University of New Hampshire University of New Hampshire Scholars' Repository
Doctoral Dissertations Student Scholarship
Fall 2009
Gonadotropin releasing hormone in agnathans
Scott Ira Kavanaugh University of New Hampshire, Durham
Follow this and additional works at: https://scholars.unh.edu/dissertation
Recommended Citation Kavanaugh, Scott Ira, "Gonadotropin releasing hormone in agnathans" (2009). Doctoral Dissertations. 497. https://scholars.unh.edu/dissertation/497
This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. GONADOTROPIN RELEASING HORMONE IN AGNATHANS
BY
SCOTT IRA KAVANAUGH
B.S., Plymouth State College, 2001
M.S., University of New Hampshire, 2004
DISSERTATION
Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
In
Biochemistry
September, 2009 UMI Number: 3383320
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
UMI®
UMI Microform 3383320 Copyright 2009 by ProQuest LLC All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.
ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 This dissertation has been examined and approved.
Pi.gr>,/A Afire/ Dissertation Director, Dr. Stacia A. Sower Professor of Biochemistry and Molecular Biology r J
Dr. William R>^fumble Provost and Vice President for Academic Affairs, Suny Canton
Dr. William A. Condon Professor of Animal and Nutritional Sciences
^ U~\5 t^cMJL^
Dr. Deena J. Small t Assistant Professor of Biochemistry and Molecular Biology 1
Dy; Beverly E. pbin, / Associate Professor of Anatomy and Cellular Biology, Tufts University School of Medicine ^n^w DEDICATION
To Butch ACKNOWLEDGEMENTS
I would like to thank my advisor, Dr. Stacia Sower, for her guidance and support during the course of my graduate career. Without her help this dissertation would have, optimistically, never been written. I would also like to thank Stacia for the many unique times and opportunities she presented me during my tenure at UNH. I had the inimitable treasure to work with her postdoctoral advisor, Dr. Aubrey Gorbman, a progenitor of the intriguing field of comparative endocrinology. It was this meeting and with Stacia's enduring guidance which set the course of my research for the years to come.. Thank You.
I would like to thank my committee members, Bill Trumble, Bill Condon,
Beverley Rubin and Deena Small for taking the time to review my dissertation and providing guidance. Thanks to my fellow SOWER LAB members who have stuck together through thick and thin, lamprey and hagfish and the PBR counseling programs we've endured during this Sisyphean curriculum. This one's for you: Mihael Freamat
(my zacusca friend), an individual whom truly embodies the basic tenets of Renaissance
Humanism, Mickie Powell, Emily LaFiandra, Mark Santos (Peter Parker), Kazufusa
Okamoto, Jason Dahlstrom (Joey), Robert Langdon, Adam Root, Lisa Merrill, Piyada
Ngemsougnern, Apichart Ngemsougnern, Jaruwan Ponjaroen, Cresentia Healy,
Nathaniel Nucci (Nananana), Peter Griffen, Mike Barron, Takayoshi Kosugi, Zoe Rogers
(the mad labeler), Jocelyn Sanford, Emily Violette (Beirut anyone?), Jen Glieco, Arthur
Dent, Mike Wilmot, Caryn MacDonald, Norville Rogers, Eileen Balz (dancing queen),
Bernie Schultz, Ben Clemens, Christina Stark, Charlie Asher, Jane Connolly, Melissa
Kopka, Cari Bourn, Kara Lee, Greg Blaisdell, Levi bar Alphaeus, Allisan Aquilina-Beck,
iv Gregory Gerome and Ben Lyons.
I am appreciative to many of Stacia's collaborators I have had the opportunity and pleasure to work with and learn from during their visits to UNH. In particular I would like to recognize: Professor's Hiroshi Kawauchi, Masumi Nozaki, Akiyoshi Takahashi and Shunsuke Moriyama for the intellectual and cultural exchange.
I would like to express my appreciation to the individuals whom helped me learn the scientific process, providing me with opportunities to work and expand as an undergraduate student and as an individual. Thanks to Mr. Jeff Elliot and Mrs. Judith
D'Aleo for the introduction to biology and its diversity. Thanks to Dr. Susan Swope and
Dr. Dominick Marocco for their support of my interest in the field of biotechnology. Dr.
Frederick Prince, thank you for helping me explore the complexity of the cell through electron microscopy and all the moose conversations. Special appreciation and accolades to Dr. Anne Packard (ATP) for her guidance and support during my tenure at Plymouth
State College. Her enthusiasm for the sciences and asking questions encouraged me to continue my studies into graduate school, where I found a whole new world to question: thank you Anne.
Thanks to Rick and Susan for their love and support before and during my collegiate experience. Dawn, Jim, and Bode: thank you for your continual support from the start of my graduate career when you provided me with everything, from food and housing to Hot Passes and everything in between. I can't thank you enough.
Support comes in many forms, within in the lab and outside the lab—sometimes they overlap. Just imagine what I thought the first day I saw this Jay and Silent Bob skateboard pushing wannabe stroll up to radiation safety class. And yah, he sat next to me.
v I've been described as Gimli in a black Harley shirt and any thoughts of this kid,
Matthew Ren Silver, becoming a friend were, let's just say they weren't happening. Well, so much for first impressions. He would later become my work wife, but unfortunately, after his dissertation defense, he moved on to a new career far far away. The distance couldn't be overcome, communications deteriorated and eventually, after only a few short months our relationship ended in divorce. None-the-less, Matt helped make the graduate experience fun, enjoyable and endurable with his friendship and support in and out of the lab, through thick and thicker. Also, I would like to thank Matt and Molly's families for their hospitality and an always warm welcome. Thank you all.
It was soon after my divorce from Matt when an undergraduate decided to join the lab for the master's program. Geoffrey John Bushold is all things Volkswagen and for a while not much else. He was always easy to schlep to the bar after a long hard day in the lab; after all, getting up at 10:00 a.m. is hard work, you know. Geoff became my second, but just as important, work wife. Geoff was very instrumental in getting the inositol phosphate assays done in a timely fashion, helping to pH and aliquot thousands of samples. He was always willing to lend a hand and made the graduate school journey just a little less painless and a little funnier. Thanks.
And then there was Dr. Priya Sampath-Wiley whom wise in all things graduate school endured the closing days of dissertation mayhem with me, thank you.
My family from North Tonawanda, New York—we have shared many a Pizza
Junction pizza during my tenure at UNH. We have also shared many ups and downs as are always present in the dynamics of family: births, graduations and deaths. I thank you all for your unwavering support during these times. And yes, I am finished©
vi The Kiesman family has been very instrumental in helping me complete my dissertation journey. They have provided me with housing and food for the last two years, but more importantly friendship and support. So, Michael, Lisa, Sacha and Nathan, thank you. Special accolades must go to Nathan whom gave up his bed for me when I wasn't sleeping in the lab.
Finally, and of most importance, I would like to thank my wife Laura, whom has been ever supportive and patient, and boy do I mean patient, and has provided me with intellectual challenge, enduring friendship and everlasting love.
"Yes, sir - strawberries"
vii TABLE OF CONTENTS
DEDICATION iii
ACKNOLEDGEMENTS iv
LIST OF TABLES xiii
LIST OF FIGURES xiv
ABSTRACT xvii
CHAPTER PAGE
I. Background and Significance 1
Introduction 1
Vertebrate Phylogeny 1
Lamprey Genome 2
Hagfish and Lampreys 3
Gonadotropin Releasing Hormone 4
Review 5
GnRH Isoforms 5
GnRH Gene Structure 7
Invertebrate GnRH 8
Hagfish GnRH 11
Lamprey GnRH-II 13
viii System 13
GnRH Development 13
Mechanism of Action 18
Gonadotropin 20
Vertebrate Hypothalamus Relations 21
Objectives 24
II. Attempts to Isolate Gonadotropin-Releasing Hormone from the Atlantic Hagfish
Myxine glutinosa
Abstract 25
Introduction 27
Materials and Methods 32
Peptide Isolation Methods 32
Peptide Isolation and Methods 32
First Extraction and Radioimmunoassay 32
Matrix-Assisted Laser-Desorption Ionization Post Source
Decay (PSD) and Collision Induced Dissociation (CID) 33
Second Extraction and Radioimmunoassay 33
Texas Peptide Sequencing 34
Molecular Methods 35
Total RNA Isolation 35
First Strand Synthesis 36
Polymerase Chain Reaction 36
ix Second Strand Synthesis, 5' and 3'-Rapid Amplification
ofcDNA Ends (RACE) 37
Plasmid Preparation 38
DNA Sequencing 39
Results 39
First Extraction and Radioimmunoassay 39
Matrix Assisted Laser Desorption Ionization Post Source
Decay (PSD) and Collision Induced Dissociation (CID) 41
Second Extraction and Radioimmunoassay 41
Peptide Sequencing at the University of Texas 45
Molecular Methods 46
Discussion 47
III. Origins of GnRH in Vertebrates: Identification of a Novel GnRH in a Basal
Vertebrate, the Sea Lamprey
Abstract 51
Introduction 53
Materials and Methods 56
Screening the Lamprey Genome 56
Lamprey 57
Isolation of Total RNA and Genomic DNA 57
Reverse Transcription and Polymerase Chain Reaction 57
Phylogenetic Analysis 59
x In Situ Hybridization 59
Peptide Synthesis and Antiserum Generation 60
Immunocytochemistry 60
In Vitro and In Vivo Biological Studies 61
Inositol Phosphate Assay 62
Estradiol RIA. 63
Statistics 63
Results 63
Cloning and Sequence Analysis of Prepro-Lamprey GnRH-II 63
Tissue Expression of Lamprey GnRH-II 65
Phylogenetic Analysis 66
In Situ Hybridization 68
Immunohistochemistry 68
In Vitro and In Vivo Biological Studies 71
Inositol Phosphate Assay 73
Discussion 74
REFERENCES 83
APPENDICES 105
APPENDK A IACUC Approval Forms.. 106
APPENDDC B Lipofectamine 2000 Inositol Phosphate Assay: Protocol, Solutions
and Reagents 110
xi APPENDIX C Ncol and Sail Restriction Site Analysis for in situ Probes for
Lamprey-II Gonadotropin-Releasing Hormone 118
APPENDIX D Trace Files Used to Generate the Lamprey Gonadotropin-
Releasing Hormone-II Consensus Sequence 120
APPENDIX E Hagfish Genus Species List 124
APPENDIX F Codon Degeneracy in the Atlantic hagfish Myxine glutinosa 127
APPENDDC G Codon Usage in the Atlantic hagfish Myxine glutinosa and the
Sea Lamprey Petromyzon marinus 129
APPENDDC H Primers Used in Attempts to Isolate Gonadotropin-Releasing
Hormone from the Atlantic hagfish, Adaptor and Control Primers,
and Lamprey Gonadotropin-Releasing Hormone-II primers 132
APPENDDC I Lamprey Antibody 3952 Radioimmunoassay of C-18 Column
Fractions 137
ACKNOWLEDGEMENT OF FUNDING 143
xn LIST OF TABLES
Table 1: Primary Structure of Gonadotropin-Releasing Hormone in Vertebrates... 6
Table 2: Primary Structure of Gonadotropin-Releasing Hormone in
Invertebrates 7
Table 3: The Lineage of Vertebrate Gonadotropin-Releasing Hormone 16
xiii LIST OF FIGURES
Figure 1 a: GnRH Gene Structure 8
Figure lb: GnRH cDNA Structure 8
Figure 2: Schematic Diagram oiCiona Ci-gnrhl Gene Structure and Schematic
Diagram ofPrepro-Ci-gnrhl 9
Figure 3: Schematic Diagram of Ciona Ci-gnrh2 Gene Structure and Schematic
Diagram of Prepro-Ci-gnrh2 10
Figure 4: The Four Proposed GnRH Lineages 17
Figure 5: Representation of the three types of adenohypophysial innervations from
the hypothalamus 22
Figure 6: Coronal Section of Pacific Hagfish Pituitary 22
Figure 7: Nearly Midsagittal Section of Atlantic Hagfish Neurohypophysis 23
Figure 8: First Extraction, Lamprey Antibody 3952 Radioimmunoassay of
Hagfish Brain G25 Fractions 40
Figure 9: Matrix Assisted Laser Desorption Ionization (Post Source Decay
(PSD) and Collision Induced Dissociation (CID)) 41
Figure 10: Second Extraction Lamprey Antibody 3952 Radioimmunoassay
of Hagfish Brain G25 Column Fractions 42
Figure 11: Lamprey Antibody 3952 Radioimmunoassay of Hagfish Brain G25
Column Fractions 127-22 42
Figure 12: Lamprey Antibody 3952 Radioimmunoassay of C-8 Column
Fractions 127-26 43
xiv Figure 13: Lamprey Antibody 3952 Radioimmunoassay of Phenyl Column
Fractions 127-33 44
Figure 14: Lamprey Antibody 3952 Radioimmunoassay of C-18 Column
Fractions 127-21. 44
Figure 15: MALDI-TOF of Fractions to Determine Purity 45
Figure 16: Edman Degradation of Control Peptide Lamprey GnRH-III 45
Figure 17: Putative Lamprey Gonadotropin-Releasing Hormone-II Transcript
Map 64
Figure 18: Primary Structure of Gonadotropin-Releasing Hormones in
Vertebrates , 65
Figure 19: Expression and Analysis of Lamprey Gonadotropin-Releasing
Hormone-II 66
Figure 20: Phylogenetic Analysis Segregates the Prepro- Gonadotropin-Releasing
Hormones into Four Groups 67
Figure 21: Evolution of Vertebrate Gonadotropin-Releasing Hormone Family of
Neuropeptides 69
Figure 22: In Situ Hybridization of the Adult Lamprey Brain 70
Figure 23: Lamprey Gonadotropin-Releasing Hormone-II-like Immunoreactivity
in the Hypothalamus of Adult Sea Lampreys 71
Figure 24: In Vitro Ovarian and Ovarian-pituitary Cultures 72
Figure 25: In Vivo Biological Assay Measuring Concentrations of Plasma
Estradiol 73
xv Figure 26: Inositol Phosphate Assay Lamprey Gonadotropin-Releasing Hormone
Dose Response 74
Figure 27: Chordata Gonadotropin-Releasing Hormone Gene Structure 77
xvi ABSTRACT
GONADOTROPIN-RELEASING HORMONE IN AGNATHANS
By
Scott I. Kavanaugh
University of New Hampshire, September, 2009
Hagfish and lampreys are the only two representatives of Agnathans among extant vertebrates. The regulatory hypothalamic neurohormone, gonadotropin-releasing hormone (GnRH), regulates reproduction in all vertebrates through the hypothalamic- pituitary-gonadal axis. Most vertebrates have at least two forms of GnRH in the brain. In hagfish the primary amino acid structure of GnRH has not been identified as yet, however, indirect methods have shown an immunoreactive GnRH or a GnRH-like peptide in the brain of hagfish. In addition concentrations of brain immunoreactive-
GnRH have been correlated with reproductive stages in the Atlantic hagfish (Myxine glutinosa). Therefore the objective of the first study was to identify the primary structure of putative GnRH(s) by using PCR, MALDI, and chromatography (column and HPLC).
However, a GnRH-like molecule was not identified despite extensive efforts and experiments.
My second objective was to identify a novel GnRH from lamprey brain using in silico analysis. A cDNA encoding a novel GnRH, named lamprey GnRH-II, was cloned from the sea lamprey. The deduced amino acid sequence of the newly identified lamprey
GnRH-II is QHWSHGWFPG. The architecture of the precursor is similar to that reported xvii for other GnRH precursors consisting of a signal peptide, decapeptide, a downstream processing site, and a GnRH-associated peptide, however, the gene for lamprey GnRH-II does not have introns in comparison with the gene organization for all other vertebrate
GnRHs. Lamprey GnRH-II precursor transcript was expressed in a variety of tissues. In situ hybridization of the brain showed expression and localization of the transcript in the hypothalamus, medulla, and olfactory regions, whereas immunohistochemistry using a specific antiserum showed only lamprey GnRH-II cell bodies and processes in the preoptic nucleus/hypothalamus areas. Lamprey GnRH-II was shown to stimulate the hypothalamic-pituitary axis using in vivo and in vitro studies. Lamprey GnRH-II was also shown to activate the inositol phosphate signaling system in COS-7 cells transiently transfected with the lamprey GnRH receptor. These studies provide evidence for a novel lamprey GnRH that has a role as a third hypothalamic GnRH. The newly discovered lamprey GnRH-II offers a new paradigm of the origin of the vertebrate GnRH family.
xvm Chapter One
Background and Significance
Introduction
Vertebrate Phvlogenv
Modern vertebrates are classified into two major groups, the gnathostomes (jawed vertebrates) and the agnathans (jawless vertebrates). The phylogenetic relationship between hagfish, lamprey and the jawed vertebrates is an unresolved issue (Delarbre et al., 2002; Kuraku et al., 1999). In this dissertation, agnathans are considered to be monophyletic in origin with the modern agnathans classified into two groups, myxinoids
(hagfish) and petromyzonids (lamprey); while the gnathostomes constitute all the other living vertebrates, including the bony and cartilaginous fishes and the tetrapods. In 2002,
Janvier and his collaborators based on analysis of the complete mitochondrial DNA suggested that lamprey and hagfish form a clade (Delarbre et al., 2002). More recently,
Ota et al., (2007) demonstrated putative neural-crest cells in hagfish embryos and showed that these cells delaminate and migrate like those of all other living vertebrates, supporting the more recent claims that the agnathans are monophyletic. It is generally believed that two large-scale genome duplications (2R) occurred during the evolution of early vertebrates, although there is controversy on whether the 2R duplications occurred before the divergence of the hagfish and lampreys, or whether there was one round prior to the jawless vertebrates and one round after the divergence of the jawless vertebrates
1 (Fried et al., 2003; Holland et al., 1994; Irvine et al., 2002; Larhammar et al., 2002;
Ohno, 1970; Vandepoele et al., 2004). Further information on the evolution of vertebrate brain/pituitary hormones and their genes in lamprey and hagfish can contribute to the ongoing phylogenetic analysis that may help in resolving the phylogenetic relationships between hagfish, lamprey, and jawed vertebrates (Sower et al., 2009). During the past two decades there have been rapid advances in our knowledge of the structure and function of reproductive hormones in lampreys. However, key elements of the endocrine reproductive system in hagfish have yet to be elucidated. Therefore, my dissertation focuses on the hypothalamic hormone, gonadotropin-releasing hormone, both in hagfish and lampreys.
Lamprey Genome
As an agnathan, the oldest extant lineage of vertebrates, the sea lamprey has become a model system for analyzing the evolution of many genes and systems including reproduction regulation (Sower, 2003 a) and the evolution of development (EvoDev)
(Kuratani et al., 2002). Lampreys as basal vertebrates were identified in a key position such that the mapping of the lamprey genome started in January 2005 (http://www. genome.gov/12511858 12511858). Nine non-mammalian organisms were chosen by NIH for genome mapping, each represents a position on the evolutionary timeline marked by important changes in animal anatomy, physiology, development or behavior (NIH News
Release August 4, 2004). As of January 2005, 39,000 sequences were available from the sea lamprey {Petromyzon marinus) genome project. By March 2009, 19,181,134 had been mapped. It is estimated the coverage of the genome is about 6.4X to 7.2X, which
2 infers that much of the genome has been sequenced and available for screening. The phylogenetic position of lampreys as a basal vertebrate allows lampreys to be a benchmark for understanding genes that evolved in the vertebrates (Sower et al., 2009).
Hagfish and Lampreys
Hagfish and lampreys belong to the class of agnathans, and are the only known living representatives of the most ancient lineage of vertebrates. Since the introductory anatomical studies of the nineteenth-century, hagfish have continued to be profound in their peculiarities in structure, life history, and in their position in vertebrate evolution
(Worthington, 1905). Hagfish belong to the family Myxinoidea, and are considered to be one of the most primitive of all vertebrates, living or extinct. Hagfish are considered an important taxonomic group because modern representatives retain many structures and functions that are representative of the ancestral condition during the origin of vertebrates
(Gorbman, 1997).
Lampreys are the earliest evolved vertebrates for which there are demonstrated functional roles for two gonadotropin-releasing hormones (GnRHs) that act via the hypothalamic-pituitary gonadal axis controlling reproductive processes (Kavanaugh et al., 2008; Sower, 2003a; Sower et al., 2009). From my dissertation studies, a third GnRH
(lamprey GnRH-II) has been discovered and is suggested to have a role as a hypothalamic GnRH (Kavanaugh et al., 2008). To date, the biochemical, molecular, immunocytochemical and functional studies on the structure and function of the GnRHs in lampreys has established that, similar to all other vertebrates, the lamprey has a hypothalamic-pituitary gonadal axis and there is high conservation of GnRHs
3 mechanisms of action (Sower, 2003a; Sower et al., 2009). Other studies have determined the primary amino acid and cDNA sequences of two forms of GnRH, lamprey GnRH-I and -III, and the cDNA of one GnRH receptor (Sherwood et al, 1986; Silver et al., 2005;
Sower et al., 1993; Suzuki et al., 2000). The high conservation of the GnRH and its receptor throughout vertebrate species makes the lamprey model highly appropriate for examining the GnRH system in terms of its ligands and novel receptors (Sower et al.,
2009).
Gonadotropin-Releasing Hormone
The regulatory neurohormone, GnRH, is pivotal in the control of reproduction in all vertebrates. GnRH is a hypothalamic neuropeptide that acts on gonadotropes in the anterior pituitary and stimulates the release of two gonadotropic hormones, luteinizing hormone (LH) and follicle stimulating hormone (FSH), which are essential in regulating the hypothalamic-pituitary-gonadal axis. All members of the GnRH family, in vertebrates and some invertebrates, that have been isolated are 10 amino acids in length, except in four species of invertebrates (octopus, limpet, annelid and aplysia) in which GnRH has
12 amino acids (Kavanaugh et al., 2008; Sower et al., 2009). All GnRH isoforms have a conserved amino and carboxyl terminal, pGlul and Pro9GlylONH2, respectfully, and a conserved Ser at the fourth position (Kavanaugh et al., 2008) (Table 1). In 2002,
Iwakoshi et al., isolated a 12 amino acid peptide from Octopus vulgaris and designated it octo-GnRH peptide. This was the first report of the characterization of a GnRH-like molecule in a non-protochordate and the first report of a GnRH to consist of 12 amino acids (Table 2). The octo-GnRH contains similar domains compared to all other GnRHs,
4 suggesting these regions are significant for conformation, function and possible participation in octopus reproduction as a neurohormone (Iwakoshi et al., 2002).
Subsequently, 3 other GnRHs' have been identified in mollusks and annelid that also consist of 12 amino acids (Tsai and Zhang, 2008; Zhang et al., 2008). To date the significance / biological role of the two additional amino acids in positions two and three is unclear (Tsai and Zhang, 2008).
Review
GnRH Isoforms
The primary amino acid structures of twenty-eight GnRH isoforms have been identified in vertebrates and invertebrates, this includes my finding of lamprey-II GnRH detailed in chapter 3 (Kavanaugh et al., 2008). Of the 28 known isoforms, 15 are present in vertebrates (Table 1): mammal (Porcine) (Burgus et al., 1972b; Matsuo et al., 1971), salmon (Oncorhynchus nerka) (Sherwood et al., 1983), catfish (Clarias macrocephalus)
(Lovejoy et al., 1992), dogfish {Squalus acanthias), two forms in chicken (Gallus domesticus), chicken-I (King et al., 1992; Miyamoto et al., 1983; Miyamoto et al., 1982), and chicken-II (Miyamoto et al., 1984). Three of the GnRHs have been identified in the sea lamprey, lamprey-I (Sherwood et al., 1986), lamprey-III (Sower et al., 1993) and lamprey-II (Kavanaugh et al., 2008). The remaining GnRH isoforms are seabream
(Spams aurata) (Powell et al., 1994), guinea pig (Cavia porcellus) (Jimenez-Linan et al.,
1997), rana (Rana dybowskii) (Wang et al., 2001; Yoo et al., 2000), Pacific herring
(Clupea harengus pallasi) (Carolsfeld et al., 2000), medaka (Oryzias latipes) (Okubo et
5 al., 2000), and whitefish (Coregonus clupeaformis) (Adams et al., 2002). Invertebrate
GnRHs include (Table 2): tunicate I and II (Chelyosoma productum) (Powell et al.,
1996), tunicate III-IX (Adams et al., 2003; Kavanaugh et al., 2005b), octopus {Octopus vulgaris) (Iwakoshi et al., 2002), Aplysia {Aplysia californica) (Zhang et al., 2008), limpet {Lottia gigantea) and annelid {Capitella sp)(Tsai and Zhang, 2008).
Primary Structure of GnRHs in Vertebrates
Vertebrate 1 2 3 4 5 6 7 8 9 10 Mammal pGlu His Trp Ser Tyr Gly Leu Arg Pro GIyNH2 Guinea Pig pGlu Tyr Trp Ser Tyr Gly Val Arg Pro GlyNH2 Seabream pGlu His Trp Ser Tyr Gly Leu Ser Pro GlyNH2 Salmon pGlu His Trp Ser Tyr Gly Trp Leu Pro GlyNH2 Medaka pGlu His Trp Ser Phe Gly Leu Ser Pro GIyNH2 Whitefish pGlu His Trp Ser Tyr Gly Met Asn Pro GlyNH2 Herring pGlu His Trp Ser His Gly Leu Ser Pro GlyNH2 Rana pGlu His Trp Ser Tyr Gly Leu Trp Pro GlyNH2 Chicken -1 pGlu His Trp Ser Tyr Gly Leu Gin Pro GlyNH2 Catfish pGlu His Trp Ser His Gly Leu Asn Pro GlyNH2
Dogfish pGlu His Trp Ser His Gly Trp IAU Pro GlyNH2 Chicken -II pGlu His Trp Ser His Gly Trp Tyr Pro GlyNH2 Lamprey-H pGlu His Trp Ser His Gly Trp Phe Pro GlyNH2 Lamprey-in pGlu His Trp Ser His Asp Trp Lys Pro GlyNH2 Lamprey-I pGlu His Tyr Ser Leu Glu Trp Lys Pro GlyNH2
Table 1. There are currently 15 reported isoforms of GnRH in vertebrates. Yellow highlight, amino acids changed compared to mammalian GnRH. Grey highlight, GnRHs occurring in the sea lamprey. Orange highlight, single amino acid difference between dogfish, chicken-II and lamprey GnRH (modified from Kavanaugh et al., 2008).
6 Primary Structure of GnRHs in Invertebrates
Invertebrate 1 2 3 4 5 6 7 8 9 10 Tunicate -1 pGlu — — His Trp Ser Asp Tyr Phe Lys Pro GlyNH2 Tunicate - II pGlu — — His Trp Ser Leu Cys His Ala Pro GlyNH2 Tunicate-Hi pGlu — — His Trp Ser Tyr Glu Phe Met Pro GlyNH2 Tunicate-TV pGlu — — His Trp Ser Asn Gin Leu Thr Pro GlyNH2 Tunicate-V pGlu — — His Trp Ser Tyr Glu Tyr Met Pro GlyNH2 Tunicate-VI pGlu — — His Trp Ser Lys Gly Tyr Ser Pro GlyNH2 Tunicate-VII pGlu — — His Trp Ser Tyr Ala Leu Ser Pro GlyNH2 Tunicate-VIE pGlu — — His Trp Ser Leu Ala Leu Ser Pro GlyNH2 Tunicate-IX pGlu — — His Trp Ser Asn Lys Leu Ala Pro GlyNH2 Octopus pGlu AMI T\r His Phe Ser Asn Gly Trp His Pro GlyMI2 Aplvsia pGlu Asn T\r His Phe Ser Asn Gly Tip Tyr Ala GlyMI2 l.iinprt pGlu His '>•" His Phe Ser Asn Gly Tip Lys Ser GlySII2 Annelid pGlu Alii Tyr His Phe Ser His Gly Tip Phe Pro GKNH2
Table 2: There are currently 13 reported isoforms of GnRH in invertebrates. Yellow highlight, amino acids are changes when compared to mammalian GnRH (Table 1). Blue highlight, GnRHs occurring with 12 amino acids. Purple highlight, non-chordate animals from which GnRH had been identified (modified from Sower et al., 2009).
GnRH Gene Structure
The genomic organization of the GnRH gene in vertebrates is comprised of three introns and four exons. Exon 1 contains the 5' untranslated region (UTR) (Bond et al.,
1991; Mason et al., 1986). Exon 2 codes for the signal peptide, the GnRH decapeptide, processing site, and part of the GnRH associated peptide (GAP). The remaining GAP sequence is coded in exon 3 and part of exon 4. The last part of exon 4 codes the 3' UTR
(Fig. la) (Adams et al., 2003; Kitahashi, 2005; Klungland et al., 1993). During post transcriptional processing, the introns are removed and the exons are spliced together to
7 produce the mature RNA or prepro GnRH (Fig. lb) (Bond, 1989; Kah et al., 2007;
Kitahashi et al., 2005; Morgan and Millar, 2004). In invertebrates the gene structure of octopus GnRH is unknown. In contrast to vertebrate GnRH gene structure, tunicate
GnRH gene structure is distinctly different.
la Gene Structure
Exon 1 Exon 2 Exon 3 Exon 4
Intron 1 Intron 2 Intron 3
cDNA Structure
Signal Peptide GnRH GnRH Associated Peptide
Dibasic Processing Site
Figure la. and lb. GnRH Gene and cDNA Structure. The conserved vertebrate GnRH gene structure consists of four exons and three introns, except for lamprey GnRH-II (la). Exon 1 contains the 5' untranslated region (UTR), exon 2 codes for the the signal peptide, the GnRH decapeptide, the processing site and part of the GnRH associated peptide (GAP). The remaining GAP sequence is coded in exon 3 and part of exon 4. The last part of exon 4 codes the 3' UTR. The cDNA structure of GnRH in vertebrates (lb).
Invertebrate GnRH
Thirteen of the twenty-eight isoforms have been found in invertebrates. Tunicate-I and tunicate-II were identified in a protochordate, the tunicate, Chelyosoma production
(Powell et al., 1996). In the tunicate Ciona intestinalis there are two genes for GnRH with each gene encoding three unique GnRH isoforms for a total of six in one animal. Ciona
8 intestinalis gnrh 1 and 2 are different from vertebrates because, unlike the vertebrate in which one gene encodes for one GnRH, in tunicates, one gene encodes for three different
GnRHs (Adams et al., 2003; Kavanaugh et al., 2005b). One gene encodes for tunicate
GnRH-III, -V, and -VI (Fig. 2) while the other gene encodes for tunicate GnRH-IV, -VII, and VIII (Fig. 3) (Kavanaugh et al., 2005b). Tunicate IX was discovered in Ciona savignyi (Adams et al., 2003). Tunicate GnRHs III - IX represent the first time an in silico (computer based search) technique was used to determine the nucleotide sequence of novel forms of GnRH. Recently the in silico was used to identification three more invertebrate GnRHs, two from mollusk and one in Annelid {Aplysia, limpet, annelid)
(Tsai and Zhang, 2008; Zhang et al., 2008).
Exon
Processing site (Gly - Arg - Arg) Processing site (Gly - Lys — Arg)
GAP GnRH GnRH i in II i II ^ A GnRH Processing site (Gly - Arg — Arg)
Figure 2. Schematic Diagram of Ciona Ci-gnrhl Gene Structure and Schematic Diagram of Vrepro-Ci-gnrhl.. Ci-gnrhl does not have introns and consists of one exon with 5' and 3' flanking regions in contrast to the three introns, four exon arrangement of the vertebrate GnRH gene. The three distinct GnRH peptides are separated by intervening sequences of thirteen and eight amino acids respectively. The first two dibasic processing sites are Arg - Arg while the third processing site is Lys- Arg. The GnRH peptides encoded in order are tunicate GnRH-III, -V, and -VI.
9 Exon Exon Exon
Intron Intron
Processing site (Gly - Lys - Arg) Processing site (Gly - Lys - Arg)
Signal peptide
GnRH GnRH
Z\ GnRH Processing site (Gly - Lys - Arg)
Figure 3. Schematic Diagram of dona Ci-gnrhl Gene Structure and Schematic Diagram of Vrepro-Ci-gnrh2. Ci-gnrhl has two introns and three exons with 5' and 3' flanking regions in contrast to the three introns four exon arrangement of the vertebrate GnRH gene. The three distinct GnRH peptides are separated by just the dibasic processing site Lys - Arg. The GnRH peptides encoded in order are tunicate GnRH-VII, -VIII, and -IV.
10 Hagfish GnRH
Since the late 1970's, attempts were made to determine if GnRH was present in hagfish. Investigations of the presence or absence of a GnRH-like molecule in the hagfish brain have provided negative and positive results Kavanaugh et al., 2005. Initial immunocytochemistry studies showed no evidence of GnRH immunoreactivity in the brain of the Pacific hagfish, Eptatretus stouti (Crim et al., 1979a). Also, in 1979, the use of immunohistochemistry failed to detect GnRH in the brain of the Pacific hagfish
Eptatretus burgeri (Nozaki and Kobayashi, 1979). However in these earlier investigations, which produced negative results of ir-GnRH in the brain of hagfish, there were a limited number of GnRH antisera available. In 1980, two groups detected an immunoreactive GnRH-like molecule in hagfish, (Jackson, 1980; King and Millar, 1980) however, both either group was not able to identify the primary GnRH sequence. In 1989, minimal immunocytochemical evidence was reported to support the existence of a form of GnRH in the brain of M. glutinosa (Blahser et al., 1989).
By 1993, two isoforms of lamprey GnRH had been isolated and the primary structures determined in the sea lamprey as well as GnRHs from other vertebrates in the
1990's, this allowed the generation of new GnRH antisera that could be tested in hagfish.
In 1995, Sower et al., using the techniques of immunocytochemistry (ICC), HPLC, and radioimmunoassay (RIA) with a specific lamprey GnRH-III antisera localized a lamprey-
III GnRH-like molecule in the hypothalamus, adenohypophysis and the neurohypophysis of the Atlantic hagfish (Sower et al., 1995). Also in 1995, using six different antisera to
GnRH (salmon PBL-49, lamprey 21-134, lamprey 1459, lamprey 1467, chicken-II, and mammalian), an ir- salmon GnRH-like molecule was shown to be present in the preoptic
11 cells, hypothalamic infundibular nucleus, hypophysial stalk and distributed fibers of the hagfish brain (Braun et al., 1995). GnRH-like immunoreactivity has also been reported in the neurohypophysis of the Atlantic hagfish using antisera against salmon GnRH, chicken-II GnRH, lamprey-I and-III GnRH (Oshima, 2000).
The presence and location of immunoreactive GnRH-like substance(s) in the brain of the hagfish have led the authors to hypothesize that GnRH has a neuroendocrine function acting on the pituitary (Braun et al., 1995; Sower et al., 1995). The concentrations of ir-GnRH in the brain of the Atlantic hagfish were examined for a one year period. The results from these studies showed brain concentrations of ir-GnRH corresponding to the stages of gonadal development (Kavanaugh et al., 2005a) suggesting the reproductive pathway in hagfish may contain the components of a complex neuroendocrine axis in the coordination and integration of environmental cues and hormonal mechanisms seen in other vertebrates (Kavanaugh et al., 2005a; Miki et al.,
2006). However, to date no experimental evidence has linked a GnRH or GnRH-like substance to the stimulation of reproductive processes in hagfish. Unfortunately, the primary structure(s) of hagfish GnRH(s) is/are still unknown. Therefore, the first objective of my dissertation research was to determine the primary amino acid structure of the GnRH(s) present in the Atlantic hagfish using protein purification and mass spectrometry.
12 Lamprey GnRH-II
Analysis of the sea lamprey genome revealed a potential novel GnRH peptide.
The peptide has a novel 10 amino acid sequence and does not match any of the currently identified forms. The novel form, lamprey GnRH-II, has all of the characteristics of the
GnRH preprohormone: signal peptide, GnRH decapeptide, dibasic processing site and the
GnRH associated peptide (GAP) (Fig. 17). Information from the lamprey genome also showed that lamprey GnRH-II is intronless (Kavanaugh et al., 2008). Examining a partial assembly of the lamprey genome at Pre-Ensembl
(http://pre.ensembl.org/Petromyzon_marinus/ Info/Index) confirms the gene structure of lamprey GnRH-I and III. Lamprey GnRH-I and III genes consist of 4 exons and 3 introns, this also confirms the nucleotide sequence of lamprey GnRH-I proposed by
Suzuki et al., (Suzuki et al., 2000).
System
GnRH Development
Using molecular phylogenetic analysis to reconstruct species phylogeny is open to conflicting results, however, it still provides useful information for systems analyses
(Brocchieri, 2001; Lio and Goldman, 1998; Silver et al., 2004; Slowinski and Page,
1999). The vertebrate GnRH family of peptides (Table 1) is a highly conserved group of neurohormones that has been subject to intense investigation since the first primary structure of GnRH was Matsuo et al., identified in 1971 (Burgus et al., 1972a; Matsuo et al., 1971). The recent identification of novel GnRH isoforms, from several species
13 representing several classes of vertebrates, has led to further immunohistochemical or
RNA expression analysis showing that a species can express two or three different forms of GnRH in the brain. (Dubois et al., 2002; Kavanaugh et al., 2008; King et al., 1995;
Root et al., 2005; Vickers et al., 2004; White and Fernald, 1998; White et al., 1998b).
Phylogenetic analysis by Fernald and White (1999) using 23 GnRH transcripts established that the GnRH family in gnathostomes consisted of 3 paralogous lineages
(Fernald and White, 1999). Since the cDNAs of lamprey GnRHs had not been determined, these analyses did not include lamprey GnRH-I and -III. Following the identity of the lamprey GnRH-I (Suzuki et al., 2000) and lamprey GnRH-III (Silver et al.,
2004) a more in-depth phylogenetic analysis was done including the recently deduced amino acid sequences from the eight cloned lamprey GnRH-III cDNAs (Table 3). The phylogenetic analysis of Silver et al., (2004) demonstrated that the lamprey GnRH forms group together separately from the three previously described lineages of GnRH, and as such they suggested that lamprey GnRHs form a 4th lineage of GnRH. These data are now supported by new analysis using a novel GnRH in lamprey and novel GnRHs in mollusks (Kavanaugh et al., 2008; Tsai and Zhang, 2008). Immunocytochemical, functional data of lamprey GnRH and mollusk GnRHs provide further evidence and support the 4th lineage of lamprey GnRH-I and -III. The lineages of GnRH identified by
Fernald and White (1999) and Silver et al., (2004) include type I GnRH which consist of mammalian GnRH and it orthologs. Its origin is in the hypothalamic / olfactory region of the brain and its expression is seen in the preoptic anterior hypothalamic region (Norgren and Gao, 1994; Schwanzel-Fukuda, 1999; Wray et al., 1989a; Wray et al., 1989b). Type
II GnRH is composed of only chicken-II GnRH which originates in the midbrain and is
14 expressed in the midbrain. Type II GnRH functions as a neuromodulator and in some cases as a hypothalamic GnRH and in addition to possible other unknown functions
(Ikemoto and Park, 2006; Li et al., 2004; Lin and Peter, 1996, 1997; Steven et al., 2003).
Type III GnRH consists of only salmon GnRH. The salmon GnRH neurons originate from the telencephalon / olfactory regions and are expressed in the ventral
Telencephalon. Similar to type II GnRH, type III GnRH functions as a neuromodulator, hypothalamic hormone in some teleost, and may have other functions that are unknown
(Amano et al., 1997; Lin and Peter, 1996; Parhar et al., 1994). Type IV GnRH is comprised of lamprey GnRH-I and -III, the neurons originate in the diencephalon / ventricular region and expression is seen in the preoptic anterior hypothalamic region
(Gorbman and Sower, 2003). Within the brain both lamprey GnRH-I and -III are expressed and confined to the preoptic anterior and hypothalamic regions and both isoforms have roles in the regulation of the pituitary-gonadal axis. (Crim, 1985; Crim et al., 1979b; Eisthen and Northcutt, 1996; Nozaki et al., 2000; Sower, 2003a; Sower et al,
2000; Tobet, 1993; Tobet et al., 1997).
15 The Lineages of Vertebrate GnRH
Type GnRH Brain Distribution/ Primary GnRH structures identified in Vertebrates (Lineage) Origin
Mammal GnRH in mouse, primate, human, sheep, Hypothalamus, pig, eel, newt, frog; chicken GnRH-I in chicken, GnRH-I diencephalon/ lizard; Seabream GnRH; Medaka GnRH, Whitefish, Olfactory origin GnRH; Herring GnRH, Catfish GnRH
Chicken GnRH-II in mouse, primate, human, chicken, lizard, frog, newt, eel, goldfish, catfish, Midbrain/ salmon, medaka, red seabream, tilapia, ratfish, GnRH-II Ventricular cichlid, herring, pejerrey, sea bass, whitefish, fugu, Ependyma origin trout, goldfish, zebrafish, arowana, Lamprey GnRH- II in lamprey.
Salmon GnRH in medaka, red seabream, tilapia, Telencephalon/ GnRH-III salmon, trout, goldfish, zebrafish, arowana, cichlid, Olfactory origin herring, pejerrey, sea bass, whitefish, fugu.
Hypothalamus, GnRH-IV diencephalon/ Lamprey GnRH-I and lamprey GnRH-III in lamprey. Ventricular origin
Table 3. GnRHs are divided into four lineage types based on a combination of function, location of expression ^nd phylogenetic analysis, adapted from Gorbman and Sower 2003.
Lamprey GnRH-I and III have been shown by extensive functional, physiological and immunocytochemical studies to control / regulate the pituitary gonadal axis (Deragon and Sower, 1994; Sower, 2003 a). The newly identified lamprey GnRH-II appears to have a hypothalamic role and the ability to act through lamprey GnRH receptor-I; this makes lamprey one of the few vertebrates to have potentially three GnRHs acting via the hypothalamic-pituitary gonadal axis (Kavanaugh et al., 2008; Sower et al., 2009). In
16 contrast to the lamprey GnRHs, the type I GnRH and orthologs neurons are not only found in the hypothalamus but in some cases, occur outside the hypothalamus in different parts of the brain. Further information on new novel and already identified GnRHs and sequence information as well as the distribution, function and physiology of these GnRHs will be needed to ultimately understand the molecular evolution of the GnRH family in metazoans (Silver et al., 2004).
Type I: Tie mGiiRH (& orthologs) GnRH Lineages p>- Group I
c* refer* i Type III: 4 sCn'RH y>~ Gtoup in
Type II: chGnRH-II J>— Group 11
•< j>-~ Group IV
SOver, et al, 2003 -$35 Changes Type IV: LGnRHs
Figure 4. The Four Proposed GnRH Lineages. The GnRH family is divided into four paralogous lineages based on phylogenetic analysis, location of expression within the brain and function (Silver and Sower, 2003).
17 Mechanism of Action
The GnRH receptor activation mechanism is ligand mediated through high affinity binding of GnRH to its cognate receptor. All GnRH receptors are members of the
Class-A G-protein coupled receptors (GPCR) and consist of an extracellular N-terminus,
7-transmembrane regions and the absence or presence of a intracellular C-terminal tail
(Silver et al., 2005; Silver and Sower, 2006). Traditionally, GnRH receptors have been classified as either type I (without a C-terminal tail) or type-II, with a C-terminal tail.
Unlike most members of the Class-A GPCRs the type I GnRH receptor is the exception, lacking the intracellular C-terminal tail. Although all functions for the C-terminal tail in the type II receptor have not been established, research has shown it has important roles in G-Protein coupling, activation of second messenger systems, receptor internalization, conformation and ligand binding. (Bockaert et al., 2003; Heding et al., 1998; Koenig and
Edwardson, 1997; Millar, 2005; Pfleger et al., 2008; Ronacher et al., 2004; Silver et al.,
2005; Silver and Sower, 2006). Type-I and some type-II GnRH receptors have been identified in mammals, the majority being type-I. However, type-II GnRH receptors are nonfunctional in the chimpanzee, cow and sheep due to stop sites or deletions in the transcript, whereas a fully functional type-II GnRH receptor is present in New and Old world monkeys and pig (reviewed in (Silver et al., 2005)). Since the first successful cloning of a GnRH receptor transcript from the mouse (Tsutsumi et al., 1992), more than
83 GnRH receptor cDNAs had been cloned leading to a better understanding of function and evolution of the GnRH receptor family (Millar et al., 2004; Silver et al., 2005; Sower et al., 2004).
18 Since the description of the catfish GnRH receptor 1, which was the first identified GnRH receptor to retain the evolutionarily conserved intracellular C-terminal tail, it has become evident that the main structural difference within the GnRH receptor family is the presence or absence of the intracellular C-terminal tail. The tail has been shown to affect not only effective GnRH binding and activation of signal transduction, but desensitization and internalization pathways as well (Blomenrohr et al., 1999; Heding et al., 1998; Hislop et al., 2005; McArdle et al., 1999; Pawson et al., 1998; Vrecl et al.,
2000; Willars et al., 1999).
In the adenohypophysis (anterior pituitary), GnRH binds a rhodopsin-like G protein-coupled receptor on gonadotropes (Millar, 2005; Nozaki et al., 1995) initiating a secondary messenger cascade. The G-protein dissociates and activates phospholipase C
(PLC) which then stimulates the hydrolysis of phosphatidylinositol 4,5-bisphosphate
(PIP2) resulting in producing inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG)
(Davis et al., 1986; Dobkin-Bekman et al., 2006; Runnenburger et al., 2002). IP3 is essential for the mobilization of calcium from outside the cell while DAG activates protein kinase C (PKC) (Shacham et al., 1999; Shacham et al., 2001). Calcium is then mobilized into the cell and calmodulin is activated which appears to mediate the release of gonadotropins. Together the activation of PKC and DAG mediate the synthesis of gonadotropins. The gonadotropins luteinizing hormone (LH) and follicle stimulating hormone (FSH) are then released into general circulation where they act on target tissues, the testis or ovaries to mediate the production of the reproductive steroids or gametogenesis.
19 In the sea lamprey, a functional type II GnRH receptor (IGnRHR) was isolated and cloned from the pituitary (Silver et al., 2005). The lamprey GnRH receptor was shown to activate both the cAMP and IP signaling systems, however the IP system was activated at an approximately 10 fold lower concentration to both lamprey GnRH-I and lamprey GnRH-III, and was also activated to a greater magnitude of approximately 4.5 fold, compared to -1.7 fold (lamprey GnRH-I) or -2.1 fold (lamprey GnRH-III) (Silver and Sower, 2006). These responses of IP3 and cAMP signaling system are similar to the type I and type II GnRH receptors from different species (Arora et al., 1998; Grosse et al., 2000; Liu et al., 2002; Oh et al., 2005; Stanislaus et al., 1998). In addition, the
IGnRHR retains conserved structural features and amino acid motifs of other known
GnRH receptors (Oh et al., 2005; Silver and Sower, 2006).
Gonadotropin
In gnathostomes, the GpH family consists of two pituitary GTHs, LH and FSH, one chorionic GTH (CG) and one thyroid-stimulating hormone (TSH). The alpha subunit is common within a single species (Kawauchi, 1989). The beta subunits are homologous and convey hormone specificity (Huhtaniemi, 2005; Kawauchi, 1989; Swanson et al.,
1991). Two GTHs have been identified in all taxonomic groups of gnathostomes
(Huhtaniemi, 2005; Kawauchi, 1989; Querat et al., 2004; Querat et al., 2000; Suzuki et al., 1988a, b). There is evidence to support the presence of GTH in hagfish, however, to date, only one GTH has been identified in jawless vertebrates (agnathans) (Nozaki et al.,
2005; Nozaki et al., 2007; Sower et al., 2006). Sower et al., have identified the first and perhaps only gonadotropin beta-like protein by cDNA cloning in sea lamprey (Sower et
20 al., 2006). Because the sea lamprey GTH P protein is a clear out-group compared to those of the LH and FSH family based on phylogenic analysis, it was proposed that an ancestral
GpH gave rise to only one GTH in lampreys and to the GpH family that gave rise to LH,
FSH, and TSH during the early evolution of gnathostomes (Freamat et al., 2006; Freamat and Sower, 2008; Nozaki et al, 2008; Sower et al., 2009).
Vertebrate Hypothalamus Relations
The anatomical relationships between the hypothalamus and pituitary vary among the vertebrates. There are three types of hypothalamic-pituitary relations, 1) a portal vascular system, 2) direct innervation and 3) diffusion (Fig. 5) (Nozaki et al., 1994).
Teleost fish have resolved this by using direct innervation of the pars distalis by neurosecretory neurons from the hypothalamus to the pituitary (Gorbman, 1980; Peter,
1990). In mammals, GnRH is released from the hypothalamus into portal vascular system where it travels to the adenohypophysis (Nozaki et al., 1994). Lamprey and hagflsh have a diffusional type hypothalamus-pituitary relationship (Nozaki et al., 1994).
They lack a median eminence or portal vascular system to transport regulatory peptides from the brain to the anterior pituitary (Fig. 5) (Gorbman, 1965, 1997; Tsukahara et al.,
1986). Anatomical and experimental studies have strongly supported the concept of the diffusion of the hypothalamic neurohormones to the anterior pituitary via the connective tissue in the hagfish and lamprey (Braun et al., 1995; Nozaki et al., 1994; Sower et al.,
1995; Tsuneki, 1986).
21 Figure 5. Representation of the three types of adenohypophysial innervations from the hypothalamus. 1. Agnathans— diffusion, 2. Teleost— direct innervation, 3. Higher vertebrates—highly vascularized median eminence (Nozaki et al., 1994).
Figures 6 and 7 are schematics of the anatomical relationship of the hypothalamus and pituitary in the Atlantic and Pacific hagfish (Braun et al., 1995). These pictures represent opposing sections, one coronal the other sagittal. They also clearly show the physical separation of the adenohypophysis from the neurohypophysis and hypothalamus. The distance between the neurohypophysis and anterior pituitary is 10 microns or less
(Nozaki et al., 1994). Figure 6. Coronal Section of Pacific Hagfish Pituitary. Schematic demonstrating general anatomy: adhyp adenohypophysis, nhyp Neurohypophysis, be - brain capsule, dnp - dorsal epithelium of nasopharyngeal duct (Braun et al.,
22 It has been demonstrated in the hagfish Eptatretus burgeri that substances of different molecular size could diffuse from the third ventricle of the hypothalamus to the adenohypophysis in a relatively short period of time (Nozaki et al., 1975; Tsukahara et al., 1986) and not across the blood brain barrier (Bundgaard et al., 1979). These studies help to support the concept of hypothalamic control of the pituitary in hagfish similar to all other vertebrates.
Figure 7. Nearly Midsagittal Section of Atlantic Hagfish Neurohypophysis. Areas b, c, d, show lamprey-III GnRH immunoreactive fibers. DW and VW represent the dorsal and ventral walls respectfully of the neurohypophysis and AH vw is the adenohypophysis (Sower et al., 1995).
23 Objectives
Gonadotropin-releasing hormone and its cognate receptor are necessary components of the hypothalamic-pituitary-gonadal axis and are required for reproduction in vertebrates. The agnathans occupy an important phylogenetic position as the most basal vertebrates. Lampreys are the earliest evolved vertebrates for which there are demonstrated functional roles for two gonadotropin-releasing hormones that act via the hypothalamic-pituitary-gonadal axis controlling reproductive processes. Unfortunately, little is known about the reproductive process and hormones involved in hagfish reproduction; currently, no forms of gonadotropin-releasing hormone have been identified from hagfish. The high conservation of gonadotropin-releasing hormones and their receptors throughout vertebrate species makes the lamprey and their sister group the hagfish models highly appropriate for examining the GnRH.
The objectives of this dissertation are to: 1) identify form(s) of gonadotropin- releasing hormone that may be present in the Atlantic hagfish, 2) using sequence trace files from the lamprey genome sequencing project—determine if a third form of GnRH is present in the lamprey, since many teleost have three gonadotropin-releasing hormones.
24 Chapter II
Attempts to Isolate Gonadotropin-Releasing Hormone from the Atlantic Hagfish,
Myxine glutinosa
Abstract
The hagfish and lampreys are the only two representatives of Agnathans among extant vertebrates. Agnathans are an important taxonomic group because they are basal vertebrates. These fish have many structures and functions that are representative of the ancestral condition during the origin and divergence of vertebrates. The regulatory hypothalamic neurohormone, gonadotropin-releasing hormone (GnRH), regulates reproduction in all vertebrates through the hypothalamic-pituitary-gonadal axis. Most vertebrates have at least two forms of GnRH in the brain. The earliest evolved vertebrate for which a functional role for GnRH has been established is the sea lamprey Petromyzon marinus. In hagfish the primary amino acid structure of GnRH has not been identified as yet, however, indirect methods such as immunohistochemistry and HPLC have shown an immunoreactive GnRH or a GnRH-like peptide in the brain of hagfish. In addition concentrations of brain ir-GnRH have been correlated with reproductive stages in the
Atlantic hagfish {Myxine glutinosa). These data provide supportive evidence for an isoform of GnRH(s) in the brain of hagfish. In my master's thesis research, attempts to identify the cDNA of hagfish GnRH, by molecular techniques did not yield the cDNA or
25 the primary structure of GnRH(s) in hagfish (Kavanaugh, 2004). Therefore the objective of this study was to identify the primary structure of putative GnRH(s) by using some molecular and protein methods including PCR, MALDI, and chromatography (column and HPLC). Although immunoreactive-GnRH was identified, again, the use of molecular methods did not yield the primary structure of GnRH. It is suggested that further attempts to determine the GnRH(s) in hagfish should wait until the hagfsh genome has been sequenced.
26 Introduction
The Agnathans which are divided into two families, Myxinoidea (hagfish) and
Petromyzontoidea (lampreys) (Janvier, 1981) are an important taxonomic group because modern representatives retain many structures and functions that are representative of the ancestral condition during the origin of vertebrates (Ota and Kuratani, 2006; Xian-guang et al., 2002). The hagfish and lampreys having evolved over 530 million years ago are the only known living representatives of the most ancient class of vertebrates. The
Myxinoidea family is considered to be one of the most ancient of all vertebrates living or extinct (Sower, 1997). Since the anatomical studies of the nineteenth-century, hagfish have continued to be enigmas in anatomy, life history, and in their position in vertebrate evolution (Amiya et al., 2007; Delarbre et al., 2002; Janvier, 1981; Worthington,
1905)(Appendix E). To better understand the reproductive system of the Atlantic hagfish the regulatory neurohormone GnRH needs to be identified.
In 1971, Matsuo et al., elucidated the first amino acid sequence of GnRH in porcine (Matsuo et al., 1971). The regulatory hypothalamic neurohormone, GnRH, regulates reproduction in all vertebrates through the hypothalamic-pituitary-gonadal axis.
To date the primary sequence of twenty-eight GnRH forms has been identified in invertebrates and vertebrates. (Kavanaugh et al., 2008; Zhang et al., 2008) (Tables 1 and
2). All isoforms have conserved regions: a signal peptide, the GnRH peptide, a dibasic cleavage site and the GnRH associated peptide (GAP) (Figs. 1, 2, 3).
Most vertebrates have at least two forms of GnRH in the brain, generally one form is released from the hypothalamus to regulate reproduction while the location and function of the second or third brain isoform is variable in different vertebrates
27 (Kavanaugh et al., 2008; Sower et al., 2009). The earliest evolved vertebrate for which a functional role for GnRH has been established is the sea lamprey Petromyzon marinus
(Sower, 2003a; Sower, 2003b; Sower et al., 2009)}. Unlike gnathostomes, both lamprey
GnRH-I and lamprey GnRH-III have been extensively demonstrated to modulate and control various reproductive processes in P. marinus (Gazourian et al., 2000; Sower,
2003a; Sower, 2003b). Recently, a third and novel form of GnRH, lamprey GnRH-II has been determined and proposed to be another hypothalamic GnRH (Kavanaugh et al.,
2008).
Since the late 1970's, attempts have been made to determine if GnRH was present in hagfish. Investigations of the presence or absence of a GnRH-like molecule in the hagfish brain have provided ambiguous results, summarized in Braun et al., 1995 and
Sower et al., 1995. An initial immunocytochemistry study showed no evidence of GnRH immunoreactivity in the brain of the Pacific hagfish, Eptatretus stouti (Crim et al., 1979a, b). Also, in 1979, the use of immunohistochemistry failed to detect GnRH in the brain of the Pacific hagfish Eptatretus burgeri (Nozaki and Kobayashi, 1979). However in these investigations, which produced negative results of ir-GnRH in the brain of hagfish, there were a limited number of GnRH antisera available. In 1980, two groups detected an immunoreactive GnRH-like molecule in hagfish, (Jackson, 1980; King and Millar, 1980) however, neither were able to identify the primary GnRH sequence. In 1989 Blahser et al., reported minimal immunocytochemical evidence to support the existence of a form of
GnRH in the brain of M. glutinosa (Blahser et al., 1989).
Attempts to identify GnRH in hagfish benefited from the discovery of two isoforms of lamprey GnRH that had been isolated and the primary structures determined
28 in the sea lamprey as well as other vertebrates in the 1990's. These discoveries allowed the generation of new GnRH antisera that could be tested in hagfish. In 1995, Sower et al., using the techniques of immunocytochemistry (ICC), HPLC, and radioimmunoassay
(RIA) with a specific lamprey GnRH-III antisera localized a lamprey-III GnRH-like molecule in the hypothalamus, adenohypophysis and the neurohypophysis of the Atlantic hagfish (Sower et al., 1995). Also in 1995, using six different antisera to GnRH (salmon
PBL-49, lamprey 21-134, lamprey 1459, lamprey 1467, chicken-II, and mammalian), an ir- salmon GnRH-like molecule was shown to be present in the preoptic cells, hypothalamic infundibular nucleus, hypophysial stalk and distributed fibers of the hagfish brain (Braun et al., 1995). GnRH-like immunoreactivity has also been reported in the neurohypophysis of the Atlantic hagfish using antisera against salmon GnRH, chicken-II
GnRH, lamprey-I and-III GnRH (Oshima, 2000).
The presence and location of immunoreactive GnRH-like substance(s) in the brain of the hagfish have led researchers to hypothesize that GnRH has a neuroendocrine function acting on the pituitary and reproductive processes (Braun et al., 1995; Sower et al., 1995). Stages of gonad development correlated with concentrations of ir-GnRH in the brain of the Atlantic hagfish during a one year period (Kavanaugh et al., 2005b; Powell et al., 2004). It has been hypothesized that the reproductive pathway in hagfish may contain the components of the complex neuroendocrine axis coordinating and integrating environmental cues and hormonal mechanisms as seen in other vertebrates (Kavanaugh et al., 2005a; Miki et al., 2006). However, to date no experimental evidence has linked a
GnRH or GnRH-like substance to the stimulation of reproductive processes in hagfish.
Unfortunately, the primary structure(s) of hagfish GnRH(s) is/are still unknown.
29 Currently, very little is known about reproduction in hagfish. Until recently, only one species, Eptatretus burgeri the Japanese hagfish, has been shown to have an annual reproductive cycle. In this cycle, the hagfish migrates between deep and shallow water for spawning (Fernholm, 1974; Gorbman and Dickhoff, 1978; Kobayashi et al., 1972;
Tsuneki et al., 1983). In 1974, Hirose demonstrated the presence of steroid hormone production in the mature ovary of the hagfish E. stouti. Powell et al., examined steroid concentrations from in vitro incubations of gonads, and have correlated these concentrations with development and maturation of gonadal tissues in Atlantic hagfish captured monthly from the Atlantic Ocean (Powell et al., 2004). These data showed an annual cycle of estradiol and progesterone production corresponding to a seasonal reproductive cycle (Kavanaugh et al., 2005a). These data, in conjunction with Kavanaugh et al., provided evidence that the Atlantic hagfish has an annual reproductive cycle likely regulated by a neuroendocrine axis (Kavanaugh et al., 2005a).
The discovery of the multiple forms of GnRH has been achieved through several techniques. Mammalian (Matsuo et al., 1971), lamprey I and III (Sherwood et al., 1986;
Sower et al., 1993), dogfish (Lovejoy et al., 1992), chicken I (Miyamoto et al., 1982) and
II (Miyamoto et al., 1984), salmon (Sherwood et al., 1983), herring (Carolsfeld et al.,
2000), catfish (Ngamvongchon et al., 1992), tunicate I and II (Powell et al., 1996) and seabream (Powell et al., 1994) GnRHs were identified using chromatographic methods.
Molecular methods were used to identify guinea pig (Jimenez-Linan et al., 1997), rana
(Yoo et al., 2000), medaka (Okubo et al., 2000) and whitefish (Adams et al, 2002)
GnRHs. The sequencing of many genomes has resulted in the identification of tunicate
GnRHs III - IX (Adams et al., 2003), aplysia (Zhang et al., 2008), lamprey-II GnRH
30 (Kavanaugh et al., 2008) and annelid and owl limpet GnRHs (Tsai and Zhang, 2008). In the early 2000s attempts to identify GnRH in hagfish using specific and non specific primers for PCR with 1st strand and 2nd strand with adaptor primers as template and the screening of an expression library with multiple antibodies to GnRH were unsuccessful in attempts to identify the sequence of GnRH believed to be present in Atlantic hagfish
(Kavanaugh, 2004).
It was not until recently (2007) that the approval was given by NIH to start mapping the genome of the hagfish E. burgeri, however, sequencing has not yet started.
Given that previous attempts to isolate GnRH from hagfish were not successful and the genome sequencing project had not started, my objective was to use protein purification methods previously used to isolate GnRH from the brains of the Atlantic hagfish. The specific protocol for isolation of GnRH followed that of Sower et al., 1993 (Sower et al.,
1993). Two attempts were made to isolate GnRH, first to obtain fractions for MALDI analysis and second for peptide sequencing. Additionally, attempts were made to identify
GnRH using polymerase chain reaction. Similar to previous peptide identification attempts, immunoreactive GnRH or a GnRH-like peptide was detected from the brain of hagfish, but no primary sequence was obtained in the current study. The lack of positive results can be attributed to the lack of a specific antisera or another explanation may be that the HPLC columns that were used.
31 Materials and Methods
Peptide Isolation Methods
Two attempts were made to isolate the GnRH peptide(s) using peptide purification: the first round was a partial purification (SepPak and G25 sephadex) and immunoreactive fractions were analyzed using matrix-assisted laser-desorption ionization. The second purification followed methods previously established during the isolation and identification of lamprey GnRH-I and -III.
First Extraction and Radioimmunoassay
Based on information from Kavanaugh et al., (Kavanaugh et al., 2005a), 300 hagfish were collected and stored at -80°C. The brains were extracted following Sower et al., (1993). Briefly, the brains were extracted in boiling 2M acetic acid (1 g of tissue /
5ml of acetic acid) and then homogenized using a Brinkmann Homogenizers polytron
(using largest blade: homogenize at setting five for 15 seconds two times, followed with one time on setting eight for 5 seconds), model PT 10/35, centrifuged at 18,000g for 60 minutes at 4°C, and the supernatant was filtered and TFA was added to a final ratio of
0.1% (v/v). The supernatant was passed through 10 C-18 Sep-Pak cartridges in tandem, preconditioned with 100% methanol followed with MqH20. The Sep-Pak was eluted with 2% formic acid followed with 80% acetonitrile. The acetonitrile fraction was dried down on a speed-vac to approximately 10ml and then loaded on a Sephadex G-25 column equilibrated with 2M acetic acid. One hundred ten ml fractions were collected and lOOul was radioimmunoassayed for GnRH (Fig. 8). The samples were assayed as previously described by Stopa and Sower (1988, 1993). Lamprey GnRH-III antiserum 3952 was
32 characterized by Coupe et al., 1995. The antiserum (lamprey GnRH-III antiserum 3952) showed a high cross-reactivity with lamprey GnRH-I of 123%, but less than 1% cross- reactivity with mammal, salmon, chicken-I and chicken-II forms. Lamprey GnRH-III antiserum was used at an initial dilution of 1:16,000. Synthetic GnRH-I was iodinated using a modification of the chloramine T method as previously described (Carolsfeld et al., 2000; Stopa et al., 1988).
Matrix-Assisted Laser-Desorption Ionization Post Source Decay (PSD) and Collision
Induced Dissociation (CID)
Immunoreactive samples were dried in a Savant Speed Vac (model RVT4104 refrigerated vapor trap). The samples were then prepared for MALDI analysis as follows: samples were reconstituted in 500ul of MilliQ water (HPLC grade) and incubated for 1 hour with shaking at 4°C. The samples were then further purified using Millipore C-18
ZipTip and then mixed 50:50 (v/v) in 100% ACN with 0.1% TFA. The samples were plated (0.5ul) with an equal volume of matrix, either a-cyano-4-hydroxycinnamic acid or
2,5-dihydroxy benzoic acid and then subjected to analysis on Shimadzu's Axima
MALDI-TOF curved field reflectron (CFR) using post source decay and Shimadzu's
Axima MALDI-TOF quadrapole ion trap (QIT) collision induced dissociation (Fig 9).
Second Extraction and Radioimmunoassay
Hagfish were collected from New England Eel Processors in February of 2005.
One Thousand brains and pituitaries (59.23g) were dissected out and stored at -80°C until extraction. The brains were extracted following Sower et al. (Sower et al., 1993) as done
33 previously. One hundred, ten ml factions were collected from the Sephadex G-25 column and lOOul was radioimmunoassayed for GnRH. The samples were assayed as previously described (Sower et al., 1993; Stopa et al., 1988). The fractions (Figs.10, 11) containing maximum immunoreactivity were processed as described (Sower et al., 1993). Briefly the immunoreactive fractions were pooled and pumped at a flow rate of 1.5 ml/min onto a 1 x 10-cm Aquapore C8 column (Applied Biosystems, Foster, CA) equilibrated with 0.1% trifluoroacetic acid. The concentration of acetonitrile in the eluting solvent was raised to
21% (vol/vol) over 10 min and held at this concentration for 30 min, and then raised to
50% (vol/vol) for another 60 min using a linear gradient. Absorbance was measured at
214 nm and 2 ml fractions were collected. Fractions were analyzed by RIA and GnRH- like immunoreactive fractions (Fig. 12) were rechromatographed on a 0.46 X 25.cm
Vydac 219TP54 phenyl column (Separations Group, Hesperia, CA) equilibrated with
0.1% trifluoroacetic acid at a flow rate of 1.5 ml/min and individual peaks were collected by hand. The concentration of acetonitrile was raised to 35% (vol/vol) over 60 min using a linear gradient. Multiple immunoreactive peaks (Fig. 13) were further purified to apparent homogeneity by chromatography on a 1 x 25.cm Vydac 218TP510 (CI8) column under the same conditions used for the phenyl column. Several peaks were not investigated because of the low level of immunoreactivity (Fig. 14).
Texas Peptide Sequencing
Peptide sequencing was performed by the Protein Chemistry Laboratory at the
University of Texas Medical Branch, Galveston, Texas. Samples were checked for purity using MALDI-TOF, samples with relatively clean peaks (Fig. 15) were prepared for
34 sequencing. Since the N-terminus is blocked by a pyroglutamate, samples were digested with pyroglutamate aminopeptidase and then sequenced using the Edman degradation method (Sower et al., 1993). A positive control of lamprey GnRH-III was digested with pyroglutamate aminopeptidase followed with Edman degradation (Fig. 16) to ensure the efficiency of the pyroglutamate aminopeptidase digestion.
Molecular Methods
Total RNA Isolation
Total RNA was isolated using ISOGEN (Nippon Gene Co. Ltd. Toyama, Japan), following the protocol as outlined by Amemiya et al (Amemiya et al., 1999b). One hundred and Twenty micrograms of dissected Myxine glutinosa brain collected in May
2005 was added to 1.2 ml of ISOGEN in a 2 ml microcentrifuge tube, and then homogenized using a Brinkmann Homogenizers polytron, model PT 10/35. The tissue was then held at room temperature for five minutes, followed with the addition of
1 ml/tube molecular biology grade chloroform, vortexed, and then held at room temperature for three minutes. The sample was centrifuged at 12,000 rpm (11,750 RCF) for 15 minutes at 4°C. The aqueous phase (upper phase) was collected, then 0.5ml of isopropanol was added, mixed and stored at room temperature for ten minutes. The mixture was then centrifuged at 12,000 rpm for 15 minutes at 4°C, aspirated, dried and the contents were resuspended in 20ul autoclaved Mili-Q water, then quantitated yielding a 260/280 of 2.122 and a total RNA concentration of 1.036ug/ ul.
35 First Strand Synthesis
First strand cDNA synthesis was accomplished by using a First-Strand cDNA synthesis kit from Amersham Pharmacia Biotech (Amersham Pharmacia Biotech, Inc.
Amersham Pharmacia Biotech UK Limited. Amersham Place, Little Chalfont,
Buckinghamshire, England HP7 9NA) following Kavanaugh et al., 2005b. Briefly,
15.2ul sterilized Mili-Q water was added to 4.8ul of 1.036ug/ul total RNA for a final concentration of 5ug/20ul. The solution was heated to 65°C for ten minutes then chilled on ice for five minutes, 1 lja.1 of bulk first-strand reaction mix was added (cloned,
FPLCpure011 murine reverse transcriptase, RNAgaurd m (porcine), Rnase/Dnase-free
BSA, dATP, dCTP, dGTP, and dTTP in aqueous buffer), then lul of 200um DTT
(dithiothreitol) solution and lul of 0.2ug/ul Not I-d(T)]8 primer (5'-AAC TGG AAG
AAT TCG CGG CCG CAG GAA T18 -3') was added. The RNA was incubated at 37°C for one hour then stored at -20°C for use in (PCR).
Polymerase Chain Reaction
PCR was performed using M. glutinosa first strand cDNA as the template with primers designed to conserved regions of the GnRH decapeptide (Appendix F, G and H) as the 5' primer and the Not I-d(T)ig primer as the 3' primer. The primers were produced by Integrated DNA Technologies, INC. (http://www.idtdna.com) in 25nmole quantities.
Initial PCR reactions were performed in a total volume of 25ul and using Promega components which consisted of 0.5 units of Taq DNA polymerase, ImM MgCl, lOmM
Tris-HCl pH9 at 25°C, 50mM KC1, 0.1% Triton x-100, 0.2mM dNTP mix, O.luM forward and reverse primers. PCR was done using a Perkin Elmer CETUS DNA
36 thermocycler 480 and an Eppendorf Mastercycler Gradient. The initial reaction conditions were: denature at 94°C for 7 minutes, 35 cycles of 94°C for 1 minute, primer specific annealing temperature for 1 minute, and 72°C for 30 seconds, concluding with a
72°C for ten minute hold. The PCR reactions were mixed with loading dye (6:1) and analyzed on agarose gels (Omnipure) with 2.5 ul of lOmg/ml ethidium bromide and electrophoresis at 84 V for 45 minutes. The gels were then visualized using a BIO-RAD
Molecular Imager FX. MgCl, Taq, primer, and template concentrations were modified as results warranted.
Second Strand Synthesis, 5' and 3'-Rapid Amplification of cDNA Ends (RACE)
RACE was performed using the previously listed primers with the Marathon cDNA Amplification Kit from CLONTECH (Palo Alto, CA). The protocol was followed using poly total RNA isolated from M. glutinosa in May 2005 (Kavanaugh, 2004). All incubations were done using a Perkin Elmer CETUS DNA thermocycler 480. The race primers used were supplied with the kit and are API (5'-
CCATCCTAATACGACTCACTA TAGGGC-3'), and AP2 (5'-ACTCACTATAGGG
CTCGGCGGC-3'). Initial conditions for thermocycling were performed using the following conditions: denature at 94°C for 1 minute, 40 cycles of primer specific °C for
30 seconds, and 63 °C for 4 minutes. The PCR reaction products were mixed with 6:1 loading dye and analyzed on agarose gels (Omnipure) with 2.5 ul of lOmg/ml ethidium bromide and electrophoresis at 84 V for 45 minutes. The gels were visualized using a
BIO-RAD Molecular Imager FX.
37 Plasmid Preparation
Products of desired size were isolated and gel purified using the QIAEX II Gel
Purification Kit and protocol from QIAGEN (Valencia, CA). Using the pGEM T-easy
Vector System I from Promega (Madison, WI), purified DNA was ligated into the pGEM
T-easy vector reaction components were as follows: 2.5ul 2x rapid ligation buffer, 0.5ul
(25ng) pGEM-T easy vector, 1.5ul QIAEX II purified PCR product, 0.5ul (1.5 units) T4
DNA ligase and incubated for 1.25 hours at room temperature. Ligated plasmid was transformed into JM109 cells (Promega). 4|a.l of the ligation reaction was added to 25ul of JM109 cells and incubated on ice for 30 minutes. The reactions were then heat- shocked for 45 seconds at 42°C and returned to ice for 2 minutes. 200ul of SOC media was added and the cultures were incubated for 1.5 hours at 37°C with shaking. Cultures were plated on LB plates inoculated with 160(J.l of a mixture of ampicillin (20uL
50mg/mL), X-GAL (40ul 40 mg/ml) and IPTG (lOOuL 0.100M). Transformed (white) colonies were picked and grown overnight at 37° C in 3ml LB/ampicillin (3ul 50mg/ml) with shaking. Plasmid purification was done using the Wizard Plus Miniprep (Promega).
The prescribed protocol was followed for this procedure. The resulting plasmids were dissolved in 50ul MilliQ water (HPLC grade). 2.5ul of the plasmid was used for quantitation in 497.5ul MilliQ water (HPLC grade). 2ul of purified plasmid was digested with EcoRI in a final volume of lOul, 2ul BSA and lx Multi-Core buffer H (Promega), 6 units EcoRI, and 5ul MilliQ water (HPLC grade), at 37°C for 1 hour. Digestions were analyzed after electrophoresis in agarose gel with 2.5ul of lOmg/m ethidium bromide and electrophoresis at 84V for 30 minutes.
38 DNA Sequencin2
DNA sequencing was performed by the HCS Scientific Core Facilities DNA
Sequencing Facility at the University of Utah and The Hubbard Genome Center at the
University of New Hampshire. The University of Utah sequencing facility used an ABI
377 slab gel automated fluorescent sequencers. The University of New Hampshire sequencing facility used an ABB 130 genetic analyzer in conjunction with the Applied
Biosystems BigDye Terminator Cycle Sequencing Kit and then resolved by capillary electrophoresis. To both facilities, samples were submitted in 600ng quantities mixed with 3.2pmoles of T7 universal sequencing primer as designated by the pGEM T-easy
Vector System I, for a total volume of 7|ol. Sequences were edited and analyzed using the DNAStar suite of analysis programs and BLAST (Basic Local Alignment Search
Tool) at NCBI (National Center for Biotechnology Information).
Results
First Extraction and Radioimmunoassay
The initial extraction of hagfish brains contained GnRH-like immunoreactivity of
2.2 ng/g wet tissue weight. The immunoreactivity in the extract, after partial purification on Sep-Pak C-18 cartridges was eluted from a Sephadex G-25 column and eluted in three regions: fractions ten to twenty-one, thirty to thirty-one and sixty-eight to seventy-one
(Fig. 8). Fraction thirty had the highest immunoreactivity and the most resolved peak. In comparison to a lamprey-III standard eluted over the same column following this
39 experiment fraction thirty was one of the last fractions to show immunoreactivity (data not shown).
The dried immunoreactive fractions were subjected to MALDI and resulting peaks were analyzed using Protein Prospector. Over 100 samples were examined; samples whose masses were within the range (Fig. 9) of known GnRHs were subjected to post source decay and collision induced dissociation. None of the PSD or CID results were GnRH.
Ab 3952 RIA of Hagfish Brain G2S Fractions £2-48
240.0 t 237.2 220.0 200.0 - 180.0 £ 160.0 § 140.0
100.0 80.0 60.0 40.0 20.0 0.0 ML*«VNiV»i«»***m* t 10 20 30 40 50 60 70 80 90 100 Fraction Number
Figure 8. First Extraction, Lamprey Antibody 3952 Radioimmunoassay of Hagfish Brain G25 Fractions. Initial purification of GnRH on Sephadex G-25 gel permeation column. Immunoreactive fractions were dried and prepared for MALDI analysis.
40 Matrix Assisted Laser Desorption Ionization Post Source Decay (PSD) and Collision
Induced Dissociation (CID)
100
80-1
% 60 »*iA%W*W^WrtSw> tl^W»dw4^ltH^r^i'4MM>wAW
40
20 : JMto4M«Wt«W«^ WW*Jrt*U**
0 ^-.r,U^^^A**y...^M^1^.^.J^ .^.ijfci "H"^> .(.»~*:JL»ui*A^Jl 1S«-3*.*jfl4»»*fjAj^JJLaAUaUj^i , 1000 1050 1100 1150 1200 1250
Mass/Charge
Figure 9. Matrix Assisted Laser Desorption Ionization (Post Source Decay (PSD) and Collision Induced Dissociation (CID)). Selected MALDI samples with masses similar to known forms of GnRH.
Second Extraction and Radioimmunoassay
The second round of extractions of hagfish brains contained GnRH-like immunoreactivity of 636.4 pg/g wet tissue weight. The immunoreactivity in the extract, after partial purification on Sep-Pak C-18 cartridges was eluted from a Sephadex G-25 column and eluted in 2 unresolved peaks: fractions nineteen to twenty-three and twenty- four to twenty-nine (Fig. 10). Fraction twenty-one and twenty-seven had the highest immunoreactivity for each peak. Because of the low immunoreactivity the Sep-Pak C-18 cartridges were re-eluted with 80% acetonitrile and eluted from a Sephadex G-25 column. Although there was more immunoreactivity there were more peaks and they were less resolved (Fig. 11).
41 Hagfish G-25 Column Fractions RIA (3952 Ab) 127-15 14 12
io H a8 o 6 M a- 4
#w*A< •MMt*»»»»««M<«W>«W»*WI«MMtWMW«MWM»M*M**Mt«» Ai 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100105110115 Fraction Number (10ml / fraction)
Figure 10. Second Extraction Lamprey Antibody 3952 Radioimmunoassay of Hagfish Brain G25 Column Fractions. Purification of GnRH on Sephadex G-25 gel permeation column. Immunoreactive fractions 15-17 and 19-31 were collected, dried and prepared for HPLC using the C-8 column.
Hagfish G-25 Column Fractions RIA (3952 Ab) 127-22
0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Fraction Number (10 ml fractions)
Figure 11. Lamprey Antibody 3952 Radioimmunoassay of Hagfish Brain G25 Column Fractions 127-22. Purification of GnRH on Sephadex G-25 gel permeation column. Immunoreactive fractions 9, 17, 19, 20-30, 33-39 and 41-52 were collected, dried and prepared for HPLC using the C-8 column.
42 Immunoreactive fractions from G-25 elution were pooled and subjected to further purification by reverse phase HPLC C-8 column. Maximum immunoreactivity was detected in a peak from fraction eleven to fifteen (Fig. 12). Fractions from this peak were eluted separately on a phenyl column (Fig. 13). Each of the immunoreactive peaks from the phenyl column were further purified on a final HPLC column, C-18. (Fig. 14 and
Appendix I). Selected immunoreactive fractions were sent to the Protein Chemistry
Laboratory at the University of Texas Medical Branch and subjected to MALDI analysis before Edman degradation (Fig. 15). Samples with good purity and intensity were selected for sequence analysis.
3952 Ab RIA of C-8 Fractions 127-26
©
«fa*W*ll*k 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100105110 Fraction Number
Figure 12. Lamprey Antibody 3952 Radioimmunoassay of C-8 Column Fractions 127-26. Purification of GnRH. immunoreactive G-25 fractions were pooled and loaded onto a 1 x 10-cm Aquapore CI8 column. Immunoreactive fractions 11-16 were pooled and dried for further purification.
43 3952 Ab RIA of Hagfish Phenyl Column Fractions 127-33
^pi.W vU \fi*sJJVb-** 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 Fraction Number
Figure 13. Lamprey Antibody 3952 Radioimmunoassay of Phenyl Column Fractions 127-33 Purification of GnRH. immunoreactive C-8 fractions were pooled and loaded onto a 0.46 X 25 cm Vydac 219TP54 phenyl column. Immunoreactive fractions 3 and 21-30 were dried for further purification.
3952 Ab RIA of C-18127.-36 Fractions of 122-30-21
2.5
2
1.5 l i
0.5
0 11*, MMMIMtlMMMMIIW ¥V7****U *«•»»•« »**»»«« 20 30 40 50 60 70 80 90 100 Fraction Number
Figure 14. Lamprey Antibody 3952 Radioimmunoassay of C-18 Column Fractions 127-21. Purification of GnRH. immunoreactive Phenyl fractions loaded onto a 1 x 25.cm Vydac 218TP510 C-18 column. Immunoreactive peaks were sent to Protein Chemistry Laboratory at the University of Texas Medical Branch, Galveston, Texas for MALDI analysis and Edman degradation sequencing.
44 •^>fe Figure 15. MALDI-TOF of Fractions to Determine Purity. Samples sent to the Protein Chemistry Laboratory at the University of Texas Medical Branch were subjected to MALDI analysis before Edman degradation. This sample, with a mass of 4298 was too large to be considered a good candidate for GnRH. Peptide Sequencing at the University of Texas The N-terminus of all forms of GnRH is blocked by a pyroglutamate. The pyroglutamate is removed by digestion with pyroglutamate aminopeptidase and then the peptide is subjected to Edman degradation. To ensure the efficiency of the digestion and sequencing reaction lamprey GnRH-III was sent to the Protein Chemistry Laboratory at the University of Texas Medical Branch. The sequence of lamprey GnRH-III was identified without ambiguity (Fig. 16). Samples that appeared to be of correct mass were sequenced, however, GnRH was not identified. 45 I 1 | 1 i D 1 { I 1 K i! 1 I I H 1 m I i! 1 ft I t « V f\J\J .wJt^-Aj V-J^vL-ii ! r 1S.0 ' & Minutes Figure 16. Edman Degradation of Control Peptide Lamprey GnRH-III. Sample of lamprey GnRH-III was sent to Protein Chemistry Laboratory at the University of Texas Medical Branch as a positive control. After pyroglutamate aminopepitidase digestion the sequence of the remaining 9 amino acids were determined to be those of lamprey GnRH-III. Arrows indicate amino acid elution profile (points). Molecular Methods Recent attempts as part of my dissertation research to find the sequence of GnRH using molecular methods did not produce positive results. Although, PCR products of the suspected size were isolated and sequenced, none were GnRH. Using degenerate primers to catfish GnRH produced a truncated cDNA sequence, however further analysis was unable to confirm or repeat these results. Similarly, adaptor ligated template 46 produced many products that were isolated and sequenced. One sequence suggested coding in the reverse reading frame, however analysis showed this sample had no similarity to known GnRH forms. Many attempts were made to obtain the hagfish GnRH cDNA, however, the correct primer sequence and/or reaction conditions remain elusive. Discussion Hagfish are the oldest lineage of vertebrates with a lineage extending over 530 million years. They are an important link between chordates and vertebrates because they retain characteristics of extinct ancestral species that are common to their closest relatives. Gonadotropin-releasing hormone (GnRH) is the essential hypothalamic regulatory neurohormone controlling reproduction in all vertebrates. We showed a correlation of immunoreactive GnRH associated with gonadal maturation in the Atlantic hagfish Myxine glutinosa, however, the primary structure(s) of GnRH have not been identified in hagfish (Kavanaugh, 2004; Kavanaugh et al., 2005a). In hagfish the primary amino acid structure of GnRH has not been identified as yet, however, indirect methods have shown an immunoreactive GnRH or a GnRH-like peptide in the brain of hagfish. Therefore, the objective of these studies was to determine the primary structure(s) of GnRH present in M. glutinosa using molecular methods, peptide purification and proteomic methods including Matrix-Assisted Laser Desorption Ionization (MALDI). M. glutinosa were collected twice for this study, first from the Gulf of Maine during May of 2004 and brains were extracted and prepared for MALDI analysis. The second group of 1000 hagfish were collected from New England Eel Processors of Gloucester, 47 Massachusetts and processed for peptide purification. Neither technique yielded the primary structure of the putative hagfish GnRH. Thus hagfish continue to hold the secrets of their GnRH. Kavanaugh (2004) attempted to identify GnRH in hagfish using molecular methods and screened two A cDNA expression libraries with several antisera to various isoforms of GnRH. In both instances positive results were produced but cDNA sequence was not obtained. Additional, recent attempts as part of my dissertation research were made to elucidate the sequence of GnRH using molecular methods, but also did not yield any positive results. Many PCR products of appropriate size were isolated and sequenced, none were GnRH. Using degenerate primers to catfish GnRH produced an initial sequence, however further analysis was unable to confirm or repeat these results. Similarly to initial PCR results, adaptor ligated template produced many products that were isolated and sequenced. One sequence suggested coding in the 3' direction, however multiple attempts showed the 3' region had no similarity to GnRH. Many attempts were made to obtain the cDNA by optimizing the primer sequence and/or reaction conditions without any positive results. Immunoreactivity to GnRH was present in the peptide isolation attempts, however, fractions showing one peak using MALDI analysis, when sequenced, were not GnRH or GnRH related. Other peaks that were sent out for sequencing were found to be a combination of several proteins and not sequenced. The earliest evolved vertebrate for which a functional role for GnRH has been established is the sea lamprey (Sower, 2003a). The two forms of GnRH, lamprey GnRH-I and lamprey GnRH-III, have been extensively demonstrated to modulate and control various reproductive processes (Sower, 2003a; Sower et al., 2009). Since the lamprey and hagfish are closely related basal 48 vertebrates it is quite possible that the GnRH in hagfish is structurally similar to, and has a similar role in reproduction as the isoforms in lamprey. The antisera 3952 recognizes both lamprey GnRH-I and -III and has demonstrated immunoreactivity in the Atlantic hagfish (Sower et al., 1995). Similar to previous peptide identification attempts, immunoreactive GnRH or a GnRH-like peptide was detected from the brain of hagfish, but no sequence was obtained in the current study. The lack of positive results can be attributed to the lack of a specific antisera or another explanation may be that the HPLC columns that were used. At one point during the early phases of using the gradient HPLC a membrane in the HPLC ruptured releasing methylene blue onto the column where the sample had been loaded. Whether this hindered the isolation process is not known. Future attempts at peptide isolation may benefit by using the lamprey-II GnRH antisera. The hagfish are in an advantageous evolutionary position. They are sandwiched between two representatives on the boundary of chordate / vertebrate evolution, the lampreys and the tunicates. The GnRHs in tunicate and lampreys are ten amino acids in length, and although their genomic arrangement varies the resulting GnRHs are decapeptides. Both the lamprey and tunicate have GnRH genes with and without introns. It is reasonable to assume that the form of GnRH present in the hagfish is a decapeptide produced by one gene that may or may not have introns. The sequencing of the lamprey genome by the University of Washington, Saint Louis has been going for four years. Recently, the Japanese hagfish, a representative of the lampreys sister group, was approved for high quality (6X) draft sequencing. These fish were chosen for sequencing because of their pivotal position in vertebrate evolution. Hagfish are significantly physically and physiologically distinct from gnathostomes and 49 the genome will provide important insight into the evolution of the vertebrate genome. In Silico technique has been used to determine the nucleotide sequence of novel forms of GnRH. Initially, the tunicate GnRHs 3-9 were the first to be identified using this method (Adams et al., 2003). Recently, in silico was used to identify three more invertebrate GnRHs, two from mollusk and one in Annelid (Aplysia, limpet, annelid) (Tsai and Zhang, 2008; Zhang et al., 2008). Likewise, lamprey GnRH-II was identified from trace files using in silico analysis (Kavanaugh et al., 2008). Once the sequencing of the hagfish genome has started the rapid examination of the trace files should quickly reveal the nucleotide sequence of GnRH or GnRHs present in the hagfish. In summary, although the sequence of GnRH(s) in the Atlantic hagfish was not determined, immunoreactivity from the initial purification confirmed previous studies showing an ir-GnRH in the hagfish. Future attempts to isolate GnRH from hagfish should include using antisera generated against lamprey-II GnRH or other recently discovered GnRH forms. Most importantly, and probably the most prudent method would be to wait and use the hagfish genome once sequences become available. 50 Chapter 3 Origins of GnRH in Vertebrates: Identification of a Novel GnRH in a Basal Vertebrate, the Sea Lamprey. Abstract We cloned a cDNA encoding a novel gonadotropin-releasing hormone (GnRH), named lamprey GnRH-II, from the sea lamprey, a basal vertebrate. The deduced amino acid sequence of the newly identified lamprey GnRH-II is QHWSHGWFPG. The architecture of the precursor is similar to that reported for other GnRH precursors consisting of a signal peptide, a decapeptide, a downstream processing site and a GnRH- associated peptide; however, the gene for lamprey GnRH-II does not have introns in comparison to the gene organization for all other vertebrate GnRHs. Lamprey GnRH-II precursor transcript was widely expressed in a variety of tissues. In situ hybridization of the brain showed expression and localization of the transcript in the hypothalamus, medulla and olfactory regions; whereas immunohistochemistry using a specific antiserum showed GnRH-II cell bodies and processes only in the preoptic nucleus/hypothalamus areas. Lamprey GnRH-II was shown to stimulate the hypothalamic-pituitary axis using in vivo and in vitro studies. Lamprey GnRH-II was also shown to activate the inositol phosphate signaling system in COS-7 cells transiently transfected with the lamprey GnRH receptor. These studies provide evidence for a novel lamprey GnRH that has a role as a third hypothalamic GnRH. In summary, the newly discovered lamprey GnRH-II 51 offers a new paradigm of the origin of the vertebrate GnRH family. We hypothesize that due to a genome/gene duplication event, an ancestral gene gave rise to two lineages of GnRHs—the gnathostome GnRH and lamprey GnRH-II. 52 Introduction The acquisition of a hypothalamic-pituitary axis was a seminal event in vertebrate evolution leading to the neuroendocrine control of many complex functions including growth, reproduction, osmoregulation, stress and metabolism. The synthesis and secretion of GnRH is the key neuroendocrine function in the hypothalamic regulation of the hypothalamic-pituitary-gonadal axis. In response to GnRH, gonadotropins (GTH), luteinizing hormone (LH) and follicle-stimulating hormone (FSH), are released from the pituitary gland, which in turn regulate gametogenesis and steroidogenesis. GnRH was first isolated from porcine (Matsuo et al., 1971) and ovine (Burgus et al., 1972b) hypothalamic extracts. The GnRH family currently includes twenty-five isoforms, fourteen and eleven from representative vertebrate and invertebrate species, respectively (Zhang et al., 2008). To date, two to three isoforms have been identified in representative species of all classes of vertebrates (Kah et al., 2007). The number of GnRH molecular variants is surprising, particularly in view of the relative constancy of their physiological role in vertebrates (Silver et al., 2004). Growing evidence reveals almost all vertebrates synthesize at least two isoforms of GnRH in the brain (Dubois et al., 2002; Fernald and White, 1999; Gorbman and Sower, 2003; Guilgur et al., 2006; Kah et al., 2007; King and Millar, 1995; Morgan and Millar, 2004; Parhar, 2002; Silver et al., 2004; White et al., 1998a). During the past few years, as more GnRH primary sequences and their respective cDNAs have been identified, more phylogenetic and functional studies have been done leading to proposed phylogenetic relationships of the GnRHs (Fernald and White, 1999; Morgan and Millar, 2004; Parhar, 2002; Silver et al., 2004; Zhang et al., 2008). An analysis by Fernald and White (Fernald and White, 1999) 53 suggested that there are three paralogous groups of GnRH based on phylogenetic analysis of 23 GnRH transcripts, location of expression of the GnRH within the brain, and function of the GnRH. This analysis excluded the lamprey GnRHs. In a recent review of GnRH and its receptors, Kah et al. (Kah et al., 2007) also suggested three lineages and did not include the lamprey GnRH-I and -III and cDNAs or place them into one of the three groups of GnRH. We had suggested from an extensive analysis of 72 cDNA GnRH sequences including the eight cloned lamprey GnRH-III cDNAs, that the vertebrate GnRHs are grouped into four lineages: GnRH 1, 2, 3 and 4 (Silver et al., 2004). Their phylogenetic analysis confirmed Fernald and White's model of three GnRH lineages and in addition showed that lamprey GnRH-I and -III form a fourth group. Recently, the identification of another invertebrate GnRH in Aplysia has suggested a fifth grouping of GnRHs in invertebrates and supports the fourth group of lamprey GnRH-I and -III (Zhang et al., 2008). The availability of the lamprey genome now offers the ability to further examine the phylogenetic relationships of the vertebrate GnRHs. Lampreys are one of only two extant representatives of the jawless vertebrate class, Agnatha. It is generally believed that two large-scale genome duplications (2R) occurred during the evolution of early vertebrates, although there is controversy on whether the 2R duplications occurred before the divergence of the hagfish and lampreys or whether there was one round prior to the jawless vertebrates and one round after the divergence of the jawless vertebrates (Fried et al., 2003; Holland et al., 1994; Irvine et al., 2002; Larhammar et al., 2002; Ohno et al., 1968; Vandepoele et al., 2004). Lampreys are the most basal vertebrates for which there are demonstrated functional roles for two GnRHs (lamprey GnRH-I and GnRH-III) that 54 act via the pituitary-gonadal axis controlling reproductive processes (Sower, 2003 a; Sower, 2003b). Lamprey GnRH-I and -III are each expressed by a separate gene (Silver et al., 2004; Suzuki et al., 2000). There are still questions about the phylogenetic relationship between the jawless vertebrate QnRHs and the variants found in gnathostomes. Identification and analysis of this third form of lamprey GnRH may clarify some important aspects of the evolutionary origin of the vertebrate GnRH family. In jawed vertebrates, GnRH-II is the most ubiquitously expressed of the GnRH family and has the identical primary amino acid structure in all gnathostomes—from sharks to mammals (Gorbman and Sower, 2003; Kah et al., 2007; Silver et al., 2004). As more GnRHs were identified during the past 20 years, one of the questions that arose was the origin of the vertebrate GnRHs and the lack of a lamprey or hagfish GnRH form more closely related to any of the gnathostome GnRH lineages. The primary amino acid sequence of GnRH-II has remained unchanged from cartilaginous fish through mammals, which would suggest a strong selective pressure, however, to date its function is ambiguous (Amemiya et al., 1999a; Kah et al., 2007; Suzuki et al., 2000). The expression pattern of GnRH-II varies from species to species, but is generally expressed in the brain and numerous peripheral tissues (Gorbman and Sower, 2003; Kah et al., 2007). The function(s) of GnRH-II in peripheral tissues and brain have not been established. In the brain, GnRH-II predominates in extra-hypothalamic regions and has been suggested to act as a neuromodulator/neurotransmitter although there are species in which GnRH-II is found in the hypothalamic regions and acts at the pituitary in stimulating gonadotropin function (Rozen and Skaletsky, 2000). Here we report the identification of a novel form of GnRH 55 from the sea lamprey, Petromyzon marinus, named lamprey GnRH-II, and considered a sister group to all forms of Gnathostome GnRH. In biological studies, lamprey GnRH-II stimulated the hypothalamic-pituitary axis. Lamprey GnRH-II was also shown to activate the inositol phosphate signaling system in transiently transfected COS7 cells with the lamprey GnRH receptor. Using in situ hybridization and immunohistochemistry (IHC), expression of lamprey GnRH-II transcript and location of GnRH-II peptide was shown in the preoptic/hypothalamic areas, and unlike the other lamprey GnRHs, lamprey GnRH-II transcript was also expressed in extra hypothalamic regions in the mid-brain and olfactory region. These studies provide evidence for an ancestral GnRH that has a role as a third hypothalamic GnRH in a basal vertebrate. Materials and Methods Screening the Lamprey Genome Trace files were produced by the Genome Sequencing Center at Washington University School of Medicine in St. Louis for the sea lamprey genome sequencing project and were obtained from the National Center for Biotechnology at ftp.ncbi. nlmgov/pub/TraceDB/petromyzon_marinus, and blasted locally, using NCBI blast software, against a custom database consisting only of GnRH prepro-hormone sequences. The parameter used for the searches was blastall -p, blastx -a, -el00, -vlOO and -blOO. The resulting sequences with high similarity were then manually re-examined for their resemblance to the GnRH preprohormone. The following are the trace identification 56 numbers first identified with similarity to known forms of GnRH: 1170767299, 1180014463, 1194330245, 1193338384 and 1438788497 (Appendix D). Lamprey For all studies, a total of 98 adult sea run lamprey were collected at the Cocheco River fish ladder in Dover, N.H. The lamprey were then transported to the Anadramous Fish and Invertebrate Research Laboratory in Durham, N.H., where they were maintained in an artificial spawning channel with flow-through reservoir water at ambient temperatures IOC - 18C and following University of New Hampshire Institutional Animal Care and Use guidelines. Isolation of Total RNA and Genomic DNA Total RNA was isolated from: liver, kidney, intestine, muscle, heart, thyroid, brain, testis, ovary, pituitary and eye using ISOGEN (Nippon Gene Co. Ltd. Toyama, Japan), following the protocol as outlined by Amemiya et al. (Amemiya et al., 1999a). Total RNA was then DNase treated using Promega RQ1 RNase-Free DNase (Madison, WI) following manufacturer protocol. Genomic DNA was isolated as described by Silver et al. (Silver et al., 2004). Reverse Transcription and Polymerase Chain Reaction PCR was performed using Petromyzon. marinus first strand cDNA and genomic DNA as the templates with primers designed to the elucidated lamprey GnRH-II sequence using Primer 3 (Rozen and Skaletsky, 2000). The following primers were 57 prepared by Integrated DNA Technologies, INC: PmFl 5'- AATGAACGAATC GATTGCTGTCTGTC -3', PmF25'-ATGAATGAACGAATCGATTGCTGTCTG-3', PmRl 5'-AAAACCCATTTGGAGAGCGTGAAC-3', PmR2 5'-CTCCAGCACTTGGG AGAGAACGTC-3', Pm beta-Actin F 5'- GACCTCACCGA CTACCTGATGA-3', Pm beta-Actin R 5'- TGATGTCGCGCACGATCT -3'. Using the AccessQuick RT-PCR System (Promega) 50ng of DNase free RNA were used in each reaction with a 0.1|o.M final primer concentration in a 25.5JJ.L final reaction volume. Thermal cycling was performed using an Eppendorf Master Gradient thermal cycler using the following parameters: 48C for 45 min, 94C for 2 min followed by 35 cycles of 94C for lmin, primer specific annealing temperature for 30 sec and 72C for 50 sec, and finishing with a 10 min 72C incubation and 4C hold. PCR of genomic DNA was done as follows: reactions were performed using Promega components consisting of 0.5 units of Taq DNA polymerase, ImM MgCl, lOmM Tris-HCl pH9 at 25C, 50mM KC1, 0.1% Triton x-100, 0.2mM dNTP mix, 0.1 uM forward and reverse primers. Cycling was done using an Eppendorf Mastercycler gradient, using the following reaction conditions: 35 cycles of 94C for 50 sec, 58C for 30 sec, and 72C for 30 sec, concluded with a 72C for ten minute hold and for digoxigenin probe synthesis: activation step of 94C for 7 min; 94C for 1 min, 57C for 1 min, 72C for 1 min, and a 72C extension for 10 min followed with 4C hold.. All PCR reactions were electrophoresed in 2% agarose and visualized using a UV light box and images captured with a digital camera. DNA sequencing was performed at the Hubbard Genome Research Center at the University of New Hampshire. 58 Phylogenetic Analysis The alignment used to generate the neighbor joining tree consisted of 43 prepro- GnRH amino acid sequences retrieved from GenBank and the deduced prepro-lamprey GnRH-II sequence (Gen Bank Accession No. DQ457017). The alignments were produced using MegAlign in the DNAStar software package from Lasergene Clustal W method. The tree was rooted with the prepro-Aplysia GnRH sequence. The alignments were then analyzed using Phylogenetic Analysis Using Parsimony (PAUP) version 4.0 betalO (Swofford, 1998) and the trees were constructed using the neighbor joining method with 1000 bootstrap replicates. In Situ hybridization Probe synthesis for in situ was done as previously described (Root et al., 2005; Rubin et al., 1997) with the following modifications. Digoxigenin-labeled sense and antisense RNA probes of complementary DNAs of lamprey GnRH-II were prepared to encompass the regions encoding the preprohormone using the Digoxigenin- (DIG; Roche, Indianapolis, IN) labeled riboprobe synthesis kit. The following primers: PmFl, PmF2, PmRl and PmR2 were used with cDNA template (Appendix C) derived from the brain using first-strand synthesis kit (Amersham Biosynthesis, Piscataway, NJ). Hybridization was performed following the protocol of Rubin et al. and Root et al. (Root et al., 2005; Rubin et al., 1997). A dot blot was done to determine cross- reactivity between anti-sense probes as previously described (Root et al., 2005). The data showed that each probe only bound to their respective template (data not shown). Sections were analyzed using the confocal facilities at the University of New Hampshire 59 with a LSM 510 Meta laser scanning confocal microscope (Zeiss, Thornton, NY) with a 633-nm helium-neon laser as outlined by Trinh et al. (Trinh, 2007) using the following parameters: filter 638-799 nm, averaging 8, unmixed, pixel time 3.37us objective 20X. Peptide Synthesis and Antiserum Generation Lamprey GnRH-I and -III were purchased from American Peptide Company Inc. (Sunnyvale, CA). The newly identified GnRH (lamprey GnRH-II) peptide was synthesized by American Peptide and purified to 95% purity. The synthesized peptide was shipped to Colcalico Biologicals (Reamstown, PA) for polyclonal antiserum production. At Colcalico Biologicals, the lamprey GnRH-II was conjugated to BSA via glutaraldehyde following the procedures described by Coligan (Coligan, 2000). Four female New Zealand white rabbits housed at their facility were injected with the peptide (2 rabbits) boosted and bled (Calvin et al., 1993). All bleeds were sent to us for characterization of the polyclonal antisera. Immunocvtochemistrv Tissue preparations and immunohisto-chemical staining procedures were described elsewhere (Nozaki et al., 2000; Nozaki et al., 2008). Anti-lamprey GnRH-II (optimum working dilution: 1/400, #UNH107) was applied as a primary antiserum. To confirm the specificity of the immunostaining, the following control staining procedures were performed: (1) replacement of primary antiserum with normal rabbit serum, (2) absorption of anti-lamprey GnRH-II with synthetic lamprey GnRH-I, -II, -III, or a mixture of -I and -III (20-50 ug/ 200 ul antiserum at working dilution), and (3) 60 absorption of anti-lamprey GnRH-I (lot No. King 1467) and anti-lamprey GnRH-III (lot No. 3952), both of which had been previously validated for localization of GnRH-I and - III, respectively (Calvin et al., 1993), with synthetic lamprey GnRH-II (25 ng/ 100 ul antiserum at working dilution). Replacement of the primary antiserum with normal rabbit serum gave no positive reaction. Positive reaction to anti-lamprey GnRH-II in the hypothalamus including the preoptic nucleus was abolished only by the preabsorption with synthetic lamprey GnRH-II. Following the preabsorption with synthetic lamprey GnRH-I, -III, or a mixture of -I and -III, GnRH-II-positive reaction was reduced considerably, but not eliminated. Moreover, both lamprey GnRH-I and -III positive reactions were not eliminated by the preabsorption with synthetic lamprey GnRH-II, respectively. Thus, taking data of both (2) and (3) into considerations, GnRH-II-like, but not -I-like or -Ill-like, material is present in the preoptic nucleus, even though anti- lamprey GnRH-II exhibited slight cross-reactivity to GnRH-I and -III. All results were described by use of anti-GnRH-II preabsorbed with a mixture of synthetic lamprey GnRH-I and -III. In Vitro and In Vivo Biological Studies The in vitro experiment followed the protocol previously outlined by Gazourian et al. (Gazourian et al., 2000). Briefly, ovarian tissue was removed from sea lamprey and placed in a petri dish containing Hanks Balanced Salt Solution (HBSS, Sigma) at pH 7.0 and held on ice. The ovarian tissue was cut into small sections (approx 30 mg). Pituitaries were removed from decapitated lampreys and immediately placed into the same buffer. Six samples were used for each treatment. Following preincubation, the 61 ovarian sections were incubated in triplicate for 18 hours at 18C with either 300ul lamprey GnRH-I, -II or -III at the following concentrations, control (HBSS/HEPES), lOng/ml, lOOng/ml or lOOOng/ml. The co-cultures of ovarian sections and pituitary (one per well) were incubated (in triplicate) in 300ul of lOOOng/ml lamprey GnRH-II or-III. At the end of the incubation period, the gonad tissue was blotted then weighed, culture medium was collected frozen at -80C until extracted, and assayed for estradiol by radioimmunoassay (RIA). The validation of the estradiol RIA was described for adult sea lamprey plasma by Sower et al. 1983 (Sower et al., 1983). The in vivo experiment followed the protocol previously described by Sower et al., 2006. In brief, female sea lamprey (10 per treatment) were injected intraperitoneally twice with either lamprey GnRH-II or GnRH-III at doses of 0, 50 or 100 ^g/kg body weight at 24 hour intervals, then blood was sampled at 24 hours. The plasma was separated from the blood and stored at -80C until extracted, and assayed for estradiol by RIA. Inositol Phosphate Assay The inositol phosphate (IP) stimulation and extraction protocol followed the procedure of Silver et al., 2005. Lamprey GnRH-I, lamprey GnRH-II or lamprey GnRH- III were used for dose response analysis, concentrations of ligand used were from 10"6 to 10"UM (Appendix B). Treatments were performed in triplicate in three independent experiments. Non-transfected cells and cells transfected with blank vector were used as negative controls. The results were analyzed using Prism (GraphPad, San Diego, CA). 62 Estradiol Radioimmunoassay The RIA for estradiol followed the procedures described previously (Sower et al., 1985,(Sower et al., 1983). The RIA for estradiol-17beta used antiestradiol-17beta (S-244) obtained from G. Niswender (Colorado State University, Fort Collins, CO). The estradiol antiserum was used at a dilution of 1: 85,000. The range of binding was between 24.1 to 29.3%. The intraassay and interassay coefficients of variation were 3.8% and 8.5% respectively. Statistics The resulting hormone concentrations were analyzed with StatView ® 5.0 using one-way ANOVA followed by Fisher's PLSD test. The level of significance for differing groups was P<0.05. Results Cloning and Sequence Analysis of Prepro-lamprev GnRH-II A 694-base sequence of the cDNA of lamprey GnRH-II was cloned from the sea lamprey. The cloned precursor includes 105 amino acids with a signal peptide of 23 amino acids; a GnRH decapeptide, dibasic processing site and 69 amino acids of the GnRH associated peptide (Fig. 17) (Gen Bank Accession No. DQ457017). The deduced amino acid sequence of the newly identified lamprey GnRH-II in lamprey is QHWSHGWFPG (Fig. 18). 63 TATTAAACTATCATTGTCTCTTGAGTCCC 29 GACCTG6TTCAACCAAATTACGTTAAACATGAATGCTTCTGGAAATCCTCTAATTCTTGAT6AAGGCA 97 ACGAGGCAAGGTAAGTGTACACTATATTGGCTTCGGTGTATTGTAGTACCGGGAGGCAATGACAGAT 164 AATAAAGCAATGACAGTTGGAGATGAATGAACGAATCGATTGCTGTCTGTCCCTCGCGCTGTGGAGG 231 AT6 GGGCGCGCG TCG CTG TCC CTG GTG CTG ATC CTG TGG CTG CTG ACG GCC CCG 285 MORA SI SLV L I LWLL T A P 18 CCA GCC TCG CTG GGG CAG CAT TGG TCG CAC GOT TGG TTC CCT GGA GGC AAG CGA 339 P A S L G HWSHGWFPG G K R 36 GGC GTT CAG GAG CCG CCC CGA GCC TCC TAC GAG AAC GTC A6C CCG TCG GAC 6GT 393 2_J_,_JP_-J_, _!___£ I--* J_._JL-.Jf-.Ji K--S-JL-.-1-J__._P. s* TCC CCT TTC ACT CCT GTG AGC TCA G6T CTT CAG GTC GCG GAC TGG CAT GTT GTT 447 ______JL «I_ JL - Jt s« _ J _?__._ - -2_ -X.-J1 2_ J&- __.___, X. 72 TGT TCA CGC TCT CCA AAT GGG TTT TCG GGT TGT GCC ATG TOT TGT TCG CCA GGA S01 £___,_, JL - f _ __. - JL --9- - JF— J- - 2- -£.- A. __M__ £_ JL- _ _.- JL --G. 90 TGT CCG ACG TTT CTC TCC CAA GTG CTG GAG GCT TCT TTG GGA ACT TAA 549 £•.__>_ J--JL ._;-.--. °___v_-i-__I-__J_-§.-J- i8--!. 10S TTCCGTCCATCCACGTGTTGGTAGCTTGTCTGTGAATTAACATT6CTAAATAT6TATTATTTAATTATT 618 C GAATATGACTTCAC ACTGGTTTATCCTAATTCACC GGTAAAACGATAAC CTAATATATTTTGATCGA 686 ATGTGATT 694 Figure 17. Putative Lamprey GnRH-II Transcript Map. The putative prepro- lamprey GnRH-II nucleotide and deduced amino acid sequences. Regions corresponding to known GnRHs are shown; signal peptide underlined, the lamprey GnRH-II decapeptide boxed, the dibasic processing site is boxed in grey and the GnRH associated peptide is dash-underlined. The stop codon is indicated by a hyphen. Analysis of the lamprey genome shows the gene for lamprey GnRH-II does not have introns. Primers used were designed to encompass the nucleotide sequence surrounding two introns normally present in the vertebrate GnRH gene. Results from PCR with genomic DNA experiment confirm the lack of introns (Fig. 19). 64 Vertebrate GnRH Family Type 1 2 3 4 5 6 7 8 9 10 GnRH-I (Mammal) pGlu His Trp Ser Tyr Gly Leu Arg Pro GlyNH2 GnRH-I (Guinea Pig) pGlu Tyr Trp Ser Tyr Gly Val Arg Pro GlyNH2 GnRH-I (Chicken -1) pGlu His Trp Ser Tyr Gly Leu Gin Pro GlyNH2 GnRH-I (Rana) pGlu His Trp Ser Tyr Gly Leu Trp Pro GlyNH2 GnRH-I (Seabream) pGlu His Trp Ser Tyr Gly Leu Ser Pro GlyNH2 GnRH-III (Salmon) pGlu His Trp Ser Tyr Gly Trp Leu Pro GlyNH2 GnRH-I (Whitefish) pGlu His Trp Ser Tyr Gly Met Asn Pro GlyNH2 GnRH-I (Medaka) pGlu His Trp Ser Phe Gly Leu Ser Pro GlyNH2 GnRH-I (Catfish) pGlu His Trp Ser His Gly Leu Asn Pro GlyNH2 GnRH-I (Herring) pGlu His Trp Ser His Gly Leu Ser Pro GlyNH2 GnRH-I (Dogfish) pGlu His Trp Ser His Gly Trp Leu Pro GKMI2 GnRH-II (Chicken -II) pGlu His Trp Ser His Gly Trp Tvr Pro GlvNI12 Lamprey - 11 pGlu His Trp Ser His Gly Trp Phe Pro GlvNH2 GnRH-IV (Lamprey - III pGlu His Trp Ser His Asp Trp Lvs Pro GlyNH2 GnRH-IV (Lamprey -1) pGlu His Tyr Ser Leu GIu Trp Lys Pro GlyNH2 Figure 18. Primary Structure of GnRHs in Vertebrates. There are currently 15 reported isoforms of GnRH in vertebrates. Light grey highlight, amino acids changed compared to mammalian GnRH. Dark grey highlight, GnRHs occurring in the sea lamprey. Medium grey highlight, single amino acid difference between dogfish, chicken-II and lamprey GnRH. Tissue Expression The lamprey GnRH-II transcript was shown to be wide spread in various tissues including liver, kidney, intestine, skeletal muscle, heart muscle, thyroid, brain, testis, ovary, pituitary and eye (Fig. 19). Negative controls of reactions that did not have template or were not reverse transcribed did not show contamination with genomic DNA. 65 L K I • S H TH B T O ]? E GMRHRT — 283 bp GuRHiioRT — 283 bp ActmRT -'• *» '•••'• :::V :"' '"'*' '•--• ** ** '-'u -'"' — 8»bp ActiimoRT —89 bp G«uomir 283 bp Figure 19. Expression and Analysis of Lamprey GnRH-II. Expression of lamprey GnRH-II in several tissues using RT-PCR (1st panel). Negative control, RNA that was not reverse transcribed (2nd panel). Lamprey actin was used to ensure quality of RNA (3rd panel) and actin without reverse transcription (4th panel). Result from PCR with genomic DNA template (5* panel) products are the same size as those produced with RT-PCR indicating the lack of introns. L, liver; K, kidney; I, intestine; S, skeletal muscle; H, heart muscle; TH, thyroid; B, Brain; T, testis; O, ovary; P, pituitary; E, eye; --, negative control. Phvlogenetic Analysis Phylogenetic analysis segregates the prepro-GnRHs into four groups: type I (mammalian and orthologs), type II (chicken-II), type III (salmon) and type IV (lamprey I and III) (Fig. 20). Further analysis suggests that lamprey GnRH II evolved from a common ancestor of all Gnathostome forms of GnRH (Fig. 21). The gene duplication events that generated the different fish and tetrapod paralogous groups (D3, D4) took place within the Gnathostome lineage, after its divergence from the ancestral agnathans. The two other forms of lamprey GnRH (I and III) can be identified now as paralogous homologs of Gnathostome GnRH and lamprey GnRH II group, resulting from a duplication within the lamprey lineage (D2) (Fig. 21). 66 rfGnKH Ow geriepinu\ C hrGoRH Aiwa sepMhtima (CnRH-16Wfos jjwftn gpGsRH Cam parcelha mCnRM //««!<•' M/itVff( raGnRH Tupsia btkngai Type I: mGnRH mCnRM Anguilie japosh-o land srtUoIflp) pjGnRH (hypos kttpta shGnRH Mumiw ckrywpa fbGnRil 5jMnr« aarolc wfGnRHfpregonnv dupatformis rGnRH Raits oaobeioua sGnRH Asiattiuispis massambicu* sGnRH Ashwtilapia butttwi SGRRH DiceiurtSiiim kbrax sGttRIl Sparta mirm Typv III: sGnRH )GnRH V'tmnper mown sGnRH Oryrhs latipe* sGnKH Ceregoaas dupeafamh _ tCnRH MugH npMus 64 fj|~ rGnRH-H Dkcniran-ktts'abrax M- fCnRH-H Sparm aurMa •— eCjiRH-B Vawtpgrmmeri & I— cGoRJM-B Attgitilkppnkit cCtRlMI Cvtepmusekp^Mmk cCtoRH-ff Ciwkgwkpmm type HJ cGitKH cGalUMt &rte%,»rf« jtyift* tCitRH-W Cjpwss «iy» cCrttRH-U Rmm wteshdima «G»RH«Ii ffiMio mpkm C «€nRJH-U Tupm kshngeri «G»1H-II GaBmgdm EGnRH'II Petnsmyzon marinm KfiiRH-I Pttrampm movant IGBKH-III Geetria m&mlb IGisRH-III PeSr0mys®n marinm r~ IGnllMIl Lampetm rkkttti»m :fy^lVilGiilH:= 1GBRH41I tckfymym mimspb IGitRH-iH Lsmpmi appendix KMH411 Lmpem triiknmm IGnRH-III Mwtaek mwiax apGitRH Aptyda eaSfontica Figure 20. Phylogenetic Analysis of GnRH Precursors. The neighbor joining method with 1000 bootstrap replicates was used to produce this phylogenetic tree using the amino acid sequences of the prepro-GnRHs (signal peptide, decapeptide, dibasic cleavage site, and GnRH associated peptide) and is rooted with Aplysia- GnRH. The branch of lamprey GnRH-II is highlighted with a thick black line. Numbers indicate the percentage of bootstrap replicates in which the labeled branch was reproduced, m, mammalian; gp, guinea pig; pj, pejerry; sb, seabream; wf, whitefish; cf, catfish; hr, herring; r, rana; s, salmon; c, chicken; lamprey; ap, Aplysia. 67 In Situ Hybridization In situ hybridization showed expression of the GnRH-II transcript in the optic lobe, hypothalamus, fourth ventricle, and medulla (Fig. 22). Immunohistochemistry Cells stained with anti-lamprey GnRH-II were densely distributed in the arc- shaped hypothalamic area extending from the preoptic nucleus to the post-optic commissure nucleus (Fig. 23A-D). In transverse sections through the preoptic nucleus, most immunoreactive (ir) GnRH-II cells were found in a neuron-rich zone just below the ependyma of the third ventricle (Fig.23A-B). Most ir-GnRH-II nerve fibers originating from cells in the arc-shaped area projected to the neurohypophysis (Fig. 23E), and formed the preoptico-hypophysial GnRH tract. 68 mGnRH (type I) D3,4 sGnRH (type III) cGnRH (type II) lost Gnathostome IGnRH I & III orthologous Cnathostomata lineage t Gnathostome/Lamprey divergence Petromyzontiformes IGnRH II IGnRH Hi D2 Figure 21. Evolution of Vertebrate GnRH Family of Neuropeptides. This is a schematic diagram in which we hypothesize that lamprey GnRH II evolved from a common ancestor of all Gnathostome forms of GnRH (black line). The gene duplication events that generated the different fish and tetrapod paralogous groups (D3, D4) took place within the Gnathostome lineage, after its divergence from the ancestral agnathans. The two other forms of lamprey GnRH (I and III, grey line) can be identified now as paralogous homologs of Gnathostome GnRH and lamprey GnRH II group, resulted from a duplication within the lamprey lineage (D2). This implies that there probably was a genome/gene duplication event which gave rise to all forms of vertebrate GnRH affecting the common ancestor all of lamprey and Gnathostome isoforms (Dl). The Gnathostome branch of the lamprey I and III orthologous group was probably lost during evolution (dotted grey line). 69 Figure 22. In Situ Hybridization of the Adult Lamprey Brain. In situ hybridization of lamprey brain, sagittal tissue sections showing distinct cell populations expressing lamprey GnRH-II and their relative locations within the lamprey brain. AS, antisense probe, S, sense probe, V, ventriculi lateralis; SL, sulcus limitans; Scale bar = 100pm. 70 "'ON h i V .. Of 01 ) h";f: A —— RK' 1'1'D \H PI D Figure 23. Immunohistochemistry. Lamprey GnRH-II-like immunoreactivity in the hypothalamus (hyp) of adult sea lampreys. A transverse (A) and a sagittal (C) sections were stained with anti-lamprey GnRH-II which was previously absorbed with a mixture of synthetic lamprey GnRH-I and —III. The areas outlined by the rectangle in A and C are enlarged and shown in B, D and E, respectively. Note lamprey GnRH-II-positive cell bodies in the preoptic nucleus (PON) and fibers in the neurohypophysis (NH). OC, optic chiasm; PI, pars intermedia; POR, preoptic recess; PPD, proximal pars distalis; RPD, rostral pars distalis; III, third ventricle. Scale bars, a and c: 200|J.m (a, x50; c, x40); b, d and e: 20 ^m (b, x390; d, x360; e, x450). In Vitro and in Vivo Biological Studies In incubations with the ovary only: lamprey GnRH-I, -II and -III increased medium estradiol concentrations when compared to control, however, only estradiol from lamprey GnRH-III treated ovary had significantly higher estradiol (P <0.05) (Fig 24). The co-cultures of pituitary and ovary with either lamprey GnRH-II or -III (24±6.4, mean ± SE, pg/mg ovary or 25.6±4.6 pg/mg ovary, respectively) had significantly higher media estradiol concentrations compared to controls (1.6±0.1 pg/mg ovary)(.P <0.05). Estradiol from medium in the lamprey-II GnRH treated ovary-pituitary co-culture was 71 significantly higher (P <0.05) compared to the lamprey GnRH-III treatment. Estradiol was not detected in medium from the pituitary only culture (Fig. 24). In the in vivo experiments, lamprey GnRH-II (50 or 100 ug/kg) and lamprey GnRH-III (50 or 100 ug/kg) increased plasma estradiol concentrations significantly (P<0.05) compared to control. Also, lamprey GnRH-II (50 or 100 ug/kg) significantly increased plasma estradiol concentrations compared to control (P <0.05) (Fig. 25). ^5$ m am 3# 25 2© 1,5 o 10 5 % CQ Mm m f-r-151 yi I*?"* Figure 24. /« Hfro Ovarian and Ovarian-pituitary Cultures. Estradiol (pg/mg tissue) following ovary treatments with: HBSS at pH 7.0 with 25 mM HEPES (control), lamprey GnRH -I, -II, -III (lOng/ml, lOOng/ml or lOOOng/ml), co-culture of pituitary and ovary treated with lamprey GnRH-I or -III (lOOOng/ml) and pituitary in HBSS at pH 7.0 with 25 mM HEPES. Lamprey GnRH-III treated ovary had significantly higher estradiol (P <0.05). The co- cultures of pituitary and ovary with either lamprey GnRH-II or -III had significantly higher medium estradiol concentrations compared to controls (P <0.05). * indicates significance. 72 J2000 ## !#§§§ * wll §§§§ 6000: IPs 4900' m 2000' 0: m ^ t*—in L-ll Figure 25. /« FiVo Biological Assay. Plasma estradiol (pg/ml) following: no injection (basal), injection with saline (control), lamprey GnRH-III (50 or 100 ug/kg), or lamprey GnRH-II (50 or 100 ug/kg). Lamprey GnRH-II (50 or 100 (ig/kg) and lamprey GnRH-III (50 |wg/kg) both increased plasma estradiol concentrations significantly (P<0.05) compared to control. Lamprey GnRH-II (50 Hg/kg) significantly increased plasma estradiol concentrations compared to control (P <0.05). * indicates significance when compared to control and ** indicates significance when compared to control and 1-GnRH-III. Inositol Phosphate Assay All of the peptides: lamprey GnRH-I, lamprey GnRH-II and lamprey GnRH-III stimulated a significant response of IP accumulation in a dose dependant manner using COS-7 cells which were transiently transfected with the lamprey GnRH receptor. The LogEQo (represented as mean ± SEM; n = 3) were lamprey GnRH-I (-8.46 ± 0.246), lamprey GnRH-II (9.21 ± 0.0921) and lamprey GnRH-III (9.41 ± 0.184) (Fig. 26). 73 LGnRH-R IP Dose Response 110-1 LGnRH-l 100- c 90- LGnRH-Ii .2 80« LGnRH-iii JS 70- § 60- » 50- LogEC50 «0 40- S 30 LGnRH-i -8.4610.246 g 20- LGnRH-ll -9.2110.092 S? 10- LGnRH-iii -9.41 ±0.184 0* -10 —i Basal •11 -10 -9 -8 -6 .5 GnRH (LogM) Figure 26. Inositol Phosphate Assay. Lamprey GnRH dose response curve. The lamprey GnRH receptor was shown to stimulate the IP signaling system in a dose dependent manner, in transiently transfected COS7 cells. Lamprey GnRH- III stimulated IP accumulation at a significantly lover logEC5o when compared to lamprey GnRH-II (P < 0.02) and lamprey GnRH-I (P < 0.001). Lamprey GnRH- II stimulated IP accumulation at a significantly lover logEC50 when compared to lamprey GnRH-II (P < 0.02). Log EC50 shown as mean ± SEM; n = 3 independent experiments. Discussion A 694-base cDNA encoding a preproGnRH has been cloned from the sea lamprey. The deduced amino acid sequence of the newly identified lamprey GnRH-II in lamprey is QHWSHGWFPG. As with all other vertebrate GnRHs, the lamprey GnRH-II is highly conserved with 10 amino acids and conserved C- and N-termini. Similar to GnRH-II expression in gnathostomes, lamprey GnRH-II was shown to be widely distributed and expressed in a number of tissues. In the brain, lamprey GnRH-II was 74 shown to be located in POA/hypothalamus by in situ hybridization and immunocytochemistry. In contrast to GnRH-II in gnathostomes, generally acting as a non-hypothalamic hormone, lamprey GnRH-II may have a role as a third hypothalamic form in lampreys. We hypothesize that lamprey GnRH-II is a direct descendant of a common ancestor of all gnathostome GnRH lineages due to a duplication event that occurred before the rise of the gnathostomes. The deduced amino acid sequence of the lamprey GnRH-II in lamprey differs from gnathostome GnRH-II (chicken GnRH-II) by only one amino acid substitution. Lamprey GnRH-II has Phe8 compared to gnathostome GnRH-II that has Tyr8. Likewise, in sharks, two GnRHs have been determined, dogfish GnRH and GnRH-II, although the cDNA for dogfish GnRH has not been elucidated. The newly discovered lamprey GnRH-II is more ancestral to GnRH-II and dogfish GnRH. GnRH-II was structurally characterized in another Chondrichthyes, the ratfish, that diverged from the vertebrate lineage of about 400 million years ago (Dellovade et al., 1998; Lovejoy et al., 1991). As shown in Figure 21, we now propose that lamprey GnRH II evolved from a common ancestor of all gnathostome forms of GnRH. The gene duplication events that generated the different fish and tetrapod paralogous groups took place within the gnathostome lineage, after its divergence from the ancestral agnathans. The origins of the gnathostome forms of GnRH is debatable (Guilgur et al., 2006). As previously described, the GnRH family of peptides in gnathostomes is typically divided in three groups. However, more rigorous/extensive phylogenetic analysis suggests that in fact there are only two main paralogous GnRH lineages in Gnathostomes: the forebrain GnRH lineage and the midbrain lineage (Guilgur et al., 2006). This is a superposition of two 75 classification criteria: on one hand an evolutionary and a functional one on the other hand. We consider that a clear distinction has to be made between the groupings of the GnRH isoforms based on their evolutionary ancestry and the clusters of the functional similar isoforms. The two other forms of lamprey GnRH (I and III) can now be identified as paralogous homologs (Group IV) of gnathostome GnRH and lamprey GnRH II group, resulting from a duplication within the lamprey lineage. This implies that there probably was a genome/gene duplication event, which gave rise to all forms of vertebrate GnRH affecting the common ancestor of lamprey and Gnathostome isoforms. The Gnathostome branch of the lamprey I and III orthologous group was probably lost during evolution. The architecture of the lamprey GnRH-II precursor is similar to that reported for other GnRH precursors consisting of a signal peptide, decapeptide, a downstream processing site and a GnRH-associated peptide; however, the gene for lamprey GnRH-II does not have introns in comparison to the gene organization for all other vertebrate GnRHs that have three introns and four exons. Exon 1 contains the 5' untranslated region (UTR) (Bond, 1989). Exon 2 encodes for the signal peptide, the GnRH decapeptide, processing site, and part of the GnRH associated peptide (GAP). The remaining GAP sequence is encoded in exon 3 and part of exon 4. The last part of exon 4 encodes the 3' UTR (Fig. 27) (Kitahashi et al., 2005). 76 Vertebrate GnRH Gene Structure Exon 1 Exon 2 Exon 3 Exon 4 Lamprey-II GnRH Gene Structure Tunicate GnRH Gene Structure Untranslated Region | | Intervening Peptide Signal Peptide \ Tj^GnRH Associated Peptide GnRH/Dibasie — Intron Processing Site Figure 27. Chordata Gonadotropin-Releasing Hormone Gene Structure. Gnathostome and Lamprey GnRH-I and —III: This figure depicts a schematic diagram of the genomic organization of the GnRH gene in vertebrates is comprised of three introns and four exons. Lamprey GnRH-II: The lamprey GnRH-II gene consists of a single exon. Ciona Ci-gnrhl Gene Structure: Ci- gnrhl does not have introns and consists of one exon with 5' and 3' flanking regions in contrast to the three introns, four exon arrangement of the vertebrate GnRH gene. In contrast to the vertebrate GnRH gene structure, tunicate GnRH gene structure is distinctly different. In the invertebrate tunicate Ciona intestinalis there are two genes for GnRH with each gene encoding three unique GnRH isoforms for a total of six in one animal (Adams et al., 2003). The gene for Ciona intestinalis gnrh 2 does not contain introns (Adams et al., 2003). Results from the current study showed that the gene encoding lamprey GnRH-II consists of a single exon and does not contain introns. There 77 are various genes across vertebrates that do not contain introns (Long et al., 2003). For some cases, it has been hypothesized that the lack of introns may be due to retro transposition (Long et al., 2003; Makalowska et al., 2007). In most cases these retro genes, which are products of reverse transcription of a spliced (mature) mRNA and are characterized by lack of introns, are not functional (Makalowska et al., 2007). In rare cases, it has been shown that retro genes can encode for functional products (Makalowska et al., 2007). Thus, one possible explanation for the lack of introns for the gene encoding lamprey GnRH-II may have been the occurrence of retro transposition. Similar to gnathostome GnRH-II, lamprey GnRH-II also appears to be widely distributed and expressed in a variety of tissues as demonstrated by RT-PCR (von Schalburg et al., 1999; White et al., 1998a). In contrast to the GnRH-II being predominantly a non-hypothalamic hormone in gnathostomes, lamprey GnRH-II may have a major role as a third hypothalamic GnRH as well as having functions in other parts of the body. Supporting the notion that lamprey GnRH-II may be acting as a hypothalamic GnRH, in situ hybridization of the brain showed expression and localization of the transcript in the hypothalamus, medulla, fourth ventricle and olfactory regions; whereas immunohistochemistry using a specific antiserum showed mostly ir- lamprey GnRH-II nerve fibers originating from cells in the arc-shaped hypothalamic/preoptic areas ending at the neurohypophysis, and proposed to form the preoptico-hypophysial GnRH tract. The distribution of ir-lamprey GnRH-II neurons was quite similar to distributions of lamprey GnRH-I and -III neurons, which were studied previously in the sea lamprey brain (Nozaki et al., 2000). In the current study, there did not appear to be ir-GnRH processed in the olfactory or mid-brain regions of the adult 78 brain. This is similar to previously reported immunohistochemical studies, both ir- lamprey GnRH-I and -III were found in the cell bodies of the rostral hypothalamus and preoptic area in larval and adult sea lamprey and not expressed in extra-hypothalamic regions of the brain (Nozaki et al., 2000; Tobet et al., 1995). Using dual-label in situ hybridization, we had shown that lamprey GnRH-I and -III mRNA are co-localized in the same cells in the preoptic nucleus/hypothalamic regions in adult lampreys (Root et al., 2005). In the current study, it is difficult to know whether lamprey GnRH-II is co- localized in lamprey GnRH-I and/or -III cells or present in different GnRH cells, since anti-lamprey GnRH-II used in the present study exhibited slight cross-reactivity to both GnRH-I and -III. These in situ and IHC data show that lamprey GnRH-II is expressed and processed in the hypothalamus-preoptic region. To examine whether the lamprey GnRH-II may have a hypothalamic role, we performed biological studies and functional receptor studies. Both lamprey GnRH-I and - III have been shown by extensive functional, physiological and immunocytochemical studies to control the pituitary-gonadal axis, reviewed in Sower (Sower, 2003a; Sower, 2003b). As in previous studies, plasma estradiol was measured in the lamprey as a potential indicator of pituitary responsiveness to GnRH (Sower et al., 1993). Lamprey GnRH-II was shown to be biologically active as determined by significantly increased levels of plasma estradiol in the in vivo studies and significantly increased medium estradiol in the co-culture ovary/pituitary in vitro studies. Lamprey GnRH-III was slightly less effective compared to lamprey GnRH-II. In these co-culture ovary/pituitary studies, media estradiol was significantly potentiated compared to media estradiol from ovary culture treated with lamprey GnRH-II. In the ovary culture only and similar to earlier 79 studies on lamprey GnRH-I and -III (Gazourian et al., 2000), lamprey GnRH-II also had a slight direct effect on stimulating media estradiol compared to controls. Administration of GnRH-II in vivo and in vitro induced significant pituitary-gonadal responses. Once a GTH radioimmunoassay or ELISA is established, further studies examining the GTH response to each of the GnRHs can be done in order to fully understand the differential effects GnRHs on pituitary function. In addition to these biological studies, the activity of lamprey GnRH-II in a transiently transfected lamprey GnRH receptor assay was examined. Lamprey GnRH-II activated the inositol phosphate signaling pathway. Stimulation with lamprey GnRH-I, -II or -III led to dose dependent responses in IP in transiently transfected COS7 cells with the lamprey GnRH receptor. As has been shown in vertebrate GnRH receptors, activation of the lamprey GnRH receptor is thought to primarily stimulate the IP3 second messenger system (Fujii et al., 2004; Dcemoto and Park, 2003; Sealfon et al., 1997; Silver et al., 2005). Lamprey GnRH-III was shown to be more potent than lamprey GnRH-II; however, lamprey GnRH-II was more potent than lamprey GnRH-I. These data provide further support that the presently cloned lamprey GnRH-R is lamprey GnRH-III selective yet can be stimulated by lamprey GnRH-I or -II. These functional studies provide further evidence for a hypothalamic role of lamprey GnRH-II and its ability to act via a putative pituitary lamprey GnRH receptor. In an evolutionary sense, the functional changes in the GnRHs appear to associate with the three types of regulation of the adenohypophysis developed in the vertebrates: the agnathan diffusional "median eminence" type, the teleostean direct innervation type, and the most highly evolved median eminence vascular type seen in amphibians, reptiles, birds and mammals (Nozaki et al., 1994). The anatomical structural differences that 80 evolved during the evolution of the vertebrates associated with the change of functions of the GnRH appear to represent adaptive evolution. As brains became larger and thicker and greater distance between the hypothalamus and pituitary arose during the evolution of the GnRH peptides, the GnRHs may have been co-opted for different functions. For instance, one could speculate that the ancestral GnRH that gave rise to lamprey GnRH-II and gnathostome GnRH may have originally been a hypothalamic GnRH in extinct vertebrates and following the duplication event, the GnRH-II in gnathostomes was co- opted by other cells in the brain (mid-brain, olfactory region) and has different functions. In the gnathostomes, GnRH-II predominates in extra-hypothalamic regions and has been suggested to act as a neuromodulator/neurotransmitter although there are species in which GnRH-II is found in the hypothalamic regions and acts at the pituitary in stimulating gonadotropin function (King and Millar, 1995). Whereas in a basal vertebrate lamprey GnRH-II may be predominantly a hypothalamic neurohormone suggesting that the function of the ancestral GnRH was as a hypothalamic hormone in extinct agnathans. Overall, the lamprey hypothalamic GnRH hormones show a pattern of both ancestral and derived features based on primary amino acid structure, phylogenetic analysis, expression and functional studies. While the primary structure of GnRH has been highly conserved, there are key differences in the distribution and functions of the GnRHs in lampreys compared to gnathostomes. In summary, the newly discovered lamprey GnRH-II offers a new paradigm of the origin of the vertebrate GnRH family. We hypothesize that due to a genome/gene duplication event, an ancestral gene gave rise to two lineages of GnRHs—the gnathostome GnRH and lamprey GnRH-II. Due to another duplication event that could 81 have occurred within the lamprey lineage the lamprey GnRH I and III became paralogous homologs of gnathostome GnRH and lamprey GnRH II. 82 REFERENCES 83 Adams, B.A., Tello, J.A., Erchegyi, J., Warby, C, Hong, D.J., Akinsanya, K.O., Mackie, G.O., Vale, W., Rivier, J.E., and Sherwood, N.M. (2003). Six novel gonadotropin- releasing hormones are encoded as triplets on each of two genes in the protochordate, Ciona intestinalis. Endocrinology 144, 1907-1919. Adams, B.A., Vickers, E.D., Warby, C, Park, M., Fischer, W.H., Grey Craig, A., Rivier, J.E., and Sherwood, N.M. (2002). Three Forms of Gonadotropin-Releasing Hormone, Including a Novel Form, in a Basal Salmonid, Coregonus clupeaformis. Biol Reprod 67, 232-239. Amano, M., Kitamura, S., Dcuta, K., Suzuki, Y., and Aida, K. (1997). Activation of salmon GnRH mRNA expression prior to differentiation of precocious males in Masu salmon. Gen Comp Endocrinol 105, 365-371. Amemiya, Y., Sogabe, Y., Nozaki, M., Takahashi, A., and Kawauchi, H. (1999a). Somatolactin in the white sturgeon and African lungfish and its evolutionary significance. Gen Comp Endocrinol 77^, 181-190. Amemiya, Y., Takahashi, A., Meguro, H., and Kawauchi, H. (1999b). Molecular cloning of lungfish proopiomelanocortin cDNA. Gen Comp Endocrinol 115, 415-421. Amiya, N., Amano, M., Takahashi, A., Yamanome, T., and Yamamori, K. (2007). Profiles of alpha-melanocyte-stimulating hormone in the Japanese flounder as revealed by a newly developed time-resolved fiuoroimmunoassay and immunohistochemistry. Gen Comp Endocrinol 151, 135-141. Arora, K.K., Krsmanovic, L.Z., Mores, N., O'Farrell, H., and Catt, K.J. (1998). Mediation of cyclic AMP signaling by the first intracellular loop of the gonadotropin-releasing hormone receptor. J Biol Chem 273, 25581-25586. Blahser, S., King, J.A., and Kuenzel, W.J. (1989). Testing of Arg-8-gonadotropin- releasing hormone-directed antisera by immunological and immunocytochemical methods for use in comparative studies. Histochemistry 93, 39-48. Blomenrohr, M., Heding, A., Sellar, R., Leurs, R., Bogerd, J., Eidne, K.A., and Willars, G.B. (1999). Pivotal role for the cytoplasmic carboxyl-terminal tail of a nonmammalian gonadotropin-releasing hormone receptor in cell surface expression, ligand binding, and receptor phosphorylation and internalization. Mol Pharmacol 56, 1229-1237. 84 Bockaert, J., Marin, P., Dumuis, A., and Fagni, L. (2003). The 'magic tail1 of G protein- coupled receptors: an anchorage for functional protein networks. FEBS Lett 546, 65-72. Bond, C.T., Francis, R.C., Fernald, R.D., and Adelman, J.P. (1991). Characterization of complementary DNA encoding the precursor for gonadotropin-releasing hormone and its associated peptide from a teleost fish. Mol Endocrinol 5, 931-937. Bond, C.T., Hayflick, J. S., Seeburg, P. H., Adelman, J. P. (1989). The rat gonadotropin- releasing hormone: SH locus: structure and hypothalamic expression. Mol Endocrinol 3, 1257-1262. Braun, C.B., Wicht, H., and Northcutt, R.G. (1995). Distribution of gonadotropin- releasing hormone immunoreactivity in the brain of the Pacific hagfish, Eptatretus stouti (Craniata: Myxinoidea). J Comp Neurol 353, 464-476. Brocchieri, L. (2001). Phylogenetic inferences from molecular sequences: review and critique. Theor Popul Biol 59, 27-40. Bundgaard, M., Cserr, H., and Murray, M. (1979). Impermeability of hagfish cerebral capillaries to horseradish peroxidase. An ultrastructural study. Cell Tissue Res 198, 65- 77. Burgus, R., Butcher, M., Amoss, M., Ling, N., Monahan, M., Rivier, J., Fellos, R., Blackwell, R., Vale, W., and Guillemin, R. (1972a). Primary structure of the ovine hypothalamic luteinizing hormone releasing factor (LRF). Proc Natl Acad Sci USA 69, 278-282. Burgus, R., Butcher, M., Amoss, M., Ling, N., Monahan, M., Rivier, J., Fellows, R., Blackwell, R., Vale, W., and Guillemin, R. (1972b). Primary structure of the ovine hypothalamic luteinizing hormone- releasing factor (LRF) (LH-hypothalamus-LRF-gas chromatography-mass spectrometry-decapeptide-Edman degradation). Proc Natl Acad Sci U S A 69, 278-282. Calvin, J.L., Slater, C.H., Bolduc, T.G., Laudano, A.P., and Sower, S.A. (1993). Multiple molecular forms of gonadotropin-releasing hormone in the brain of an elasmobranch: evidence for IR-lamprey GnRH. Peptides 14, 725-729. 85 Carolsfeld, J., Powell, J.F., Park, M., Fischer, W.H., Craig, A.G., Chang, J.P., Rivier, J.E., and Sherwood, N.M. (2000). Primary structure and function of three gonadotropin- releasing hormones, including a novel form, from an ancient teleost, herring. Endocrinology 141, 505-512. Coligan, J. (2000). Peptides. In Current Protocols in Immunology, K.A. Coligan J, Margulies D, Shevach EM, Stober W, ed. (New York, John Wiley & Sons, Inc.), pp. 9.0.0-9.8.15. Coupe, M., Quick, M., Gamble, R., Chase, C, and Sower, S.A. (1995). Development of techniques (RIA and ELISA) for use in quantifying lamprey GnRH-III. Paper presented at: 4th Annual COLSA Undergraduate Research Conference (University of New Hampshire, Durham, NH). Crim, J.W. (1985). Physiology of endogenous luteinizing hormone-releasing hormone in agnathan fishes and amphibians. In Current Trends in Comparative Endocrinology, B. Lofts, and W.M. Holmes, eds. (Hong Kong, Hong Kong University Press). Crim, J.W., Urano, A., and Gorbman, A. (1979a). Immunocytochemical studies of luteinizing hormone-releasing hormone in brains of agnathan fishes. I. Comparisons of adult Pacific lamprey (Entosphenus tridentata) and the Pacific hagfish (Eptatretus stouti). Gen Comp Endocrinol 37, 294-305. Crim, J.W., Urano, A., and Gorbman, A. (1979b). Immunocytochemical studies of luteinizing hormone-releasing hormone in brains of agnathan fishes. II. Patterns of immunoreactivity in larval and maturing Western brook lamprey (Lampetra richardsoni). Gen Comp Endocrinol 38, 290-299. Davis, J.S., West, L.A., and Farese, R.V. (1986). Gonadotropin-releasing hormone (GnRH) rapidly stimulates the formation of inositol phosphates and diacyglycerol in rat granulosa cells: further evidence for the involvement of Ca2+ and protein kinase C in the action of GnRH. Endocrinology 118, 2561-2571. Delarbre, C, Gallut, C, Barriel, V., Janvier, P., and Gachelin, G. (2002). Complete mitochondrial DNA of the hagfish, Eptatretus burgeri: the comparative analysis of mitochondrial DNA sequences strongly supports the cyclostome monophyly. Mol Phylogenet Evol 22, 184-192. 86 Dellovade, T., Schwanzel-Fukuda, M., Gordan, J., and Pfaff, D. (1998). Aspects of GnRH neurobiology conserved across vertebrate forms. Gen Comp Endocrinol 112, 276- 282. Deragon, K.L., and Sower, S.A. (1994). Effects of lamprey gonadotropin-releasing hormone-III on steroidogenesis and spermiation in male sea lampreys. Gen Comp Endocrinol 95, 363-367. Dobkin-Bekman, M., Naidich, M., Pawson, A.J., Millar, R.P., Seger, R., and Naor, Z. (2006). Activation of mitogen-activated protein kinase (MAPK) by GnRH is cell-context dependent. Mol Cell Endocrinol 252, 184-190. Dubois, E.A., Zandbergen, M.A., Peute, J., and Goos, H.J. (2002). Evolutionary development of three gonadotropin-releasing hormone (GnRH) systems in vertebrates. Brain Res Bull 57, 413-418. Eisthen, H.L., and Northcutt, R.G. (1996). Silver lampreys {Ichthyomyzon unicuspis) lack a gonadotropin-releasing hormone- and FMRFamide-immunoreactive terminal nerve. J Comp Neurol 3 70, 159-172. Eschmeyer, W.N., E.S. Herlad and H. Hammann (1983). A field guide to Pacific coast fishes of North America. (Houghton Mifflin Company, Boston, U.S.A.). Eschmeyer, W.N., E.S. Herlad and H. Hammann (1998). Catalog of fishes. Special publication, California Academy of Sciences, (San Francisco). Fernald, R.D., and White, R.B. (1999). Gonadotropin-releasing hormone genes: phylogeny, structure, and functions. Front Neuroendocrinol 20, 224-240. Fernholm, B. (1974). Diurnal variations in the behavior of the hagfish Eptatretus burseri. Marin Biol 27, 351-356. Fernholm, B. (1990). Myxinidae. In Check-list of the fishes of the eastern tropical Atlantic (CLOFETA), J.C.H. J.C. Quero, C. Karrer, A.Post and L. Saldanha, ed. (Paris, JNICT). 87 Fernholm, B. (1998). Hagfish systematics. In The Biology of Hagfishes, J.P.L. J.M. Jorgensen, R.E. Webber and H. Malte, ed. (London, Chapman & Hall), p. 578. Freamat, M., Kawauchi, H., Nozaki, M., and Sower, S.A. (2006). Identification and cloning of a glycoprotein hormone receptor from sea lamprey, Petromyzon marinus. J Mol Endocrinol 37, 135-146. Freamat, M, and Sower, S.A. (2008). A sea lamprey glycoprotein hormone receptor similar with gnathostome thyrotropin hormone receptor. J Mol Endocrinol 41, 219-228. Fried, C, Prohaska, S.J., and Stadler, P.F. (2003). Independent Hox-cluster duplications in lampreys. J Exp Zoolog B Mol Dev Evol 299, 18-25. Fujii, Y., Enomoto, M., Dcemoto, T., Endo, D., Okubo, K., Aida, K., and Park, M.K. (2004). Molecular cloning and characterization of a gonadotropin-releasing hormone receptor in the guinea pig, Caviaporcellus. Gen Comp Endocrinol 136, 208-216. Gazourian, L., Evans, E.L., Hanson, L., Chase, C.F., and Sower, S.A. (2000). The effects of lamprey GnRH-I, III and analogs on steroidogenesis in the sea lamprey (Petromyzon marinus). Aquaculture 188, 147-165. Gorbman, A. (1965). Vascular relations between the neurohypophysis and adenohypophysis of cyclostomes and the problem of evolution of hypothalamic neuroendocrine control. Archives d Anatomie Microscopique et de Morphologie Experimentale 54, 163-194. Gorbman, A. (1980). Endocrine regulation in Agnatha: primitive or degenerate. In Hormones, adaptation and evolution, S.I.e. al, ed. (Tokyo, Japan Sci Soc Press), pp. 81- 92. Gorbman, A. (1997). Hagfish Development. Zool Sci 14, 375-379. Gorbman, A., and Dickhoff, W.W. (1978). Endocrine control of reproduction in hagfish (Amsterdam, Elsevier/North-Holland Biomedical Press). 88 Gorbman, A., and Sower, S.A. (2003). Evolution of the role of GnRH in animal (Metazoan) biology. Gen Comp Endocrinol 134, 207-213. Grosse, R., Schmid, A., Schoneberg, T., Herrlich, A., Muhn, P., Schultz, G., and Gudermann, T. (2000). Gonadotropin-releasing hormone receptor initiates multiple signaling pathways by exclusively coupling to G(q/11) proteins. J Biol Chem 275, 9193- 9200. Guilgur, L.G., Moncaut, N.P., Canario, A.V., and Somoza, G.M. (2006). Evolution of GnRH ligands and receptors in gnathostomata. Comp Biochem Physiol A Mol Integr Physiol 144, 272-283. Heding, A., Vrecl, M., Bogerd, J., McGregor, A., Sellar, R., Taylor, P.L., and Eidne, K.A. (1998). Gonadotropin-releasing hormone receptors with intracellular carboxyl- terminal tails undergo acute desensitization of total inositol phosphate production and exhibit accelerated internalization kinetics. J Biol Chem 273, 11472-11477. Hislop, J.N., Caunt, C.J., Sedgley, K.R., Kelly, E., Mundell, S., Green, L.D., and McArdle, C.A. (2005). Internalization of gonadotropin-releasing hormone receptors (GnRHRs): does arrestin binding to the C-terminal tail target GnRHRs for dynamin- dependent internalization? J Mol Endocrinol 35, 177-189. Holland, P.W., Garcia-Fernandez, J., Williams, N.A., and Sidow, A. (1994). Gene duplications and the origins of vertebrate development. Dev Suppl, 125-133. Huhtaniemi, I. (2005). Focus on gonadotropin signaling. Reproduction 130, 261-262. Ikemoto, T., and Park, M.K. (2003). Identification and characterization of the reptilian GnRH-II gene in the leopard gecko, Eublepharis macularius, and its evolutionary considerations. Gene 316, 157-165. Ikemoto, T., and Park, M.K. (2006). Molecular and evolutionary characterization of the GnRH-II gene in the chicken: distinctive genomic organization, expression pattern, and precursor sequence. Gene 368, 28-36. 89 Irvine, S.Q., Carr, J.L., Bailey, W.J., Kawasaki, K., Shimizu, N., Amemiya, C.T., and Ruddle, F.H. (2002). Genomic analysis of Hox clusters in the sea lamprey Petromyzon marinus. J Exp Zool 294, 47-62. Iwakoshi, E., Takuwa-Kuroda, K., Fujisawa, Y., Hisada, M., Ukena, K., Tsutsui, K., and Minakata, H. (2002). Isolation and characterization of a GnRH-like peptide from Octopus vulgaris. Biochem Biophys Res Commun 291, 1187-1193. Jackson, I.M.D. (1980). Distribution and evolutionary significance of the hypophysiotropic hormones of the hypothatlamus. Frontiers of Hormone Research 6, 35- 69. Janvier, P. (1981). The phylogeny of the craniata, with particular reference to the significance of fossil "Agnathans". J Vertebr Paleontol 1, 121-159. Jimenez-Linan, M., Rubin, B.S., and King, J.C. (1997). Examination of guinea pig luteinizing hormone-releasing hormone gene reveals a unique decapeptide and existence of two transcripts in the brain. Endocrinology 138, 4123-4130. Kah, O., Lethimonier, C, Somoza, G., Guilgur, L.G., Vaillant, C, and Lareyre, J.J. (2007). GnRH and GnRH receptors in metazoa: a historical, comparative, and evolutive perspective. Gen Comp Endocrinol 153, 346-364. Kavanaugh, S.I. (2004). Gonadotropin Releasing Hormone (GnRH) in chordates: The Cloning of the GnRH Precursor and the Distribution of GnRH in the Tunicate Ciona intestinalis and Seasonal Changes of GnRH in the Atlantic hagfish Myxine glutinosa. In Biochemistry and Molecular Biology (Durham, University of New Hampshire), pp. 115. Kavanaugh, S.I., Nozaki, M., and Sower, S.A. (2008). Origins of gonadotropin-releasing hormone (GnRH) in vertebrates: identification of a novel GnRH in a basal vertebrate, the sea lamprey. Endocrinology 149, 3860-3869. Kavanaugh, S.I., Powell, M.L., and Sower, S.A. (2005a). Seasonal changes of gonadotropin-releasing hormone in the Atlantic hagfish Myxine glutinosa. Gen Comp Endocrinol 140, 136-143. 90 Kavanaugh, S.I., Root, A.R., and Sower, S.A. (2005b). Distribution of gonadotropin- releasing hormone (GnRH) by in situ hybridization in the tunicate Ciona intestinalis. Gen Comp Endocrinol 141, 76-83. Kawauchi, H. (1989). Evolutionary aspects of pituitary hormones. Kitasato Arch Exp Med 62, 139-155. King, J.A., and Millar, R.P. (1980). Comparative aspects of luteinizing hormone- releasing hormone structure and function in vertebrate phylogeny. Endocrinology 106, 101-1X1. King, J.A., and Millar, R.P. (1995). Evolutionary aspects of gonadotropin-releasing hormone and its receptor. Cell Mol Neurobiol 15, 5-23. King, J.A., Millar, R.P., Vallarino, M., and Pierantoni, R. (1995). Localization and characterization of gonadotropin-releasing hormones in the brain, gonads, and plasma of a dipnoi (lungfish, Protopterus annectens). Regul Pept 57, 163-174. King, J.A., Steneveld, A.A., Millar, R.P., Fasano, S., Romano, G., Spagnuolo, A., Zanetti, L., and Pierantoni, R. (1992). Gonadotropin-releasing hormone in elasmobranch (electric ray, Torpedo marmorata) brain and plasma: chromatographic and immunological evidence for chicken GnRH II and novel molecular forms. Peptides 13, 27-35. Kitahashi, T., Sato, H., Sakuma, Y., and Parhar, I.S. (2005). Cloning and functional analysis of promoters of three GnRH genes in a cichlid. Biochem Biophys Res Commun 336, 536-543. Kitahashi, T., Sato, H., Sakuma, Y., Parhar, I. S. (2005). Cloning and functional analysis of promoters of three GnRH genes in a cichlid. Biochem Biophys Res Commun 336, 536-543. Klungland, H., Andersen, O., Kisen, G., Alestrom, P., and Tora, L. (1993). Estrogen receptor binds to the salmon GnRH gene in a region with long palindromic sequences. Mol Cell Endocrinol 95, 147-154. 91 Kobayashi, H., Ichikawa, T., Suzuki, H., and Sekomoto, M. (1972). Seasonal migration of the hagfish Eptatretus burgeri (In Japanese). Jap J Ichthyol 19, 191-194. Koenig, J.A., and Edwardson, J.M. (1997). Endocytosis and recycling of G protein- coupled receptors. Trends Pharmacol Sci 18, 276-287. Kuraku, S., Hoshiyama, D., Katoh, K., Suga, H., and Miyata, T. (1999). Monophyly of lampreys and hagfishes supported by nuclear DNA-coded genes. J Mol Evol 49, 729-735. Kuratani, S., Kuraku, S., and Murakami, Y. (2002). Lamprey as an evo-devo model: Lessons from comparative embryology and molecular phylogenetics. Genesis 34, 175- 183. Larhammar, D., Lundin, L.G., and Hallbook, F. (2002). The human Hox-bearing chromosome regions did arise by block or chromosome (or even genome) duplications. Genome Res 12, 1910-1920. Li, S., Hu, W., Wang, Y., and Zhu, Z. (2004). Cloning and expression analysis in mature individuals of two chicken type-II GnRH (cGnRH-II) genes in common carp (Cyprinus carpio). Sci China C Life Sci 47, 349-358. Lin, X.W., and Peter, R.E. (1996). Expression of salmon gonadotropin-releasing hormone (GnRH) and chicken GnRH-II precursor messenger ribonucleic acids in the brain and ovary of goldfish. Gen Comp Endocrinol 101, 282-296. Lin, X.W., and Peter, R.E. (1997). Cloning and expression pattern of a second [His5Trp7Tyr8]gonadotropin-releasing hormone (chicken GnRH-H-II) mRNA in goldfish: evidence for two distinct genes. Gen Comp Endocrinol 107, 262-272. Lio, P., and Goldman, N. (1998). Models of molecular evolution and phylogeny. Genome Res 8, 1233-1244. Liu, F., Usui, I., Evans, L.G., Austin, D.A., Mellon, P.L., Olefsky, J.M., and Webster, N.J. (2002). Involvement of Both Gq/11 and Gs Proteins in Gonadotropin-releasing Hormone Receptor-mediated Signaling in Lbeta T2 Cells. J Biol Chem 277, 32099- 32108. 92 Long, M., Betran, E., Thornton, K., and Wang, W. (2003). The origin of new genes: glimpses from the young and old. Nat Rev Genet 4, 865-875. Lovejoy, D.A., Fischer, W.H., Ngamvongchon, S., Craig, A.G., Nahorniak, C.S., Peter, R.E., Rivier, J.E., and Sherwood, N.M. (1992). Distinct sequence of gonadotropin- releasing hormone (GnRH) in dogfish brain provides insight into GnRH evolution. Proc Natl Acad Sci U S A 89, 6373-6377. Lovejoy, D.A., Sherwood, N.M., Fischer, W.H., Jackson, B.C., Rivier, J.E., and Lee, T. (1991). Primary structure of gonadotropin-releasing hormone from the brain of a holocephalan (ratfish: Hydrolagus colliei). Gen Comp Endocrinol 82, 152-161. Makalowska, I., Lin, C.F., and Hernandez, K. (2007). Birth and death of gene overlaps in vertebrates. BMC Evol Biol 7, 193. Mason, A.J., Hayflick, J.S., Zoeller, R.T., Young, W.S., 3rd, Phillips, H.S., Nikolics, K., and Seeburg, P.H. (1986). A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science 234, 1366-1371. Matsuo, H., Baba, Y., Nair, R.M., Arimura, A., and Schally, A.V. (1971). Structure of the porcine LH- and FSH-releasing hormone. I. The proposed amino acid sequence. Biochem Biophys Res Commun 43, 1334-1339. McArdle, C.A., Davidson, J.S., and Willars, G.B. (1999). The tail of the gonadotrophin- releasing hormone receptor: desensitization at, and distal to, G protein-coupled receptors. Mol Cell Endocrinol 151, 129-136. Miki, M., Shimotani, T., Uchida, K., Hirano, S., and Nozaki, M. (2006). Immunohistochemical detection of gonadotropin-like material in the pituitary of brown hagfish (Paramyxine atami) correlated with their gonadal functions and effect of estrogen treatment. Gen Comp Endocrinol 148, 15-21. Millar, R.P. (2005). GnRHs and GnRH receptors. Anim Reprod Sci 88, 5-28. Millar, R.P., Lu, Z.L., Pawson, A.J., Flanagan, C.A., Morgan, K., and Maudsley, S.R. (2004). Gonadotropin-releasing hormone receptors. Endocr Rev 25, 235-275. 93 Mincarone, M.M. (2000). Eptatretus menezesi, a new species of hagfish (Agnatha, Myxinidae) from Brazil. Bulletin of Marine Science 67, 815 - 819. Mincarone, M.M. (2001). Myxine sotoi, a new species of hagfish (Agnatha, Myxinidae) from Brazil. Bull Mar Sci 68, 479-483. Miyamoto, K., Hasegawa, Y., Igarashi, M., Chino, N., Sakakibara, S., Kangawa, K., and Matsuo, H. (1983). Evidence that chicken hypothalamic luteinizing hormone-releasing hormone is [Gln8]-LH-RH. Life Sci 32, 1341-1347. Miyamoto, K., Hasegawa, Y., Minegishi, T., Nomura, M., Takahashi, Y., Igarashi, M., Kangawa, K., and Matsuo, H. (1982). Isolation and characterization of chicken hypothalamic luteinizing hormone-releasing hormone. Biochem Biophys Res Commun 707,820-827. Miyamoto, K., Hasegawa, Y., Nomura, M., Igarashi, M., Kangawa, K., and Matsuo, H. (1984). Identification of the second gonadotropin-releasing hormone in chicken hypothalamus: evidence that gonadotropin secretion is probably controlled by two distinct gonadotropin-releasing hormones in avian species. Proc Natl Acad Sci U S A 81, 3874-3878. Mok, H.-K. (2002). Myxine Kuoi, A new Species of Hagfish from Southwestern Taiwanese Waters. Zoological Studies 41, 59-62. Mok, H.-K., C-H Kuo (2001a). Myxine formosana, a new species of hagfish (Myxiniformes: Myxinidae) from the southwest waters of Taiwan. Ichthyol Res 48, 295- 297. Mok, H.-K., L.M. Saavedra-Diaz and A.P. Acero (2001b). Two new species of Eptatretus quadatus (Myxinidae, Myxiniformes) from the Caribbean Coast of Columbia. Copeia, 1026-1033. Morgan, K., and Millar, R.P. (2004). Evolution of GnRH ligand precursors and GnRH receptors in protochordate and vertebrate species. Gen Comp Endocrinol 139, 191-197. 94 Ngamvongchon, S., Lovejoy, D.A., Fischer, W.H., Craig, A.G., Nahomiak, C.S., Peter, R.E., Rivier, J.E., and Sherwood, N.M. (1992). Primary structures of two forms of gonadotropin-releasing hormone, one distinct and one conserved, from catfish brain. Mol Cell Neurosci 3, 17-22. Norgren, R.B., Jr., and Gao, C. (1994). LHRH neuronal subtypes have multiple origins in chickens. Dev Biol 165, 735-738. Nozaki, M, Fernholm, B., and Kobayashi, H. (1975). Ependymal absorption of peroxidase into the third ventricle of the hagfish, Eptatretus burgeri (Girard). Acta Zool ( Stockh ) 56, 265-269. Nozaki, M., Gorbman, A., and Sower, S.A. (1994). Diffusion between the neurohypophysis and the adenohypophysis of lampreys, Petromyzon marinus. Gen Comp Endocrinol 96, 385-391. Nozaki, M., and Kobayashi, H. (1979). Distribution of LHRH-like substance in the vertebrate brain as revealed by immunohistochemistry. Arch Histol Jpn 42, 201-219. Nozaki, M., Mitsunaga, F., and Shimizu, K. (1995). Reproductive senescence in female Japanese monkeys (Macaca fuscata): age- and season-related changes in hypothalamic- pituitary-ovarian functions and fecundity rates. Biol Reprod 52, 1250-1257. Nozaki, M, Ominato, K., Gorbman, A., and Sower, S.A. (2000). The distribution of lamprey GnRH-III in brains of adult sea lampreys {Petromyzon marinus). Gen Comp Endocrinol 118, 57-67. Nozaki, M., Ominato, K., Shimotani, T., Kawauchi, H., Youson, J.H., and Sower, S.A. (2008). Identity and distribution of immunoreactive adenohypophysial cells in the pituitary during the life cycle of sea lampreys, Petromyzon marinus. Gen Comp Endocrinol 155, 403-412. Nozaki, M., Oshima, Y., Miki, M., Shimotani, T., Kawauchi, H., and Sower, S.A. (2005). Distribution of immunoreactive adenohypophysial cell types in the pituitaries of the Atlantic and the Pacific hagfish, Myxine glutinosa and Eptatretus burgeri. Gen Comp Endocrinol 143, 142-150. 95 Nozaki, M., Shimotani, T., and Uchida, K. (2007). Gonadotropin-like and adrenocorticotropin-like cells in the pituitary gland of hagfish, Paramyxine atami; immunohistochemistry in combination with lectin histochemistry. Cell Tissue Res 328, 563-572. Oh, D.Y., Song, J.A., Moon, J.S., Moon, M.J., Kim, J.I., Kim, K., Kwon, H.B., and Seong, J.Y. (2005). Membrane-proximal region of the carboxyl terminus of the gonadotropin-releasing hormone receptor (GnRHR) confers differential signal transduction between mammalian and nonmammalian GnRHRs. Mol Endocrinol 19, 722-731. Ohno, S. (1970). Evolution by gene duplication (New York, Allen & Unwin Springer- Verlag). Ohno, S., Wolf, U., and Atkin, N.B. (1968). Evolution from fish to mammals by gene duplication. Hereditas 59, 169-187. Okubo, K., Amano, M., Yoshiura, Y., Suetake, H., and Aida, K. (2000). A novel form of gonadotropin-releasing hormone in the medaka, Oryzias latipes. Biochem Biophys Res Commun 275,298-303. Oshima, Y., Kunihiro Ominato, Masumi Nozaki (2000). Distribution of GnRH-like immunoreactivity in the brains of lampreys and hagfish. Annual Activity Reports of The Sado Marine Biological Station Niigata University No.31, 4-5. Ota, K.G., Kuraku, S., and Kuratani, S. (2007). Hagfish embryology with reference to the evolution of the neural crest. Nature 446, 672-675. Ota, K.G., and Kuratani, S. (2006). The history of scientific endeavors towards understanding hagfish embryology. Zoolog Sci 23, 403-418. Parhar, I.S. (2002). Cell migration and evolutionary significance of GnRH subtypes. Prog Brain Res 141, 3-17. Parhar, I.S., Koibuchi, N., Sakai, M., Iwata, M., and Yamaoka, S. (1994). Gonadotropin- releasing hormone (GnRH): expression during salmon migration. Neurosci Lett 172, 15- 18. 96 Paulin, C, A. Stewart, C. Roberts and P. McMillan (1989). New Zealand fish: A complete guide, no. 19 edn. Pawson, A.J., Katz, A., Sun, Y.M., Lopes, J., Illing, N., Millar, R.P., and Davidson, J.S. (1998). Contrasting internalization kinetics of human and chicken gonadotropin- releasing hormone receptors mediated by C-terminal tail. J Endocrinol 156, R9-12. Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley (1989). Pisces. Petromyzontidae to Carangidae, Vol 7 (Canberra, Australian Government Publishing Services). Peter, R.E., Kei-Li Yu, Tracy A. Marchant, Paul M. Rosenblum (1990). Direct Neural Regulation of the Telost Adenohypophysis. The Journal of Experimental Zoology Supplement 4, 84-89. Pfieger, K.D., Pawson, A.J., and Millar, R.P. (2008). Changes to gonadotropin-releasing hormone (GnRH) receptor extracellular loops differentially affect GnRH analog binding and activation: evidence for distinct ligand-stabilized receptor conformations. Endocrinology 149, 3118-3129. Powell, J.F., Reska-Skinner, S.M., Prakash, M.O., Fischer, W.H., Park, M., Rivier, J.E., Craig, A.G., Mackie, G.O., and Sherwood, N.M. (1996). Two new forms of gonadotropin-releasing hormone in a protochordate and the evolutionary implications. Proc Natl Acad Sci U S A 93, 10461 -10464. Powell, J.F., Zohar, Y., Elizur, A., Park, M., Fischer, W.H., Craig, A.G., Rivier, J.E., Lovejoy, D.A., and Sherwood, N.M. (1994). Three forms of gonadotropin-releasing hormone characterized from brains of one species. Proc Natl Acad Sci U S A 91, 12081- 12085. Powell, M.L., Kavanaugh, S.I., and Sower, S.A. (2004). Seasonal concentrations of reproductive steroids in the gonads of the Atlantic hagfish, Myxine glutinosa. J Exp Zoolog A Comp Exp Biol 301, 352-360. Querat, B., Arai, Y., Henry, A., Akama, Y., Longhurst, T.J., and Joss, J.M. (2004). Pituitary glycoprotein hormone beta subunits in the Australian lungfish and estimation of the relative evolution rate of these subunits within vertebrates. Biol Reprod 70, 356-363. 97 Querat, B., Sellouk, A., and Salmon, C. (2000). Phylogenetic analysis of the vertebrate glycoprotein hormone family including new sequences of sturgeon (Acipenser baeri) beta subunits of the two gonadotropins and the thyroid-stimulating hormone. Biol Reprod 63, 222-228. Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott (1991). World fishes important to North Americas: Exclusive of species from the continental waters of the United States and Canada. Am Fish Soc Spec Publ 21, 243. Ronacher, K., Matsiliza, N., Nkwanyana, N., Pawson, A.J., Adam, T., Flanagan, C.A., Millar, R.P., and Katz, A.A. (2004). Serine residues 338 and 339 in the carboxyl-terminal tail of the type II gonadotropin-releasing hormone receptor are critical for beta-arrestin- independent internalization. Endocrinology 145, 4480-4488. Root, A.R., Nucci, N.V., Sanford, J.D., Rubin, B.S., Trudeau, V.L., and Sower, S.A. (2005). In situ characterization of gonadotropin- releasing hormone-I, -III, and glutamic acid decarboxylase expression in the brain of the sea lamprey, Petromyzon marinus. Brain Behav Evol 65, 60-70. Rozen, S., and Skaletsky, H.J. (2000). Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology, M.S. Krawetz S, ed. (Totowa, Humana Press), pp. 365-386. Rubin, B.S., Lee, C.E., Ohtomo, M., and King, J.C. (1997). Luteinizing hormone- releasing hormone gene expression differs in young and middle-aged females on the day of a steroid-induced LH surge. Brain Res 770, 267-276. Runnenburger, K., Breer, H., and Boekhoff, I. (2002). Selective G protein beta gamma- subunit compositions mediate phospholipase C activation in the vomeronasal organ. Eur J Cell Biol 81, 539-547. Schwanzel-Fukuda, M. (1999). Origin and migration of luteinizing hormone-releasing hormone neurons in mammals. Microsc Res Tech 44, 2-10. Sealfon, S.C., Weinstein, H., and Millar, R.P. (1997). Molecular mechanisms of ligand interaction with the gonadotropin- releasing hormone receptor. Endocr Rev 18, 180-205. 98 Shacham, S., Cheifetz, M.N., Lewy, H., Ashkenazi, I.E., Becker, O.M., Seger, R., and Naor, Z. (1999). Mechanism of GnRH receptor signaling: from the membrane to the nucleus. Ann Endocrinol (Paris) 60, 79-88. Shacham, S., Harris, D., Ben-Shlomo, H., Cohen, I., Bonfil, D., Przedecki, F., Lewy, H., Ashkenazi, I.E., Seger, R., and Naor, Z. (2001). Mechanism of GnRH receptor signaling on gonadotropin release and gene expression in pituitary gonadotrophs. Vitam Horm 63, 63-90. Sherwood, N., Eiden, L., Brownstein, M., Spiess, J., Rivier, J., and Vale, W. (1983). Characterization of a teleost gonadotropin-releasing hormone. Proc Natl Acad Sci U S A 80, 2794-2798. Sherwood, N.M., Sower, S.A., Marshak, D.R., Fraser, B.A., and Brownstein, M.J. (1986). Primary structure of gonadotropin-releasing hormone from lamprey brain. J Biol Chem 261, 4812-4819. Silver, M.R., Kawauchi, H., Nozaki, M., and Sower, S.A. (2004). Cloning and analysis of the lamprey GnRH-III cDNA from eight species of lamprey representing the three families of Petromyzoniformes. Gen Comp Endocrinol 139, 85-94. Silver, M.R., Nucci, N.V., Root, A.R., Reed, K.L., and Sower, S.A. (2005). Cloning and characterization of a functional type II gonadotropin-releasing hormone receptor with a lengthy carboxy-terminal tail from an ancestral vertebrate, the sea lamprey. Endocrinology 146, 3351-3361. Silver, M.R., and Sower, S.A. (2003). The lamprey lineage: a phylogenetic perspective. Intergr Comp BioW2, 1313. Silver, M.R., and Sower, S.A. (2006). Functional characterization and kinetic studies of an ancestral lamprey GnRH-III selective type II GnRH receptor from the sea lamprey, Petromyzon marinus. J Mol Endocrinol 36, 601-610. Slowinski, J.B., and Page, R.D. (1999). How Should Species Phylogenies Be Inferred From Sequence Data? Systematic Biology 48, 814-825. 99 Smith, C.L. (1997). National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. (New York, Alfred A. Knopf Inc.). Sower, S., Nucci, N.V., and Silver, M.R. (2004). Gonadotropin-Releasing Hormone, Family of. In Encyclopedia of Endocrine Diseases, L. Martini, ed. (Amsterdam; Boston, Elsevier Inc.), pp. 306-316. Sower, S.A. (1997). Evolution of GnRH in fish of ancient origins. In GnRH Neurons: Gene to Behavior, I.S. Parthar, and Y. Sakuma, eds. (Tokyo, Brain Shuppan), pp. 27-49. Sower, S.A. (2003a). The Endocrinology of Reproduction in Lampreys and Applications for Male Lamprey Sterilization. J Great Lakes Research 29, 50-65. Sower, S.A. (2003b). The Physiology of Reproduction in Lampreys and Applicatons for Male Lamprey Sterilization. Journal of Great Lakes Research In Press. Sower, S.A., Chiang, Y.C., Lovas, S., and Conlon, J.M. (1993). Primary structure and biological activity of a third gonadotropin-releasing hormone from lamprey brain. Endocrinology 132, 1125-1131. Sower, S.A., Dickhoffj W.W., and Gorbman, A. (1983). Ovulatory and steroidal responses in the lamprey following administration of salmon gonadotropin and agonistic and antagonistic analogues of gonadotropin-releasing hormone. Canadian Journal of Zoology 61, 2653-2626-2659. Sower, S.A., Freamat, M., and Kavanaugh, S.I. (2009). The origins of the vertebrate hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-thyroid (HPT) endocrine systems: new insights from lampreys. Gen Comp Endocrinol 161, 20-29. Sower, S.A., McGregor, A.J., Materne, O.L., Chase, C, Potter, I., and Joss, J. (2000). Evidence for lamprey GnRH-I and -Ill-like molecules in the brains of the southern hemisphere lampreys Geotria australis and Mordacia mordax. Gen Comp Endocrinol 120, 168-175. 100 Sower, S.A., Moriyama, S., Kasahara, M., Takahashi, A., Nozaki, M., Uchida, K., Dahlstrom, J.M., and Kawauchi, H. (2006). Identification of sea lamprey GTHbeta-like cDNA and its evolutionary implications. Gen Comp Endocrinol 148, 22-32. Sower, S.A., Nozaki, M., Knox, C.J., and Gorbman, A. (1995). The occurrence and distribution of GnRH in the brain of Atlantic hagfish, an agnatha, determined by chromatography and immunocytochemistry. Gen Comp Endocrinol 97, 300-307. Stanislaus, D., Ponder, S., Ji, T.H., and Conn, P.M. (1998). Gonadotropin-releasing hormone receptor couples to multiple G proteins in rat gonadotrophs and in GGH3 cells: evidence from palmitoylation and overexpression of G proteins. Biol Reprod 59, 579- 586. Steven, C, Lehnen, N., Kight, K., Ijiri, S., Klenke, U., Harris, W.A., and Zohar, Y. (2003). Molecular characterization of the GnRH system in zebrafish (Danio rerio): cloning of chicken GnRH-II, adult brain expression patterns and pituitary content of salmon GnRH and chicken GnRH-II. Gen Comp Endocrinol 133, 27-37. Stopa, E.G., Sower, S.A., Svendsen, C.N., and King, J.C. (1988). Polygenic expression of gonadotropin-releasing hormone (GnRH) in human? Peptides 9, 419-423. Suzuki, K., Gamble, R.L., and Sower, S.A. (2000). Multiple transcripts encoding lamprey gonadotropin-releasing hormone-I precursors. J Mol Endocrinol 24, 365-376. Suzuki, K., Kawauchi, H., and Nagahama, Y. (1988a). Isolation and characterization of subunits from two distinct salmon gonadotropins. Gen Comp Endocrinol 71, 302-306. Suzuki, K., Kawauchi, H., and Nagahama, Y. (1988b). Isolation and characterization of two distinct gonadotropins from chum salmon pituitary glands. Gen Comp Endocrinol 71, 292-301. Swanson, P., Suzuki, K., Kawauchi, H., and Dickhoff, W.W. (1991). Isolation and characterization of two coho salmon gonadotropins, GTH I and GTH II. Biol Reprod 44, 29-38. Swofford, D.L. (1998). PAUP: phylogenetic analysis using parsimony (Champaign, IL, Illinois Natural History Survey). 101 Tobet, S.A., Crandall, J. E., Schwarting, G. A. (1993). Relationship of migrating luteinizing hormone-releasing hormone neurons to unique olfactory system glycoconjugates in embryonic rats. Dev Biol 155, 471-482. Tobet, S.A., Nozaki, M., Youson, J.H., and Sower, S.A. (1995). Distribution of lamprey gonadotropin hormone-releasing hormone-III (GnRH-III) in brains in larval lampreys (Petromyzon marinus). Cell Tissue Research 279, 261-267. Tobet, S.A., Sower, S.A., and Schwarting, G.A. (1997). Gonadotropin-releasing hormone containing neurons and olfactory fibers during development: from lamprey to mammals. Brain Res Bull 44, 479-486. Trinh, L.A., Marshal D. McCutchen, Marianne Bonner-Fraser, Scott E. Fraser, Loyd A. Bumm, and David W. McCauley (2007). Fluorescent in situ hybridization employing the conventional NBT/BCIP chromogenic strain. Biotechniques 42, 756-759. Tsai, P.S., and Zhang, L. (2008). The Emergence and Loss of Gonadotropin-Releasing Hormone in Protostomes: Orthology, Phylogeny, Structure, and Function. Biol Reprod 79, 798-805. Tsukahara, T., Gorbman, A., and Kobayashi, H. (1986). Median eminence equivalence of the neurohypophysis of the hagfish, Eptatretus burgeri. Gen Comp Endocrinol 61, 348- 354. Tsuneki, K. (1986). A survey of occurrence of about seventeen circumventricular organs in brains of various vertebrates with special reference to lower groups. J Hirnforsch 27, 441-470. Tsuneki, K., Ouji, M., and Saito, H. (1983). Seasonal migration and gonadal changes in the hagfish Eptatretus burgeri. Jap J Ichthyol 29, 429-440. Tsutsumi, M., Zhou, W., Millar, R.P., Mellon, P.L., Roberts, J.L., Flanagan, C.A., Dong, K., Gillo, B., and Sealfon, S.C. (1992). Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 6, 1163-1169. 102 Vandepoele, K., De Vos, W., Taylor, J.S., Meyer, A., and Van de Peer, Y. (2004). Major events in the genome evolution of vertebrates: paranome age and size differ considerably between ray-finned fishes and land vertebrates. Proc Natl Acad Sci U S A 101, 1638- 1643. Vickers, E.D., Laberge, F., Adams, B.A., Hara, T.J., and Sherwood, N.M. (2004). Cloning and localization of three forms of gonadotropin-releasing hormone, including the novel whitefish form, in a salmonid, Cpregonus clupeaformis. Biol Reprod 70, 1136- 1146. Vladykov, V.D. (1979). Check-list of the fishes of the north-eastern Atlantic and of the Mediterranean, Vol 1 (Paris, UNESCO). von Schalburg, K.R., Harrower, W.L., and Sherwood, N.M. (1999). Regulation and expression of gonadotropin-releasing hormone in salmon embryo and gonad. Mol Cell Endocrinol 757,41-54. Vrecl, M., Heding, A., Hanyaloglu, A., Taylor, P.L., and Eidne, K.A. (2000). Internalization kinetics of the gonadotropin-releasing hormone (GnRH) receptor. Pflugers Arch 439, Rl 9-20. Wang, L., Yoo, M.S., Kang, H.M., Im, W.B., Choi, H.S., Bogerd, J., and Kwon, H.B. (2001). Cloning and characterization of cDNAs encoding the GnRHl and GnRH2 precursors from bullfrog (Rana catesbeiana). J Exp Zool 289, 190-201. White, R.B., Eisen, J.A., Kasten, T.L., and Fernald, R.D. (1998a). Second gene for gonadotropin-releasing hormone in humans. Proc Natl Acad Sci USA 95, 305-309. White, R.B., and Fernald, R.D. (1998). Genomic structure and expression sites of three gonadotropin-releasing hormone genes in one species. Gen Comp Endocrinol 112, 17-25. White, S.A., Urbanski, H.F., and Fernald, R.D. (1998b). A second gene for gonadotropin- releasing hormone is expressed in the rhesus macaque. Abstract-Society of Neuroscience 24, 1609. 103 Willars, G.B., Heding, A., Vrecl, M., Sellar, R., Blomenrohr, M., Nahorski, S.R., and Eidne, K.A. (1999). Lack of a C-terminal tail in the mammalian gonadotropin-releasing hormone receptor confers resistance to agonist-dependent phosphorylation and rapid desensitization. J Biol Chem 274, 30146-30153. Worthington, J. (1905). Contribution to our knowledge of the myxinoids. The American Naturalist 39, 625-663. Wray, S., Grant, P., and Gainer, H. (1989a). Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode. Proc Natl Acad Sci U S A 86, 8132-8136. Wray, S., Nieburgs, A., and Elkabes, S. (1989b). Spatiotemporal cell expression of luteinizing hormone-releasing hormone in the prenatal mouse: evidence for an embryonic origin in the olfactory placode. Brain Res Dev Brain Res 46, 309-318. Xian-guang, H., Aldridge, R.J., Siveter, D.J., and Xiang-hong, F. (2002). New evidence on the anatomy and phylogeny of the earliest vertebrates. Proc Biol Sci 269, 1865-1869. Yoo, M.S., Kang, H.M., Choi, H.S., Kim, J.W., Troskie, B.E., Millar, R.P., and Kwon, H.B. (2000). Molecular cloning, distribution and pharmacological characterization of a novel gonadotropin-releasing hormone ([Trp8] GnRH) in frog brain. Mol Cell Endocrinol 164, 197-204. Zhang, L., Tello, J.A., Zhang, W., and Tsai, P.S. (2008). Molecular cloning, expression pattern, and immunocytochemical localization of a gonadotropin-releasing hormone-like molecule in the gastropod mollusk, Aplysia californica. Gen Comp Endocrinol 156, 201- 209. 104 APPENDACIES 105 APPENDIX A IACUC APPROVAL FORMS UNIVERSITY O/NEW HAMPSHIRE July 27, 2005 Sower, Stacia Biochemistry Molecular Biology Rudmart Hall Durham, NH 03824 IACUC#: 040701 Original Approval Date: 07/21/2004 Next Review Date: 07/21/2006 Review Level: C Project: Neuroendocrine Control of Reproduction in Fish The Institutional Animal Care and Use Committee (IACUC) has reviewed and approved your request for a time extension for this protocol. Approval is granted until the "Next Review Date" indicated above- You will be asked to submit a report with regard to the involvement of animals in this study before that date. If your study is still active, you may apply for extension of IACUC approval through this office. The appropriate use and care of animals.in your study is an ongoing process for which you hold primary responsibility. Changes in your protocol must be submitted to the IACUC for review and approval prior to their implementation. Please Note: 1. All cage, pen, or other animal identification records must include your IACUC # listed above. 2. Use of animals in research and instruction is approved contingent upon participation in the UNH Occupational Health Program for persons handling animals. Participation is mandatory for all principal investigators and their affiliated personnel, employees of the University and students alike. A Medical History Questionnaire accompanies this approval; please copy and distribute to all listed project staff who have not completed this form already. Completed questionnaires should be sent to Dr. Gladi Porsche, UNH Health Services. If you have any questions, please contact either me at 862-2726 or Julie Simpson at 862-2003. For the IACUC, Research Conduct and Compliance Services, Office of Sponsored Research, Service Building, 51 College Road, Durham, NH 03824-3585 * Fax: 603-862-3564 107 UNIVERSITY of NEW HAMPSHIRE August 5, 2004 Sower, Stacia Biochemistry Molecular Biology Rudman Hall Durham, NH 03824 IACUC #: 010902 Approval Date: 09/24/2001 Review Level; B Project: Neuroendocrine Control of Reproduction in Fish The Institutional Animal Care and Use Committee (IACUC) reviewed and approved the protocol submitted for this study under Category C on Page 4 of the Application for Review of Vertebrate Animal Use in Research or Instruction - the research potentially involves minor short-term pain, discomfort or distress which will be treated with appropriate anesthetics/analgesics or other assessments. Approval is granted for a period of three years from the approval date above. Continued approval throughout the three year period is contingent upon completion of annual reports on the use of animals. At the end of the three year approval period you may submit a new application and request for extension to continue this study. Requests for extension must be filed prior to the expiration of the original approval. Please Note: 1. AH cage, pen, or other animal identification records must include your IACUC # listed above. 2. Use of animals in research and instruction is approved contingent upon participation in the UNH Occupational Health Program for persons handling animals. Participation is mandatory for all principal investigators and their affiliated personnel, employees of the University and students alike. A Medical History Questionnaire accompanies this approval; please copy and distribute to all listed project staff who have not completed this form already. Completed questionnaires should be sent to Dr. Gladi Porsche, UNH Health Services. If you have any questions, please contact either Van Gould at 862-4629 or Julie Simpson at 862- 2003. FertheMCUCn A Robert G. Mair, Ph.D. Chair cc: File Research Conduct and Compliance Services, Office of Sponsored Research, Service Building, 51 College Road, Durham, NH 03824-3585 * Fax: 603-862-3564 108 University of New Hampshire Research Conduct and Compliance Services, Office of Sponsored Research Service Building, 51 College Road, Durham, NH 03824-3585 Fax: 603-862-3564 23-May-2007 Sower, Stacia Biochemistry Molecular Biology, Rudman Hall Durham, NH 03824 IACUC #: 070401 Project: Neuroendocrine Control of Reproduction/Training of Undergraduate & Graduate Students Category: C Approval Date: 23-May-2007 The Institutional Animal Care and Use Committee (IACUC) reviewed and approved the protocol submitted for this study under Category C on Page 5 of the Application for Review of Vertebrate Animal Use in Research or Instruction - the research potentially involves minor short-term pain, discomfort or distress which will be treated with appropriate anesthetics/analgesics or other assessments. The IACUC made the following comment(s) on this protocol: 1. Eileen Bali'needs to complete the Medical Questionnaire prior to handling any vertebrate animals. 2. The investigator needs to correct the larval sea lamprey numbers in Section V, Table 1 and update the total animal number (and in other places in the form, if necessary). Approval is granted for a period of three years from the approval date above. Continued approval throughout the three year period is contingent upon completion of annual reports on the use of animals. At the end of the three year approval period you may submit a new application and request for extension to continue this project. Requests for extension must be filed prior to the expiration of the original approval. Please Note: 1. All cage, pen, or other animal identification records must include your IACUC # listed above. 2. Use of animals in research and instruction is approved contingent upon participation in the UNH Occupational Health Program for persons handling animals. Participation is mandatory for all principal investigators and their affiliated personnel, employees of the University and students alike. A Medical History Questionnaire accompanies this approval; please copy and distribute to all listed project staff who have not completed this form already. Completed questionnaires should be sent to Dr. Gladi Porsche, UNH Health Services. 109 APPENDIX B LIPOFECTAMINE 2000 INOSITOL PHOSPHATE ASSAY: PROTOCOL, SOLUTIONS AND REAGENTS 110 Transfection with Lipofectamine 2000 for IP assays Transfection and Assay Procedural Overview Day 1 -Seed 60 mm plates from T75 (~ 6-60mm / T75) Day 2-Transfect (Receptor, PcDNA plasmid only, No Transfection) Day 3-Transfer ~1.5xl05 cells to 12 well plate Day 4-Switch media to 2% dialyzed FBS, 2 uCi/mL Myo-[3H]-inositol in Medium 199 Day 5-Stimulate cells, extract IPs, isolate IPs, count in liquid scintillation counter (can be split into a 6th day) Specifics Dayl Putting things where thev belong -Trypsinize cells in T75's with 2.5 mL of IX trypsin for 10 minutes at 37°C. Wash cells off the growing surface with 5 mL of 10% FBS in DMEM, and combine cells from each plate in a 50 mL tube (15 mL total volume) and mix well. -Count cells with hemocytometer. -Seed experiment specific number of 60 mm culture plates with 5xl05 cells in 5 mL 10% FBS in DMEM. -Incubate overnight in humidified CO2 (5%) 37°C incubator. Day 2 Cell Transfection - 2 hours before transfection aspirate the medium from the 60 mm plates and wash with 5 ml DMEM, swirl, aspirate and then feed the cells with 5 ml of fresh 10% FBS in DMEM. -Set up 2 tubes (sterile eppendorf 1.5mL, 2.0 mL or any other), labeled I and II -Tube I: 8 ng of vector with GnRH receptor in 500 |iL Opti-MEM-I (119-141-1^ -Tube II: 20 uL Lipofectamine 2000 and 480 uL Opti-MEM-I -Tube A: 8 jxg of vector w/o receptor in 500 \iL Opti-MEM-I -Tube B: 20 \iL Lipofectamine 2000 and 480 uL Opti-MEM-I -Mix contents of tube I (A) and II (B), and incubate at room temperature for 20 minutes. Gently mix by swirling, and incubate over night in humidified CO2 (5%) 37°C incubator. Day 3 Cutting and Counting -Cut cells with 1 mL of IX trypsin for 10 minutes. -Transfer cells to a sterile 1.5 mL tube, and centrifuge at 1500 rpm for 5 minutes (setting 1.5 on the eppendorf mini centrifuge in Rm 322). -Remove Super carefully. Resuspend pellet in appropriate volume of 10% FBS in DMEM and combine when necessary (i.e. if you were to seed 9 wells with ~lxl05 cells/well, resuspending in 10 mL of medium would be wise as you would seed 1 mL per well (assuming you set up 2-60 mm cultures for transfection and recovered 100% of the cells after trypsinizing them). Count cells to be sure. Ill -Plate lxlO5 to 2xl05 cells/well (or more) in a total of lmL of 10% FBS in DMEM. If set up right you would just seed lmL of resuspended cells. -Incubate overnight. Day 4 Giving up the Hot Stuff -Aspirate media off of cells -Add 1 mL of 2% dialyzed FBS, 2 uCi/mL Myo-[2-3H]-inositol in Medium 199 to the cells -Incubate over night -Prepare Columns for IP isolation: -Use lg resin per column (which will pour a lmL column) -Let resin soak in MQ H2O for 30 minutes at room temp (10 mL/gram) -Pour off most of the water -While PolyPrep column is plugged, pipette resin and let settle until bed volume is approximately lmL. -Remove column plug and run 20 mL MQ H2O through each column to clean. -NOTE: resin is in hydroxyl form, and needs to be in Formate form. -Resin Conversion: (Not So Bad) -Run 2 mL of 1M Formic Acid threw column. This is a harsh treatment; some bubbles will form in the bed and the resin will appear lighter. Let the acid completely run out of the column (i.e. no more drops) -Add 1 mL 1M Formic Acid to the resin bed and pipet up and down two or three time to remove bubbles and to make sure all of the resin is converted. Test effluent pH with litmus paper, should be ~2.0 -Wash column with ~40 mL MQ H2O, 10 mL at a time. Column is ready when effluent ~pH = ~MQ H20 pH -Add 5 mL MQ H20, cap and plug column. Column can sit overnight at room temp. Day 5 "Stimulation" and IP Extraction -In hood: -Carefully remove medium from wells (into a 50 mL labeled Falcon) -Wash wells (with cells) 2x with lmL IP buffer (20mM HEPES, 20mM LiCl in HBSS with O.Olmg/ml Phenol Red) (save buffer for proper disposal) -Pre-Incubation: add 1 mL IP buffer and incubate cells at 37°C with gentle shaking for 15 minutes Note-NOT in CO2 incubator, HBSS does not have sodium bicarbonate and cultures will quickly become extremely acidic -Carefully remove medium and save in 50 mL falcon -Add lmL of stimulant to the cells (control and some range of concentrations of stimulant), 112 generally using IP buffer, and incubate 1 hour at 37 °C with gentle shaking. -Immediately put plates on ice and add 200 uL of pre-chilled (on ice) 20% Perchloric Acid. Incubate on ice for 30 min. OPTIONAL this incubation is supposed to be at ~4°C, so ice bucked with plate(s) could be moved into the cold room during this time, but it isn't necessary. -During this time set up 1.5 mL tubes (1 for each well), to which add 5 uL of 500mMEDTApH8.0. -After the 30 minute incubation transfer medium from wells (first mix by pipette 1 time (just be consistent) to the 1.5 mL tube from the previous step. -Neutralize. This is where it gets tedious... (and I aint kidding)....All samples need to be approximately pH 7.4, which is a light pink color (IP has phenol red). All samples need to be as close in color as possible, but it doesn't need to be exact. -To the first tube, add ~155 uL of 5N KOH (Chem Shelves Room 324), close and mix. Check color, if it's light pink (probably not), test with litmus to verify. Otherwise, add 5N KOH in 5 uL increments until you get there (again, verified by litmus). -Use this first tube to 1) determine how much KOH to add to each tube (very few of which will come out perfect) and 2) as a color reference. -Incubate at 4°C (cold room) for 1 hour -Centrifuge samples at 5000 rpm (40%) at 4°C for 15 minutes -Carefully transfer 1.2 mL (2x600 JJ,L) of the Super to a clean 1.5 mL tube. **AT THIS POINT SAMPLES CAN BE STORED AT -20°C OVERNIGHT** IP Isolation Reagents: -Wash Buffer 60 mM Ammonium Formate (Room 324 Chem Shelves) 5 mM Sodium Tetraborate (A.K.A. Borax) (Room 324 Chem Shelves) -Elution Buffer 100 mM Formic Acid (Acid Cabinet Room 324) 1 M Ammonium Formate -Regeneration Buffer 100 mM Formic Acid 3 M Ammonium Formate -MQ H20 55.5 M MQ H20 Column Running This will take you an entire day, not kidding -Load 1 mL sample to column (in Formate form-see above) -Wash with 10 mL Wash Buffer -Elute with 3 mL Elution Buffer. Collect sample in a 20 mL Scintillation vial. -Regenerate column with 5 mL Regeneration Buffer -Rinse with 10 mL MQ H20 113 -Repeat with next sample. -NOTE-Resin bed is very fragile and will be disturbed by essentially every step -Resin has a very inconveniently high affinity for phenol red, which will accumulate as you load samples. As a result each column can be used 6- 10 times, and then should be discarded. The PolyPrep column itself can be reused numerous times. -For example, if 36 samples are to be isolated, 6 columns could be used, which would each be loaded 6 times, after which the resin is discarded. -10 mL pipetman is very useful-set up four big beakers for each solution and four small beakers to hold the 10 mL pipetman tips. -Total run time for 1 cycle, from loading sample to the end o f the water rinse, is about 28 minutes. -Add 500 uL sample to 5 mL of RIA Solvell (in a 7 mL scint vial), mix and let sit in the dark for 2 hours. Count 10 min/sample. -Analyze data using Excel and/or Prism (GraphPad). 114 1M Formic Acid How to handle 88% formic acid (make solutions for IP3) 1M Formic Acid Density is 1.22 Molecular Weight 46.03 100 ml = 122 g solvent X / 122 * 100 = 88% X = 107.36 g formic acid per 100 ml 107.36 g / 43.06 g/mol = 2.49 mol in 100 ml which = 24.9 M Add 10 ml of 88% formic acid to 90 ml MqH20 (slowly) = 100 ml of 2.49 M formic acid For 1 M Formic Acid CI * VI = C2 * V2 2.49M*V1 = 1M* 100 ml VI = 100ml/2.49 M VI = 40.16 ml of formic acid Need 59.84 ml MqH20 40.16 ml of 2.49 M formic acid + 59.84 ml MqH20 = 1M Formic Acid 115 IP Buffer (2 X 500 ml bottles) To 800 ml of Hanks Buffered Saline Solution (HBSS) add: 20.4 ml HEPES (1M) 865.1 mgLiCl 11.1 ml 1 mg/ml Phenol Red (Below) Bring to 1L with HBSS How to make Phenol Red (50 mis) Dissolve 50 mg of Phenol Red in 15 ml of 0.02M NaOH 0.02M NaOH = 300 ul of 1M NaOH and 14.7 ml of MqH20 Add MqH20 to 50 mis (35mls) Wash Buffer (1L) 60 mM Ammonium Formate (Room 324 Chem Shelves) 5 mM Sodium Tetraborate (A.K.A. Borax) (Room 324 Chem Shelves) 3.78 g Ammonium Formate 1.006 g Sodium Tetraborate 700mlMqH2O Mix Bring to 1L Elution Buffer (1L) 100 mM Formic Acid (Acid Cabinet Room 324) 1 M Ammonium Formate 40.16 ml of 2.49 M Formic Acid 63.06 g Ammonium Formate 700 ml MqH20 Mix Bring to 1L Regeneration Buffer (1L) 100 mM Formic Acid (Acid Cabinet Room 324) 3 M Ammonium Formate (Room 324 Chem Shelves) 40.16 ml of 2.49 M Formic Acid 189.18 g Ammonium Formate 700 ml MqH20 Mix Bring to 1L 116 Cell Culture (IP Assay) Item Company | Cat# | Unit | Price | # Units Cost L-IGnRH American Peptide lOOmg $1,900.00 0.00105 $2.00 L-III GnRH American Peptide A-6851 lOOmg $1,900.00 0.00105 $2.00 L-II GnRH American Peptide 336556 5mg $42.50 0.02 $0.85 Poly-Prep Chromatography Column BioRad 731-1550 50 ea $66.00 1 $66.00 AG 1-8X Resin BioRad 143-2445 100 g $285.00 1 $285.00 P-10 tips pre-loaded Denville P2104 960 tips $17.00 10 $170.00 P-1000 tips pre-loaded Denville P2103-N 960 tips $18.00 10 $180.00 P-200 tips pre-loaded Denville P2101-Y 960 tips $16.00 10 $160.00 Trypsin IX Cell Cuture Fisher SH3023601 100 mL $9.00 1 $9.00 50 ml falcon tube Fisher 14-375-150 500 ea $199.19 1 $199.19 60 mm X 15mm plates Fisher 353002 500 ea $272.00 1 $272.00 12 Well Plates Fisher 08-772-29 50 ea $123.00 1 $123.00 DMEV1 Fisher SH3028401 500 mis $11.41 6 $68.46 T-75 culture flasks Fisher 10-126-37 100 flask $115.35 0.1 $11.54 10 ml pipets serological Fisher 13-668-6 250/case $81.10 1 $81.10 25 ml pipets serological Fisher 13-668-2 200/case $148.74 1 $148.74 50 ml pipets serological Fisher 13-675-52 100/case $128.00 1 $128.00 Color pHast pH strips Fisher M95903 100 strips $20.11 2 $40.22 Lithium Chloride Fisher LI 20-500 500 g $59.70 1 $59.70 Perchloric Acid 70% in H20 Fisher AC42403-2500 250 g $49.95 1 $49.95 Potassium Hydroxide Fisher P250-500 500 g $32.27 1 $32.27 Ammonium Formate Fisher A666-500 500 g $46.61 1 $46.61 Sodium Tetraborate Fisher AC20629-5000 500 g $34.47 1 $34.47 20 ml Scintilation vials Fisher 03-337-7 500 ea $152.06 1 $152.06 7 ml scintillation vial Fisher 03-337-26 1000 ea $168.55 1 $168.55 Myo-[2-3H]-mositol GE Life Sciences TRK317-250UCi 250uCi $467.00 1 $467.00 Hanks Balanced Salt Gibco 14025-092 500 mis $13.80 1 $13.80 HEPES Gibco 15630-080 100 mis $42.20 1 $42.20 L-GnRHR in house Nucci 1 8ul/rxn $0.00 COS 7 Cells in house Passed Medium 199 Invitrogen 12350-039 500 mis $26.50 2 $53.00 Opti-MEM-I Invitrogen 31985-070 500 mis $27.50 2 $55.00 Lipofectamme 2000 Invitrogen 11668-019 1.5 mis $418.00 1 $418.00 FBS (We have) Invitrogen 10438-026 500 mis $285.90 1 $285.90 milliQ water see next 4 items RO Pretreatment Pak Millipore / Fisher CPROPO402 each $316.00 1 $316.00 Qpak Millipore / Fisher CPMQK05R1 each $446.00 1 $446.00 Super-C 12" PE Matrix Millipore / Fisher CDFC01204 4/PK $323.04 1 $323.04 Polygard Millipore / Fisher CL05F1006 6/PK $83.42 1 $83.42 RIA Solve II RPI 111180 4L $55.00 1 $55.00 Formic Acid Sigma Aldrich 399-388 500 mis $95.35 1 $95.35 2.0 ml blue tubes USA Scientific 1620-2700 500 ea $20.00 1 $20.00 1.5 ml microfuge tubes USA Scientific 1415-2500 500 ea $16.50 1 $16.50 P-200 tips cell culture USA Scientific 1111-1006 1000 tips $22.75 10 $227.50 P-10000 tips bulk 1 USA Scientific 1051-0000 200 tips $42.50 2 | $85.00| 117 APPENDIX C NCOI AND SALI RESTRICTION SITE ANALYSIS FOR IN SITU PROBES FOR LAMPREY-II GONADOTROPIN-RELEASING HORMONE 118 Sequence from 125-69-8 aka 7A Checked for the presence of Ncol and Sail restriction sites and none found. This make this sequence a good candidate for in situ probe production. 5' TAATGAACGMTCGATTGCTGTCTGTCCCTCGCGCTGTGGAGGATGGGGCGCGCGTCGCTGTCCCTGGTGCTGATCCTGT o iiii | i i i i | i i i i|iiii | i i i i | i i ii|ii i i | i i i i | i i ii|ii i 11 i i i i | i i ii|ii i i | i i i i [ i iii|i i i i | 80 o 5' GGCTGCTGACGGCCCCGCCAGCCTCGCTGGGGCAGCATTGGTCGCACGGTTGGTTCCCTGGAGGCAAGCGAGGCGTTCAG o i i ii | iiii|iiii|iiii|ii i i|iiii|iiii|iiii|iiii|iiii|iiii|iiii|iiii|iiii|iiii[iiii| 160 o 5' GAGCCGCCCCGAGCCTCCTACGAGAACGTCAGCCCGTCGGACGGTTCCCCTTTCACTCCTGTGAGCTCAGGTCTTCAGGT o i i i i | i i i i | i i i i | i iii|iiii|iiii|iiii|iiii|iiii|iii i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | 240 o 5' CGCGGACTGGCATGTTGTTTGTTCACGCTCTCCAAATGGGTTTTAA o iiii | iii i Ji i ii[ii i i I i i i i [ i i i i j i i i i | i i i i | i i i i | i 286 o Sequence from 125-56-4 Checked for the presence of Ncol and Sail restriction sites and none found. This make this sequence a good candidate for in situ probe production. 5' AATGAACGAATCGATTGCTGNCTNNCCNTCGCGCTGTGGAGGATGGGGCGCGCGTCGCTGTCCCTGGTGCTGATCCTGTG o i i i i [ i i i i | i i i i | i i i i | i i i i | i i i i | i t i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i [ i i i i | i i i i | 80 o 5' GCTGCTGACGGCCCCGCCAGCCTCGCTGGGGCAGCATTGGTCGCACGGTTGGTTCCCTGGAGGCAAGCGAGGCGTTCAGG o i i i i | i i i i | i i i i [ i i i i | i i i i | i > i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i [ i i i i | i i i i [ 160 o 5' AGCCGCCCCGAGCCTCCTACGAGAACGTCAGCCCGTCGGACGGTTCCCCTTTCACTCCTGTGAGCTCAGGTCTTCAGGTC o i i i t | i i i i | t i i i | i i i i | i i i t | i i i i | i i i i | i i i i | i i i i | i i t i | i i i i j i i i i | i i i i | i i i i | i i i i | i i i i | 240 o 5' GCGGACTGGCATGTTGTTTGTTCACGCTCTCCAAATGGGTTTTCGGGTTGTGCCATGTGTTGTTCGCCAGGATGTCCGAC o i i i i | i i i i | i i i i | i i i i | i i i i | i i i i ] i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | 320 o 5' GTTTCTCTCCCAAGTGCTGGAGGCTTCTTTGGGAACTTA o i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i 35 9 o Sequence from 125-56-7 Checked for the presence of Ncol and Sail restriction sites and none found. This make this sequence a good candidate for in situ probe production. 5' ATGAATGAACGAATCGATTGCTGTCTGTCCCTCGCGCTGTGGAGGATGGGGCGCGCGTCGCTGTCCCTGGTGCTGATCCT o i i i i | i i i i | i iii | i i i i | i i ii | i i i i | i i t i | i i i i | i i i i | i i i i| ii i i | i i i i | i i i i | i i i i | i i i i | iii i | 80 o 5' GTGGCTGCTGACGGCCCCGCCAGCCTCGCTGGGGCAGCATTGGTCGCACGGTTGGTTCCCTGGAGGCAAGCGAGGCGTTC o i i i i | i i i i [ i i i i | i i t i | i i i i | i i i i | i i i i [ i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | i i i i | 160 o 5' AGGAGCCGCCCCGAGCCTCCTACGAGAACGTCAGCCCGTCGGACGGTTCCCCTTTCACTCCTGTGAGCTCAGGTCTTCAG o i i i i |i ti i | i i i i | i i i i | i i ii| i i ii | i i i i | i i ii|t iii |i i i i|iiii|i i i i | i i i i | i i i i | i i i i | i i i t | 24 0 o 5' GTCGCGGACTGGCATGTTGTTTGTTCACGCTCTCCAAATGGGTTTTCGGGTTGTGCCATGTGTTGTTCGCCAGGATGTCC o ii i i | i i i i | i i i i| i i i i | i i ii |i i i i | i i i i | ii i i | i i i i | i i i i| i i i i | i i i i | i i i i | i i i i [ i M i |i i i i | 320 o 51 GACGTTTCTCTCA o iiii|iiii|iii 333 119 APPENDIX D TRACE FILES USED TO GENERATE THE LAMPREY GONADOTROPIN- RELEASING HORMONE-II CONSENSUS SEQUENCE 120 >gnl|ti|l 170767299 name:PMAC-acw74h08.bl mate: 1171825954 TGCTAATTCTCGCACTGTGGTGGATTCCAAAAGAACATACCTATATATAGAGT TTACTTTATATTAATAATAATATAAAAAACACACAGCAATAGTTACAAATTAT ACCACAAAGTTATTAAATCAGTTGGAAATCACAGTTGCAAATGTGAATGGAG TTGGTCGTACCCAACACAATATTCACGCACACCTGTACGTGATACCTTACGC TCAGATTTAACTACACATACAGGCAATGCGAATAACTTAACTTTTCATCCTGT GCTAGCTTGGTCTGGTGTGATGCCTTGGGTAGATAAGTTATGACGGTTACGTC CGTCGAGTACATAAACACATTCGATCAAAATATATTAGGTTATCGTTTTACTG TTGAATTAGGATAAACAAGTGTGAAGTCATATTCGAATAATTAAATAATAC ATATTTAGCAATGTTAATTCACAGACAAGCTACCAACACGTGGATGGACGGA ATTAAGTTCCCAAAGAAGCCTCCAGCACTTGGGAGAGAAACGTCGGACATCC TGGCGAACAACACATGGCACAACCCGAAAACCCATTTGGAGAGCGTGAACA AACAACATGCCAGTCCGCGACCTGAAGACCTGAGCTCACAGGAGTGAAAGG GGAACCGTCCGACGGGCTGACGTTCTCGTAGGAGGCTCGGGGCGGCTCCTGA ACGCCTCGCTTGCCTCCAGGGAACCAACCGTGCGACCAATGCTGCCCCAGCG AGGCTGGCGGGGCCGTCAGCAGCCACAGGATCAGCACCAGGGACAGCGACG >gnl|ti| 1180014463 name:PMAC-adv76g05.bl mate: 1179236621 ACTAAACTTCGCCCTGTGGTGGATTCAGTCCGCGACCTGAAGACCTGAGCTC ACAGGAGTGAAAGGGGAACCGTCCGACGGGCTGACGTTCTCGTAGGAGGCTC GGGGCGGCTCCTGAACGCCTCGCTTGCCTCCAGGGAACCAACCGTGCGACCA ATGCTGCCCCAGCGAGGCTGGCGGGGCCGTCAGCAGCCACAGGATCAGCACC AGGGACAGCGACGCGCGCCCCATCCTCCACAGCGCGAGGGACAGACAGCAA TCGATTCGTTCATTCATCTCCAACTGTCATTGCTTTATTATCTGTCATTGCCTC CCGGTACTACAATACACCGAAGCCAATATAGTGTACACTTACCTTGCCTCGTT GCCTTCATCAAGAATTAGAGGATTTCCAGAAGCATTCATGTTTAACGTAATTT GGTTGAACCAGGTGGGGACTCAAGAGACAATGATAGTTTAATAACCTGGGTC AATACAATTATAAAAGCAAAACAAATAAACATCAGAACGAAAGCAACTGTA TCACATGAGGAATTGAAAGTACTCCAAACATGATTCCCATACCACAAACCGA CGAGAGAAGATTATCTCCAGGTTGAACACAGCACAAAAGATACAACTATACT ACATTAATATTTAAACATCGTACCCAATGACTATTATTAAATTCAAGCAACGT CACACATATATGCATTCTTTGGGGTTAGTATGATTTAATACTGGGGTGTAACG ATGGTGCGTGGTTAGACGCCTGCGCTATTAACCCAGACAACCCCAGAGTTTG TATCCATACAACG 121 >gnl|ti| 1193338384 name:PMAC-aiv55ell.gl mate: 1255550159 GTCATACCATACGCAGGAACAGCTATGACCATCTCGAGCAGCTGAAGCTCCA ATGTGGTGGAATTCTCATATTCGAATAATTAAATAATACATATTTAGCAATGT TAATTCACAGACAAGCTACCAACACGTGGATGGACGGAATTAAGTTCCCAAA GAAGCCTCCAGCACTTGGGAGAGAAACGTCGGACATCCTGGCGAACAACAC ATGGCACAACCCGAAAACCCATTTGGAGAGCGTGAACAAACAACATGCCAG TCCGCGACCTGAAGACCTGAGCTCACAGGAGTGAAAGGGGAACCGTCCGAC GGGCTGACGTTCTCGTAGGAGGCTCGGGGCGGCTCCTGAACGCCTCGCTTGC CTCCAGGGAACCAACCGTGCGACCAATGCTGCCCCAGCGAGGCTGGCGGGGC CGTCAGCAGCCACAGGATCAGCACCAGGGACAGCGACGCGCGCCCCATCCTC CACAGCGCGAGGGACAGACAGCAATCGATTCGTTCATTCATCTCCAACTGTC ATTGCTTTATTATCTGTCATTGCCTCCCGGTACTACAATACACCGAAGCCAAT ATAGTGTACACTTACCTTGCCTCGTTGCCTTCATCAAGAATTAGAGGATTTCC AGAAGCATTCATGTTTAACGTAATTTGGTTGAACCAGGTGGGGACTCAAGAG ACAATGATAGTTTAATAACCTGGGTCAATACAATTATAAAAGCAAAACAAAT AAACATCAGAACGAAAGCAACTGTATCACATGAGGAATTGAAAGTACTCCAA ACATGATTCCCATACCACAAACCGACGAGAGAAGATTATCTCCAGGTTGAAC ACAGCACAAAAGATACAACTTAAA >gnl|ti|l 194330245 name:PMAC-aic64e08.gl mate: 1194342540 CTGTTATACCTACGCAGGAACAGCTATGACCATCTCGAGCAGCTGAAGCTCC AATGTGGTGGAATTCCTTTATATTAATAATAATATAAAAAACACACAGCAAT AGTTACAAATTATACCACAAAGTTATTAAATCAGTTGGAAATCACAGTTGCA AATGTGAATGGAGTTGGTCGTACCCAACACAATATTCACGCACACCTGTACG TGATACCTTACGCTCAGATTTAACTACACATACAGGCAATGCGAATAACTTA ACTTTTCATCCTGTGCTAGCTTGGTCTGGTGTGATGCCTTGGGTAGATAAGTT ATGACGGTTACGTCCGTCGAGTACATAAACAGATTCGATCAAAATATATTAG GTTATCGTTTTACTGTTGAATTAGGATAAACAAGTGTGAAGTCATATTCGAAT AATTAAATAATACATATTTAGCAATGTTAATTCACAGACAAGCTACCAACAC GTGGATGGACGGAATTAAGTTCCCAAAGAAGCCTCCAGCACTTGGGAGAGAA ACGTCGGACATCCTGGCGAACAACACATGGCACAACCCGAAAACCCATTTGG AGAGCGTGAACAAACAACATGCCAGTCCGCGACCTGAAGACCTGAGCTCAC AGGAGTGAAAGGGGAACCGTCCGACGGGCTGACGTTCTCGTAGGAGGCTCG GGGCGGCTCCTGAACGCCTCGCTTGCCTCCAGGGAACCAACCGTGCGACCAA TGCTGCCCCAGCGAGGCTGGCGGGGCCGTCAGCAGCCACAGGATCAGCACCA GGGACAGCGACGCGCGCCCCATCTTCA 122 >gnl|ti| 1438788497 name:PMAC-bay37c03.bl mate:1438813303 CATCATCGCCATGTGGTGGATTCTTGAGTCCCACCTGGTTCACCAAATTACGT TAAACATGAATGCTATCTGGAAATCCTCTAATTCTTGATGAAGGCAACGAGG CAAGGTAAGTGTACACTATATTGGCTTCGGTGTATTGTAGTACCGGGAGGCA ATGACAGATAATAAAGCAATGACAGTTGGAGATGAATGAACGAATCGATTGC TGTCTGTCCCTCGCGCTGTGGAGGATGGGGCGCGCGTCGCTGTCCCTGGTGCT GATCCTGTGGCTGCTGACGGCCCCGCCAGCCTCGCTGGGGCAGCATTGGTCG CACGGTTGGTTCCCTGGAGGCAAGCGAGGCGTTCAGGAGCCGCCCCGAGCCT CCTACGAGAACGTCAGCCCGTCGGACGGTTCCCCTTTCACTCCTGTGAGCTCA GGTCTTCAGGTCGCGGACTGGCATGTTGTTTGTTCACGCTCTCCAAATGGGTT TTCGGGTTGTGCCATGTGTTGTTCGCCAGGATGTCCGACGTTTCTCTCCCAAG TGCTGGAGGCTTCTTTGGGAACTTAATTCCGTCCATCCACGTGTTGGTAGCTT GTCTGTGAATTAACATTGCTAAATATGTATTATTTAATTATTCGAATATGACT TCACACTTGTTTATCCTAATTCACAGTAAAACGATAACCTAATATATATTTGA TCGAATGTGTTTATGTACTCGACGGACGTAACCGTCATAACTTATCTACCCAG GCATCCACACCAGACCCAGCTAGCACAAGATGAAAAATTAAGTTATTCGCAT TGGCTGTATGTGTATTTAAACCTGAACGCAAGGATAC 123 APPENDIX E HAGFISH GENUS SPECIES LIST 124 Appendix E. Hagfish Genus Species List. Although there are some question to the taxonomy of hagfish; listed here are the current recognized species, the individuals to first identify that species, and reference. Hagfish Genus and Species List Genus/Species First Identified References Eptatretus atami Dean, 1904 Fernholm, 1998 Eptatretus bischoffii Schneider, 1880 - Regan, 1912 Eschmeyer, 1998 - Fernholm 1998 Eptatretus burgeri Girard,1855 Kuo Eptatretus caribbeaus Fernholm, 1982 Fernholm, 1998 Eptatretus carlhubbsi McMillan and Wisner, 1984 Fernholm, 1998 Eptatretus chinensis Kuoand Mok, 1994 Fernholm, 1998 Eptatretus cirrhatus Forster, 1801 - Fleming, 1822 Paxton - Eschmeyer, 2000 Eptatretus deani Evermann and Goldsborough, 1907 Eschmeyer, 1998 Eptatretus eos Fernholm, 1991 Fernholm, 1998 Eptatretus fritzi Wisner and McMillan, 1990 Fernholm, 1998 Eptatretus grousrei McMillan, 1999 McMillan Eptatretus hexatrema Muller, 1836 Fernholm, 1998 Eptatretus indrambaryai Wongratana, 1983 Fernholm, 1998 Eptatretus laurahubbsae McMillan and Wisner, 1984 Fernholm, 1998 Eptatretus longpinnis Strahan, 1975 Paxton Eptatretus mcconnaugheyi Wisner and McMillan, 1990 Fernholm, 1998 Eptatretus mendozai Hensley, 1985 Fernholm, 1998 Eptatretus menezesi Mincarone, 2000 Mincarone, 2000 Eptatretus minor Fernholm and Hubbs, 1981 Fernholm, 1998 Eptatretus multidens Fernholm and Hubbs, 1981 Fernholm, 1998 Eptatretus nanii Wisner and McMillan, 1998 Fernholm, 1998 Eptatretus octatrema Barnard, 1923 Fernholm, 1986 Eptatretus okinoseanus Dean, 1904 Fernholm, 1998 Eptatretus polytrema Girard, 1855 Fernholm, 1998 Eptatretus profundus Barnard, 1923 Fernholm, 1986 Eptatretus sinus Wisner and McMillan, 1990 Fernholm, 1998 Eptatretus springeri Bigelo and Schroeder, 1952 Fernholm, 1998 Eptatretus stoutii Lockington, 1878 Fernholm, 1998 Eptatretus strahani McMillan and Wisner, 1984 Fernholm, 1998 Eptatretus wayuu Mok, ef a/., 2001 Mok, 2001b Eptatretus wisneri Kuoand Mok, 1994 Fernholm, 1998 125 Appendix E. Hagfish Genus Species List. Although there are some question to the taxonomy of hagfish; listed here are the current recognized species, the individuals to first identify that species, and reference. Hagish Genus and Species List Genus /Species First Identified References Myxine australis Jenyns, 1822 - Garmann, 1899 Fernholm, 1998 Myxine affinis Gunther, 1870 Robins Myxine capensis Regan, 1913 Fernholm, 1986 Myxine circifrons Garman, 1899 Eschmeyer, 1983 Myxine debueni Wisnerand McMillan, 1995 Fernholm, 1998 Myxine dorsum Wisnerand McMillan, 1995 Fernholm, 1998 Myxine fernholmi Wisnerand McMillan, 1995 Fernholm, 1998 Myxine formosana Mok and Kuo, 2001 Mok, 2001a Myxine garmani Jordan and Snyder, 1901 Fernholm, 1998 Myxine gluntinosa Linnaeus, 1758- Bloch, 1795 Vladykov - Eschmeyer, 1998 Myxine hubbsi Wisnerand McMillan, 1995 Fernholm, 1998 Myxine hubbsoides Wisnerand McMillan, 1995 Fernholm, 1998 Myxine ios Fernholm, 1981 Fernholm, 1990 Myxine knappi Wisnerand McMillan, 1995 Fernholm, 1998 Myxine kuoi Mok, 2002 Mok, 2002 Myxine limosa Girard, 1859 - Regan, 1913 Fernholm, 1998 Myxine mccoskeri Wisnerand McMillan, 1995 Fernholm, 1998 Myxine mcmillanae Hensley, 1991 Smith Myxine paucidens Regan, 1913 Fernholm, 1998 Myxine pequenoi Wisnerand McMillan, 1995 Fernholm, 1998 Myxine robinsorum Wisner and McMillan, 1995 Fernholm, 1998 Myxine sotoi Mincarone, 2001 Mincarone Nemamyxine elongata Richardson, 1958 Paulin Nemamyxine kreffti McMillan and Wisner, 1982 Fernholm, 1998 Neomyxine biniplicata Richardson and Jowett, 1951 Fernholm, 1998 Notomyxine tridentiger Garman, 1899 Fernholm, 1998 Paramyxine cheni Shen andTao, 1975 Randall Paramyxine fernholmi Kuo and Mok, 1994 Randall Paramyxine sheni Kuo and Mok, 1994 Randall Quadratus ancon Mok, 2001 Mok, 2001a Quadratus nelsoni Kuo and Mok, 1994 Randall Quadratus taiwanae Shen and Tao, 1975 Fernholm, 1998 Quadratus yangi Teng, 1958 Frenholm, 1998 126 APPENDIX F CODON Degeneracy in the Atlantic hagfish Myxine glutinosa 127 Codon Degeneracy in the Atlantic hagfish Myxine glutinosa Serine AGC AGT TCA TCC TCG TCT 0.01991 0.008296 0.009718 0.016829 0.010666 0.010192 Arginine AGA AGG CGA CGC CGG CGT 0.006874 0.008059 0.006637 0.012325 0.007348 0.015169 Leucine CTA CTC CTG CTT TTA TTG 0.00474 0.017777 0.030576 0.011851 0.003081 0.016118 Proline CCA CCC CCG CCT 0.015881 0.012088 0.006637 0.010192 Glycine GGA GGC GGG GGT 0.025124 0.020147 0.00877 0.019199 Alanine GCA GCC GCG GCT 0.018251 0.027258 0.013747 0.016118 Threonine ACA ACC ACG ACT 0.013984 0.01991 0.010429 0.009007 Valine GTA GTC GTG GTT 0.004029 0.018014 0.031524 0.011851 Isoleucine ATA ATC ATT 0.004503 0.030813 0.01351 Glutamine CAA CAG 0.021095 0.037213 Histidine CAC CAT 0.016829 0.012088 Asparagine AAC AAT 0.023939 0.013984 Cystine TGC TGT 0.016829 0.007111 Aspartate GAC GAT 0.029154 0.024176 Glutamate GAA GAG 0.021095 0.037213 Lysine AAA AAG 0.020384 0.04219 3henylalanine TTC TTT 0.027495 0.012799 Tyrosine TAC TAT 0.021569 0.010192 Methionine ATG 0.030339 Tryptophan TGG 0.01114 STOP TAA TAG TGA 0.001422 0.000237 0.00237 128 APPENDIX G CODON USAGE IN THE ATLANTIC HAGFISH MYXINE GLUTINOSA AND THE SEA LAMPREY PETROMYZON MARINUS 129 Codon Usage in the Atlantic Hagfish. fields: [triplet] [frequency: per thousand] ([number]) UUU 13.4(75) UCU11.4(64) UAU10.3(58) UGU 9.6(54) UUC 25.7 (144) UCC16.2(91) UAC 19.4(109) UGC16.6(93) UUA 3.7 (21) UCA11.8(66) UAA 1.4(8) UGA 2.0(11) UUG16.2(91) UCG11.1 (62) UAG 0.2(1) UGG11.2(63) CUU 13.2(74) CCU 12.3(69) CAU 12.5(70) CGU 13.2(74) CUC 20.3 (114) CCC11.8(66) CAC17.1 (96) CGC12.7(71) CUA 4.5 (25) CCA 17.8 (100) CAA17.3(97) CGA 7.0(39) CUG 29.8 (167) CCG 9.6(54) CAG 25.3 (142) CGG 7.8(44) AUU 12.1 (68) ACU 8.4(47) AAU13.9(78) AGU 8.9(50) AUC 28.2 (158) ACC 19.3 (108) AAC 22.3 (125) AGC 20.3 (114) AUA 5.2 (29) ACA13.5(76) AAA 18.7 (105) AGA 6.6 (37) AUG 36.2 (203) ACG10.5(59) AAG 37.4 (210) AGG 8.4(47) GUU 12.5 (70) GCU 17.8 (100) GAU 21.0 (118) GGU 18.9 (106) GUC 15.9 (89) GCC 25.5 (143) GAC 28.3 (159) GGC 20.3 (114) GUA 5.0 (28) GCA17.6(99) GAA 21.7 (122) GGA 25.0 (140) GUG 29.2 (164) GCG12.7(71) GAG 36.5 (205) GGG 9.8(55) Coding GC 52.91% 1st letter GC 54.99% 2nd letter GC 42.55% 3rd letter GC 61.18% 130 Codon Usage in the Sea Lamprey. fields: [triplet] [frequency: per thousand] ([number]) UUU 9.5(519) UCU 8.4(458) UAU 5.5(301) UGU 6.4(350) UUC20.7(1132) UCC17.1(937) UAC 20.9 (1140) UGC 24.0 (1313) UUA 1.4(78) UCA 8.8(480) UAA 0.7(38) UGA 1.6(89) UUG 9.3(506) UCG 16.4 (899) UAG 0.4 (20) UGG 14.3 (782) CUU 6.2(339) CCU 9.1 (495) CAU 6.3 (346) CGU 6.5 (354) CUC 27.2 (1486) CCC 26.6 (1455) CAC 23.0 (1260) CGC 17.9 (976) CUA 4.0(221) CCA 9.9(544) CAA 9.8 (534) CGA 4.0(221) CUG 43.5 (2379) CCG 14.2 (778) CAG 39.6 (2167) CGG 8.1 (445) AUU 7.7(423) ACU 8.9 (485) AAU 11.9 (653) AGU 8.0 (437) AUC 26.1 (1428) ACC 25.2 (1378) AAC 28.9 (1582) AGC 25.7 (1406) AUA 3.4(186) ACA 9.6(527) AAA 12.7 (697) AGA 4.7 (256) AUG 19.9 (1086) ACG 20.7 (1133) AAG 34.8 (1905) AGG 10.5 (576) GUU 7.0(381) GCU 13.0 (713) GAU 11.0 (599) GGU 9.8 (536) GUC 17.6 (960) GCC 31.6 (1728) GAC 35.6 (1948) GGC 33.2 (1815) GUA 4.2 (232) GCA 12.2 (667) GAA 15.7 (856) GGA 13.5 (736) GUG 34.8 (1901) GCG 21.9(1200) GAG 43.1 (2359) GGG 15.4 (844) Coding GC 59.39% 1st letter GC 57.57% 2nd letter GC 45.75% 3rd letter GC 74.85% 131 Appendix H PRIMERS USED IN ATTEMPTS TO ISOLATE GONADOTROPIN-RELEASING HORMONE FROM THE ATLANTIC HAGFISH, ADAPTOR AND CONTROL PRIMERS, AND LAMPREY GONADOTROPIN-RELEASING HORMONE-II PRIMERS 132 Sequence Name Base Sequence MW nmoles/OD ug/OD EC GC Tm GnRH Primers g/mole 260 260 L/(mole-cm) % °C ZZ-70-1 27 CAG CAC TGG TCG CAT GAG TGG A AG CCC 8310.4 3.89 32.35 256900 63 67 77-70-2 27 CAG CAC TGG TCC TAC GAG TGG A AG CCA 8294.4 3.83 31.73 261400 59 65 Amphi-IF 26 CAR CAY TTS GGM AGR GCM CAY TAY CC 7912.7 4.08 32.27 245200 55 62 Amphi-2F 29 CAR CAY TTS GGM CGY GCM CAY TAC CCM GG 8816.2 3.77 33.20 265550 64 69 Hag-1 17 CAG CAC TGG TCS YA Y GG 5191.4 6.31 32.77 158400 65 56 Hag-2 21 CAG CAC TGG TCS TA Y GG1 TGG 6475.7 5.02 32.48 199350 60 61 Hag-3 14 CCYGGRGGIAAGAG 4363.4 6.07 30.40 143550 64 50 L3-1 21 GAR CAY TGG TCN CAC GAT TGG 6466.5 4.93 31.85 203000 55 57 L3-2 21 GAR CAY TGG AGY CAC GAT TGG 6503.3 4.80 31.20 208450 55 57 L3-3 15 TGG TCN CAY GAY TGG 4603.8 7.09 32.63 141100 58 50 MaClSea 1 14 TGG AGY T A Y GGN CT 4314.6 7.49 32.31 133550 54 47 MaClSea 2 14 TGG TCN TA Y GGN TT 4292.8 7.62 32.92 130400 46 44 MAM1 24 CAR CAY TGG TCN TAY GGN CTN CGN 7336.8 4.48 32.84 223400 56 61 MAM2 24 CARCAYTGG AGYTAYGGN TTR AGR 7437.1 4.17 31.04 239600 48 57 Mg-IOF 29 CAGCAYTGGTCB TAYGGH CTS AND CCM GG 8885.2 3.70 32.85 270492 60 66 Mg-llFsal 26 TGG TCB TAY GGH TGG CTS CCH GGH GG 8041.0 4.21 33.87 237422 66 68 Mg-12F 26 TGGTCB CAY GGH TGG TAY CCH GGH GG 8037.6 4.11 33.07 243022 64 67 Mg-16R 3 'Salmon 30 CAT CAT RTT RAT BGT NGC YTC VAG YTC DCC 9114.7 3.63 33.04 275858 42 61 Mg-17F-LIII 25 CAG CAC TGG TCI CAY GAY TGG A AR CC 7958.2 4.00 32.20 247300 56 65 Mg-18F-UII 26 CAG CAC TGG AGY CAY GAY TGG A AR CC 7989.7 3.97 31.73 251800 58 63 Mg-19F-LI 26 CAGCACTAYTCI CTN CARTGG AARCC 7897.4 4.07 32.14 245700 50 61 ATT TTGCCGACCTCA GAA GGA TGA CAG Mg-IF 27 8308.4 3.75 31.19 266400 48 60 CAGCAC TAYTCI CTN GMI CT Mg-20F 18 6023.2 5.50 33.20 181150 48 58 CAR CAY TGG TCN CAY GGN TGG TT Mg-21F-LII 23 7063.1 4.70 32.90 214700 61 54 AGT CAA CCC ACC GGGTGT TAC TTC A AC Mg-2F 27 8204.4 3.91 32.11 255500 52 62 TCA ACGGTA AAA CAGGGGCTC AAA CTC Mg-3F 27 8286.4 3.74 30.98 267500 48 61 TGC AGR ACR TGG CA Y CCM A AC ATG Mg^Fb 24 7351.3 4.29 31.50 233350 54 62 TGC CGY ACR TGG CAY CCM A AC ATG Mg-5Fb 24 7302.8 4.45 32.52 224550 58 64 TGC TTC AGY CGY GCN TAY CCM ACR CC Mg-6Fa 26 7835.4 4.36 34.19 229200 61 67 TGC TTC TCB CGY GCN TAY CCM ACR CC Mg-7Fa 26 7797.2 4.51 35.14 221914 62 67 TGG TCB TAY GGH TGG CTS CCH GGH GG Mg-8F 26 8041.0 4.21 33.87 237422 66 68 TGG TCB CAY GGH TGG TAY CCH GGH GG Mg-9F 26 8037.6 4.11 33.07 243004 64 67 YYC KYT T YC CYC CAG G PSR1 16 4764.1 7.48 35.62 133750 62 53 Sequence Name Base Sequence MW nmoles/OD ug/OD EC GC Tm GnRH Primers g/mole 260 260 L/(mole-cm) % °C SAL1 21 CARCAYTGG AGYTAYGGN TGG 6506.5 4.88 31.70 205050 54 57 SAL2 21 CARCAYTGGTCN TAYGGRTGG 6482.0 4.94 32.00 202600 54 58 SAL3 21 CAR CAYTGGTCN TAYGGN TGG 6469.7 4.99 32.30 200300 54 57 Sal-4 15 TGG AGY TA Y GGN TGG 4683.8 6.78 31.77 147450 57 49 Sal-5 15 TGG TCN TA Y GGN TGG 4647.0 7.01 32.57 142700 57 49 SPF1 16 TSS TGS TGS TGY TGR C 4919.7 7.09 34.88 141050 63 56 T753SRC1MWS 1 17 CARCAYTGGAGYTAYGG 5235.0 5.98 31.33 167100 53 50 T753SRC1MWS 2 17 CARCAYTGGTCN TAYGG 5198.2 6.16 32.02 162350 53 50 Tun3-1 18 TGG AGYTAYGARTTS ATG 5581.7 5.55 30.96 180300 41 48 Tun3-2 18 TGGTCNTAYGARTTS ATG 5544.9 5.70 31.59 175550 42 48 Tun4-1 17 TGG AGY A AY A AR CTN GC 5231.2 5.89 30.82 169570 47 50 Tun4-2 17 TGG TCN A A Y A AR TTR GC 5221.7 5.93 30.96 168650 41 47 Tun5-1 18 TGG AGY TA Y GAR TA Y ATG 5578.2 5.40 30.14 185100 39 45 Tun5-2 18 TGG TCN TA Y GAR TA Y ATG 5541.4 5.54 30.73 180350 39 45 Tun9-1 17 TGGAGYAAY AARCTN GC 5231.2 5.89 30.82 169750 47 49 Tun9-2 17 TGG TCN AAYAARTTRGC 5221.7 5.93 30.96 168650 41 47 White 1 15 TGG AGY TAY GGN ATG 4667.8 6.65 31.05 150350 50 46 Adaptor Primers API 27 CCA TCC TAA TAC GAC TCA CTA TAGGGC 8188.4 3.90 31.70 258400 48 58 API (b) 26 CCA TCC TAA TAC GAC CAC TAT AGG GC 7884.2 4.00 31.50 250300 50 59 AP2 23 ACT CAC TAT AGGGCT CGA GCGGC 7049.6 4.57 32.23 218700 61 63 CDS Ill-Full 57 ATT CTA GAG GCC GAG GCG GCC GAC ATG-d(T)30 17476.3 1.98 34.52 506300 30 66 CDS/III-17 17 ATT CTA GAGGCCGAGGC 5235.4 5.98 31.29 167300 59 54 CDS/III-22 22 AGA GGC CGA GGC GGC CGA CAT G 6835.5 4.60 31.44 217400 73 68 CDS/III-27 27 ATT CTA GAG GCC GAG GCG GCC GAC ATG 8350.4 3.80 31.76 262900 63 67 FullNOTl 42 AACTGGAAGATTCGCGGCCGCAGA A-d(T)18 12896.4 2.58 33.33 386900 33 64 IV 39 A AG CAG TGG TAT CA A CGC AGA GTG GCC ATT ACG GCC GGG 12106.9 2.60 31.42 385300 59 71 NOT1 43 A AC TGG A AG A AT TCG CGG CCG CAG GA A(T)18 13200.6 2.53 33.42 395000 33 64 NOT1 24 TGG A AG A AT TCG CGG CCG CAG GA A T 8671.7 3.58 31.00 279400 54 68 Oligo dT 3* 22 TTTTTTTTTTTTTTTTTTTTVN 6641.4 5.47 36.33 182813 5 41 Smart IVoligo 22 22 AGT GOT ATC A AC GCA GAG TGG C 6824.5 4.50 30.74 222000 55 60 Smart IV oligo 27 27 AAGCAGTGGTAT CAA CGC AGA GTGGCC 8647.7 3.60 31.12 277900 57 66 Sequence Name Bases Sequence MW nmoles/OD ug/OD EC GC Tm g/mole 260 260 L/(mole-cm) % °C Control Primers M.g.GADF 25 GAA ACT CTA ACGTTG ACG A AG ATGG 7779.1 3.85 29.98 259500 44 56 M.g.GADR 24 ACT GTT GGC ATA ACT CAGCTA CAG 7376.8 4.22 31.11 237100 46 57 P.m. Actin F 25 CAA GAG AGGTAT CCT GACTCT CAA G 7675.0 4.03 30.90 248400 48 56 P.m. Actin R 25 TCA GTC ATG ATC TTC ATC AGA TAG G 7656.0 4.05 31.03 246700 40 54 L-IIGnRH PrnFl 26 A AT GAA CGA ATC GAT TGC TCT CTG TC 7985.2 3.97 31.66 252200 42 58 P.m. F2 27 ATG A AT GAA CGA ATC GAT TGC TCT CTG 8338.5 3.74 31.16 267600 41 58 P.m Rl 24 AAA ACC CAT TTGGAG AGC CTG A AC 7394.9 4.12 30.43 243000 46 58 P.mR2 25 CTC CAG CAC TTG GGA GAG A A A CCT C 7676.0 4.13 31.71 242100 56 61 P.m.F3 21 A AC GAA TCG ATT GCT CTC TCT 6436.2 4.97 31.97 201300 43 55 P.m.R3 21 GAG AGA A AC CTC GGA CAT CCT 6464.3 4.71 30.48 212100 52 56 P.mF4 30 ATG A AT GAA CGA ATC GAT TGC TCT CTGTCC 9221.0 3.44 31.71 290800 43 61 P.m.R4 30 TAA GTT CCC AAA GAA GCC TCC AGC ACT TGG 9160.0 3.48 31.87 287400 50 64 P.m.F5 23 CAG TTG GAG ATG A AT GAA CGA AT 7160.7 4.15 29.70 241100 39 53 P.m.R5 23 TAA GTT CCC AAA GAA GCC TCC AG 7001.6 4.44 31.06 225400 48 57 P.m. F6 21 TGG AAA TCC TCT AAT TCT TGA 6395.2 4.96 31.72 201600 33 49 P.m.R6 20 GGA ACA GCT ATG ACC ATC TC 6086.0 5.17 31.45 193500 50 53 Sequence Name Bases Sequence MW nmoles/OD ug/OD EC GC Tm g/mole 260 260 L/(mole-cm) % °C Alpha/Receptor Pm beta-Actin F 22 GAC CTC ACC GAC TAC CTG ATG A 6664.4 4.78 31.87 209100 55 58 Pm beta-Actin R 18 TGA TGT CGC GCA CGA TCT 5490.6 6.01 33.00 166400 56 57 Pm AF8 26 GTT TGT TAA ACA CGA GAC ATC CAA AG 7987.3 3.79 30.27 263900 38 55 P.m. AF9 25 GTT AAA CAC GAG ACA TCC AAA GOT G 7708.1 3.88 29.90 257800 44 56 P.m. AR8 30 TTA TAG GAG TGA ATGTAA CGA TAT AAGTGG 9373.2 3.14 29.40 318800 33 54 P.m AF9 30 TAT TTT A AT GGA TGA AGT GAA AGGTTA TAG 9363.2 3.17 29.68 315500 27 52 Pm. bAF2 20 TGG TAG ACC AAA GCA AAA AT 6167.1 4.73 29.19 211300 35 50 Pm.bAR2 20 TGG TGT TGA ATG AGT A AC CA 6196.1 4.91 30.45 203500 40 51 PM2ndGnRHRFl 20 TAC TAG CGC ACGCGT GTA AC 6102.0 5.24 31.98 190800 55 57 PM2ndGnRHRRl 20 GCGTCT CTG TCC GTGGAT AC 6100.0 5.50 33.53 181900 60 57 PM2ndGnRHRF2 18 CTC CCT CGT CAC CTC GAA 5355.5 6.35 34.02 157400 61 56 PM2ndGnRHRR2 19 ACA CGC CGA GCA GOT AGT A 5846.8 5.15 30.11 194200 58 58 PM2ndGnRHRR3 18 TTG ACCACG GCCGAGTAG 5524.6 5.74 31.73 174100 61 57 PM2ndGnRHRF3 18 ATG GGC CA A GCA CGC TAT 5508.6 5.74 31.60 174300 56 57 PM2ndGnRHRF4 20 TTC ACC TTC TCG TGC CTC TA 5969.9 5.87 35.06 170300 50 55 PM2ndGnRHRR4 20 ATC ACG AGO AGO GTG A AG AG 6280.1 4.66 29.24 214800 55 56 PM2ndGnRHRF5 20 CGA CTT GCT CAA ACT CAT CG 6037.0 5.46 32.93 183300 50 54 PM2ndGnRHRR5 20 GTGCTT GTG GTT GTG A AT GG 6250.1 5.24 32.77 190700 50 55 APPENDIX I LAMPREY ANTIBODY 3952 RADIOIMMUNOASSAY OF C-18 COLUMN FRACTIONS 137 C-18 Column Hagfish Fractions Immunoreactivity 3952 Ab RIAof C-18122-43 fractions of sample 127-30-3 5 in 4.5 4 3.5 B 3 m e 2.5 2 a. ©\ 06 so 1.5 t- _: rriSO 90 o\ oo >n JS ° OOV> in 1 ^ <= 3952 Ab RIA of C-18122-47 fractions of sampleI22-30-22 -j 160 150 140 130 120 110 •= 100 90 80 70 60 50 40 00 m OSVO C* ON 30 •VON OO is J£r ^ ON Oa\N v©0\ NO 20 IT) •• - m ss 10 r*. o O O •"* O •«© © © © 0 **- 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 105 110 Fraction Number 138 3952 Ab RIA of C-18122-51 fractions of sample 127-30-23 © e a. 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 Fraction Number 3952 Ab RIA of C-18 127-55 fractions of sample 127-30-24 16 14 12 10 © © 8 es n. 6 4 2 0 •**iiUMtft|«%«*0»«MM«»»« 139 3952 Ab RIAof C-18 127-59 fractions of sample 127-30-25 8 7 i 6 5 4 3 2 1 0 HM«n«»»«t«^«ft»»* lAV» »»•»«. » X 30 35 40 45 50 65 70 75 80 85 Fraction Number 3952 Ab RIAof C-18 127-63 fractions of sample 127-30-26 30 35 40 45 Fraction Number 140 3952 Ab RIA of C-18 127-67 fractions of sample 127-30-27 60 50 - 40 - a 2 30 O 2 00 f»5 I 20 3 3 oo «2 10 0 !*»»*••AAiWvU... ^ 0 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 Fraction Number 3952 Ab RIA of C-18 12J-71 fractions of sample 127-30-28 2.5 9\ 2 15 a NO o o 00 M a 2^ *> 0.5 H —l 96 0 ***l|i»«»t»»«»t»*»» • V\»»«*»»«l 0 10 15 25 30 35 40 45 50 55 65 70 Fraction Number 141 3952 Ab RIA of C-18121-75 fractions of sample 127-30-29 a o o o OX) a 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 Fraction Number 3952 Ab RIA of C-18 127-79 fractions of sample 127-30-30 3.5 3 2.5 £ 2 o © 1.5 M a. 1 0.5 2 It It I 0 *********** 0 5 15 20 25 30 35 40 45 50 55 Fraction Number 142 Acknowledgement of Funding 143 This work was supported by National Science Foundation Grants: IBN-0421923, DBI- 0618719, 0090852, 0421923, NHAES 332 and UNH/UME NOAA Sea Grant R/FMS- 168. Funding for travel to scientific meetings was provided by the University of New Hampshire Graduate School and the University of New Hampshire Marine Program. 144 »»»^ W ••/»»•« » 10 15 20 25 30 35 40 45 50 55 Fraction Number