aequorea victoria 96 78 EU272619-Halecium muricatum 15 EU305528-Rhacostoma atlantica FJ550524-Symplectoscyphus turgidus 6 100 FJ550516-Nemertesia antennina 30 FJ550427-Eucheilota menoni 46 98 HM357627-Plumularia strictocarpa FJ550444-Eucheilota maculata Z92899Selaginopsis cornigera 98 55 EU305503-Thuiaria thuja 64 FJ550455-Eutima curva EU272600-Abietinaria filicula FJ550372-Calycella syringa 98 FJ550557-Diphasia fallax 51 35 FJ550451-Melicertum octocostatum 52 EU272602-Amphisbetia minima FJ550572-Sertularia moluccana FJ550403-Sertularella mediterranea 31 FJ550573-Cnidoscyphus marginatus 83 FJ550433-Halopteris carinata 96 FJ550575-Antennella secundaria 100 EU272583-Plumularia setacea 74 EU305497-Monostaechas quadridens 99 FJ550576-Halopteris carinata 74 FJ550450-Aglaophenia elongata FJ550581-Kirchenpaueria similis 92 53 28 FJ550442-Gymnangium gracilicaule 65 61 FJ550597-Cladocarpus integer 52 FJ550568-Hydrodendron mirabile FJ550453-Cladocarpus integer 0.01 92 EU272601-Aglaophenia tubiformis 77 FJ550429-Sertularia moluccana FJ550591-Lytocarpia sp. 65 FJ550418-Amphisbetia operculata FJ550586-Macrorhynchia sibogae 64 89 FJ550416-Hydrallmania falcata EU272603-Anthohebella parasitica 84 99 AZ3-1-Blackfordia virginica (Korean) 65 FJ550414-Diphasia fallax 99 AF358078-Blackfordia virginica EU305501-Rhacostoma atlantica 76 FJ550567-Hydranthea margarica FJ550587-Eucheilota maculata 80 FJ550600-Eutima gegenbauri FJ550594-Opercularella lacerata FJ550519-Calycella syringa 100% 18S rRNA FJ550596-Campanulina panicula 90 FJ550531-Tiaropsis multicirrata similarity 98 EU272611-Clytia noliformis FJ550589-Obelia bidentata 59 FJ550547-Gonothyraea loveni 88 FJ550590-Laomedea calceolifera AY789773-Lovenella gracilis AY789737-Orthopyxis integra FJ550549-Silicularia rosea 0.01 99 AY789740-Bonneviella regia 65 AY789739-Campanularia volubilis 60 AY789738-Rhizocaulus verticillatus Blackfordia virginica judged by DNA Morphology of polyps

A A

0.5mm

Chae 2004 (in Sihwa)

Mills & Rees 2000

Polyps of Blackfordia virginica. A: The polyps attached on an abandoned fish-net in Sihwa Lake in 2004. B: A polyp (& a young medusa) photograph form Mills and Rees (2000). Distribution of B. virginica in the East Asia sea

▪ Samples from Sihwa and Jiolong River showed 100 % similarity in ITS rDNA sequencing. ▪ Gene variation in rDNA IGS region, mtCO1, or 16S rDNA need to be examined (Genelle et al 2013).

This study See Mayer (1910), Moore (2009), Toyokawa (2015) and etc. for morphological taxonomy.

Toyokawa (2015)

Hsu and Chin (1962)

Occurrence in the East Asia region. Population dynamics of B. virginica in Sihwa Lake

2000 35 B.virginica 14000 Temperature(oC)

)

1500 )

-3 copepods 30 12000 -3

o 1000 10000 25 500 8000

(indiv. m (indiv. 200 20 6000 150 4000

Temperature ( 100 15

2000 copepodsm (indiv. B. virginicaB. 50

0 10 0 . .. . . 4 Jul 2 Oct 2 Jun 12 Jul 4 Sep 27 Apr 19 Jun 28 Jul 5 Sep 5 May 30 Jun 16 Jul 8 Sep 29 Jun 22 May 16 Aug 20 May 12 Aug 10 Aug 31 Mar 12 Sep 2013 2014 2015 2016 Density variation (2013 – 2016).

100 100 100 1400 80 4 Jul 80 20 May 80 2 Jun 1200 60 60 60

40 40 40 -3 1000 20 20 20 800 0 0 0 100 100 100 indiv.m 600 80 12 Jul 80 19 Jun 80 30 Jun 400 60 60 60 200 40 40 40 20 20 20 0 0 0 0 ~18 20 22 24 26 28 30 32 ~18 20 22 24 26 28 30 32 ~18 20 22 24 26 28 30 32 100 100 100 Salinity(PSU) 80 16 Aug 80 28 Jul 80 15 Jul 60 60 60 1400 40 40 40 1200 20 20 20

-3

Percent frequency Percent 1000 0 0 0 100 100 100 800 80 4 Sep 80 13 Aug 80 10 Aug indiv.m 600 60 60 60 40 40 40 400 20 20 20 200 0 0 0 0 <1 1 2 3 4 5 6 7 8 9 10 11 12 13 <1 1 2 3 4 5 6 7 8 9 10 11 12 13 <1 1 2 3 4 5 6 7 8 9 10 11 12 13 ~20 21 22 23 24 25 26 27 ~20 21 22 23 24 25 26 27 ~20 21 22 23 24 25 26 27 O Bell diameter(mm) Temperature( C) Salinity, temperature range and the jellyfish density (2013 – Bell diameter growth (2013 – 2015). 2015). Studies on Blackfordia virginica

1. Taxonomy ▪ morphological ▪ molecular

2. Population dynamics in Sihwa Lake ▪ Spatio-temporal variation of the density ▪ Individual growths (bell diameter) ▪ Optimal TS condition

4. Is the species being dispersed in other estuaries? ▪ Daecheon-cheon, Sumgingang, Kumgang, Nakdonggang and others in 2018 (?) Other high density hydromedusae, Sarsia tubulosa Turritopsis nutricula, Rathkea octopunctata and Sarsia tubulosa Rathkea octopunctata

Turritopsis dohrnii s.l.

(b)

phylogeny using 18S rDNA of Turritopsis dohrnii (sys. T. nutricula?)

phylogeny using 28S rDNA of Turritopsis dohrnii (sys. T. nutricula?) Extreme bloom-event of Rathkea octopunctata

Rathkea octopunctata

Bloom event of R. octopunctata in Saemangum in Apr 2016.

Extremely high density (c.a. 100 indiv. m-3 and 607.8 indiv. m-3 at inner brackish waters and off the dike) were recorded in Saemangum in Apr 2016.

The bloom caused harm damage to glass-eel fisheries. Population dynamics of Rathkea octopunctata Sihwa Blooms of the species were also 2500 With Egg 35 observed in Sihwa and Yeosu. With Bud None Reproduction 30 Temperature 2000 Temp. Limit 25

Optimal temperature of their )

-3

C) 1500 o peaks were different in two 20 regions. 15 1000

Temperature ( Temperature

Density (indiv. m (indiv. Density Medusa budding is performed in 10 500 early season, then it is changed 5 into egg production before 0 0

finishing of medusa stages. 201406201407201408201409201410 201103252011041920110503201105162011052720110617201106282011081920110921 2012022820120409201204102012051120120531201206212012071220120723 201304152013041820130522201307042013071220130816 2014012920140313201403252014042320140519 201503212015040320150417 201603052016032920160428

Polyps are not found. Yeosu

3000 With Egg 20 With Bud None Reproduction 18 2500 Temperature Temp. Limit 16

)

-3 2000

14 o

1500 12

1000 Temperature (

Density (indiv. m (indiv. Density 8

500 6

0 4

Population dynamics of R. octopunctata in Yeosu. 20140327201404062014041620140423 201501292015022020150325201504012015040620150408201504102015041220150415201504212015042320150507 2016032120160404201604182016043020160516 Proportion of medusa buds and eggs of Rathkea octopunctata

100 medusa budding egg production With Bud Proportion Sihwa 80

Proportion (%) Proportion 20

0 2 4 6 8 10 12 14 16 18 20

14 With Egg Proportion

Proportion (%) Proportion 2

0 2 4 6 8 10 12 14 16 18 20 Temperature(OC)

100 With Bud Proportion

80 Yeosu 60

Proportion (%) Proportion 20

0 2 4 6 8 10 12 14 16 18 20 30 With Egg Proportion 25

Proportion (%) Proportion 5

0 2 4 6 8 10 12 14 16 18 20 Temperature(OC)

Proportion of medusa bud- and egg-carrying medusae of R. octopunctata in Sihwa and Yeosu. Optimal temperature of abundance, bud carrying, egg carrying

Temperature Range (°C) Salinity Range (ppt) R. octopunctata Abundance (Sihwa 2011-2015) 2.0°C – 16.5°C 23.2ppt – 36.8ppt Optimum 5.5°C- 16.5°C Bud carrying R. octopunctata Abundances (Sihwa 2011-2015) 5.0°C – 13.1°C 28.1 ppt - 36.8 ppt Optimum 5.5°C – 11.5°C Optimum- 28.1ppt – 36.8ppt Egg carrying R. octopunctata Abundances (Sihwa 2011-2015) 10.5°C-15.2°C 23.2ppt - 33.7ppt Optimum 10.5°C – 15.2°C Optimum- 23.2ppt – 33.7ppt R. octopunctata Abundance (Gamak Bay 2014-2015) 5.9°C-18.1°C 31.0ppt – 34.8ppt Optimum 10.8°C – 17.3°C Bud carrying R. octopunctata Abundances (Gamak Bay 2014-2015) 5.9-18.1°C 31.0ppt – 34.8ppt Optimum 10.9°C – 15.7°C Optimum- 33.5ppt – 34.7ppt Egg carrying R. octopunctata Abundances (Gamak Bay 2014-2015) 11.7-18.1°C 33.2ppt – 34.7ppt Optimum 12.3°C – 17.1°C Optimum- 33.8ppt – 34.7ppt Study comparison Time (Yr) Location Buds Rep. Avg Buds Temp (°C) Sal (ppt) Eggs Rep. % Temp Sal Ref. % no. ind-1 (°C) (ppt) 1909–1923 Great Belt 1%-60% No data 3.6°C - No data No data 5.5°C 1923 Femern Belt 72 No data 3.8°C No data No data 1923 Bay of Samso 24 No data 5.1°C No data No data April, 1923 South Kattegat 00 No data 6.1°C No data No data Kramp,1927 North Kattegat a 77 No data 5.5°C No data No data 1923 nd North Sea 1923 North Sea 46 No data 5.2°C No data No data 1923 Skagerrak 37 No data 5.9°C No data No data 1968 Jarnyshnaya 0.91 - 0.7, No data No data 13.7% - No data No data Zelickman et al., 1969 Fjord 49.5 1% 4 42.1% 1963 Lab Buds No data 5.0°C No data Eggs 8.0°C No data Werner, 1963 occurred occurred 2011-2015 Sihwa Lake 6.32% - 2/ind – 5.0°C – 28.1ppt – 8.75% - 10.5°C – 23.2ppt – 100% 4/ind 13.1°C 36.8ppt 78% 15.2°C 33.7ppt 2014-2015 Gamak Bay 9.05% - 2/ind – 5.9°C – 31.0ppt – 5.48% - 11.7°C – 33.2ppt – This Study 72.39% 3.7/ind 18.1°C 34.8ppt 15.85% 18.1°C 34.7ppt DNA probes for early detection of R. octopunctata

Q-PCR primer from mitochondrial 16s in R. octopunctata

Primer name Nucleotides (5'->3') Tm(°C) bp (nt) Remarks

Ro-16F204 CTGTCTTTGCAAGAAACCTC 58 20 Forward Ro-16F319 TTAAATACCAGGGAGATTGG 59 20 Reverse Ro-16R431 AGTAATTGTTAAGATTGTGGTC 57 22 Reverse Ro-16R486 TTCATTGATCGTTGCTTGTG 61 20 Reverse

comparison of mitochondrial 16s sequence

Test of reaction of 4 sets of Q-PCR probes Bloom event of Sarcia tubulosa at Sihwa in 2014

Sarsia tubulosa

40 Sarsia tubulosa

-3

indiv. m indiv. 10

Population dynamics of S. tubulosa in Sihwa Lake. Bloom event of Sarcia tubulosa at Sihwa in 2014

22 Jan 13 Mar

25 Mar 17 Apr

12 May

Distribution of S. tubulosa in Sihwa Lake, 2014. Bloom event of Sarcia tubulosa at Gamak Bay in 2014

26 Jan 16 Mar 6 Apr

16 Apr 16 May

Distribution of S. tubulosa in Gamak Bay, 2014. Young medusae of Aequrea sp.

Aequorea sp., Namhae Medusae of Aequrea sp.

Distribution of Aequrea in Enggang Bay, 2016. Medusae of Bougainvilla sp., a non-indigeneous species?

© Jinho Chae Bloom event of Bougainvilla sp., a non-indigeneous species? Conclusion and prospects Conspicuous phenology ▪ Temperature dependent? ▪ Prey density is concerned to? ▪ More predictable than scyphozoans?

Extreme density ▪ Introduced species that has little evolutionary experience to its prey communities (B. virginica)? ▪ Effective reproductive strategy (R. octopunctata) ▪ Possibly high impacts on zooplankton and fish eggs/larvae? ▪ Possible harm effects to fishery and/or fishery grounds

Non-indigenous species ▪ Pathway? ▪ Survival of polyps in ballast water? (euryhaline polyps of widely invading species)

Future studies ▪ Adequate size for laboratory observation on feeding and reproductive behavior ▪ No-limit of prey amounts in the lab; need to measure in situ feeding rate ▪ Prey items (not only meso-zooplankton)? Thank you.