Tropomyosins and the actin cytoskeleton in neuronal morphogenesis and differentiation
A thesis submitted in partial fulfilment of the requirements for the Degree of Doctor of Philosophy (Medicine) at the University of New South Wales, 2011
Nikki Curthoys
Neurodegeneration and Repair Laboratory Oncology Research Unit School of Medical Sciences Faculty of Medicine University of New South Wales
This thesis is dedicated to my mum
Jan Curthoys
09.07.1944 – 28.06.2003
Strength and grace
And my nan
Joan Margery Curthoys
23.03.1923 – 12.08.2010
A warm sunbeam
iii
Thesis Abstract
The actin cytoskeleton is crucial for many functions including cell motility, cytokinesis, and vesicle formation. Tropomyosins (Tm) are actin associated proteins which regulate the functional capacity of actin filaments. At least 40 Tm isoforms are produced from four genes (αTm, βTm, γTm, and δTm), with differential expression and localisation in tissues, cells and subcellular compartments. As some Tms are potential targets for anti- cancer therapies, one aim of this project was to measure how eliminating one subset of isoforms affected expression of other Tms in brain. Using a knockout (KO) mouse model lacking the γTm-gene 9d exon, regional distributions of Tms were investigated by Western blotting in wild type and 9d KO adult mouse Whole Brain, Cerebellum,
Amygdala, Hypothalamus, Cerebral Cortex, Hippocampus, and Olfactory Bulb. KO of
γTm-gene isoforms Tm5NM1 and Tm5NM2was shown to induce upregulation of other
γTm-gene products. Regional expression patterns of other Tms, including the δTm-gene product Tm4, were established in brain. A previously unidentified product immunoreactive with the Tm4 antibody was observed and characterised as having similar biochemical properties to Tm4; 2D gel electrophoresis indicated Tm4 and this associated product were both post translationally modified. To investigate Tm4 function in neural cells, rat neuroblastoma cells (B35) were stably transfected with a mammalian vector containing the Tm4 gene. These cells were compared with previously developed
B35 clones overexpressing the neuronal isoforms: TmBr1, TmBr2, or TmBr3. Using light microscopy it was shown that while overexpression of these isoforms each induced neurite outgrowth, each had highly specific effects on neurite morphology. Analyses of
TmBr2 and Tm4 overexpressing B35 cells by fluorescence activated cell sorting indicated these isoforms could significantly affect cell cycle exit. Quantitative proteomics approaches (LC-MS/MS and iTRAQ) identified proteins affected by
iv overexpression of Tm5NM1, TmBr2, TmBr3, or Tm4 isoforms in B35 cells. These data show for the first time that Tms differentially induce changes in the levels of many other proteins, and Tm expression results in isoform specific profiles of other actin binding proteins (ABP). The main aims of this work were: 1) to investigate the potential of Tms to compensate for Tm isoform loss in brain, 2) to characterise a previously unidentified Tm associated product, and 3) to examine the role of Tms in neural morphogenesis, and the capacities of different Tm isoforms to regulate protein levels of other ABPs. The actin cytoskeleton underpins neurite outgrowth and branching, and the here examined Tms have been identified as regulators of these events and ABP expression.
v
Acknowledgements
The Germans have a word meaning “friends who have been chosen as family”. Shame I don’t know what that word is. Thomas Fath has been a supervisor I was lucky to have; one who taught me really a lot about biochemistry and cell biology. And Germans. And also the more subtle (nowadays sadly overlooked) finer points of high German culture. Like their interesting attitudes to social graces, and what constitutes them. Thomas has also become family to me. Thomas, you and I know what a journey this thing was. I can’t imagine having done it with anyone else.
Peter Gunning: Champion. What is it like to deal with students, year in, year out, and impress on them a certain way of approaching problems, a way of thinking, and a way of communicating data? I always found our talks helpful, insightful, and a pleasure. Meetings in your office felt like several species of small furry animals gathered together in a cave and grooving..
Justine Stehn: Thank you for being my unofficial supervisor. I have considered you a mentor throughout my time in this project, and I will continue to value your opinion highly.
Andrea Connor- just as Wallerawang provides power for Sydney, you came in and put so much energy into this ordeal (.. you like that?). Some days even in farm jeans and goatkicker boots. Hope to be seeing you soon, mate.
Hannah Freittag, you gave your all to the project; I almost forgive you for speaking German (i.e. throat-clearing) with Thomas so much in the lab. I know I will be reading your papers soon.
Mel Desouza. Thanks for your help with this work; good to hear that you’re starting a PhD in the lab.
Galina Schevzov, I am indebted to you not only for teaching me some of the lab fundamentals, but also laying so much groundwork for tropomyosin research.
Much gratitude to all the lab folk who helped throughout this project: Claire Martin, Anne Poljak, Kim Guven, Marcus Beuke, Geraldine O’Neill, Christine Lucas, Jessie Zhong, Teresa Bonello, Anders Darhed, Jocelyn Widagdo, Adam Winterhalter and others..... And all the moral supporters- Cuc, Munther, James, Trevor, Seb, Em, Leonie, Mat,Franz, Fei, Abbey, Helen, Maha, Keerthi, Jayne, Helen, Marko, and Lawrence.
Especially big thanks and much respect to my rockclimbing friends, Dave, Su Li, Steph, Martin, Digi, Stu, Enmoore, Chuin Nee, John, Albear, Kim and Glen. You have each taught me many valuable lessons about focus and persistence.
vi
Julie Ward and Renee Szokolai - legends. Even on those lowest of days just seeing you do my paperwork for me was enough to remind me to be thankful I’m not in admin. Thanks also for providing nutrition when things were dire. I know I owe you both.
Jeff Hook, you are a gene guru, and a dead set lovely guy. I won’t forget how much time you’ve given me through this. All my best wishes for a bright future.
Steve Palmer and Romain Barres, cheers to you both for showing incredible patience when explaining molecular biology to me.
Edna Hardeman– my gratitude for all your support of this project and myself, and for your sage advice.
Anthony Kee, you are a proofreading, paper recommending machine. I appreciate all your comments on the manuscript greatly. It’s been nice to have someone else in the lab who gets excited about the same things I do.
Antonio Lee, hope to see you in Korea one day. We can unearth some Kim Chi together (I'll bring the pickles). Thanks for being a dude through the oddness.
Sam Hess. Mate. Gratitude cubed for all of your time and help. You have given me something to be justly enthusiastic about. Delighted you are now the father of a bouncing Australian capital city, as well as FPALM.
Dad, you have shown me such complete support, and have helped me so much through this and everything. You and your work set a standard to which I aspire. I am proud to be your daughter.
Sasha, my sister: you proofread this whole entire thesis brick, and as such you deserve a round of applause. And heaps more. Sis, consider this acknowledgement a coupon for a one time chit you can call in for anything, anytime.
Finally, my husband, Twig. You have tolerated all that weird postgrad stuff: the drifting off, the quiet cursing, the stupid hours science-making.. and through it all you have loved me. I truly am lucky to be your wife.
vii
Publications arising from this thesis
Curthoys, N.M., Gunning, P.W., and Fath, T. (2011). Tropomyosins in Neuronal Morphogenesis and Development. In: Cytoskeleton of the Nervous System, R.A. Nixon, and A. Yuan, eds. (Springer New York), pp. 411-445.
Fath, T., Chan, Y.-K. A., Vrhovski, B., Clarke, H., Curthoys, N.M., Hook, J., Lemckert, F., Schevzov, G., Tam, P., Watson, C.M., Khoo, P.-L., and Gunning, P. (2010). New Aspects of Tropomyosin-Regulated Neuritogenesis Revealed by the Deletion of Tm5NM1 and 2. European Journal of Cell Biology 89(7): 489-498.
viii
Selected abstracts
Curthoys, N. M., Freittag, H., Schevzov, G., Gunning, P., and Fath, T. Tropomyosins and the Actin Cytoskeleton in Neuronal Morphogenesis and Differentiation. Invited Speaker, Queensland Brain Institute Special Seminar, Brisbane, Australia. 2010, December.
Curthoys, N. M.,Schevzov G., Gunning P., and Fath T. The Tropomyosin Isoform Tm4 Affects Neuronal Morphogenesis and Dif ferentiation. Symposium speaker, OzBio International Conference, Melbourne, Australia. 2010, September.
Curthoys N. M., Schevzov G., Gunning P., and Fath T. The Tropomyosin Isoform Tm4 Promotes Neuritogenesis and Neuronal Morphogenesis. Australia New Zealand Society for Cell Biology NSW Chapter Conference, Sydney, Australia. 2010, March.
Curthoys N. M.,Schevzov G., Gunning P., and Fath T. Tropomyosin 4 Affects Neuronal Morphogenesis and Differentiation. American Society for Cell Biology Conference, San Diego, USA. 2009, December.
Curthoys, N. M., Connor, A., Schevz ov, G., Gunning , P., F ath, T. Tropomyosin 4 Affects Neuronal Morphogenesis and Differ entiation. Speaker, Univ ersity of S ydney Discipline of Paediatrics and Child H ealth Conference, Sydney, Australia. 2009, August.
Curthoys, N. M., Connor, A., Schevzov, G., Gunning, P., Fath, T. Defining the Repertoire of Tropomyosins in Adult Mouse Brain. Australian Society for Medical Research Conference, Sydney, Australia. 2009, June.
Curthoys, N. M., Connor, A., Schevzov, G., Gunning, P., Fath, T. Defining the Repertoire of Tropomyosins in Adult Mouse Brain. University of Sydney School of Public Health Conference, Blue Mountains, Australia. 2008, November.
Curthoys, N. M., Connor, A., Schevzov, G., Gunning, P., Fath, T. Defining the Repertoire of Tropomyosins in Adult Mouse Brain. Australia New Zealand Society for Cell Biology ComBio Conference, Canberra, Australia. 2008, September.
Curthoys, N. M., Schevzov, G., Gunning, P., Fath, T. Regulation of Neuronal Morphogenesis by the Tropomyosin Isoform, Tm4. Speaker, University of Sydney Discipline of Paediatrics and Child Health Conference, Sydney, Australia.2008, August.
Chan, A., Curthoys, N. M., Clarke, H., Sche vzov, G., Gunning, P., Fath, T. Functional Redundancy Among Tropomyosin Isoforms: Consequences For Growth Cone Dynamics and Ne urite Outgrowth. Australian Society for Medical Research Conference, Sydney, Australia.2008, June.
ix
Prizes awarded
2010, September. Australian Society for Cell and Developmental Biology (ANZSCDB) Student Bursary. The Tropomyosin Isoform Tm4 Affects Neuronal Morphogenesis and Differentiation. Awarded at the ANZ SCDB/ASBMB OzBio conference, Melbourne, Australia.
2010, March. Best Student Or al Presentation, ANZSCDB. The Tropomyosin Isoform Tm4 Promotes Ne uritogenesis and Neuronal Morphogenesis. Awarded at th e ANZSCDB NSW Chapter Meeting, Sydney, Australia.
2009, December. American Society for Cell Biology Travel Award Grant. Tropomyosin 4 Affects Neuronal Morphogenesis and Di fferentiation. Awarded at the 44 th annual ASCB conference in San Diego, U.S.A.
2008, September. Best Cell Biology Poster, ANZSCDB. Defining the Repertoire of Tropomyosins in Adult Mouse Brain. Awarded at the ANZSCDB ComBio Conference, Canberra, Australia.
2008, August. Beckman Coulter Award for Excellence in Oral Presentation. Regulation of Neuronal Morphogenesis by the Tropomyosin Isoform, Tm4. Awarded at the University of Sydney Discipline of Paediatrics and Child Health Conference, Sydney, Australia.
x
Abbreviations used in this thesis
2D-GE Two dimensional gel electrophoresis Aa Amino acid ABP Actin binding protein ADF Actin depolymerising factor ADP Adenosine diphosphate APS Ammonium per sulphate Arp Actin-related protein ATP Adenosine triphosphate BSA Bovine serum albumin. CaD Caldesmon cAMP 3'-5'-cyclic adenosine monophosphate 3-[(3-Cholamidopropyl)-dimethylammonio]-1-propane CHAPS sulfonate C-terminus Carboxyterminus Cy3 Indocarbocyanine 3 DAPI 4',6-diamidino-2-phenylindole dbcAMP N6,O2'-Dibutyryl cyclic adenosine 3,-5-monophosphate DMEM Dulbecco’s modified eagle’s medium DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid dNTPs Dinucleotide phosphates DTT Dithiothreitol ECL Enhanced chemi-luminescence EDTA Ethylene diamine tetra-acetic acid FBS Foetal bovine serum GTPase Guanosinetriphosphatase HFBA Hepta-fluorobutyric acid HMW High molecular weight HRP Horseradish peroxidase KO Knock-out LB Luria broth LC-MS/MS Liquid chromatography tandem mass spectrometry LIMK Lim kinase LMW Low molecular weight MALDI Matrix-assisted laser desorption/ionisation (MALDI) MCS Multiple cloning site MQ water Water purified by the Milli-Q element pump (Millipore) mRNA Messenger ribonucleic acid N-terminus Amino terminus OD Optical density PAGE Polyacrylamide gel electrophoresis
xi
PBS Phosphate buffered saline PCR Polymerase chain reaction PFA Paraformaldehyde pI Isoelectric point
Pi Phosphate group PTM Post-translational modification PVDF Polyvinylidene fluoride RNA Ribonucleic acid RT Room temperature SDS Sodium dodecyl sulphate SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis TAE Tris-Acetate EDTA buffer TBS Tris buffered saline TBS-T Tris buffered saline and Tween-20 TEMED N, N, N', N'-tetramethylethylenediamine Tm Tropomyosin Tmod Tropomodulin Tof Time of flight UTR Untranslated region v/v volume/volume w/v weight/volume WASP Wiskott-Aldrich Syndrome Protein WT Wild type
xii
Table of Contents:
Originality Statement ...... Error! Bookmark not defined. Thesis Abstract ...... iv Acknowledgements ...... vi Publications arising from this thesis ...... viii Selected abstracts ...... ix Prizes awarded ...... x Abbreviations used in this thesis ...... xi Table of Contents: ...... xiii List of Figures: ...... xvii List of Tables: ...... xix
1. Chapter 1: Introduction ...... 1 1.1. Actin ...... 2 1.2. Tropomyosin ...... 8 1.3. Developmental regulation of tropomysoin isoforms in brain ...... 9 1.3.1. Neuronal maturation and differentiation...... 11 1.4. Neuronally expressed tropomyosin isoforms ...... 12 1.4.1. The γTm gene: diverse isoforms, diverse functions? ...... 14 1.4.1.1. Exon 9d products from the γTm gene: Tm5NM1 and Tm5NM2 isoforms ...... 15 1.4.1.2. Exon 9d isoforms as detected by the WS5/9d antibody ...... 16 1.4.1.3. The exon 9c products from the γTm gene: a contrast to 9d products . 20 1.4.1.4. Exon 9a products from the γTm gene ...... 21 1.4.1.5. Summary: γTm gene products in brain: exons 9a, 9c and 9d ...... 21 1.4.2. αTm gene products: TmBr1, TmBr2, TmBr3, Tm5a, and Tm5b ...... 23 1.4.2.1. Regional expression in brain: TmBr1 and TmBr3 ...... 23 1.4.2.2. Neuronal distribution of TmBr1 and TmBr3: highly polarised ...... 25 1.4.2.3. TmBr1: astrocyte or neuron specific? ...... 26 1.4.2.4. TmBr3: in the neurites as they extend ...... 27 1.4.2.5. TmBr2: uniform distribution ...... 29 1.4.2.6. Tm5a and 5b: in the growth cones ...... 29 1.4.3. The δTm gene product Tm4 ...... 30 1.4.4. Summary: neuronally expressed tropomyosins: isoform-specific regulation33 1.5. Actin binding proteins and tropomyosins ...... 33 1.5.1. Arp2/3 ...... 34 1.5.2. Formins ...... 35 1.5.3. ADF/Cofilin ...... 36 xiii
1.5.4. Myosin ...... 37 1.5.5. Tropomodulin ...... 39 1.5.6. Drebrin ...... 41 1.5.7. Caldesmon ...... 42 1.5.8. Profilins ...... 43 1.5.9. Fascin ...... 44 1.5.10. Filamins ...... 45 1.5.11. α-Actinins ...... 46 1.6. Tropomyosins in the growth cone ...... 47 1.7. Tropomyosins at the synapse ...... 50 1.8. Tropomyosins in the neurites ...... 54 1.9. Tropomyosins in neurons: seeing the forest and the trees ...... 55 1.10. Aims of this project ...... 57
2. Chapter 2: Materials and methods ...... 59 2.1. Equipment and Reagents ...... 60 2.2. Western blotting ...... 66 2.2.1. Protein extraction: brain dissection and lysis ...... 66 2.2.2. Protein extraction: cell lysates ...... 67 2.2.3. Immunoprecipitation ...... 68 2.2.4. Protein quantification ...... 70 2.2.5. SDS PAGE gel electrophoreses ...... 70 2.2.5.1. Gel running ...... 70 2.2.5.2. Gel transfer ...... 72 2.2.5.3. Immunoblotting ...... 73 2.2.6. Image analyses: Western blotting ...... 74 2.3. Tissue Culture ...... 76 2.3.1. Passaging cells ...... 77 2.3.2. Cryopreservation of cells ...... 77 2.3.3. Thawing of cryopreserved cells ...... 77 2.3.4. Stable transfection...... 78 2.3.5. Colony picking of transfected cells ...... 79 2.3.6. Growth curve analysis ...... 80 2.4. Immunofluorescence ...... 81 2.5. Isobaric tagging and relative and absolute quantitation (iTRAQ): ...... 83 2.5.1. Sample preparation ...... 83 2.5.2. iTRAQ reporter ion labelling ...... 84 2.5.3. iTRAQ: Liquid chromatography – tandem mass spectrometry (LC-MS/MS) analyses …………………………………………………………………………...86 2.6. Flow cytometry and cell cycle analyses ...... 89 2.6.1. Sample preparation ...... 89 2.6.2. Cell harvesting for analysis...... 89 2.7. Two dimensional gel electrophoreses ...... 90
xiv
2.8. Molecular Biology ...... 91 2.8.1. General techniques: agarose gel electrophoresis ...... 91 2.8.2. Purification of DNA fragments...... 92 2.9. Bacterial Work ...... 92 2.9.1. Preparation of electrocompetent cells ...... 92 2.9.2. Transformation of bacteria...... 93 2.9.2.1. Electroporation...... 93 2.9.2.2. Heat shock...... 93 2.9.3. Purification of DNA...... 94 2.9.3.1. Minipreps ...... 94 2.9.3.2. Midipreps ...... 94 2.9.4. Cloning rat Tm4 into a mammalian expression vector ...... 95 2.9.4.1. PCR for cloning ...... 95 2.9.5. Sequencing reaction ...... 99 2.9.6. Restriction digests ...... 99 2.9.7. Phenol : chloroform cDNA clean-up ...... 100 2.9.8. DNA Ligation ...... 101 2.9.9. PCR analyses of mouse brain Tm4 ...... 102 2.9.9.1. RNA trizol extraction...... 102 2.9.9.2. cDNA library transcription ...... 103 2.9.10. Sequence analyses ...... 105 2.9.11. DNA denaturing acrylamide-urea gels...... 105 2.10. Statistics ...... 106
3. Chapter 3: Defining the repertoire of tropomyosins in adult mouse brain ...... 107 3.1. Introduction ...... 108 3.2. Results ...... 111 3.2.1. Protein levels of αTm, βTm and δTm gene cytoskeletal isoforms are unaffected by γ9d exon knockout ...... 111 3.2.2. Autoregulation of the γTm gene: γ9c exon-containing isoforms are upregulated in response to γ9d exon loss ...... 115 3.2.3. The relative pool size of total γTm gene products in γ9d knockout versus wild type mice is dependent on brain region ...... 119 3.2.4. Observation of an alternative product with the δTm gene isoform, Tm4 ... 121 3.3. Discussion ...... 123 3.3.1. Cytoskeletal tropomyosins can autoregulate ...... 123 3.3.2. The γTm gene pool: regional differences in brain ...... 123 3.3.3. The δTm gene product: Tm4 ...... 125
4. Chapter 4: The δTm gene product - investigating Tm4 function and characterising a Tm4 associated product...... 127 4.1. Introduction ...... 128 4.2. Results ...... 133 4.2.1. Characterising the Tm4 associated product ...... 133 4.2.1.1. Identification of the protein product using mass spectrometry ...... 133 xv
4.2.1.2. Heat stability and purification...... 139 4.2.1.3. Investigating splice variants of the δTm gene ...... 142 4.2.1.4. Immunoprecipitation of Tm4 and its associated product...... 144 4.2.1.5. Investigation of Tm4 post translational modifications: acetylation . 146 4.2.2. Construction of a Tm4 overexpressing neuroblastoma cell line B35 ...... 150 4.2.2.1. The Tm4 overexpressing construct ...... 150 4.2.2.2. Stable overexpression of rat Tm4 in the B35 cell line ...... 150 4.2.2.3. Tm4 overexpression and the levels of endogenous tropomyosins .. 152 4.2.2.4. Categorisation of B35 morphologies ...... 154 4.2.2.5. Impact of Tm4 overexpression on B35 morphology ...... 158 4.2.2.6. Impact of Tm4 overexpression of B35 proliferation rate ...... 160 4.3. Discussion ...... 162 4.3.1. The Tm4 associated product ...... 162 4.3.2. Characterisation of a novel Tm4 overexpressing B35 cell line ...... 164
5. Chapter 5. Characterisation of tropomyosin specific effects on the cytoskeleton, and additional effects on protein expression and cell cycle in the neuroblastoma cell system B35 166 5.1. Introduction ...... 167 5.2. Results: ...... 172 5.2.1. Tropomyosins induce neurite outgrowth: phenotype categories ...... 172 5.2.2. Tropomyosins differently affect neurite outgrowth ...... 176 5.2.3. Increased neurite branching, but not length, is associated with changes in growth cone area of tropomyosin overexpressing cells ...... 181 5.2.4. Tropomyosin overexpression can affect levels of other proteins ...... 183 5.2.4.1. Tropomyosin isoforms Tm5NM1 and TmBr3 are N-terminally acetylated……………...... 187 5.2.5. Tropomyosins differently affect ADF/cofilin activity ...... 189 5.2.6. Tropomyosins differently affect cell cycle exit ...... 191 5.3. Discussion ...... 196 5.3.1. Tropomyosins differently affect neurite outgrowth and arborisation ...... 196 5.3.2. Tropomyosins and growth cone size ...... 197 5.3.3. Tms differently alter the levels of other proteins: iTRAQ...... 198 5.3.3.1. Fascin ...... 201 5.3.3.2. ADF/Cofilin ...... 202 5.3.4. Neuronal cell fate and differentiation ...... 205
6. General discussion: ...... 209 6.1. Tropomyosin regulation and compensation ...... 210 6.2. Regulation of cytoskeletal versus muscle Tms ...... 211 6.3. Tm overexpression in B35 cells: identifying mechanisms of Tm function Error! Bookmark not defined. 6.4. Tropomyosin isoforms differentially alter expression of multiple actin binding proteins ...... 214
xvi
6.5. Characterisation of a Tm4 associated product is mouse brain: functional diversity from the δTm gene? ...... 217 6.6. Limitations of this work ...... 220 6.7. Conclusions and further study ...... 222
7. References ...... 224
Appendices:
Appendix 1: Functional annotation clustering of proteins significantly deregulated with Tm5NM1, Tm4, TmBr2 or TmBr3 overexpression ...... 246
Appendix 2: Fragmentation of the Tm5NM1 and TmBr3 N-terminal peptides indicate N-terminal acetylation...... ………………………………………. 251
Appendix 3: Details of the different clones discussed in Section 5.2.1...... 253
List of Figures:
Figure 1.1 Actin polymerisation and depolymerisation ...... 5 Figure 1.2 The organisation of actin filaments ...... 7 Figure 1.3 Mammalian tropomyosin isoforms found in neurons ...... 10 Figure 1.4 Developmental profiles of tropomyosin localisation in neurons ...... 13 Figure 1.5 Tropomyosins and other actin binding proteins in the growth cone ...... 49 Figure 1.6 Tropomyosins at the synapse ...... 53
Figure 2.1 Setup of transfer apparatus for Western blotting ...... 72 Figure 2.2 iTRAQ sample preparation and experimental design ...... 88 Figure 2.3 Plasmids maps of expression vectors used in this study ...... 98
Figure 3.1.2 Expression of αTm, βTm and δTm gene products is not altered with γ9d exon knockout ...... 114 Figure 3.2.1 Knockout of γ9d exon induces upregulation of γ9c exon-containing products ...... 116 Figure 3.2.2 Exon γ9d KO induces upregulation of exon γ9c-containing products in brain...... 118 Figure 3.2.3 Pool size of γTm gene products remains constant despite exon γ9d KO in whole brain and five out of six brain regions ...... 120 Figure 3.3 Detection of a Tm4 associated product in mouse brain…………………..122
Figure 4.1 Tropomyosin isoforms produced from the δTm gene ...... 129 Figure 4.2 Western blotting with the WD4/9d antibody detects the Tm4 associated product in adult and embryo mouse brain ...... 135
xvii
Figure 4.3.1 Initial 2D gel electrophoresis: WD4/9d Western blot, and Coomassie and SYPRO stained gels of mouse brain lysate ...... 136 Figure 4.3.2 Spot choice from 2D gel electrophoresis and WD4/9d Western blot of mouse brain lysate for sequencing by MALDI mass spectrometry ...... 137 Figure 4.4 Heat treatment does not eliminate Tm4 associated product in mouse brain lysate ...... 141 Figure 4.5 DNA denaturing acrylamide gel eliminates the presence of the upper band in PCR reactions of mouse cerebellum Tm4 ...... 143 Figure 4.6 The Tm4 associated product is immunoprecipitated by the WD4/9d antibody in mouse brain lysate ...... 145 Figure 4.7 Immunoprecipitation with the WD4/9d antibody does not yield sufficient protein for sequencing by MALDI ...... 145 Figure 4.8.1 Collision induced dissociation fragmentation of peptides by LC-MS/MS results in N- and C-terminal ion series ...... 147 Figure 4.9 Protein expression ranges of Tm4 in nine different Tm4 overexpressing B35 clones...... 151 Figure 4.10 Tropomyosin levels in Tm4 overexpressing B35 clones ...... 153 Figure 4.11 Categories of B35 cell morphologies ...... 157 Figure 4.12 High levels of Tm4 overexpression induce neurite outgrowth ...... 159 Figure 4.13 Tm4 overexpression slows proliferation in B35 cells ...... 161
Figure 5.1 Overexpression of tropomyosin isoforms TmBr1, TmBr2, TmBr3, and Tm4 each promote neurite outgrowth in uninduced cells ...... 174 Figure 5.2 Phenotypes of uninduced Tm5NM1 overexpressing B35s vary with clone 175 Figure 5.3 Tm4 and TmBr3 overexpression each result in increased numbers of primary neurites per cell ...... 177 Figure 5.4 Tm4 and TmBr3 overexpression each result in increased branching ...... 178 Figure 5.6 Tropomyosins impact on cell morphology of induced B35 cells in an isoform specific manner ...... 180 Figure 5.8 ADF/cofilin phosphorylation is influenced by Tm overexpression in uninduced B35 cells in an isoform dependent manner ...... 190 Figure 5.9.1 Flow cytometry cell cycle analysis of uninduced Tm4, TmBr2 and control cell samples ...... 193 Figure 5.9.2 Flow cytometry cell cycle analysis of 24 hours induced Tm4, TmBr2 and control cell samples ...... 194 Figure 5.9.3 Flow cytometry cell cycle analysis of 48 hours induced Tm4, TmBr2 and control cell samples ...... 195
xviii
List of Tables:
Table 2.1.1: Equipment and manufacturers ...... 60 Table 2.1.1: Equipment and manufacturers (continued) ...... 61 Table 2.1.2: Commercially available reagents and kits ...... 62 Table 2.1.2: Commercially available reagents and kits (continued) ...... 63 Table 2.1.3: Composition of buffers and solutions ...... 64 Table 2.1.3: Composition of buffers and solutions (continued)...... 65 Table 2.2: SDS-PAGE gels for tropomyosin: 12.5% low bis-acrylamide ...... 71 Table 2.3.1: Primary antibodies: Western blotting ...... 75 Table 2.3.1: Primary antibodies: Western blotting (continued) ...... 76 Table 2.3.2: Secondary antibodies: Western blotting ...... 76 Table 2.4.1: Primary antibodies: immunofluorescence ...... 82 Table 2.4.2: Secondary antibodies: immunofluorescence...... 83 Table 2.5.1: Molecular biology enzymes and buffers ...... 95 Table 2.5.2: Primers for rat cDNA amplification by PCR ...... 96 Table 2.6.1: Plasmid vectors ...... 99 Table 2.6.2: Primers for sequencing pGEM-T/Tm4 ...... 99 Table 2.6.3: Primers for DNA sequencing of rat Tm4 in PG307...... 102 Table 2.6.4: Primers for amplification of internal mouse Tm4 fragment ...... 104
Table 4.1: Summary of the proteins identified by MALDI mass spectrometry...... 138
Table 5.1 Autobias correction values for iTRAQ labeled TmBr2, TmBr3, Tm4 and Tm5NM1 samples relative to control samples ...... 185 Table 5.2 Tropomyosins differently alter the expression of other cytoskeletal related proteins ...... 188
xix
Chapter 1: Introduction
1
1. Chapter 1: Introduction
1.1. Actin
The cytoskeleton regulates cellular structure and is involved in a range of functions including cell motility, cytokinesis, intracellular transport, vesicle formation and membrane organisation. Actin is a core component of the cytoskeleton. Understanding the regulation of actin is crucial for understanding a multitude of cellular functions, including neuronal morphogenesis and differentiation.
Of the six isoforms of mammalian actin, four are present within the contractile muscle apparatus (one in heart, one in skeletal muscle and two in smooth muscle), and two (β- and
γ-actin) contribute to the cytoskeleton (Herman, 1993). The β- and γ-actin isoforms differ by four amino terminal amino acids (Vandekerckhove and Weber, 1978a), but have differing 3'UTR sequences (Erba et al., 1986). The mRNA of these two cytoskeletal isoforms are differently distributed, with β-actin enriched in the motility related membrane ruffling edges and filopodia in myoblasts (Hill and Gunning, 1993), and in the cell processes of osteoblasts (Watanabe et al., 1998), and γ-actin enriched in perinuclear domains of both cell types (Hill and Gunning, 1993). In neurons, β-actin protein is enriched within filopodia of developing axons and dendrites, and both protein and mRNA are enriched within growth cones, whereas γ-actin protein and mRNA are more uniformly distributed throughout the cell (Bassell et al., 1998). Differing functions of cytoskeletal actin isoforms are evident also; overexpression of β-actin increased cell surface area, and overexpression of γ-actin decreased cell surface area in myoblasts (Schevzov et al., 1992).
Studies of the divergent functions of β- and γ-actin indicate generally a greater role of β- 2 actin in motility, reflected by its localisation in motile structures- protrusions, filopodia, lamellae, growth cones, and at the leading edge of motile cells (see Tondeleir et al., 2009 for review). The smallest subunit of actin is a globular monomer weighing 42kDa
(Vandekerckhove and Weber, 1978b) consisting of a single polypeptide chain of 375 amino acids (Collins and Elzinga, 1975; Vandekerckhove and Weber, 1978b). These actin monomers can organise head-to-tail in polarity to produce actin filaments –double helical polymers of 13 actin monomers per 6 turns, with filaments between 90 and 100 Å in diameter (Egelman, 1985; Holmes et al., 1990).
Actin monomers can polymerise to form actin filaments in a reversible process. Actin filaments are polarised, with one end favoured for actin monomer association (the barbed end) and one end favoured for dissociation (the pointed end). While actin monomers can also associate with the pointed end, it is more likely they will be dissociating from this end, and contributing to a pool of actin monomers which are again free to associate at the barbed end. Actin monomers each have four subdomains which surround a cleft that binds adenosine tri-phosphate (ATP) or adenosine di-phosphate (ADP) (Korn, 1982; Korn et al.,
1987; Straub and Feuer, 1989). Actin-ATP is more likely to associate to the barbed end in filament elongation, and whilst the monomer is incorporated in the filament, the bound
ATP is hydrolysed, leaving the third phosphate (Pi) still associated with adenosine, and forming actin-ADP-Pi (Korn et al., 1987). Thus the state of ATP or ADP-Pi bound to the actin monomer can act as an indicator of the age of the filament. ATP hydrolysis is more likely the longer monomer is in association with the filament, and actin-ADP-Pi is a relatively long-lived state in the filament. The final Pi dissociation forms actin-ADP which
3 preferentially dissociates from the pointed end (Korn et al., 1987) (See Figure 1.1). In this way, a single actin monomer can treadmill through a filament – by initially associating at its barbed end (as actin-ATP), moving through the filament and being hydrolysed (forming actin ATP-Pi), finally losing the Pi phosphate group (forming actin-ADP), dissociating from the filament at the pointed end, joining a pool of actin monomers and undergoing
ADP-ATP exchange before re-associating (as actin-ATP) with the barbed end of the actin filament. Polymerisation and depolymerisation of actin filaments is driven in part by ATP hydrolysis and phosphate dissociation from actin monomers. Actin-binding proteins (ABP) can further alter filament dynamics by altering, for example, the rate of exchange of ATP and ADP.
4
Figure 1.1 Actin polymerisation and depolymerisation
Figure 1.1. Actin monomers bound to the nucleotide ATP (actin-ATP) are favoured for joining the actin filament at the barbed end. Monomers within the actin filament quickly have their nucleotides hydrolysed, forming actin-ADP-Pi, which still remain polymerised in the actin filament. The final dissociation of the Pi group leaves actin-ADP, a monomer which rapidly depolymerises from the pointed end of the actin filament. These actin-ADP monomers join the local pool of free monomers, and after ADP-ATP exchange are again actin-ATP, and capable of reassociating with the barbed end of the actin filament. 5
Individual actin filaments can nucleate branch points along their length. In addition, actin filaments are capable of interacting with each other. These interactions can result in meshworks (arrangements of actin filaments at opposing angles) and bundles (many actin filaments in approximately parallel and/or antiparallel arrangements). These structures can combine in such architecture as to form higher order structures: varied arrangements of actin filaments, meshworks and bundles, which produce integrated structural regions within the cell (see Pak et al., 2008 for further explanation). It is the ability of actin to move between monomeric and filamentous forms, and its capacity to form filamentous and higher order structures (see Figure 1.2), that allows actin involvement in many diverse functions within the cell. The cycling of actin between its many forms is regulated by a host of ABPs.
One family of proteins which attenuates the relationships between actin and ABPs are the tropomyosins.
6
Figure 1.2. The organisation of actin filaments
Figure 1.2. Individual actin filaments (a) are capable of organizing into a number of structures, including bundles (b); individual actin filaments are also capable of branching (c), and individual filaments can organise at opposing angles to form meshworks (d). These structures can be found in close proximity in the cell – such as meshworks being directly adjacent to bundles (e), a situation found, for example, in the interface between the meshwork of lamellipodia and the bundled filaments of filopodia.
7
1.2. Tropomyosin
Tropomyosins (Tm) are α-helical coiled-coil proteins (Millward and Woods, 1970), found in both muscle and non-muscle cells (Pittenger et al., 1994). Within muscles Tms (together with troponin) form calcium regulatory switches which help regulate contraction. Within the cytoskeleton, Tms insert along the α-helical groove of the actin filament, and regulate the access of other ABPs to the filaments (see Gunning et al., 2005 for review). In total, more than 40 isoforms of Tm have been discovered. This isoform diversity is due to three factors. Tms are products of four different genes, the αTm, βTm, γTm, and δTm genes
(equivalent to the TPM1, TPM2, TPM3 and TPM4 genes respectively) (Pittenger et al.,
1994). From each of these genes, some product variation is due to different promoters which lead to the use of different exons (1a or 1b), and multiple protein isoforms are generated from the αTm, βTm, and γTm genes by alternative splicing (Cooley and
Bergtrom, 2001; Dufour et al., 1998b; Wang and Rubenstein, 1992). This alternative splicing is achieved through a mutually exclusive choice of two internal exons (6a and 6b), and three alternative carboxy-terminal exons (9a, 9c, and 9d) (See Figure 1.3) (Dufour et al., 1998b). Different Tm isoforms differ in their actin binding strengths and their effects on the actin filament (e.g. Bryce et al., 2003; Gunning et al., 2005; Matsumura and
Yamashiro-Matsumura, 1985). The functional diversity of actin filaments is in part due to
Tm isoform diversity – Tms can differentially regulate the availability of actin to a range of
ABPs and their effects, and they can in this way define functionally distinct populations of actin filaments in the cell. Tms also each have distinct spatial and developmental
8 distributions, thus regulating these different pools of actin in space (at the level of tissue, cell and subcellular domains) and time (throughout the development of the individual, and also throughout the shorter time scales of individual cellular processes). In reviewing the various Tms and their functions, this chapter will focus on those isoforms found in brain.
1.3. Developmental regulation of tropomysoin isoforms in brain
Isoforms from the mammalian αTm, γTm and δTm genes are expressed in brain. Of these three genes, the γTm gene contributes the largest number of Tm isoforms in brain. The mRNA of at least 10 different isoforms arising from the choice of different exons (C- terminal exon 9a,9c, or 9d, and internal exon 6a or 6b) of the γTm gene have been detected in brain (Dufour et al., 1998b) (Figure 1.3). From the αTm gene, the isoforms TmBr1 and
TmBr3 (Schevzov et al., 2005b), TmBr2 (Hannan et al., 1995) and Tm5a and Tm5b
(Weinberger et al., 1993) are also found in brain. The single known low molecular weight
(LMW) product of the mammalian δTm gene, Tm4, is also found throughout rat and mouse brain (Had et al., 1994; Schevzov et al., 2005b). While the βTm gene product Tm1 (Had et al., 1994), and possibly the αTm gene product Tm2 (Nicholson-Flynn et al., 1996; Stamm et al., 1993) are also expressed in brain, their presence and distributions in neurons is not as yet described, and so will not be further discussed in this chapter.
9
Figure 1.3 Mammalian tropomyosin isoforms found in neurons
Figure 1.3 The mammalian Tm isoforms detected in neurons are derived from the αTm, γTm and δTm genes. Alternative splicing can give rise to multiple products from a single gene (figure after Gunning et al., 2005). Note that only those isoforms discussed in detail in this chapter are illustrated in this figure.
10
The following is a discussion on the expression of products from the αTm, γTm and δTm genes in neurons and brain. The use of different experimental systems with regards to 1) complexity of the model (e.g. in vitro vs. in vivo), 2) species (e.g. mouse vs. rat), 3) anatomically distinct regions (e.g. cerebellum vs. whole brain), 4) different developmental times (e.g. embryonal vs. postnatal), and 5) variables of measurement (e.g. mRNA vs. protein), render the task of compiling a composite picture of developmental regulation of
Tms challenging. A further confounding factor is the presence of various Tms within non- neuronal cells, including astrocytes and oligodendrocytes, which can influence some protein measures in neuronal cultures and in brain. For these reasons, we have tried to be explicit about the experimental systems used in each of the studies in this chapter, so as to be mindful that these systems are not necessarily equivalent.
1.3.1. Neuronal maturation and differentiation
Development is associated with changes in Tm expression and distribution across regions in brain, and also changes in the neuronal expression and subcellular distributions of Tm isoforms. We here explore the regional and subcellular shifts in localisation, and the expression changes of different Tms, throughout brain and neuronal development. In fact, defining the nature of “maturational change”, and defining the point at which a neuron is no longer immature, is no simple task. While neurons throughout the brain develop at different time points in the lifetime of the individual, there are some general principles we can use to categorise the maturational state. Throughout the literature discussed below, there are some recurring ideas as to what constitutes a mature versus an immature neuron. Generally, the
11 emergence of neurites, and the initial non-polarisation of these neurites are considered
“immature” stage characteristics, as are the presence of growth cones – the dynamic, distal regions of neurites which sample the environment in search of synaptic targets. Maturation brings the replacement of growth cones by well-formed synapses, and subsequent arrangement of axons and dendrites and their synapses with surrounding neurons. Those variables of neurite polarisation, growth cone loss, synapse formation and persistence with surrounding cells are here considered to be defining characteristics of a mature neuron. The expression of a specific repertoire of Tm isoforms at various stages of development, and in various structures of developing (immature) and developed (mature) neurons (e.g. the axon shaft) is subject to complex regulation. For clarity, the different Tm isoforms will initially be considered separately. The exon compositions of only those Tm isoforms covered in this chapter (listed in Section 1.4) are illustrated in Figure 1.3.
1.4. Neuronally expressed tropomyosin isoforms
The distribution and regulation of Tm is highly isoform-specific. A summary of distributions in immature and mature neurons of the Tmisoforms discussed in this section is given in Figure 1.4.
12
Figure 1.4. Developmental profiles of tropomyosin localisation in neurons
13
Figure 1.4. The developmental expression profiles of neuronal Tms. Colours indicate protein, black horizontal stripes indicate mRNA distribution. Note that these diagrams provide only a general overview, and do not portray some more specific nuances of isoform-specific distributions discussed in the text. Isoforms are listed in the order they are discussed in Section 1.2. “References” indicate the following publications: 1: (Hannan et al., 1995), 2: (Hannan et al., 1998), 3: (Bryce et al., 2003), 4: (Schevzov et al., 2005a), 5: (Dufour et al., 1998b), 6: (Vrhovski et al., 2003), 7: (Weinberger et al., 1996), 8: (Had et al., 1994), 9: (Schevzov et al., 1997). The two toned coloring of Tm5NM1 in mature neurons reflects the restricted localisation of the endogenous (yellow) protein versus the more extensive distribution of the exogenous human Tm5NM1 (orange) (Bryce et al., 2003; Schevzov et al., 2005a). Note that the distributions of Tm5NM1 and Tm5NM2 mRNA in immature neurons are identical, as the probe used in these studies could not distinguish between the two isoforms. Not shown is the dynamic shift in Tm5NM1/2 mRNA throughout differentiation where there is initial movement from the cell body into the axonal shaft, and a later recession into the cell body as occurs in the mature neuron (Hannan et al., 1995) (see Sections 1.4.1.1 and 2 of the text for details). The question marks (?) refer to localisations of exon 9c and 9a (γTm gene) products in immature neurons, and Tm5a/5b in mature neurons, which are yet to be determined.
1.4.1. The γTm gene: diverse isoforms, diverse functions?
The γTm gene produces at least 10 non-muscle isoforms in rat brain. These isoforms are produced through alternative use of internal exons 6a and 6b and C-terminal exons 9a, 9c, and 9d. The γTm gene isoforms are differentially regulated throughout development in rat brain. While no two of the γTm gene isoforms are identically regulated in rat brain development, there appears to be a switch in mRNA in rat whole brain from isoform products containing internal exon 6a (Tm5NM1, 5, 8, 10, 11) in embryonal stages, to isoform products containing internal exon 6b (Tm5NM2, 3, 4, 6, 9) in mature stages
(Dufour et al., 1998b). Similarly, proteins from the γTm gene containing C-terminal exon
9a, 9c, or 9d are differently regulated throughout development in mouse brain (Vrhovski et
14 al., 2003). Non-muscle protein products from γTm gene exons 9a and 9c are found at embryonic days (ED) 11.5 and ED15.5 respectively, and both increase in their expression into adulthood (Vrhovski et al., 2003). The products containing γTm gene exon 9d, however, are present in brain at ED11.5, and then increase until birth at which time they decrease dramatically postnatally to lower adult levels in rat (Weinberger et al., 1996) and mouse brain (Vrhovski et al., 2003).
This complementary expression of the different C-terminal exons (9a, 9c and 9d) of the
γTm gene ensures that the net pool of γTm gene proteins in mouse brain is relatively constant throughout development (Vrhovski et al., 2003). On the basis of these temporal changes in expression, Vrhovski et al (2003) hypothesise that 9d expression is associated with early brain development and axon outgrowth, whereas 9a and 9c expression are associated with later maturational changes.
1.4.1.1. Exon 9d products from the γTm gene: Tm5NM1 and Tm5NM2 isoforms
Early analyses with a particular antibody to exon 9d, the WS5/9d antibody, suggested certain neuronal distributions of Tm5NM1 and Tm5NM2 proteins. The following section will describe these distributions as they were reported, and then discuss the reasons why they need to be re-examined.
15
1.4.1.2. Exon 9d isoforms as detected by the WS5/9d antibody
Within embryonal immature neurons, the exon 9d-containing isoforms Tm5NM1 and
Tm5NM2 proteins have been located predominantly within the axonal compartment. This has been demonstrated in vivo in the rat embryonic (ED13) nervous system: Tm5NM1/2 proteins localised to axons within the spinal cord, tectum, and dorsal root ganglia (DRG)
(Weinberger et al., 1996). Even with unipolarity, day ED13 DRG cells localised
Tm5NM1/2 throughout the length of the axons, and the protein was absent from the cell body (Hannan et al., 1998). Observations on Tm5NM1/2 distribution in ED14.5 mouse embryonal primary cultured neurons indicated that these isoforms were abundant in the cell body and primary neurite, but invariably absent from growth cones (Schevzov et al., 1997).
Throughout maturation, the neuronal subcellular localisation of Tm5NM1/2 shifted. Within a two day period (ED15 to ED17), Tm5NM1/2 were lost from axons in the rat medulla and appeared within neuronal cell bodies (Weinberger et al., 1996). A similar shift in localisation was seen in primary mouse cortical cells, with Tm5NM1/2 protein being initially within the axons, and then relocated to the cell body and all neurites (axons and dendrites) post differentiation (Hannan et al., 1995). In adult rat and mouse cerebellum,
Tm5NM1/2 protein was confined to the cell soma and dendrites of Purkinje neurons
(Dufour et al., 1998b; Hannan et al., 1998; Vrhovski et al., 2003) but was absent from granule cell bodies (Vrhovski et al., 2003; Weinberger et al., 1996).
These conclusions were all drawn from the use of the WS5/9d antibody. Although the
16
WS5/9d antibody was raised to exon 9d of the γTm gene, it lacks immunoreactivity with the Tm5NM1 isoform (Percival et al., 2004 show none; Schevzov et al., 1997 show only weak reactivity with the Tm5NM1 protein), which would imply that studies using this antibody are reporting Tm5NM2 localisation only. Under this assumption, Tm5NM2 protein would generally localize to the axons of developing neurons, then shift to the somatodendritic compartment during development. Unfortunately, in the absence of a positive control for the immunoreactivity and specificity of WS5/9d with Tm5NM2, questions as to its specificity have been raised, and the use of this antibody has been discontinued. Hereafter this review instead considers the mRNA localisations of these isoforms, and the patterns of protein localisation revealed by verified antibodies raised to the γTm gene 9d exon as representing the distribution of Tm5NM1 and Tm5NM2. In those cases where probes against the 9d exon, either RNA or antibody, are unable to distinguish between Tm5NM1 and Tm5NM2 isoforms, they will be referred to as Tm5NM1/2.
In primary cultured mouse neurons, Tm5NM1/2 mRNA changes in distribution with the development of the neuron. By day two in culture, mRNA is found in the cell body in a polarised distribution, with enrichment at the base of a single neurite presumed as the precursor to the axon. By day seven in culture, Tm5NM1/2 mRNA is localised within cell bodies and axons, and by day 14 in culture, the mRNA is restricted to the cell body
(Hannan et al., 1995). Similarly, Tm5NM1/2 mRNA in neurons of developing embryonic brain is directed towards the axonal pole, even before the outgrowth of neurites (Hannan et al., 1995). And, in mature rat cerebellum, the Tm5NM1/2 mRNA is localised within the cell bodies of developed Purkinje neurons (Hannan et al., 1998).
17
The localisation of Tm5NM1/2 mRNA to axons in developing neurons indicates a function associated with neuronal polarity during neuronal differentiation. This is further supported by studies of differentiating PC12 cells, which localise Tm5NM1/2 mRNA uniformly throughout the cell body, without polarity in mRNA distribution, consistent with the lack in polarity of these cells (Hannan et al., 1995). Conversely, DRG neurons (which are unipolar and develop neurites into axons only) express Tm5NM1/2 mRNA at the axonal poles
(Hannan et al., 1998).
The developmental regulation of Tm5NM1/2 mRNA in polarised cells has been further investigated in embryonic rat brain. In cells of the hippocampus and basal ganglia, which are proximal to the ventricle and thought to be younger and less developmentally advanced,
Tm5NM1/2 mRNA localised to the axonal pole. In cells more developmentally advanced in layers more distal to the ventricle, Tm5NM1/2 mRNA localised to the cell body (Hannan et al., 1995). Despite these differences, analyzing different regions of brain at one developmental time point may reflect intrinsic physiological differences between these layers affecting Tm5NM1/2 distribution, rather than accurately reflecting how Tm5NM1/2 distribution changes with differentiation.
Tm5NM1/2 mRNA localisation is not a universal marker of early neuronal polarity. Not all primary mouse cultured neurons localise Tm5NM1/2 mRNA to the axon, not all
Tm5NM1/2 mRNA stained neurites are axons, and not all neurons in vivo express
Tm5NM1 or 2 (Hannan et al., 1995). Evidence as to the differential protein localisation of
18
Tm5NM1 versus 2 comes from overexpression studies. Human Tm5NM1 (hTm5NM1) differs from its mouse homologue by only one amino acid and is likely to be very similar to the endogenous protein in its physical property and subcellular distribution. In transgenic mice which overexpress exogenous hTm5NM1, the specific distribution of hTm5NM1 can be mapped through different antibodies which together can distinguish between hTm5NM1 and mouse Tm5NM1. In primary cortical neurons cultured from hTm5NM1 transgenic mice (by day five in culture), hTm5NM1 localised to the peripheral regions of the growth cone and the filopodia (Bryce et al., 2003; Schevzov et al., 2005a). If we assume the localisation of endogenous Tm5NM1 is the same as this, and compare this to the localisation of total exon 9d protein (detected by the γ9d antibody), then the remaining localisation besides this growth cone/filopodia distribution would be representative of
Tm5NM2 distribution only. Under these assumptions, Tm5NM2 protein is found in the axon shaft (Schevzov et al., 2005a). In adult transgenic mice hTm5NM1 was detected in the cell bodies and dendrites of the cortex (Bryce et al., 2003), however further investigation is required to determine if endogenous Tm5NM1 is in these same regions.
In summary, these studies indicate that Tm5NM1 in developing neurons is most probably enriched in the growth cones, while Tm5NM2 is within the proximal developing axon shaft and the axonal pole of the cell body. During differentiation, Tm5NM1 relocates to the cell body, so that differentiated cells express only Tm5NM2 in the axon (See Figure 1.4). In addition, Tm5NM1 in differentiated neurons may also localise to dendrites. Together these studies indicate that Tm5NM2 is associated specifically with the establishment and development of immature axons, whereas Tm5NM1 is associated with neurite outgrowth
19 via involvement in the growth cone, and possibly in dendritic function of mature neurons. It would appear that Tm5NM2 mRNA expression is only required in the early stage of axon development; once differentiation is complete, mRNA can shift from the axon to a uniform cell body distribution. The possible functions of Tm5NM1 are discussed in the growth cone
(Section 1.6) and synapse sections (Section 1.7) of this chapter.
1.4.1.3. The exon 9c products from the γTm gene: a contrast to 9d products
Exon 9c of the γTm gene encodes two isoforms, Tm5NM4 and Tm5NM7, which are specific to brain (Vrhovski et al., 2003). Tm5NM4/7 proteins are expressed in mouse brain starting as early as ED15.5, and levels increase through to adulthood. On a subcellular level these isoforms are widespread throughout cell bodies and dendrites in mature neurons of the mouse hippocampus, cortex and cerebellum; in the axons of the cortex, and in the adult cerebellum throughout the molecular layer, further indicating an axonal distribution
(Vrhovski et al., 2003); and in the Purkinje cell bodies and axons of the molecular layer of adult rat cerebellum (Dufour et al., 1998a). Together these studies indicate that exon 9c products can localise to dendritic, axonal and cell body compartments in a region dependent manner. It is important to note that the antibody used by Vrhovksi and others (2003) has since been shown to cross-react with the αTm gene products, TmBr1 and TmBr3
(Schevzov et al., 2005b). However, the distributions of TmBr1 and 3 are mainly in the axonal shaft of developed neurons (as discussed in Section 1.4.2.2), suggesting that the reported distributions of exon 9c products in the cell body and dendrites of mature neurons may be a true representation of their location and not due to cross-reactivity. The presence 20 of the exon 9c products in axons of the mature cortex and in the molecular layer of the mature cerebellum is less certain due to this cross-reactivity, and requires further confirmation.
1.4.1.4. Exon 9a products from the γTm gene
Isoforms containing exon 9a (Tm5NM3, 5, 6, 8, 9,and 11) (Dufour et al., 1998b) are abundant in brain, lung, and spleen, and at lower levels in the kidney, liver, and embryonic primary fibroblasts (Schevzov et al., 2005b). Exon 9a isoforms are found in all brain regions, and whole brain levels increase from ED15.5 to adulthood in mouse (Vrhovski et al., 2003). The subcellular distribution of exon 9a protein products is similar to exon 9c- containing protein products: throughout Purkinje cell bodies and dendrites, and within axons of the molecular layer in the mature mouse cerebellum, and also within cell bodies, dendrites and axons of neurons in cortex and pyramidal cells in the hippocampus (Figure
1.4). Although exon 9c and exon 9a products have similar distributions (see Figure 1.4), exon 9c-containing proteins are found more intensely in the cell body. In general, the distribution of exon 9a- and 9c-containing isoforms in mouse do not undergo any major shift from postnatal day five (PND5) through to adulthood (Vrhovski et al., 2003).
1.4.1.5. Summary: γTm gene products in brain: exons 9a, 9c and 9d
The γTm gene products containing exon 9d change in their predominant subcellular localisations during neuronal differentiation – Tm5NM1 is initially in the growth cone and
Tm5NM2 in the axon, and both isoforms shift to the cell body during maturation. Together these developmental shifts in localisation indicate roles in neuronal differentiation and
21 axonal outgrowth. Conversely, exon 9a and 9c containing products from the γTm gene have wider distributions throughout cell bodies, axons and dendrites, in patterns of expression that do not measurably change with development. It is therefore evident that different exons from the same gene, and different isoforms containing the same C-terminal exon, can be sorted to very different subcellular domains, and in the cases of Tm5NM1 and 2, these distributions can change with differentiation. Further evidence of the ability of different
Tms to define distinct actin filaments, and their implications for morphological processes associated with differentiation, can be found by examining the complementary expression patterns of other Tms in brain.
22
1.4.2. αTm gene products: TmBr1, TmBr2, TmBr3, Tm5a, and Tm5b
1.4.2.1. Regional expression in brain: TmBr1 and TmBr3
The αTm gene produces five isoforms in brain, two of which are brain specific: TmBr1 and
TmBr3. TmBr1 is a high molecular weight (HMW) Tm, and TmBr3 is a low molecular weight (LMW) Tm (Lees-Miller et al., 1990; Weinberger et al., 1993). TmBr2, another
LMW isoform produced by the αTm gene, was also hypothesised to be brain specific
(Lees-Miller et al., 1990), however, transcripts have since been found in fibroblasts
(Weinberger et al., 1993). The lack of specific antibodies to TmBr2 makes its protein distribution difficult to ascertain (see Section 1.4.2.5). In brain, TmBr3 is expressed at much greater levels than TmBr1 and TmBr2 (Lees-Miller et al., 1990; Stamm et al., 1993).
While TmBr3 protein levels are mainly equivalent throughout different regions of adult rat brain (Stamm et al., 1993), TmBr1 shows some regional variation in expression. Greater abundance of TmBr1 protein was detected in the cortex, hippocampus, striatum, olfactory bulb, and thalamus (areas of brain derived from the prosencephalon) than in the midbrain, cerebellum, spinal cord, and hindbrain, where TmBr1 was almost undetectable (Stamm et al., 1993; Vrhovski et al., 2003).
Unlike Tm5NM1 and 2, TmBr1 and TmBr3 isoform expression first appears in later developmental stages. TmBr3 protein first appears at ED16 in rat whole brain (Stamm et al., 1993), ED17 in rat medulla (Weinberger et al., 1996), and birth in mouse whole brain
(Vrhovski et al., 2003), whereas TmBr1 protein is not detected until PND5 (Vrhovski et al.,
2003). TmBr1 and TmBr3 protein levels both increase during postnatal rat brain development (Had et al., 1994; Stamm et al., 1993), with transcripts of both showing a 23 dramatic postnatal increase from PND0 - PND21 in rat cerebellum, to high adult levels of transcription of these isoforms (Weinberger et al., 1993). Similar to this mRNA profile, minor expression of TmBr3 protein is detected in rat cerebellum at PND0, followed by an increase until PND20 when levels begin to plateau (Had et al., 1994).
These investigations into the developmental regulation of TmBr3 expression in rat cerebellum and whole brain show that from relatively low levels at birth, protein and mRNA expression increases markedly, and remain relatively high in adulthood. The period of greatest increase in expression of these isoforms (between days PND0 and PND21) coincides with a period of intense neurite outgrowth and synaptogenesis in the rat cerebellum (Altman, 1972). It is possible that TmBr1 and TmBr3 contribute to the establishment of cerebellar neural networks. From PND6, the different layers of the cerebellum are well defined (Had et al., 1994), and so it would seem unlikely that the sole function of TmBr3 in the cerebellum is in differentiation to define these distinct organisational layers. As TmBr3 protein levels in rat whole brain (Stamm et al., 1993), mouse whole brain (Vrhovski et al., 2003), rat cerebellum (Had et al., 1994), and mRNA levels in rat cerebellum (Weinberger et al., 1993) are maintained in relatively high levels from PND20 into adulthood, this suggests that TmBr3 may be responsible for the maintenance of established neural networks in the cerebellum and other brain regions.
The possible roles of TmBr1, TmBr2 and TmBr3 in neurite outgrowth, and the genesis and persistence of the synapse, can be better understood by inspecting the localisation of these isoforms at a subcellular level. Where antibodies or RNA probes are unable to discriminate between the TmBr1 and TmBr3 isoforms, they are collectively termed TmBr1/3. 24
1.4.2.2. Neuronal distribution of TmBr1 and TmBr3: highly polarised
A primarily, if not entirely, axonal distribution of TmBr1 and TmBr3 is seen in different regions of embryonal and postnatal rat and mouse brain. In the rat medulla, TmBr1/3 protein first appears at ED17, localised to the axons (Weinberger et al., 1996). In the rat cerebellum however, protein levels are almost undetectable until PND10- PND14, when
TmBr1/3 appears gradually in the molecular layer and the cerebellar glomeruli of the internal granule layer (Had et al., 1994; Vrhovski et al., 2003). In fully developed (PND35) adult rat cerebellum, TmBr1/3 is present in the pre-synaptic web of cerebellar glomeruli, in the internal granule layer, and clearly in the axons (parallel fibres) of granule cells within the molecular layer (Had et al., 1994; Weinberger et al., 1996) with mildly detectable levels in the dendritic spines of this layer (Had et al., 1994). This predominantly pre-synaptic distribution is echoed in PND14 mouse hippocampus and cortex, where TmBr1/3 has a predominantly axonal distribution (Vrhovski et al., 2003). This illustrates a mainly pre- synaptic distribution of TmBr1/3 that occurs throughout development and persists into adulthood (see Figure 1.4). In immunofluorescence studies of developing chick cerebellum,
TmBr1/3 also appears between ED15 and ED17 in Purkinje cells, where it extends into both axons and dendrites. By hatch, the protein is no longer found around the cell body, although there is strong staining of the molecular layer that is densely packed with axons
(Weinberger et al., 1996). These studies indicate that ED17 is a critical period of actin filament reorganization within chick Purkinje cells, after which sorting and segregation of
TmBrl/3 into specific intracellular compartments occurs to produce an essentially adult distibution at hatch (Weinberger et al., 1996).
25
1.4.2.3. TmBr1: astrocyte or neuron specific?
Specific conclusions about the neuronal specificity of TmBr1 are hampered in part by problems of antibody specificity. To date the antibodies used recognise both TmBr1 and
TmBr3 isoforms, which only are distinguishable on a western blot due to their different molecular weights. Previously it was shown that TmBr1 mRNA was absent from embryonic rat primary neuronal cultures, but present in astrocyte cultures; whereas TmBr3 mRNA was found in these same neuronal cultures but not the astrocytes (Had et al., 1993).
On the basis of this, in 1994 Had and others reasoned that their antibody labeling of the
PND35 rat cerebellum reported TmBr3 localisation only (Had et al., 1994). Using an antibody raised to the 9c exon of the αTm gene (α9c, see Figure 1.3 for map), Western blotting of both adult rat whole brain lysate and mouse whole brain lysate reveals two bands – one consistent with the molecular weight of TmBr3, and another higher band consistent with TmBr1 molecular weight (Weinberger et al., 1996), although total protein estimates cannot distinguish between different cell types (neurons versus glia) within a brain lysate. There is some controversy surrounding the cell type specificity of TmBr1 either as astrocyte specific (Had et al., 1993) or neuron specific (Weinberger et al., 1993).
In fact, as the primary neuronal cultures used in these studies were harvested from animals no later than ED17, and as the TmBr1 protein is not detected before PND20 (Stamm et al.,
1993), it is impossible to use TmBr1 absence from these neuronal cultures as evidence to it being absent from neurons in vivo across all developmental time points. Furthermore, the cultures in which TmBr1 is absent are cortical neurons (Had et al., 1993), and may not represent the expression pattern of TmBr1 in other brain regions, such as cerebellum.
Because of this, and in the absence of other verifications of the cell types in which TmBr1 26 and 3 are expressed, it is prudent to assume that any localisation revealed by the antibody raised against exon 9c could be reporting the distribution of TmBr1, as well as (or instead of) TmBr3 distribution. Further evidence as to the questionable basis of mRNA levels as a reliable indicator of protein levels can be found in the work of Faivre-Sarrailh (1990) and others. The group found no expression of γTm gene transcripts in rat brain, however protein products (and also mRNA) from this gene have since then been consistently found in rat brain (see Gunning et al., 1998; Gunning et al., 2008 for reviews). In summary, the possibility that TmBr1 is expressed in both astrocytes (Had et al., 1993) and neurons
(Weinberger et al., 1993) cannot be discounted.
1.4.2.4. TmBr3: in the neurites as they extend
TmBr3 has been observed in a general distribution throughout the cell body and processes, without reference to neuronal polarity, in rat cortical and midbrain cultures, by Stamm
(1993) and others. This group confronted problems of antibody specificity in immunohistology by using neurons harvested from ED16 (earlier than the first detected
TmBr1 expression at PND20), and confirming TmBr1 protein was not detected in Western blots of these rat cortical and midbrain primary cultures (Stamm et al., 1993). Thus, the immunofluorescence staining of these neurons probably reflects the subcellular distribution of TmBr3, and not TmBr1. Investigation into a stable cell line, PC12 cells, has shown that differentiation and neurite outgrowth are required precursors to TmBr3 mRNA transcription (Weinberger et al., 1993). In their undifferentiated state, PC12 cells express undetectable levels of TmBr1 and TmBr3. These cells can be induced to differentiate into a quasi-neuronal phenotype lacking neurite polarity – this differentiation induces TmBr3
27 mRNA in these cells, with transcript level increases mirroring the induction of neurite outgrowth. When cells are forced to reverse morphological differentiation (achieved experimentally by transferring cells to suspension), the levels of TmBr3 progressively decrease (Weinberger et al., 1993).
In the case of PC12 cells, TmBr1/3 expression in vitro is correlated with morphological changes in neuronal differentiation. Expression persists once differentiation is complete, but requires the maintenance of those morphological characteristics of differentiation.
Induction of TmBr1 and TmBr3 expression in embryonic brain occurs in the developing neuron, at ED17, and persists predominantly in the axons of mature neurons(Weinberger et al., 1996). By at least PND10 TmBr1/3 appears pre-synaptically in rat and mouse cerebellum. In adult mouse and rat cerebellum, TmBr1/3 are found predominantly in the axons of Purkinje neurons (Weinberger et al., 1996), in the granule cell axons (parallel fibres) surrounding Purkinje dendrites (Had et al., 1994; Weinberger et al., 1996), and in areas of intense synaptic activity (within the cerebellar glomeruli of the internal granule layer) (Had et al., 1994; Vrhovski et al., 2003). These data point towards a possible enrichment of TmBr1/3 in the pre-synaptic terminals, an hypothesis which is now testable due to the resolving capabilities of current light micrcoscopy.
The persistence of TmBr1 and 3 transcription and translation in brain into adulthood
(Stamm et al., 1993; Weinberger et al., 1993) suggests a role of these isoforms in the maintenance of neural networks post differentiation. The localisation of TmBr3 pre- synaptically in cerebellum (Had et al., 1994) further implies a function in the plasticity of
28 these networks, perhaps at the level of actin filament remodelling for vesicle release and re- uptake at the synapse. The functional significance of TmBr1/3 is further discussed in the synapse section (Section 1.7) of this chapter.
1.4.2.5. TmBr2: uniform distribution
Had and others (1993) found TmBr2 mRNA transcripts were absent from cultured rat neurons. In a subsequent study, TmBr2 mRNA was found in mouse primary cortical neurons, and at ED13 in dorsal midbrain (Hannan et al., 1995). In contrast to TmBr3 (and possibly TmBr1), TmBr2 mRNA is distributed in a non-polarised, uniform fashion throughout the cell body of embryonic rat hindbrain neurons in vivo, and throughout primary mouse cortical neurons in vitro, in a distribution that does not change with development (Hannan et al., 1995) (see Figure 1.4). TmBr2 mRNA expression is present at the initiation of differentiation in PC12 cells and in contrast to TmBr1 and TmBr3 isoform levels, continues to increase even when cells are forced to lose their morphological characteristics of differentiation, such as neurite outgrowth (Weinberger et al., 1993).
1.4.2.6. Tm5a and 5b: in the growth cones
The levels of Tm5a and 5b mRNA in developing postnatal rat cerebellum remain mostly constant from high levels at birth, with an increase in expression from PND3 to PND7, and then a slight decline in levels to those seen in adult stages (Weinberger et al., 1993). Tm5a and 5b proteins are distributed throughout the cell body, axon, and growth cones of primary mouse embryonic cultured neurons (Schevzov et al., 1997). In the growth cones Tm5a and
Tm5b are detected in the proximal filopodia, which are the finger-like projections from the
29 growth cones which protrude into and sample the environment with rapid turnover of actin
(Schevzov et al., 1997). The localisation of Tm5a and Tm5b within the growth cone and proximal filopodia, however, recedes as the growth cone size diminishes with time in culture (see Figure 1.4). This localisation shift is accompanied with a reduction in protein levels. Interestingly, within a single growth cone, some but not all filopodia stain for Tm5a and 5b (Schevzov et al., 1997). Tm5a is entirely absent from the growth cone of mouse primary cortical neurons at day five in culture (Schevzov et al., 2005a). In PC12 cells,
Tm5a and Tm5b mRNAs are the most abundant αTm gene transcripts, are present when cells are entirely undifferentiated, and increase dramatically in early differentiation.
Additionally, when cells are forced to lose the morphological characteristics of differentiation, Tm5a and 5b mRNA levels also increase (Weinberger et al., 1993). This suggests that Tm5a and 5b may function in the rapid actin remodelling requirements of fast, large scale morphological changes. Additional to its neuronal profile, Tm5a mRNA is also found in glial cultures (Had et al., 1993). The functions of Tm5a are discussed in the growth cone (Section 1.6) and synapse (Section 1.7) sections of this chapter.
1.4.3. The δTm gene product Tm4
Tm4 is the only known LMW protein product of the mammalian δTm gene. Tm4 is found in a range of tissues, including brain. Tm4 mRNA has been found in cultures of astrocytes, oligodendrocytes, and neurons, with the highest transcription levels corresponding to the immature stages (after one day in culture) of neurons and astrocytes, and remaining constant throughout the development of oligodendrocytes (Had et al., 1993). Tm4 mRNA is more concentrated in embryonic than adult whole rat brain (Yamawaki-Kataoka and
30
Helfman, 1987). Tm4 protein is expressed at birth, and expression levels in rat cerebellum increase nearly tenfold from birth to a peak at PND10, which is followed by a rapid decrease to about half this level at PND14, then remaining constant throughout subsequent development into adulthood (Had et al., 1994). Tm4 mRNA shows much the same pattern as protein during rat cerebellum development (Faivre-Sarrailh et al., 1990), but the protein undergoes a more marked post-peak decrease. The antibody used for detection of Tm4 protein by Had and others (1994) is immunoreactive with the αTm gene isoform Tm1.
Because of this, immunofluorescence data using this antibody were confirmed by Tm1 peptide inhibition in order to specifically detect Tm4 localisation (Had et al., 1994). In neurons, the subcellular distribution of Tm4 changes with development. Cultured rat cortical neurons express Tm4 protein at one day in culture, and it remains in axonal and dendritic growth cones, cell bodies and neurites until at least six days in culture. In these growth cones, Tm4 co-localises with the proximal filopodia, but is not in the distal filopodial tips (Had et al., 1994). In cultured hippocampal rat neurons, both axonal and dendritic growth cones are enriched with Tm4 protein, regardless of the time at which these growth cones emerge in culture (Had et al., 1994).
Within the cerebellum, Tm4 protein was first detected at ED20, and immunoreactivity increased in intensity until birth, at which time the forming internal granule and molecular layers were immunoreactive, but quite notably, the organising Purkinje cell layer was not.
By PND6, Purkinje and granule cell bodies were still not labeled, but the axonal fibers within the internal granular layer (Purkinje cell axons, climbing and mossy fibres) contained Tm4 protein, as did the innermost meningeal layer (the pia mater), and the blood
31 vessels (Had et al., 1994). By PND10 Tm4 was in the Purkinje cell bodies and dendrites, but staining then decreased in intensity in all regions, such that by PND14, only diffuse staining remained in the molecular layer and the cerebellar glomeruli within the internal granule layer, a pattern which persisted into adulthood (PND35). Immuno-electron microscopy (EM) analyses of PND35 rat cerebellum revealed accumulation of Tm4 in the dendrite spines of Purkinje cells in the molecular layer, and especially at the post-synaptic densities of these spines. However, Tm4 was notably absent from the adjacent pre-synaptic parallel fibers (Had et al., 1994). This shift in the localisation of Tm4 from being enriched in the growth cones of axons and dendrites in immature neurons to post-synaptic sites in mature neurons (see Figure 1.4) represents a potentially substantive shift in function in response to the changing requirements of the neuron throughout differentiation.
Alternatively, Tm4 may be fulfilling the same functional requirement at different locations
(and different developmental stages) within the cell. Tm4 localisation within growth cones indicates a role in the motile events of neurite outgrowth, supported by its rapid increase in mRNA and protein levels between PND0 and PND10, which coincides with a time of great neurite motility when neurons in the developing cerebellum are seeking and finding targets to build a neural web. The persistence of Tm4 transcription and translation into adulthood, and later localisation to the post-synapse, tend to suggest an ongoing involvement in synaptic plasticity (Had et al., 1994). The possible functions of Tm4 are further discussed in the growth cone (Section 1.6) and synapse (Section 1.7) sections of this chapter.
32
1.4.4. Summary: neuronally expressed tropomyosins: isoform-specific regulation
Throughout differentiation, the expression of Tms in neurons changes in a highly isoform- specific fashion, as illustrated by comparing the distributions of all Tms within immature and mature neurons (see Figure 1.4). The possible functions of each Tm isoform discussed in this section will be explored in relation to two specific neuronal compartments – the growth cones and synapses. To better explore why Tms are expressed at different developmental stages, and at different places within the neuron, we will briefly review the functions of those actin binding proteins (ABP) which are associated with these isoforms.
1.5. Actin binding proteins and tropomyosins
The sheer diversity of Tm isoforms in mammals, and the isoform-specific patterns of localisation throughout different tissues, cells, and subcellular compartments, indicate the divergent functions of isoforms in vivo. The mechanisms by which actin filaments are regulated by Tms hinge on two general factors: 1) the different abilities of Tms to interact with other ABPs and 2) the different affinities that Tm isoforms have with actin. The second factor also means that Tm isoforms can affect the access of other ABPs to the actin filament, and in doing so can differently influence the structural outcome of actin filaments.
Tms can augment the interactions between actin and ABPs in a highly isoform-specific manner. The next section is a short overview of established functions of some of those
ABPs expressed in neurons. Some of these ABPs have been shown to interact, either directly or indirectly, with certain Tm isoforms. The implications of these ABP-Tm interactions will be further discussed in the growth cone (Section 1.6) and synapse (Section
33
1.7) sections of this chapter.
1.5.1. Arp2/3
The actin-related protein2/3 (Arp2/3) complex is an actin filament nucleator which can initiate lateral branching from already existing filaments, with these new daughter filaments elongating from the barbed ends (Mullins et al., 1998). Additionally, Arp2/3 may prevent the addition of monomers to the pointed end of filaments (Mullins et al., 1998) and also inhibit the depolymerisation of actin filaments from their pointed ends (Svitkina and
Borisy, 1999). Arp2/3 requires activation to nucleate these branches, and WASP/Scar proteins are prominent in activating this nucleation. In turn, the activity of the WASP/Scar proteins is regulated by various Rho-GTPases (see Higgs and Pollard, 2001 for review).
Generally, lamellipodia are composed of a diagonal meshwork of actin filaments
(Verkhovsky et al., 2003), with barbed ends of these filaments found closest to the leading edge (Svitkina et al., 1997), and Arp2/3 found at the branching points of these filaments
(Korobova and Svitkina, 2008; Svitkina and Borisy, 1999). These studies suggest a role for
Arp2/3 in actin filament assembly which drives protrusion at the leading edge. Aside from roles in the lamellipodial actin network, Arp2/3 may also contribute to filopodial formation, as filaments originating from branching points can then join an actin bundle within filopodia (Korobova and Svitkina, 2008).
Tms can inhibit the Arp2/3 mediated branching of actin filaments. The αTm gene products
Tm2 and Tm5a can each reduce the rate of branching by WASP stimulated Arp2/3, although neither Tm isoform can eliminate this branching, even when present in concentrations which saturate the actin filament (Blanchoin et al., 2001). Tm5a is the more
34 effective of these two Tms, and can reduce Arp2/3-mediated branching events by 50%
(Blanchoin et al., 2001). Such an interaction has implications for leading edge structures and filopodia in neurons.
1.5.2. Formins
The formins are an extensive family of proteins. Their roles within cells are isoform- specific, and include nucleation of new actin filaments, modulating the rate of elongation at the fast-growing barbed end (by attenuating profilin-actin assembly onto the filament), organising multiple actin filaments into bundles, and even severing actin filaments (see
Kovar, 2006 for review). Additionally, formins are thought to exist as heterodimers with the potential of having opposing effects on the actin filament – either enhancing polymerisation (elongation) or depolymerisation (dissociation) at the barbed end, depending on their conformational states (Otomo et al., 2005). Some formin isoforms can also inhibit elongation at the barbed end by capping the filament (see Wallar and Alberts,
2003 for further description). At least two neuronally expressed mouse formins, mDia1 and mDia2, are inhibited in this capacity by Tms in an isoform-specific manner (Wawro et al.,
2007). While Tm5a almost completely overcomes the inhibition of elongation by the formin construct FRL1-FH1FH2, it has little effect on the inhibition exerted by mDia2.
Conversely, Tm5a can stimulate elongation, but this is significantly reduced in the presence of FRL1-FH1FH2 (Wawro et al., 2007). Some formins can also bind to the sides of actin filaments, a process implicated in both filament bundling and severing (see Wallar and
Alberts, 2003 for review), and Tm isoforms can also inhibit this side-binding process
(Wawro et al., 2007). These particular formins, however, are yet to be located to neurons.
35
Tms can exert their influence on formins without displacing them from the filament
(Ujfalusi et al., 2008; Wawro et al., 2007). In fact, the synergistic model of simultaneous
Tm-formin association with the actin filament predicts a stable, straight filament, which is protected from severing (Ujfalusi et al., 2008; Wawro et al., 2007). Recently, studies in fission yeast have illuminated a fundamental relationship between formins and Tms. During mitosis, yeast fission formin (Cdc12) nucleates the growth of actin filaments that associate with Tm (Cdc8) and undergo rapid elongation (Kovar et al., 2011; Skau et al., 2009). This recruitment of Tm by formin to the actin filament is one mechanism by which Tms themselves are spatially regulated in mammalian cells also.
1.5.3. ADF/Cofilin
Actin-depolymerising factor (ADF)/cofilin family members exert a range of effects on the actin filament. Here discussed will be those effects which are known to be altered by Tms, which include 1) the depolymerisation of actin filaments by enhancing the rate of monomer dissociation from pointed ends, 2) the inhibition of depolymerisation at barbed ends of filaments and 3) the reduction of filament lengths and the increase in filament numbers by conferring an instability on actin filaments via increasing their chances of severing
(Andrianantoandro and Pollard, 2006; Kuhn and Bamburg, 2008). ADF/cofilin activity is regulated by phosphorylation: ADF/cofilin is active in its dephosphorylated form, and
ADF/cofilin not bound to actin filaments is typically inactivated by LIM-kinase-mediated phosphorylation (Arber et al., 1998; Yang et al., 1998). These LIM-kinases are in turn regulated in part by Rho-GTPases (see Bernard, 2007 for review). Additionally, the
36 activation of ADF/cofilin can be achieved through dephosphorylation by Slingshot phosphatases (Niwa et al., 2002).
At its simplest, non-mammalian variants of Tms are antagonists of ADF/cofilin, as Tm binding to the actin filament can stabilise the actin filament by protecting it from the depolymerising effects of ADF/cofilin (e.g. Ono and Ono, 2002). However, the interactions between Tms and ADF/cofilin are much more complex in mammalian systems, as the nature of the relationship is Tm isoform-specific. In vitro studies show that overexpressing human Tm5NM1 is sufficient to increase the concentration of unbound, phosphorylated
(and therefore inactive) ADF/cofilin, suggesting that hTm5NM1 out-competes ADF/cofilin for binding to the actin filament (Bryce et al., 2003). Overexpression of TmBr3 in this same cell line did not induce an increase in phosphorylated ADF/cofilin levels, and in fact
TmBr3 co-immunoprecipitates with ADF/cofilin-bound actin filaments, suggesting cooperation between the two, or recruitment of ADF/cofilin by TmBr3 (Bryce et al., 2003).
The localisation of ADF/cofilin is also influenced by these isoforms, as shown by the loss of the characteristic localisation of ADF/cofilin in the proximal region of the lamellipodia with hTm5NM1, but not TmBr3, overexpression. This study suggests that the Tm-
ADF/cofilin relationship is isoform-specific, with TmBr3 perhaps functioning as a recruiter of ADF/cofilin (or vice versa) to the actin filament in lamellipodia, and Tm5NM1 displacing ADF/cofilin from actin filaments.
1.5.4. Myosin
Myosins are a superfamily of actin-associated ATPases, originally characterised in striated
37 muscle, but with isoforms now found in all eukaryotic cells. In non-muscle cells, myosin II can act as a molecular motor, translocating actin filaments by mechanical force generated from ATP hydrolysis. To do so, non-muscle myosin requires phosphorylation of its light chain (MLC) domains which is achieved by calcium-calmodulin dependent MLC-kinase
(MLCK), Rho-kinase, or AMP-activated protein kinase (AMP-kinase) (see Conti and
Adelstein, 2008 for further explanation).
Muscle-specific Tms, of which there are three, are an integral component of the thin filament of the muscle contractile unit, the sarcomere, and the mechanisms by which they regulate the actin-myosin interaction has been well characterized (see Lehman and Craig,
2008 for review). Likewise, there are a number of muscle-specific myosins which are responsible for producing the force required for contraction in skeletal, cardiac and smooth muscle. In the cytoskeleton, actin and myosin also work together to produce contractile force. Myosins can also influence the turnover of actin filaments, and myosin can realign, or even translocate actin filaments (Conti and Adelstein, 2008). Myosins are implicated in actin filament stability, such that when myosin II is already bound to actin filaments, phosphorylation of MLC can stimulate ATPase activity to incorporate actin monomers into actin filaments (Sellers, 1981). In these capacities, myosins can influence cell motility, cell polarity, and local processes such as movement of growth cones. The activation of myosin
II occurs by phosphorylation of the MLC domains, and can be achieved through multiple pathways, including those using Rho-kinases (e.g. Amano et al., 1996; Chrzanowska-
Wodnicka and Burridge, 1996).
Tms affect myosin activity and localisation in an isoform-specific manner. hTm5NM1
38 overexpression can drive myosin activation by MLC phosphorylation. Overexpression of hTm5NM1 results in myosin enrichment in somatodendritic compartments of cultured mouse neurons, concomitant with an aberrant localisation of myosin IIA to the dendrites
(Bryce et al., 2003). Conversely, within growth cones, myosin IIB (and not myosin IIA) co- localises with exogenous hTm5NM1 in filopodia and the leading edge of the lamellipodia, where it is usually absent. Overexpression of TmBr3 does not recruit myosin II in growth cones (Bryce et al., 2003), thus the process is isoform-specific.
1.5.5. Tropomodulin
Tropomodulin (Tmod) caps the slow-growing, pointed ends of actin filaments, preventing both elongation and depolymerisation at this end of the filament. After being identified as a
Tm binding molecule (Fowler, 1987), Tmod was shown to also bind actin filaments
(Gregorio and Fowler, 1995; Weber et al., 1994). The polarity of the elongated Tmod allows it to bind to actin at its C-terminal end in a Tm independent manner, while the N- terminus of Tmod contains two Tm binding sites (one for each Tm dimer associated with the actin filament), and one Tm-dependent actin binding site (see Kostyukova, 2008b for review).
Four isoforms of Tmod exist, of which three are expressed in brain: Tmod1, 2, and 3.
Tmod1, or E-Tmod (erythrocyte Tropomodulin) is expressed in brain (Watakabe et al.,
1996) and has recently been found in horizontal cells of the retina (Yao and Sung, 2009).
Tmod 1 and Tmod 2 each negatively regulate neurite outgrowth, although through distinct mechanisms (Fath et al., 2011). Tmod1 can bind to LMW products of the δTm, γTm and
αTm genes, but has the highest affinity for αTm gene products, including Tm5a
39
(Kostyukova, 2008a). Through specific binding to Tm5a decorated actin filaments, Tmod1 can specifically stabilize these filament populations.
Neuron-specific Tmod (N-Tropomodulin, or Tmod2) has also been shown to bind to Tm in a highly isoform-specific manner. TmBr3, Tm5a, and Tm5NM1 isoforms have high affinities for Tmod2 (Watakabe et al., 1996). The binding of these Tm isoforms with
Tmod2 enhances the affinity of Tmod2 with the actin filament (see Fischer and Fowler,
2003 for review). Conversely, Tmod2 does not bind with Tm4, Tm2, or TmBr1 isoforms
(Watakabe et al., 1996). Tmod2 is found throughout brain, as early as ED11.5, and expression persists through to adulthood. Tmod2 has been implicated in increased hippocampal long term potentiation (LTP) and strain specific learning impairments in mice
(Cox et al., 2003), however the mechanism for this remains to be elucidated. Given the arrangement of actin filaments in the synapse, there are a range of mechanisms by which an actin pointed-end stabiliser such as Tmod could function at this site. Indeed, given the isoform-specific localisation of Tms at the adult synapse (TmBr3 being predominantly pre- synaptic and Tm4 post-synaptic), it may be that the differential affinity of Tmods for these
Tms produces unique actin filament populations on either side of the synapse.
The differential affinity of Tm isoforms for Tmods provides a system whereby the local repertoire of Tm isoforms can influence the lengths and stability of actin filaments; for example one could expect a region rich in Tm4 (which has a low affinity for Tmod1 and no detectable affinity for Tmod2) to have actin filaments undergoing pointed-end depolymerisation at greater rates than those in TmBr3-rich regions (as TmBr3 binds to
Tmod2, and enhances its affinity for the actin filament).
40
1.5.6. Drebrin
Developmentally regulated brain proteins, or Drebrins, can compete for actin binding with each of: Tm (both muscle and cytoskeletal isoforms), α-actinin-1 (Ishikawa et al 1994), and fascin (Sasaki et al 1996). Through alternative splicing, one mammalian drebrin gene produces two isoforms: drebrin-E (embryonic), which is ubiquitously expressed, and drebrin-A (adult), which is exclusively neuronal (Kojima et al 1993, Shirao et al 1989). A third isoform, s-drebrin A, has been identified as a truncated splice variant of drebrin-A, with similar distribution in brain and some comparable functions with regard to actin organisation (Jin et al 2002). Since its discovery, however, little research has focused on s- drebrin A.
Drebrin-A has an exclusively post-synaptic distribution at excitatory synapses (Aoki et al
2005), and knocking out drebrin-A interferes with homeostatic synaptic plasticity at excitatory synapses in adult mice (Aoki et al 2009). The actin binding domain of drebrin is necessary for its exclusive localisation to the dendrite spine, and the overexpression of drebrin-A induces elongation of dendritic spines in cultured cortical neurons (Hayashi
&Shirao 1999). When exogenously introduced into fibroblasts, drebrin-A induces the outgrowth of highly branched neurite-like processes (Shirao et al 1998).
The ability to displace each of Tm, α-actinin 1, and fascin from actin filaments indicates drebrin can regulate other ABPs, and thus regulate actin structure. This regulation has been demonstrated in neurite outgrowth (by regulating fascin-mediated actin bundling) (Sasaki et al 1996; Shirao et al 1994) and hypothesised in trafficking of vesicles at the synapse (by regulating the α-actinin bond between NMDARs and actin filaments) (Shirao and Sekino,
41
2001). Drebrin-A is considered generally to be involved in rapid changes of actin organisation at the post-synapse, and potentially during neurite outgrowth (see Majoul et al., 2007 for review). Like Tm, the ability of drebrin to compete with other ABPs in actin filament binding allows it to regulate actin filament stability and organisation by differentially allowing access to the actin filament of other ABPs.
1.5.7. Caldesmon
Caldesmon (CaD) can regulate the actin-myosin interaction. CaD isoforms are found within muscle and non-muscle cells. CaD is an elongated molecule, containing binding sites for myosin, Tm, and calmodulin (see Dabrowska et al., 2004 for review). Non-muscle CaD can bind to actin filaments and Tm simultaneously, occupying space in the longitudinal groove of actin filaments, much in the same fashion as Tm. Indeed CaD and Tm have almost identical periodicities (Yamashiro-Matsumura and Matsumura, 1988). In a calcium dependent manner, CaD binds to calmodulin, and through this interaction can regulate actin based motility – in the absence of calcium and calmodulin, CaD can inhibit the actin- myosin interaction.
The affinity between Tm and CaD is enhanced by actin (Horiuchi and Chacko, 1988).
When bound to actin, CaD inhibits actin-myosin ATPase activity, and this inhibition is synergistically enhanced in the presence of Tm (see Wang, 2008 for review). CaD is found in growth cones and extending filopodia of developing rat cortical neurons, colocalising with myosin II and a LMW Tm, probably Tm4 (Kira et al., 1995). It is hypothesised that
CaD regulates actin-myosin in a calcium/calmodulin dependent manner (Kira et al., 1995).
42
1.5.8. Profilins
Profilins can have many effects on the actin filament. Four different genes (Profilin I, II,
III, and IV) comprise the mammalian profilin family. Products of profilin III and IV are testis-specific, and profilin I is ubiquitous (Honoré et al., 1993). Profilin II produces at least two isoforms through alternative splicing: profilin IIA and the less prominent profilin IIB, the former being enriched in brain, the latter in kidney and embryonic stem cells (Di Nardo et al., 2000). While the following short review is drawn from studies using a range of sources of profilin, from amoebae to sea urchins to bovine calves, profilins exhibit a homology between species (see Birbach, 2008 for review) and so we here outline general models of profilin function.
When bound to actin monomers, profilin catalyses nucleotide exchange, aiding the charging of actin with ATP (Mockrin and Korn, 1980), and can inhibit actin filament nucleation (Pollard and Cooper, 1984) and elongation at the pointed end of the actin filament (Pollard and Cooper, 1984; Tilney et al., 1983). In the model first proposed by
Tilney and others (1983), profilin binds actin monomers, occluding the site required for monomer-pointed end elongation, but still allowing for the addition of the monomer to the barbed end – explaining the polarity of profilin function, which inhibited pointed end elongation only. Indeed, evidence followed that profilin could elongate filaments at their barbed ends (Pollard and Cooper, 1984; Pring et al., 1992). While profilin can work with thymosin to enhance actin polymerisation in the presence of newly formed barbed ends
(Pantaloni and Carlier, 1993), when tightly complexed with actin, profilin can slow barbed end actin filament elongation rates, ostensibly by capping barbed ends (DiNubile and
43
Huang, 1997). These studies speak to the number and complexity of interactions between profilin and actin. In neurons, profilin can interact with a range of regulatory proteins, and bind to the ABP drebrin (see Section 1.5.6). Just as profilin can have a range of effects on the actin filament, its roles in neuronal function are varied. In immature neurons, profilin
IIA can inhibit neuritogenesis, elongation and branching (Da Silva et al., 2003). In developed neurons, profilins have been implicated in neural plasticity, and profilin II is necessary for actin polymerisation at the synapse, so influencing vesicle exocytosis and synaptic excitability (Pilo Boyl et al., 2007). The nature of profilin involvement in synaptic remodeling and learning is still being resolved – despite evidence of involvement in post- synaptic spine stabilization (Ackermann and Matus, 2003), knock out studies indicate profilin II is not required for plasticity (Birbach, 2008; Pilo Boyl et al., 2007). While the interactions between profilins and Tms are yet to be understood in mammalian systems (see
Butler-Cole et al., 2007 for evidence of interaction between a poxviral profilin homolog and host-cell Tm), it is quite possible that neuronal events such as neuritogenesis and actin stabilization at the synapse require, or induce, interactions between the two.
1.5.9. Fascin
Fascin is a phospho-regulated ABP which can cause actin filaments to aggregate into bundles. The actin affinity and actin bundling activity of fascin is decreased by its phosphorylation (Yamakita et al., 1996). By influencing actin bundling, fascin has been implicated in cellular motility, cell-cell interactions, cell adhesion, and metastasis. There are three isoforms of fascin: Fascin-1, Fascin-2 (or retinal fascin) and Fascin-3 (or testis- specific fascin), with Fascin-1 mRNA enriched in (but not restricted to) developing neural
44 tissue and brain (De Arcangelis et al., 2004). Fascin in axons is important in the initial morphogenesis of growth cones, as well as the dynamics and structure of actin bundles within filopodia and lamellipodial structures (Cohan et al., 2001; Sasaki et al., 1996). Like some Tms and other ABPs, fascin is also regulated by drebrin (Sasaki et al., 1996) (see
Section 1.5.6). Additionally, fascin inhibits the binding of LMW Tms (Tm4 and γTm gene products) to actin, and actin binding assays using human fascin, rat Tms, and CaD show certain Tm isoforms and CaD together can impart a synergistic effect of inhibiting the binding of fascin to actin (Ishikawa et al., 1998). These interactions suggest that Tms and
CaD together may regulate the formation and disassembly of filopodia and stress fibres by attenuating fascin activity (Ishikawa et al., 1998). Recently fascin has been shown to interact with exogenous Tm3 (a non-neuronal isoform) in neuroblastoma cells, and the two colocalise to profuse filopodia in these cells. This interaction is isoform specific; no such relationship was detected with the neuronal Tm5NM1 isoform (Creed et al., 2011).
1.5.10. Filamins
Filamins have an interesting multitude of functions. As well as being important in a range of transcription and cell signaling cascades (see Popowicz et al., 2006 for review), filamins have a distinct duality of effects on actin filament organisation, depending on filamin:actin molar ratios. At low filamin:actin molar ratios filamins can help orientate actin filaments in perpendicular arrangements, producing dynamic orthogonal networks. At higher concentrations filamins can act as filament bundling proteins, producing more resilient covalently cross-linked gels (Schmoller et al., 2009; Tseng et al., 2004). It has also been proposed that these differences in function may be also due to the flexibility of the filamin
45 isoform (van der Flier and Sonnenberg, 2001). In isolation, filamin and α-actinin (see
Section 1.5.11) can each orientate actin filaments into orthogonal networks (see Nakamura et al., 2011 for review). In conjunction, these two proteins can together produce parallel bundles of actin filaments (Schollmeyer et al., 1978). These two arrangements of actin filaments, loose orthogonal networks versus stiff covalent bundles, hint at the possible different roles of filamins in cell shape: contributing to a dynamic meshwork, capable of rapidly reforming to provide motility (e.g. at the leading edge of a migrating cell)
(Nakamura et al., 2011; Tseng et al., 2004), and producing stable, bundled filaments, more useful in maintaining cell shape for long periods of time (Tseng et al., 2004).
1.5.11. α-Actinins
While they share some structural actin-binding domain similarity with the filamins (see
Popowicz et al., 2006 for review), α-actinins primarily organise actin filaments into parallel bundles rather than orthogonal networks (Tseng et al., 2004).
In mammalian systems, four α-actinin genes produce at least six isoforms, of which only two, α-actinin 1 and 4, are routinely considered cytoskeletal (Sjöblom et al., 2008), however α-actinin 2 is also found in non-muscle cells, and along with α-actinins 1 and 4 is expressed in brain (Wyszynski et al., 1998). Both α-actinins 1 and 4 are found in stress fibres where they colocalise with myosins (see Naumanen et al., 2008 for review), and focal adhesions (Fraley et al., 2010). Cytoskeletal α-actinins contribute to the structural organisation of actin filaments, and also a framework for other actin binding and regulatory proteins (e.g. the cell adhesion receptors integrins) (Pavalko and Burridge, 1991).
46
In neurons, α-actinin2 localises to dendritic spines and shafts (Nyman-Huttunen et al.,
2006; Wyszynski et al., 1998), and also to the post-synaptic density (PSD) of excitatory synapses (Wyszynski et al., 1998), where it can bind the NMDA receptor subunits NR1 and
NR2 (Wyszynski et al., 1997), suggesting a role in synaptic plasticity. Through their association with other signaling proteins, the α-actinins are also implicated in neurite outgrowth and neuronal differentiation (Nyman-Huttunen et al., 2006).
1.6. Tropomyosins in the growth cone
Growth cones are highly motile organelles at the distal portions of immature neurites, directing their outgrowth. To date, the Tm isoforms which are present in growth cones include the αTm gene products Tm5a and Tm5b (which we hereafter refer to as Tm5a because of a greater understanding of Tm5a relationships with ABPs) (Schevzov et al.,
1997), the δTm gene product Tm4 (Had et al., 1994), and the γTm gene product Tm5NM1
(Schevzov et al., 1997). The growth cone can be viewed as an arrangement of distinct sub- regions, each with their specific actin filament organisations- the filopodia (1), comprising bundled actin cables, protruding into the extracellular environment, between which span the lamellipodia (2), comprising orthogonal networks of actin filaments and including an immediate interface with the extracellular environment at the leading edge of the cell; the lamella (3), the proximal continuation of those actin networks of the lamellipodia, which directly border with the transition zone (4), where shearing forces exert enough torque to sever actin filaments, and bordered by a series of actin arcs, and the actin filament-poor central zone (5), the most proximal portion of the growth cone, adjacent to the neurite shaft.
While the localisations of Tm isoforms at the level of these sub regions is still being 47 discovered, what follows is a series of hypotheses on how Tms may interact with ABPs found in growth cones to help produce and maintain the various forms of actin filament structural complexity, and how they can influence and direct the movement of actin between these regions (See Figure 1.5). It is important to stress that what follows is hypothesis only, and for more detailed analyses of actin filament superstructures and their associated ABPs in the growth cone, see a thorough review by Pak and others (2008).
48
Figure 1.5 Tropomyosins and other actin binding proteins in the growth cone
49
Figure 1.5. This figure depicts a newly emerging growth cone (see text in Section 1.6 for details). Tms are associated with actin filaments in the lamellipodia, lamellae, and filopodia. In the lamellipodium (A) Tm5a associating with actin enhances the barbed end elongation of filaments at the leading edge and in the lamellipodium. Tm5a also inhibits excessive branching by inhibiting Arp2/3 binding to filaments. Tm5a and formin together produce unbranched, stable filaments, which elongate very slowly at their barbed ends.
In the lamellum (B) Tm4 binds caldesmon, and together they modulate the binding of myosin to form stable filaments. Tm5NM1 bound actin filaments also recruit myosin, and inhibit severing by ADF/cofilin. Myosin acts on these filaments to help pull them rearward in retrograde flow. Tmod2 binding to Tm5NM1 associated actin filaments inhibits depolymerisation from their pointed ends, and results in more stable filaments. Tmod1 binding to Tm5a associated actin filaments slows pointed end depolymerisation, and enhances the stability of the filament.
In the filopodium (C) Tm5NM1 recruits myosin to the actin filaments in the distal filopodium. The arrangement of these myosin motors produces two directional forces on the filopodium – 1) the rearward pulling of actin filaments (aiding treadmilling forces in producing retrograde flow), and 2) the shearing torque forces which contribute to the breaking of these filaments as they enter the transition zone. Whilst Tm5NM1 may here function indirectly to remodel the filaments of the filopodium, it is also inhibiting ADF/cofilin binding to these filaments, so preventing them severing before entering the transition zone. More distally, Tm5a associated actin filaments inhibit excessive Arp2/3 branching of the filopodium.
1.7. Tropomyosins at the synapse
Actin is distributed widely in the CNS. Actin localises to both the axonal (pre-synaptic) and dendritic (post-synaptic) sides of the synapse (Goldman, 1983; Landis and Reese, 1983), but is particularly enriched within highly specialised regions of post-synaptic activity, the dendritic spines (Matus et al., 1982). Around the synapse, actin has many functions, including the pre-synaptic trafficking of vesicles to the synapse, the trafficking of receptors to the post-synaptic terminal, and the maintenance or change of dendritic head size in
50 potentiation (see Cingolani and Goda, 2008 for review). Indeed, the nature of the synapse requires morphological changes in response to stimuli (e.g. enlargement of dendritic spine heads during long term potentiation (LTP)), and various pools of both monomeric and filamentous actin in the dendritic spine will provide a structural framework. These pools of actin are sometimes dynamic and producing forces which drive changing spine morphology, and sometimes rigid and stable to maintain dendritic head shape (Honkura et al., 2008). A number of ABPs help to orchestrate the many forms of actin at the synapse, and the sometimes very rapid actin reorganisation there (see Sekino et al., 2007 for review).
Tms, like the ABPs they influence, localise to the synapse in a polarised and compartmentalised manner. To date only αTm gene products have been found pre- synpatically (Had et al., 1994; Vrhovski et al., 2003; Weinberger et al., 1996). In adult rat cerebellar neurons, one or both of TmBr1 and 3 proteins were detected (Had et al., 1994).
Both of these isoforms are found in brain, yet TmBr1 expression is predominantly found in brain areas deriving from the prosencephalon (Stamm et al., 1993), and is almost undetectable in adult cerebellum, where TmBr3 is enriched (Weinberger et al., 1996). So it is likely that TmBr3 was the isoform detected at the pre-synapse of mature cerebellar neurons.
The δTm gene isoform Tm4 is localised post-synaptically, being enriched in the dendritic spines (Had et al., 1994). The γTm gene may also produce isoforms which localise post- synaptically – while transgenically overexpressed hTm5NM1 in mice is localised in dendrites and cell bodies (Bryce et al., 2003), the precise localisation of endogenous
Tm5NM1 in mature neurons is incompletely understood (see Section 1.4.1.1 - 2). However
51 the identification of a γTm gene product in synaptosomes (Mello et al., 2007) indicates isoforms from this gene, along with the aforementioned α- and δTm genes, also play a role at the synapse.
At the very least there is evidence the αTm gene product TmBr3 is localised to the pre- synaptic terminal, and the δTm gene product, Tm4is localised to the post-synaptic terminal.
This specific compartmentalisation of Tms reflects the different regulation and roles of actin on either side of the synapse. As in other cellular regions, Tm expression is capable of directing local actin organisation through their isoform specific relationships with other
ABPs (see Figure 1.6 for a set of hypotheses on what these relationships are at the pre- and post-synapse).
52
Figure 1.6 Tropomyosins at the synapse
53
Figure 1.6: Schematic of a mature excitatory synapse in the CNS. Depicted are individual actin filament populations at the pre-synapse and post-synapse (on the left). On the right, models are shown for Tm decorated actin filaments at the endocytic zone (A) and in the spine head (B). In the endocytic zone (A) decoration of actin filaments with TmBr1/3 (hereafter referred to as TmBr3) allows ADF/cofilin to exert its severing activity on the filament and inhibits the binding of myosin. At the post-synapse, actin filaments are decorated either with Tm4 or drebrin A. In contrast to TmBr3, Tm4 allows myosin to bind to the filament which is critical for processes involved in neurotransmitter receptor trafficking. While Tm4 decorated filaments inhibit gelsolin activity, drebrin A decorated filaments – which block access of Tm4 – allow gelsolin to sever filaments, thereby generating different actin filament populations with distinct dynamic properties (Figure 1.6 and figure header produced by Dr. Thomas Fath, and reproduced with permission).
1.8. Tropomyosins in the neurites
Actin filament organisation is imperative in the final synaptic connections between mature neurons, and also in the growth cones which have guided neurites to these connections. The reorganisation of actin is also required in neuritogenesis (Da Silva and Dotti, 2002). The presence of different Tms in axons (e.g. TmBr1/3) and dendrites (e.g. Tm4) (see Figure
1.4) indicates potential functions in neurite outgrowth and polarity. Some ABPs which impact on neurite outgrowth and branching, such as Profilin (e.g. Sharma et al., 2005), and
ADF/cofilin (e.g. Meberg and Bamburg, 2000) interact with Tms in an isoform specific manner. Further investigations of these relationships, and the impact Tms can have on neuritogenesis and morphology, are in Chapter 5 of this thesis.
54
1.9. Tropomyosins in neurons: seeing the forest and the trees
The development of neurons through morphogenesis, differentiation, and the synaptic plasticity which continues throughout ontogeny requires a remarkable diversity of actin filament function. Actin is distributed throughout the neuron, and it is now clear that neuronal actin is subdivided into populations of actin filaments, each with distinct subcellular localisations, properties and functions. There is no one single property of actin which provides a diversity of form and dynamics required for the many different roles it performs. It is through the differential and highly specific associations of actin with other proteins which allow it to be so multifaceted.
Tms play an integral part in this differential control of actin function- by directly affecting actin filament stability, by modulating the effects of other ABPs on the actin filament, and by promoting fidelity of function along the length of a single filament. Because of the isoform-specificity of interactions between Tms and ABPs, the engagement of actin with a particular Tm isoform can be a predictor of the structure and fate of that filament. Actin is ubiquitous in neurons, and Tms segregate in an isoform-specific manner to spatially and functionally distinct compartments (containing distinct actin populations) of the neuron.
The colocalisation of actin with a particular Tm isoform will confer selectivity onto the filament: actin filaments will interact with ABPs in a highly specific manner depending on which Tm isoform decorates the filament. Through this conduit, Tm isoforms allow the selectivity of ABP:actin filament interaction that underpins the functional compartmentalisation of actin in neurons.
55
Clues as to how the actin cytoskeleton is capable of immense yet specific organisation can be found in the localisation patterns of different ABPs and Tms, and how these patterns change throughout differentiation. The developmental regulation of Tms and their localisations is so tightly controlled that each isoform has a distinct spatial pattern of expression within immature and mature neurons. Different Tm isoforms contribute to different aspects of neuronal function: some Tms are important in growth cone morphology
(such as Tm5NM1) (Schevzov et al., 2005a), other Tms are not found in growth cones, but are expressed only post differentiation (such as TmBr3) (Vrhovski et al., 2003; Weinberger et al., 1996). Even a single isoform can shift localisation dramatically throughout the development of the neuron. An example is Tm4, which in immature neurons is in the growth cones of both dendrites and axons, but with neuronal maturity shifts to a post- synaptic localization (Had et al., 1994). Tms are regulated throughout neuronal development, and are also differently regulated in neurological disorders such as
Alzheimer’s Disease (Galloway et al., 1987),which underpins the importance of understanding their functions.
We can appreciate the importance of Tms by observing how neurons respond to experimental manipulations of Tm expression profiles. Knockout, knockdown and overexpression studies have helped elucidate the specific relationships different Tms have – whether as competitors, collaborators or neither – with various ABPs. A single ABP can have different relationships with different Tm isoforms. For example, Tm5NM1 can apparently recruit myosin II to actin filaments, whereas TmBr3 has no such effect (Bryce et al., 2003). Similarly, one Tm isoform can have different relationships with different ABPs -
56 while Tm5NM1 can recruit myosin II to actin filaments, it also can displace active
ADF/cofilin from the actin filament (Bryce et al., 2003). The nature of the relationship is defined strictly by the ABP and the Tm isoform.
Tms offer us a way of discriminating one actin population from another. The extrinsic utility of understanding Tm isoform function lies in the information they can tell us about their associated actin filaments- by knowing their properties, we can build a picture of how one protein, actin, can for example be reorganised during the rapid transport of vesicles at the synapse, and simultaneously remain static in bundles within the mature axon. Tms superimpose heterogeneity of function onto the actin pool in the neuron, and allow us to both visualise and understand functionally distinct actin filament populations. It is this level of detail, of local discrimination at the level of actin filament populations and even between filaments themselves, which is so important in understanding neuronal function.
1.10. Aims of this project
It is with the goal of understanding neuronal function that this thesis has been undertaken.
Initially, a Tm5NM1/2 knockout mouse line will be used to investigate effects of Tm knockout on expression of other Tms in brain. The effect of Tms on the actin cytoskeleton will be measured by using clones of the rat neuroblastoma cell line, B35, overexpressing various Tm isoforms (the γTm gene product Tm5NM1, and the αTm gene products TmBr1,
TmBr2, TmBr3), and novel B35 clones overexpressing the δTm gene product Tm4 will be generated and characterised. The different effects of Tm isoforms on actin will be measured in the contexts of neurite morphogenesis by quantifying the morphological changes that
57 each of these Tms induces. Also investigated will be the effects different Tm isoforms can have on cellular differentiation, and by using proteomics approaches other proteins which are affected by specific Tm isoform overexpression will be identified, and the pathways by which Tm isoforms can differentially drive changes in neuronal actin organisation will be examined.
58
Chapter 2: Materials and methods
59
2. Chapter 2: Materials and methods
2.1. Equipment and Reagents
The general equipment used is shown in Table 2.1.1. Commercially available reagents used are shown in Table 2.1.2. The composition of buffers and solutions is shown in Table 2.1.3.
Table 2.1.1: Equipment and manufacturers Equipment Manufacturer/supplier 145G-281-D Incubator Thermoline Scientific
3K15 Refrigerated Centrifuge Sigma
API QStar Pulsar i-hybrid tandem mass spectrometer Applied Biosystems
AxioSkop 40/AxioCam MRC fluorescence Zeiss microscope
Bio-line Shaking incubator Edwards Instrument Co.
Block Heater SBH 130D Stuart
CCD Camera LAS 3000 FujiFilm
CellQuest Flow Cytometry Software Becton Dickinson
Centrifuge 5810 Eppendorf
Class II Biological Safety Cabinet Email Air Handling Systems
CP1000 Film Processor AGFA
DU 650 Spectrophotometer Beckman
Dynal MPC magnet Invitrogen
FACSCalibur flow cytometry machine BectonDickinson
FlowJo Flow Cytometry Analysis Software FlowJo
GelDoc BioRad
GenePulser II Electroporator BioRad
GS-6R Centrifuge Beckman
Haemocytometer Neubauer
ICAT cation exchange cartridge and cartridge buffer Applied Biosystems kit
60
Table 2.1.1: Equipment and manufacturers (continued) Equipment Manufacturer/supplier ImageJ Imaging Software National Institutes of Health IPG Strips pH 4.0 – 7.0 Sigma-Aldrich IPGPhorII Isoelectic Focusser Amersham
MCO-17A CO2 Incubator Sanyo Micro Ultrasonic Cell Disrupter Sonicator Kontes Microcentrifuge 5424 Eppendorf Microwave MW73B-S Samsung Milli-Q Element water purification system Millipore Mini-PROTEAN 3 Cell Western Equipment BioRad Nanodrop ND-1000 Spectrophotometer NanoDrop NBI-80-T Laboratory Waterbath Thermoline Scientific Oasis HLB Cartridge 6cc/150mg Waters Micromass Olympus BX50 microscope Olympus Orbital Shaker Incubator Bioline pH meter TPS LabChem PlateReaderSpectraMax M2 Molecular Devices Platform Mixer Ratek PowerPac 300 BioRad PRO200 Tissue Homogeniser ProScientific ProteinPilot Mass Spectrometry Analysis Applied Biosystems Software QTofUltima Waters Micromass S1000 Thermal Cycler BioRad Speedvac Savant Speedvac Plus, SCV10A Savant Suspension Mixer Rotor Ratek Syringe pump KD Scientific Trans-Blot SD Semi-Dry Electrophoretic BioRad Transfer Cell Typhoon 9400 Laser Scanner GE Healthcare UV transilluminator UVP, Inc. X Ray Film Cassette FujiFilm
61
Table 2.1.2: Commercially available reagents and kits Reagent Manufacturer / Australian Supplier 1kb plus DNA ladder Invitrogen Australia, Mt Waverly VIC Australia
50bp DNA ladder Invitrogen Australia, Mt Waverly VIC Australia
Amplitaq polymerase and 10x PCR Applied Biosystems, Mt Waverly, VIC Australia buffer
BCA (bicinchoninic acid) Protein Thermo Scientific Pierce, Lidcombe, NSW Assay Reagent Australia
Benchmark Prestained Protein Ladder Invitrogen Australia, Mt Waverly VIC Australia
Bradford Assay Kit Sigma-Aldrich, Castle Hill NSW Australia
Chromatography paper 3mm Whatman, Mt Waverly, VIC Australia
Complete mini EDTA-free protease Roche Australia, Dee Why NSW Australia inhibitor tablets
Criterion 10-20 % gel, Tris-HCl BioRad, Gladesville, NSW Australia
DAPI (4',6-diamidino-2- Invitrogen Australia, Mt Waverly VIC Australia phenylindole)
Developer G153 (A and B) AGFA, Rydalmere NSW Australia
Dulbecco’s Modified Eagle Media Gibco, Invitrogen Australia, Mt Waverly VIC (DMEM) – high glucose/L-glutamine Australia dNTPs Invitrogen Australia, Mt Waverly VIC Australia
EconoTaq PLUS Green Lucigen, Ryde NSW Australia
Fixer reagent G354 AGFA, Rydalmere NSW Australia
Fluorsave reagent CalBioChem, Castle Hill NSW Australia
Gibco, Invitrogen Australia, Mt Waverly VIC Foetal Bovine Serum (FBS) Australia
FuGene 6 Transfection Reagent Roche Australia, Dee Why NSW Australia
G418 Disulfide Salt selection agent Sigma-Aldrich, Castle Hill NSW Australia
Immunoprecipitation Kit – Invitrogen Australia, Mt Waverly VIC Australia Dynabeads Protein-G
Nail Polish, clear Amcal Chemist Brand, Newtown, Australia
62
Table 2.1.2: Commercially available reagents and kits (continued) Reagent Manufacturer / Australian Supplier pGEM-T Easy Vector System I Promega, Alexandria NSW Australia
PhosSTOP Phosphatase Inhibitor Roche Australia, Dee Why NSW Australia Cocktail Tablets
Precision Plus Protein Dual Color BioRad, Gladesville, NSW Australia Standard
Precision Unstained Marker BioRad, Gladesville, NSW Australia
PVDF (Polyvinylidene fluoride) Millipore, North Ryde NSW Australia membrane Immobilon P
QIAfilter Plasmid Maxi Kit Qiagen Pty Ltd, Doncaster VIC Australia
QIAfilter Plasmid Midi Kit Qiagen Pty Ltd, Doncaster VIC Australia
QiagenRNEasy Mini Kit Qiagen Pty Ltd, Doncaster VIC Australia
QIAprep Spin Miniprep Kit Qiagen Pty Ltd, Doncaster VIC Australia
Random Hexamers Promega, Alexandria NSW Australia
Reporter Ion Labels for iTRAQ AB Sciex, Mt Waverly, VIC, Australia
Ribonuclease A Sigma-Aldrich, Castle Hill NSW Australia
RNAse Invitrogen Australia, Mt Waverly VIC Australia
SYPRO-Ruby Gel Stain Sigma-Aldrich, Castle Hill NSW Australia
TRI reagent Sigma-Aldrich, Castle Hill NSW Australia
Trypsin- Porcine (for proteomics) Promega, Alexandria NSW Australia
Trypsin/EDTA (0.5%) (for cell Gibco, Invitrogen Australia, Mt Waverly VIC culture) Australia
Vacuum pump grease Dow Corning, Smithwood NSW Australia
Western Lightning Chemiluminescence Reagent Perkin Elmer Australia, Melbourne VIC Australia (Luminol reagent and oxidising reagent)
Wizard Gel Purification Kit Promega, Alexandria NSW Australia
X-ray Film Medical SuperRX FujiFilm, Ambervale NSW Australia
63
Table 2.1.3: Composition of buffers and solutions Solution Composition 2D Gel Buffer 7M Urea, 2M Thiourea, 4% CHAPS and 35mM Tris 2D Gel Blocking solution PBS, 5% (w/v) Skim Milk powder, 0.05% (v/v) Tween- 20 2D WB Washing solution PBS, 0.05% (v/v) Tween20 Acrylamide Stock (30%) 29.2% (v/v) acrylamide, 0.8% (v/v) bis acrylamide Acrylamide Stock (low bis, 29.73% (v/v) acrylamide, 0.27% (v/v) bis acrylamide 30%) Blocking solution (Tms: 5% skim milk (w/v), TBS Western Blotting) Blocking solution (ADF/cofilin: 5% (w/v)BSA, TBS Western Blotting) Blocking solution 2% (v/v) FBS, PBS (immunofluorescence) Citrate Phosphate Buffer: pH 5.0 25mM Citric Acid, 50mM Dibasic Sodium Phosphate (Na2HPO4) dehydrate in 1L water, pH 5.0 Citrate Phosphate (tween) 25mM Citric Acid, 50mM Dibasic Sodium Phosphate buffer: pH 5.0 (Na2HPO4) dehydrate in 1L water, 0.1% Tween-20, pH 5.0 Citrate Phosphate buffer: pH 2.0 25mM Citric Acid, 50mM Dibasic Sodium Phosphate (Na2HPO4) dehydrate in 1L water, pH 2.0 Coomassie Stain solution 0.2% (w/v) Coomassie R250, 20% (v/v) methanol, 5% (v/v) glacial acetic acid Denaturing gel sample buffer 95% (v/v) formamide, 10mM EDTA, 0.025% (10x) (w/v) bromophenol blue Destaining solution 40% (v/v) methanol, 10% (v/v) acetic acid dbcAMP stock 200mM dbcAMP in DMSO DMP buffer 20mM dimethyl pimelimidate x2HCl, 0.2M (Immunoprecipitation) triethanolamine pH 8.2 DNA sample buffer (10x) 0.1% (w/v) Xylene cyanol, 0.1% (w/v) bromophenol blue, 50% (v/v) glycerol, 0.1M EDTA DTT solubilisation buffer 10mM Tris pH 7.6, 2% (v/v) SDS, 2mM DTT, 1x Protease Inhibitor Equilibriation Buffer 6M urea, 3% (v/v) SDS, 20% (v/v) glycerol, 1x Tris-HCl buffer Fix/Destain Solution (2D gel) 10% (v/v) methanol, 7% (v/v) acetic Acid Freezing media DMEM, L-glutamine, 10% (v/v) FBS, 0.6% G418, 20% (v/v) DMSO Freezing media (parental clones) DMEM, L-glutamine, 10% (v/v) FBS, 20% (v/v) DMSO Growth Media DMEM, L-glutamine, 10% (v/v) FBS, 0.6% G418
64
Table 2.1.3: Composition of buffers and solutions (continued) Solution Composition Immunoprecipitation lysis PBS, 0.05% (v/v) Tween-20, 1x Protease inhibitor buffer Immunoprecipitation (storage) PBS, 0.05% (v/v) Tween-20 buffer Induction Media DMEM, L-glutamine, 0.1% (v/v) FBS, 0.5mM (v/v) dbcAMP, 0.6% G418 iTRAQ lysis buffer PBS, Protease Inhibitor 1x Laemmli Buffer (protein sample 500mM Tris (pH 8.8), 20% (v/v) Glycerol, 2% (v/v) SDS, buffer) 20% (v/v) β-Mercaptoethanol, Bromophenol blue Luria broth ((LB) media) 1% (w/v) bactotryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCl LB Agar 1% (w/v) bactotryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCl, 1.5% (w/v) agar Paraformaldehyde (4%) 4% (w/v) paraformaldehyde, 10% (v/v) 10xPBS, pH to 7.4 Parental growth media DMEM, L-glutamine, 10% (v/v) FBS
Phosphate Buffered Saline 0.1M NaCl, 2.7mM KCl, 0.015M NaHPO4, pH 7.2 (PBS) (1x) PBS storage buffer PBS, 0.05% Tween-20 Ponceau Staining Solution 0.5% (w/v) Ponceau, 3% (v/v) Acetic Acid Protein running buffer (1x) 10% (v/v) 10x Tris Glycine, 3mM SDS Protein sample buffer (4x) 0.5M Tris, pH 6.8, 20% (v/v) Glycerol, 2% (w/v) SDS, 20% (v/v) β-mercaptoethanol, bromophenol blue Protein transfer buffer (1X) 10% (v/v) 10x Tris Glycine, 20% (v/v) methanol Selection Media DMEM, L-glutamine, 10% (v/v) FBS, 1% (v/v) G418 Solution 1 (minipreps) 25mM Tris pH 8.0, 50mM glucose, 10mM EDTA Solution 2 (minipreps) 0.2M NaOH, 1% SDS Solution 3 (minipreps) 3M KOAc, 11.5% acetic acid TAE (50x) 2M Tris acetate, 50mM EDTA TAE (1x) 2% (v/v) 50x TAE TBE (10x) 0.89M Tris, 0.89M Boric Acid, 20mM EDTA TBS (10x) 0.05M Tris-HCl, 0.15M NaCl, pH 7.5 TBS (1x) 10% (v/v) 10x TBS TBS-T (1x) 10% (v/v) 10x TBS, 0.1% (v/v) Tween 20 TE 10mM Tris, 1mM EDTA Tris buffer 10mM Tris, 1x Protease Inhibitor Tris Glycine (10x) 0.25M Tris, 1.92M Glycine
65
2.2. Western blotting
2.2.1. Protein extraction: brain dissection and lysis
All experiments involving mouse brain were done with C57-BL6 strain mice.
For experiments analysing γ9d exon KO mice (see Chapter 3): Female 12 week old
(adult) wild type mice and mice lacking the 9d exon of the γTm gene were sacrificed by cervical dislocation, crania dissected and brainstems severed at the level of C2/C3, and brains quickly removed. Brains were then dissected into sagittal hemispheres, the left hemisphere left intact (“whole brain” region) and the right hemisphere dissected into the following regions: hippocampus, cortex, amygdala, olfactory bulb, hypothalamus, and cerebellum. These regions were each transferred to a 1.5ml microfuge tube, weighed, and then kept on ice while each had DTT solubilisation buffer relative to five times the weight of the tissue added, and regions were homogenised by pestle and then probe sonication using a Micro Ultrasonic Cell Disrupter Sonicator (Kontes). Protein concentration was estimated by BCA assay (Pierce), Laemmli buffer was added to the remaining sample, and samples were stored at -80°C for further analyses.
For experiments analysing Tm4 doublet in mouse brain (see Chapter 4): Brains of adult mice were removed and left hemispheres, amygdalae, cerebella dissected as above.
Embryo brains (day 16.5 post gestation; ED16.5) were removed whole. Tissue was weighed and kept on ice, and homogenisation buffer relative to 20 times the weight of the sample was added (for 2D gel analyses, 2D gel buffer was used, for heat treatment,
Tris buffer was used; see Table 2.1.3). Tissue was homogenised by pestle, then by sonication with a Micro Ultrasonic Cell Disrupter Sonicator (Kontes) for 4 brief pulses
(while samples were kept on ice). Protein quantitation was immediately assayed by 66
Bradford assay (Sigma-Aldrich; for 2D gel analyses) or BCA (for all other experiments) before further analyses, or samples were exposed to heat treatment before BCA assay.
Heat treatment: Embryo and adult whole brain regions were prepared as above, and after sonication were:
1) heated at 100°C in a waterbath for 10 minutes
2) re-homogenised with a pestle
These steps were done three times before samples were centrifuged for 30 minutes at
4°C and 16,000 g. Supernatant was recovered and protein quantitation estimated by
BCA assay. Samples were either frozen in liquid nitrogen and stored at -80°C for further application, or immediately prepared for Western blotting.
2.2.2. Protein extraction: cell lysates
Lysates were made with different buffers, depending on further testing. The buffers used are listed in Table 2.1.3. Cells were plated at a density of 5 x 105cells per 100mm dish and cultured for 24 hours at 37°C and 5% CO2 before being washed five times with room temperature (RT) PBS whilst dishes were on ice. Between one and five dishes of the same cells were used to harvest one lysate sample. After washing, 20μl of the appropriate lysis buffer (e.g. iTRAQ lysis buffer for iTRAQ experiments, DTT solubilisation buffer for Western blotting) was pipetted onto one dish, and cells scraped off the dish with a rubber policeman. If more than one dish of cells was used, this lysate was then pipetted onto the second (PBS washed) dish and harvested cells pooled in this manner for up to five dishes per sample. Lysates were kept on ice, and were sonicated for four brief pulses before being snap frozen on liquid nitrogen and stored at -80°C until required, or immediately assayed by BCA to estimate protein concentration. 67
2.2.3. Immunoprecipitation
Immunoprecipitations were done using the Dynal MPC magnet rack (Invitrogen).
Dynabeads Protein-G (Invitrogen) used for immunoprecipitation are magnetised, and all washes were done by placing samples (in 1.5ml centrifuge tubes) on the rack and allowing beads to migrate towards the magnet for 1 minute. Supernatant was pipetted off whilst tubes remained on racks. Solutions were added to beads with sample tubes off the rack.
Binding antibody to beads:
In a 1.5ml centrifuge tube, 300μl of Protein-G Dynabeads (Invitrogen) were washed three times with citrate phosphate buffer (pH 5.0) before beads were incubated with
180μl of purified WD4/9d antibody for two hours at RT with gentle agitation. This was done a total of three times, for a total incubation of 540μl of antibody, with antibody recovered. After the final incubation, beads were washed three times with 1ml citrate phosphate (tween) buffer each time.
Crosslinking antibody to beads:
After antibody was bound to beads (see above), beads were washed twice with
1.5mltriethanolamine 0.2M (pH 8.2), and then incubated in 1.5ml DMP buffer for 30 minutes at RT, with gentle agitation (on a tube rotator). After incubation supernatant was removed, beads were re-suspended in 50mM Tris pH 7.5 for 15 minutes at RT with gentle rocking. Beads were then washed three times with 1.5mlimmunoprecipitation
(storage) buffer each wash, and stored in 1.5mlimmunoprecipitation (storage) buffer at
4°C.
68
Immunoprecipiating Tm4 from mouse brain lysates:
Two samples were prepared from mouse brain: 800μl of immunoprecipitation lysis buffer was added to one sample of five cerebella, and 400μl to one sample of five amygdala. Each sample was then homogenised with a pestle before being sonicated with a Micro Ultrasonic Cell Disrupter Sonicator (Kontes) for 4 brief pulses. Cerebellar lysate was divided into two samples: one sample of 500μl was heat treated (see Section
2.2.1; and supernatant recovered after centrifuging), and the other 500μl lysate was incubated on ice. The total amygdala lysate sample was incubated on ice. Each of these three samples (200μl heat treated cerebella, 300μl non heat treated cerebella and 400μl non heat treated amygdalae) were then incubated with 166μl Protein-G Dynabeads
(Invitrogen) crosslinked to WD4/9d (see above), and each sample re-suspended before being incubated at 4°C on a rotor (in a cool room) for two hours. Before resuspension with Dynabeads, aliquots of each sample were taken and diluted in water and Laemmli buffer, and stored at -20°C (as non-immunoprecipitation sample controls). After the 4°C incubation, immunoprecipitation samples were placed on the Invitrogen magnet rack, and supernatant was recovered. Beads were washed three times with 1ml PBS each time, and then precipitant eluted from the beads. 25μl of citrate phosphate (pH 2.0) buffer was added to each bead sample (cerebella, amygdalae, and cerebella heat treated samples) which were mixed, before using the Dynal MPC magnet rack to recover this eluate. Each sample’s eluate was added to 3μlTris 50mM pH 7.5 to adjust pH. Beads were then washed twice with Tris50mM pH 7.5 and once with PBS storage buffer before being stored at 4°C in PBS storage buffer. Eluate was added to Laemmli buffer and Tris 50mM pH 8.8 (1:4) before 10μl of each sample was loaded on a 12.5% low bis-acrylamide gel (see Table 2.2) for Western blotting with WD4/9d antibody, and remaining sample run on a 12.5% low bis-acrylamide gel for staining with Coomassie 69
Blue staining solution and band excision for sequencing by matrix-assisted laser desorption/ionisation (MALDI).
2.2.4. Protein quantification
The BCA protein assay (Pierce) was used to estimate all protein concentrations, except for those samples used for 2D gel analyses, which were estimated using the Bradford assay (Sigma-Aldrich), each according to manufacturer’s instructions. For BCA assays, lysates were diluted between 1:10 (cell lysates) and 1:100 (brain lysates) in water or buffer used, and duplicates of each sample added to working reagent. BCA assays were done in 96 well plates, and after working reagent was added to samples, plates were incubated at 37°C for 30 minutes. Absorbance was measured using a plate reader at
562nm, and the BSA standard curve used to estimate protein concentrations of all lysate solutions. For Bradford assays, the procedure was the same as BCA assays, except that plates were incubated at 5 minutes RT before absorbance was measured at 595nm.
2.2.5. SDS PAGE gel electrophoreses
2.2.5.1. Gel running
Gels were cast and poured using the Mini-PROTEAN 3 Cell Western Equipment
(BioRad). For Tm detection, gels used were 12.5% low bis-acrylamide prepared as in
Table 2.2. Samples were diluted with 4x concentrated Laemmli buffer before being heated at 95°C for 5 minutes (unless stated otherwise) and loaded (between 10 and
40μl) into gel wells. If sample volume exceeded well capacity, 10μl of sample was loaded, then the gel was run at 100V for 5 – 10 minutes (until sample had started to migrate into the stacking gel, but some sample volume was still left in the well), current paused, and an extra 10μl of sample loaded. This was repeated up to four times, before 70
on the final load, protein marker was loaded into a separate well and the gel run as normal. As molecular weight marker, 6μl of BenchMark pre-stained ladder (Invitrogen) or Precision Plus Protein Dual Color Standard (BioRad) were loaded. Gels were run using the Mini-PROTEAN tank and current applied by a PowerPac (BioRad). Gels had current applied at 100V until the dye front had migrated entirely through the stacking gel and into the resolving gel, at which point charge was increased to 120V. Gels for
Tms were run until the dye front had run off the gel, and after initial optimisation experiments, low bis-acrylamide gels for Tm4 were run until the 20 kDa marker dot was the lowest visible on the gel.
Table 2.2: SDS-PAGE gels for tropomyosin: 12.5% low bis-acrylamide Resolving gel Stacking Gel
30% Acrylamide-Low Bis 2.5ml 30% Acrylamide Bis 266μl
1M Tris pH8.8 2.25ml 1M Tris pH6.8 250μl
Water 1.14ml Water 1.45ml
10% SDS 60μl 10% SDS 20μl
N, N, N', N'- 2.4μl TEMED 2μl tetramethylethylenediamine
(TEMED)
10% Ammonium 45μl 10% APS 15μl persulphate (APS)
71
2.2.5.2. Gel transfer
After electrophoresis, gels were assembled into Mini-PROTEAN 3 Cell Western
Equipment (BioRad) transfer apparatus as shown in Figure 2.1. Polyvinylidene fluoride
(PVDF) membrane was activated in methanol for 10 seconds prior to use. The transfer apparatus was placed into a transfer tank and cooled at 4°C. Transfer tanks had current applied through a PowerPac (BioRad) at 80V for two hours or 35V overnight. After transfer was complete, membrane was stained with Ponceau staining solution and destained with water (to confirm protein transfer), and membranes were scanned to later measure protein loading between lanes. Membranes were then washed once with 1x
TBS and placed into blocking solution. Blocking solution used depended on primary antibody being used: 5% skim milk powder in 1x TBS (Tropomyosins) or 5% BSA in
1x TBS (ADF/cofilin). Membranes were incubated in blocking solution for one hour at
RT or overnight at 4°C.
Figure 2.1 Setup of transfer apparatus for Western blotting − Electrode _ Sponge Filter paper
Gel Membrane
Filter paper Electric Sponge current + + Electrode
Figure 2.1 To transfer proteins from gel to PVDF membrane, a transfer “sandwich”andwich” was made with the gel and membrane, containing filter paper on either side, followed by spacers. Current flowing from the negative electrode to the positive electrode transfers proteins from the gel onto the membrane.
72
2.2.5.3. Immunoblotting
After blocking, membranes were:
1) washed once with 1x TBS for 30 seconds
2) incubated with the primary antibody (see Table 2.3.1) at RT for 1 – 2 hours, or
overnight at 4°C
3) washed three times with 1x TBS-T, for 15 minutes each wash
4) washed once with 1x TBS for 10 minutes
5) incubated with secondary antibody solution (see Table 2.3.2) for 1 – 2 hours at
RT on a rocker (diluents for secondary incubation are the same as for
corresponding primary antibodies, see Table 2.3.1).
6) washed three times with 1x TBS-T, for 15 minutes each wash
7) washed once with 1x TBS for 10 minutes
8) incubated for one minute with 1mlWestern Lightning Chemiluminescence
reagents (Luminol and oxidising reagents were mixed 1 : 1 immediately prior to
incubation) (Perkin Elmer)
9) Reagent was pipetted off, and membranes were covered in a plastic sheet. Using
a X Ray film-developing cassette (FujiFilm), membranes were exposed to film
for between 10 seconds and overnight (depending on antibody used) and
developed using an X-ray Film processor (AGFA) and Developer G153 and
Fixer G354 reagents (AGFA).
73
2.2.6. Image analyses: Western blotting
Quantification of Western blots was done using the National Institute of Health software ImageJ. Films were scanned at 600 dots per inch, and converted to negative images. A box the size of the largest band (for analyses) was drawn, and this box was used to measure the signal intensity of all band measurements on this film. Four background regions of the same film (randomly placed) were measured, and their average intensity deducted from the signal intensity of each other band measured.
Quantitation of signal intensity was done on three (or more) replicate blots (using independent samples for each blot), except where stated otherwise.
74
Table 2.3.1 Primary antibodies: Western blotting Antibody Antibody Dilution Diluent Species Supplier Name Specificity (Reference) Tropomyosin Antibodies αfast9d Tm1, 2, 3, 6, 1:400 2% skim Sheep Lab reagent 5a, 5b milk (w/v) polyclonal (Schevzov et al., in 1x TBS 1997) CG3 Pan Tm5 1:100 2% skim Mouse Jim Lin (Novy et al., Tm5NM1-11 milk (w/v) monoclonal 1993) in 1x TBS γ/9a Tm5NM5, 6, 8, 1:50 2% skim Sheep Lab reagent 9, 10, 11, 3 milk (w/v) polyclonal (Vrhovski et al., in 1x TBS 2003) γ/9c Tm5NM4, 7 1:200 2% skim Sheep Lab reagent milk (w/v) polyclonal (Vrhovski et al., in 1x TBS 2003) γ/9d Tm5NM1, 2 1:200 2% skim Sheep Lab reagent (Percival milk (w/v) polyclonal et al., 2004) in 1x TBS γ/9d Tm5NM1, 2 1:200 2% skim Mouse Lab reagent milk (w/v) monoclonal in 1x TBS α/9c TmBr1,3 1:100 2% skim Rabbit Jim Lin (Novy et al., milk (w/v) polyclonal 1993) in 1x TBS α/9c TmBr1, 3 1:150 2% skim Mouse Lab reagent (Hannan milk (w/v) monoclonal et al., 1998) in 1x TBS α9b TmBr2 1:50 2% skim Sheep Lab reagent milk (w/v) polyclonal in 1x TBS WD4/9d Tm4 1:200 2% skim Rabbit Lab reagent (Hannan milk (w/v) Polyclonal et al., 1998) in 1x TBS δ1b (44) Tm4 1:10 2% skim Mouse Lab reagent milk (w/v) monoclonal in 1x TBS Tm311 Tm1, 2, 3, 6 1:200 2% skim Mouse Lab milk (w/v) monoclonal reagent(Nicholson- in 1x TBS Flynn et al., 1996)
75
Table 2.3.1 Primary antibodies: Western blotting (continued) Antibody Antibody Dilution Diluent Species Supplier Name Specificity (Reference) Actin and Actin Binding Protein Antibodies: Western Blotting
C4 Pan-actin 1:1000 2% skim Mouse Jim Lessard milk in 1x monoclonal (Lessard, TBS 1988) Glyceraldehyde GAPDH 1:5000 1x TBS Mouse Sigma 3-phosphate dehydrogenase (GAPDH) 1439 serum Total 1:200 1% BSA Rabbit Jim Bamburg ADF/cofilin in 1x polyclonal (Shaw et al., TBS-T 2004) 4317 Serum Phospho 1:200 1% BSA Rabbit Jim Bamburg ADF/cofilin in 1x polyclonal (Shaw et al., TBS-T 2004)
Table 2.3.2. Secondary antibodies: Western blotting Antibody Dilution Supplier Jackson ImmunoResearch HRP donkey anti-mouse 1:5000 Laboratories Jackson ImmunoResearch HRP donkey anti-sheep 1:5000 Laboratories Jackson ImmunoResearch HRP donkey anti-rabbit 1:5000 Laboratories
2.3. Tissue Culture
Parental clone (non-transfected) B35 cells were cultured in parental clone growth media in 100mm dishes, maintained at 37°C with 5% CO2. After transfection and selection,
Tm4 overexpressing B35 cells (and the TmBr1, TmBr2, TmBr3 and Tm5NM1 overexpressing clones and control clones) were cultured in growth media (including the selection agent G418, see Table 2.1.3).
76
2.3.1. Passaging cells
Media was aspirated from cells and cells washed once in warm (37°C) PBS. After aspirating off PBS, cells were incubated in 1ml of 1% trypsin/EDTA at 37°C and 5%
CO2for between 1 and 5 minutes (until cells were detached). An appropriate volume of media was added and the cells typically diluted 1:10 (cell suspension : media), or cell numbers counted for replating (where indicated).
2.3.2. Cryopreservation of cells
Confluent 100mm dishes of cells were harvested with trypsin as per “passaging cells” protocol (see Section 2.3.1). Once detached, cells were suspended in 5ml media (per dish) and transferred to a 10ml falcon tube. Cells were then centrifuged at 300 g at RT for 7 minutes, supernatant aspirated off and cell pellets re-suspended in 2ml media
(parental cells = parental growth media, control or Tm overexpressing cells = growth media, see Table 2.1.3) and then 2ml of freezing media (appropriate growth media with
20% DMSO, see Table 2.1.3) was added dropwise. 500μl aliquots of this solution were pipetted into cryovials, and placed into a polystyrene foam container and frozen at -
80°C until they were transferred to liquid nitrogen for long term storage.
2.3.3. Thawing of cryopreserved cells
Cryovials of frozen cells were thawed quickly at 37°C in a waterbath, and then 1ml of warm growth or selection media added to the cell solution before the entire contents were transferred to a 10ml falcon tube. To this tube 5ml of warm media was added, and the solution centrifuged at 300 g at RT for 7 minutes. Supernatant was aspirated off (to remove DMSO), and the remaining pellet was re-suspended in 1ml media and 77
transferred to a 100mm dish containing 9ml media which had been incubated at 37°C in
5% CO2for at least 20 minutes. Cells were then cultured at 37°C and 5% CO2for 24 hours before media was changed.
2.3.4. Stable transfection
Four 100mm dishes (labelled A, B, C and D) of B35 parental clone cells (B35 cells not transfected with any construct) were plated at a density of 1.5 x 105 cells in 10ml parental growth media, and after 24 hours incubation at 37°C and 5% CO2, cells (at 40-
50% confluency) were transfected with the Tm4-PG307 expression construct using
Fugene (Roche) according to manufacturer’s instructions. A pilot transient transfection indicated a 6:1 ratio of Fugene reagent (μl): DNA (μg) was optimal. 36μl Fugene reagent : 6μg Tm4-PG307 expression per 100mm dish was used for transfection. Dishes were incubated at 37°C and 5% CO2 for 24 hours before being passaged 1:20 (i.e. cell solution from 1 dish was split and transferred to 20 new dishes) into 37°C parental growth media. These 80 dishes were incubated for a further 24 hours at 37°C and 5%
CO2 before media was changed to selection media (see Table 2.1.3). After 48 hours, those dishes originating from the C and B dishes of transfected parental clone cells were near 90% confluency, whereas those originating from A and D dishes were closer to
20% confluency. As successful transfection induces some proportion of toxicity, it was presumed the B and C dishes did not transfect efficiently, and only the A and D dishes continued to be cultured. These 40 dishes were cultured in selection media, with media changed every 48 hours a total of six times. 48 hours after the final media change colonies of between 10 and ~200 cells were visible under a light microscope.
78
2.3.5. Colony picking of transfected cells
Dishes of transfected cells were viewed at 10x magnification under a light microscope, and visible colonies of between 10 and ~150 cells which were clearly independent of other cellular growth were circled from below with a pen (marking the underside of each dish). Colonies were picked in one of two ways:
Pipetting method: In a biological safety cabinet, media was aspirated off and cells were washed with PBS. PBS was aspirated off, but a fine film of liquid was left still covering the adherent cells. A 200μl pipette was then used to pipette the contents of these colonies up and down, whilst scraping the pipette along the dish surface within the border of the circle. Those colonies which had been circled then had their contents pipetted up, to a total volume of 100 μl, and transferred to one well (per colony) of a 24- well plate. Each well of this plate contained 1ml selection media which previously had been incubated at 37°C and 5% CO2 for 30 minutes.
Colony cylinders: Colony cylinders were fashioned from blue (1ml) pipette tips, by using a razor to cut a cylinder ~1cm in height from the wide end of the tip. These cylinders were autoclaved, as was a glass dish coated with vacuum pump grease (Dow
Corning). In a biological safety cabinet, 100mm dishes containing transfected B35 cells were washed once with PBS, which was entirely aspirated off. Using forceps, an autoclaved colony cylinder was generously coated (base down) in the vacuum grease, and then placed on the dish to surround a circled colony. 100μl of RT Trypsin-EDTA was pipetted into the middle of the cylinder, and allowed to incubate for 2 minutes at
RT. This cell suspension was then pipetted up and transferred to one well (per colony) of a 24-well plate containing 1ml selection media which previously had been incubated at 37°C and 5% CO2 for 30 minutes. 79
Between one and five colonies per dish were picked for a total of 24 colonies picked in these ways, and these colonies were grown to confluency in selection media (taking between four and 14 days) before being trypsinised and passaged 1:2 between two wells, each well on a different 6 well plate (each well containing 3ml selection media).
Cells took 48 hours to reach confluency, and once confluent, cells from one well were frozen into stocks for later use, and cells from the other well were lysed and protein harvested for further analyses.
2.3.6. Growth curve analysis
Growth curve analyses of Tm4 high overexpressing and control cells were done three times, under different conditions. In each experiment, cells were cultured in 24-well plates, with each well area = 1.8cm2 per well.
Experiment 1: Cells were plated at a density of 1x103cells per well, three wells per clone per 24 hours, for a planned total of seven days worth of wells (21 wells) per clone.
Cells were cultured in growth media, and after plating were incubated for 24 hours at
37°C and 5% CO2 before three wells of each clone were sampled. Wells were washed twice with PBS, incubated with 75μl trypsin for 1 minute at 37°C and 5% CO2, and each well mixed thoroughly by pipetting before 10μl of cell suspension was transferred to a haemocytometer (Neubauer). Cells were counted separately for each well, giving n
= 3 wells per clone per day for a total of seven days. Numbers of cells per well were averaged over three wells per day and Student’s t-test analyses done comparing the means of control and Tm4 overexpressing cells.
80
Experiment 2: As for Experiment 1, except that 600 cells per well were initially plated, and media on each well was changed every 24 hours. Cells were sampled every 24 hours over seven days.
Experiment 3: As for Experiment 1, except that 600 cells per well were initially plated, and two treatments were included: 1) media changed daily, and 2) no media change. A total of 45 wells per clone were plated, and cells were sampled every 24 hours over 15 days.
2.4. Immunofluorescence
Cells were plated out at a density of 1x103 cells per coverslip in 24-well plates. Cells were incubated for 24 hours at 37°C and 5% CO2, either in growth media or induction media depending on experimental treatment (see Chapters 4 and 5 for details). Cells were fixed as follows:
1) washed twice with 37°C RT 1x PBS
2) incubated with 4% paraformaldehyde in 1x PBS for 15 minutes at RT
3) washed twice with RT 1x PBS
Either the 1x PBS was left on coverslips (if plates were sealed with parafilm and stored at 4°C for later use), or the second 1x PBS wash was aspirated off and cells were:
4) permeabilised with cold (-80°C stored) methanol for 15 minutes at RT
5) washed twice with RT PBS
6) incubated in blocking solution (blocked) for 30 minutes with 2% FBS in 1x PBS
solution at RT
7) washed once with RT 1x PBS
81
8) incubated with primary antibodies diluted in blocking solution (see Table 2.6.1)
overnight at 4°C
9) washed three times with 1x PBS
10) incubated with secondary antibodies diluted in blocking solution (see Table
2.6.2) for one hour at RT, and protected from light
11) washed twice with 1x PBS
12) incubated with DAPI in 1x PBS (1 : 10,000 dilution) for 2 minutes (to stain
nuclei)
13) washed once in 1x PBS
14) washed once in Milli-Q element (Millipore) purified water (MQ water)
15) coverslips were mounted upside-down onto glass slides using Fluorsave reagent
(CalBioChem)
16) edges of coverslips were sealed to glass slides using clear nail polish (Amcal),
and left to dry in the dark. Coverslips hereafter were kept protected from light to
prevent bleaching of fluorophores.
Table 2.4.1 Primary antibodies: immunofluorescence Antibody Antibody Dilution Species Supplier (Reference) Name Specificity Tropomyosin Antibodies WD4/9d Tm4 1:500 Rabbit Lab reagent (Hannan polyclonal et al., 1998)
Actin and Tubulin Antibodies AC74 β-actin 1:1000 Mouse Sigma Aldrich monoclonal (Gimona et al., 1994) γ-actin γ-actin 1:1000 Sheep (Schevzov et al., 2005) polyclonal DMIA α-tubulin 1:8000 Mouse Sigma-Aldrich monoclonal 82
Table 2.4.2 Secondary antibodies: immunofluorescence Antibody Dilution Supplier Alexa-488 donkey anti-mouse IgG 1:1000 Molecular Probes Alexa-488 donkey anti-sheep IgG 1:1000 Molecular Probes Alexa-488 donkey anti-rabbit IgG 1:1000 Molecular Probes Jackson ImmunoResearch Cy3 donkey anti-mouse IgG 1:1000 Laboratories Jackson ImmunoResearch Cy3 donkey anti-sheep IgG 1:1000 Laboratories Jackson ImmunoResearch Cy3 donkey anti-rabbit IgG 1:1000 Laboratories
2.5. Isobaric tagging and relative and absolute quantitation (iTRAQ):
2.5.1. Sample preparation
Isobaric Tagging and Relative and Absolute Quantitation (iTRAQ) was done in two separate experiments. The first experiment comprised lysates of Tm4 (clone #A3.1),
Tm5NM1 (clone #314.9), and TmBr2 (clone #2.8) overexpressing cells, and control cells. The second experiment comprised lysates of control, Tm4 (clone #A3.1), TmBr1
(clone #1.9), and TmBr3 (clone #3.5) overexpressing cells. Duplicate samples of each clone in each experiment were made by culturing cells from two separate freeze-down cryovials per clone per experiment, and samples were lysed independently of each other. Lysates for all 16 samples were prepared by seeding four 100mm dishes per
5 lysate at 5 x 10 cells/dish, and incubating each at 37°C and 5% CO2 for 24 hours.
Dishes were lysed as described in Section 2.3.2 using iTRAQ lysis buffer. By using five dishes per clone per lysate, the cells of five dishes were combined into one sample to ensure a sufficient total protein yield for experimentation (i.e. more concentrated than
1μg/μl) and total protein yield (i.e. greater than 115μg total: 100μg for iTRAQ labeling,
83
5μl for BCA protein concentration determination, and 10μl for gel Coomassie staining).
In the first experiment, all lysates were aliquotted and frozen on dry ice immediately post lysing, and stored at -80°C. In the second experiment, all samples were kept on ice,
BCA assayed immediately, and each sample was diluted to give an estimated protein concentration of 1mg/ml. 15μg of each sample was then run on a 12.5% low bis- acrylamide gel (see Table 2.2) at 130V for one hour, then stained immediately in
Coomassie G250 staining solution for two hours before being destained for five hours.
In each experiment, resulting gels indicated approximately equal protein loading among all samples.
2.5.2. iTRAQ reporter ion labelling
The following experiments were done in the Bioanalytical Mass Spectrometry Facility at UNSW, with the assistance of Dr Anne Poljak.
100μl of each lysate (1μg/μl) was adjusted to pH 8 by addition of 500mM sodium bicarbonate (~3μl per sample). This was to ensure that the pH was optimal (between pH
7 and pH 9) for trypsin digestion. 2μl of tris-(2-carboxyethyl) phosphine (TCEP) was added to each sample. All samples were incubated at 60°C for 60 minutes. 1μl of iodacetamide (37mg/ml) was then added to each sample, which was then mixed by vortexing, and samples were centrifuged briefly and incubated at RT for 10 minutes.
400ng Porcine trypsin (Promega) (reconstituted in MQ water) was added to each sample, and all samples were incubated overnight at 37°C. Samples were centrifuged for 4 minutes at RT and15,000g then their pH adjusted with sodium bicarbonate to between pH 9 -10, to optimise iTRAQ labeling. iTRAQ reporter labels were allowed to reach RT (from -20°C storage) before each being added to 50μl isopropanol, vortexed for 1 minute, and centrifuged briefly. One reporter label/isopropanol mix was added 84
(entire volume) to one trypsin digested cell lysate (as per Table 5.1 “Autobias Ratios”, see Chapter 5). All samples were vortexed and incubated at RT for 60 minutes.
Meanwhile, a strong ICAT cation exchange micro column cartridge (Applied
Biosystems) was loaded into a cartridge kit, and using a syringe pump (KD Scientific) was primed with 1ml “clean” exchange buffer and 2ml “load” buffer consecutively
(“clean”, “load” and “elute” buffers are ICAT column kit reagents, Applied
Biosystems). All buffer was pumped through the cation exchange cartridge at
9.5ml/hour.
After incubation, all 8 samples (per experiment) were combined into one 1.5ml tube.
This was then added to 12.6ml cation exchange “load” buffer, to reduce the concentration of buffer salts. The resulting ~14ml of pooled sample and buffer was loaded, 1ml at a time, onto the cation exchange cartridge via the syringe pump. Once complete, 1ml of “load” buffer was loaded onto the cartridge. All flowthrough was collected, pooled and stored at 4°C. The digested peptides were eluted off the cartridge with 500μl of cation exchange “elute” buffer. The eluate (“A”) (in a 1.5ml tube) was then dried in a speedvac for 3 hours.
The remaining pellet and 40μl solution was re-suspended in 500μl 0.2% hepta- fluorobutyric anhydride (HFBA) in MQ water. This sample was then passed onto a
Macrotrap (MichromBioresources) cartridge, which had been primed with 1ml acetonitrile followed by 1ml acetonitrile/0.1% formic acid (in MQ water). The cartridge was loaded with 0.2% HFBA (in MQ water) before being loaded with the re-suspended sample pellet. The cartridge was then washed with 1ml 0.2% HFBA, and the flowthrough (“B”) was kept. Following this, the cartridge was eluted with 500μl 0.1% formic acid/50% acetonitrile then a further 200μl acetonitrile. Eluates were pooled as
85
700μl total in a 1.5ml tube. While this sample was speedvac drying, the flowthrough
“B” was passed through an Oasis cartridge (Waters Micromass), which had been primed in the same method as the Macrotrap, with volumes 4 times greater (e.g. 4ml acetonitrile etc.). After the 1ml of flowthrough “B” was passed through the cartridge, elution buffer of 1ml 0.1% formic acid/50% acetonitrile, and then a further 400μl of acetonitrile was passed through the cartridge and recovered. This 1.4ml was added to the previously speedvac-dried eluate (“A”), and the mixture was again speedvac dried before the pellet was re-suspended in 0.05% HFBA and 1% formic acid. This sample was kept at -80°C before being analysed by liquid chromatography tandem mass spectrometry (LC-MS/MS).
2.5.3. iTRAQ: Liquid chromatography – tandem mass spectrometry (LC-MS/MS) analyses
High voltage (2300 V) was applied through a low volume tee (Upchurch Scientific) at the column inlet and the outlet positioned 1cm from the orifice of an API QStar Pulsar i hybrid tandem mass spectrometer (Applied Biosystems). Positive ions were generated by electrospray and the QStar operated in information-dependent acquisition mode. A
Tof (time of flight) MS survey scan was acquired (m/z 350–1700, 0.75 s) and the three largest multiply-charged ions (counts 420, charge state ≥2 and ≤4) sequentially selected by Q1 for MS/MS analysis. Nitrogen was used as collision gas and an optimum collision energy automatically chosen (based on charge state and mass). Tandem mass spectra were accumulated for up to 2.5 s (m/z 65–2000) with two repeats (technical replicates). In each experiment, one lysate was analysed twice by LC-MS/MS, giving a total of four technical replicates (two per lysate, with two lysates per clone per
86
experiment) (see Figure 2.2). All data were sorted and analysed using ProteinPilot software.
87
Figure 2.2 iTRAQ sample preparation and experimental design
.
88
Figure 2.2 Workflow illustrating iTRAQ procedure. Note that diagram illustrates one experiment only. Two experiments were done; the second experiment analysed control, Tm4, TmBr1, and TmBr3 overexpressing cells. Diagram illustrates reporter ion tagging of one peptide per sample only; in total >10,961 distinct peptides were tagged and identified in Experiment 1. Throughout the text, one “run” is considered the analysis of one biological replicate within one technical replicate.
2.6. Flow cytometry and cell cycle analyses
2.6.1. Sample preparation
Control, Tm4 (clone #A3.1) and TmBr2 (clone #2.8) overexpressing cells were plated at a density of 5 x 105 cells per 100mm dish in 10ml growth media. Nine dishes per clone per experiment were plated out. After 24 hours incubation at 37°C and 5% CO2, three dishes of cells per clone were harvested (see Section 2.6.2) (“uninduced” samples) and the other six dishes per clone were treated with 10ml induction media per dish and incubated at 37°C and 5 %CO2. Of these six dishes per clone, three were harvested 24 hours after addition of the differentiation media (“24 hours induced” sample) and the other three harvested 48 hours after addition of the differentiation media (“48 hours induced” sample). This experiment was done a total of three times.
2.6.2. Cell harvesting for analysis
Cells were trypsinised and counted, and 1 x 106 cells were transferred to a 15ml centrifuge tube. PBS up to 10ml total volume was added. Cells were centrifuged at between 400 and 1,000 g for 20 minutes at RT. The supernatant was discarded, and the pellet was transferred to a 1.5ml centrifuge tube. Pellets were then re-suspended in
300μl of PBS, before adding 100μl of 5% Triton-X100, 50μl 25mg/ml RNaseA and
50μl 0.5mg/ml Propidium Iodide. Suspensions were mixed after addition of each reagent. These stained cell samples were incubated on ice for 1 hour, before samples 89
were analysed using a FACSCalibur (Becton Dickinson) machine, and after gating,
10,000 events/sample were analysed. CellQuest software (Becton Dickinson) was used for data acquisition, and FlowJo software was used for further analyses.
2.7. Two dimensional gel electrophoreses
Running of two dimensional gel electrophoresis (2D-GE) and Western blotting was done with the assistance of Dr. Alamgir Khan and Mrs.Vidya Nelaturi at the Australian
Proteomic Analysis Facility.
Three mouse embryo (E16.5) brains were removed and lysed together (see Section
2.2.1) in 2D Gel buffer, and protein concentration estimated by Bradford assay (Sigma-
Aldrich) as 3.5μg/μl. 35μl (122.5μg) of sample was added to a further 170μl of 2D buffer.
The sample was then reduced in 5mM Tributyl phosphine and alkylated in 10mM acrylamide for 60 minutes to break disulphide bridges between cysteine residues and to prevent their reforming. Reduced and alkylated samples were centrifuged at 20,000 g for 10 minutes at 20°C prior to loading on 2 separate pH 4.0 – 7.0 IPG strips (Sigma-Aldrich) by rehydration method. The focused IPG strips were equilibrated for 15 minutes twice in equilibration buffer, then run on one Criterion 10-20 % Tris-HCl second dimension gel each
(BioRad). The gels were run at 5mA/gel for 20 minutes then at 40mA/gel for 2.5 hours until
30 minutes after the bromophenol blue dye front had run off the bottom of the gels.
Gel 1: In the marker lane, 5μl (17μg) of sample was added to 10μl of Laemmli sample buffer and loaded. This was run alongside one of the rehydrated IPG strips. This gel was used for Western blotting.
Gel 2: In the marker lane, 3μl of Precision Unstained marker (BioRad) was loaded. This was run alongside the second re-hydrated pH 4.0 -7.0 range IPG strip. This gel was used for total staining with SYPRO Ruby stain (Sigma Aldrich).
90
Gel 1 was used for Western Blotting with the WD4/9d antibody. Gel 1 was transferred to a
PVDF membrane for 60 minutes at 300mA using the Semi-Dry blotting system (BioRad).
The membrane was blocked in 2D gel blocking solution at RT for 1 hour. The WD4/9d antibody was diluted 1:100 and the blot was incubated in primary antibody overnight at 4°C followed by half an hour at RT. The membrane was then washed 3x 1 minute and 3x
10minute washes in 2D WB washing solution. The membrane was incubated in secondary antibody for 60 minutes at RT, and washed as described for the primary antibody. The blot was exposed to Western Lightning Chemiluminescence reagents (Luminol and oxidising reagents were mixed 1 : 1 immediately prior to incubation) (Perkin Elmer) at RT for 5 minutes and the image was captured on a CCD camera LAS 3000 (FujiFilm) with a 5 minute exposure.
Gel 2 was fixed in Fix/Destain solution for 1 hour then stained with SYPRO Ruby fluorescent stain overnight. The gel was destained for 4 hours in Fix/Destain solution and for 1 hour in 1% (v/v) acetic acid before imaging. The gel was scanned using the Typhoon
Laser Scanner (GE Healthcare).
2.8. Molecular Biology
2.8.1. General techniques: agarose gel electrophoresis
1-1.5% agarose gels were made by dissolving 0.5-0.75g agarose in 50ml 1xTAE, pouring into a gel mould. For larger gels, volumes were scaled up to 120ml. A 1 :10 volume of 10x DNA sample buffer was added to each DNA sample, and samples were loaded into wells. Gels were immersed with 1x TAE and run at 100V for 1hour. Gels were stained in 0.5μg/ml ethidium bromide in 1x TAE for >20 minutes, and destained in water for >5 minutes. Images of gels were taken using a GelDoc (BioRad).
91
For low-melt agarose gels, 0.8% gels were made by dissolving 0.4g high purity low- melt agarose in 50ml of 1x TAE. Samples were prepared and loaded as described previously, and gels were run at 70 volts for 1-1.5hours.
2.8.2. Purification of DNA fragments
Restriction digests were electrophoresed on a 0.7% high purity low-melt agarose gel at
70V for 1hour, stained with 0.5μg/ml ethidium bromide in TAE for >20 minutes, and destained in water for >5 minutes. Fragments of interest were cut out of the gel under a
UV light box, and purified using the Wizard Gel Purification Kit (Promega), following the manufacturer’s instructions. Samples were eluted with 50μl TE buffer.
2.9. Bacterial Work
2.9.1. Preparation of electrocompetent cells
A 500ml flask of LB media was inoculated with 5ml overnight culture of DH5α cells.
Cells were grown at 37°C with shaking for approximately 4h, until an OD600 of 0.5 was reached. Culture was chilled on ice for 20min, then centrifuged at 4,000 g at 4°C for 15 minutes. The supernatant was discarded, and cell pellets were re-suspended in 500ml of cold water. Cells were centrifuged again at 4,000 g at 4°C for 15min, supernatant was removed and cell pellets were re-suspended in 250ml cold water. Cells were centrifuged again at 4,000 g at 4°C for 15min, supernatant was removed and cell pellets were re-suspended in 20ml cold 10% glycerol. Cells were centrifuged a final time at
4,000 g at 4°C for 15min, supernatant was removed and cell pellets were re-suspended in 2ml cold 10% glycerol. Cells were aliquotted into 90μL volumes, frozen on dry ice, and stored at -80°C.
92
2.9.2. Transformation of bacteria
2.9.2.1. Electroporation
Electrocompetent DH5α or HB101 Escherichia coli cells (which had been stored at -
80°C) were thawed on ice. One μl DNA was added to 40μl cells and incubated for 1-2 minutes before the mixture was transferred to a pre-chilled electroporation cuvette.
Electroporation was performed in a GenePulserII (BioRad) at 25kV, 25μF capacitance and 200Ω resistance. A time constant of approximately 5ms indicated successful transformation. After electroporation, 1ml of LB media was added, and cells were transferred to a 15ml tube. After a 60minute recovery period with shaking at 37°C, cells were plated onto LB agar/ampicillin (100μg/ml) plates.
2.9.2.2. Heat shock
Heat shock competent XL1-Blue cells (made by Dr. Steve Palmer and Ms. Kylie
Taylor) were thawed quickly on ice. The entire ligation (10μl) or 1μl plasmid DNA was added to 50μl cells and incubated on ice for 5 minutes. The cells were heated in a 42°C waterbath for 30 seconds, and transferred back to ice. Cells then had 100μl LB media
(no antibiotic) added, and were immediately put into a shaking incubator at 37°C, 250 rpm. After a 90 minute recovery period with shaking at 37°C, cells were plated onto LB agar/ampicillin (100μg/ml) plates.
93
2.9.3. Purification of DNA
2.9.3.1. Minipreps
Single bacterial colonies were picked and grown overnight in 2ml LB media containing ampicillin (100μg/ml). 2ml culture was centrifuged for 5 minutes at RT and 12,000 g, supernatant discarded, and the pellet re-suspended in 100μL solution 1 (see Table 2.1.3 for solution recipes). After 5 minutes incubation at room temperature, 200μl solution 2 was added, and samples were gently mixed. After 5 minutes incubation on ice, 150μl ice cold solution 3 was added, and samples mixed vigorously (but not vortexed). After
5 minutes incubation on ice, samples were centrifuged for 5 minutes at 16,000 g at RT.
Supernatant was transferred to a new tube, and 900μL ethanol was added. Samples were incubated on dry ice for 10 minutes, then centrifuged for 15 minutes at 16,000 g at
RT. The DNA pellet was washed with 200μl 70% ethanol and centrifuged at 16,000 g at
RT for a further 2 minutes. The pellet was air dried for 30 minutes, then re-suspended in
50μl TE. DNA concentration and purity was calculated using a spectrophotometer
(Beckman) to measure A260 and A280.
For clean minipreps for sequencing reactions, bacteria were grown and pelleted as above. Minipreps were then performed using a QIAprep Spin Miniprep Kit (Qiagen), following the protocol described in the manufacturer’s protocol. Pellets were re- suspended in water, and DNA concentration was determined as above.
2.9.3.2. Midipreps
Single bacterial colonies were picked in the evening and grown overnight (for approximately 8h) in 2ml LB media containing ampicillin (100μg/ml). These were used to inoculate overnight cultures in 400ml LB media containing ampicillin (100μg/ml) in 94
a conical flask, agitated by shaking. Midipreps were then performed using a QIAfilter
Plasmid Midiprep Kit (Qiagen), following the manufacturer’s protocol. Pellets were re- suspended in TE buffer. A spectrophotometer was used to measure A260 and A280 and
DNA concentration was calculated according to the formula:
DNA concentration (mg/ml) = A260 x 50 x dilution factor
DNA was estimated as being pure enough to proceed if the ratio of A260/ A280 was between 1.8 and 2.0.
2.9.4. Cloning rat Tm4 into a mammalian expression vector
2.9.4.1. PCR for cloning
Rat Tm4 cDNA in a bacterial expression vector was used as template for polymerase chain reactions (PCR). Primers for this PCR incorporated the SalI and NotI restriction sites at the 5' end of the transcript and a BamHI site at the 3' end of the transcript to facilitate cloning (see Table 2.5.2).
Table 2.5.1: Molecular biology enzymes and buffers Enzyme Manufacturer/Supplier BamHI Roche Applied Science, Dee Why NSW Australia DNAse Invitrogen Australia, Mt Waverly VIC Australia EcoRI Roche Applied Science, Dee Why NSW Australia
HindIII Roche Applied Science, Dee Why NSW Australia M-MLV RT (H-) enzyme Promega, Alexandria NSW Australia
SalI Roche Applied Science, Dee Why NSW Australia T4 DNA ligase Invitrogen Australia, Mt Waverly VIC Australia
95
Note that buffers for restriction enzyme digestion (“H” and “B” buffers) also supplied by Roche Applied Science Dee Why NSW Australia; M-MLV RT (H-) enzyme buffer supplied by Promega; and T4 DNA Ligase buffer supplied by Invitrogen.
Table 2.5.2. Primers for rat cDNA amplification by PCR Direction Primer Sequence 5' to 3' (restriction sites underlined, start and stop codons in bold) Forward: 5'TAC GT CGA CC ATG GCC GGC CTC AAC TCA C 3' (with SalI site underlined), start codon in bold Reverse: 5'GCGC GGA TCC TTA TAT ACA GTT AAG TTC G 3' (with BamHI site underlined), stop codon in bold Forward primer is on the plus strand, reverse primer is on the minus strand and resulting sequence must be reversed and complemented to obtain forward sequence
PCR reactions were set up in 50μl volumes as follows:
Final Concentration 10x PCR Buffer 5μl 1x
Magnesium Chloride 3μl 2mM dNTPs (10mM stock) 1μl 0.2mM
Forward primer (100pmol/μl) 1.5μl 150pmol
Reverse primer (100pmol/μl) 1.5μl 150pmol
Amplitaq polymerase 0.2μl 1 unit
Template DNA 1μl 50ng
Autoclaved MQ Water 39μl
96
Reactions were then cycled using the following protocol:
Initial denaturation: 95ºC for 10 minutes 5 cycles of: Denaturing: 95ºC for 30 seconds Annealing: 60°C for 45 seconds Extension: 72ºC for 45 seconds 30 cycles of: 94ºC for 30 seconds 65°C for 45 seconds 72ºC for 45 seconds Final extension step: 72°C for 5 minutes.
PCR products were run on 0.8% high purity low-melt agarose gels at 80V and stained with ethidium bromide, and those bands corresponding to ~769bp in size (rat Tm4 insert size) were excised and purified using the Wizard Gel purification kit (Promega), and cloned into the pGEM-T Easy vector following the manufacturer’s protocol described in the pGEM-T Easy Vector System I Kit (Promega).
pGEM-T/Tm4 vectors were transformed into E. coli cells using electroporation, and resulting cell suspensions (either 20μl or 200μl per plate) smeared onto LB agar/ampicillin (100μg/ml) plates, along with untransformed cells on separate LB agar/ampicillin (100μg/ml) plates (to confirm antibiotic function). All plates were incubated at 37°C overnight. Colonies were then picked from one plate of transformed bacteria and grown up in 2ml LB media with ampicillin (100μg/μl) at 37°C overnight with shaking. 50μl of these cell suspensions were left at 4°C, and the remaining volume had DNA purified by miniprep.
97
Figure 2.3: Plasmids maps of expression vectors used in this study
A
B
PG307 10.9kb
Fig. 2.3: Plasmid maps of the vectors used in this study for cloning and expression of Tm isoforms. pGEM-T Easy (A) was used for cloning of PCR products (Figure from Promega). The phβAPr-4 (sig-) vector (PG307),was used for expression in mammalian cells under control of a human β-actin promoter (B) (Figure courtesy of Claire Martin). Multi cloning sites (MCS) are shown for both.
98
Table 2.6.1 Plasmid vectors Name Size Promoter Resistance Used For Supplier/Reference pGEM-T 3 kb lacZ Ampicillin Cloning of Promega Easy PCR products PG307 10.9 kb β-actin Ampicillin Mammalian (Qin and Gunning, expression 1997) Description of plasmids used for cloning and expression.
2.9.5. Sequencing reaction
Purified DNA of pGEM-T/Tm4 was sequenced using primers (T7 and SP6, see Table
2.6.2) for either side of the MCS in the pGEM-T easy vector (see Figure 2.3).
Sequencing was done by the Australian Genome Research Facility (AGRF), Westmead
Millenium Institute, Westmead NSW.
Table 2.6.2. Primers for sequencing pGEM-T/Tm4 Primer name Target sequence Primer sequence (5' – 3') in gene / vector T7 pGEM-T 5' MCS TAATACGACTCACTATAGGG (forward) SP6 pGEM-T 3' MCS ATTTAGGTGACACTATAGAA (reverse)
2.9.6. Restriction digests
Purified DNA was digested by SalI and BamHI enzymes sequentially. Simultaneously, in different reactions, empty PG307 vector (purified by MidiPrep, Qiagen) was linearised by digestion with SalI and BamHI enzymes. Each was digested in the following reactions:
99
Vector digest: pGEM-T/Tm4 pGEM-T/Tm4 DNA 16.7μl (40μg) SalI enzyme 2μl ‘H’ buffer (Roche) 5μl MQ water 23.7μl
Vector digest: PG307
PG307 6.5μl (10.4μg) SalI enzyme 2μl ‘H’ buffer (Roche) 5μl MQ water 36.5μl
These reactions were incubated at 37°C for 1.5 hours before the following was added to each:
BamHI enzyme 2μl ‘B’ buffer (Roche) 5.5μl
Reactions were left for a further 1.5 hours at 37°C. After this time, the pGEM-T/Tm4 digest was run on a 0.8% low-melt agarose gel and the Tm4 insert excised, gel-purified, and phenol : chloroform-cleaned.
2.9.7. Phenol : chloroform cDNA clean-up
Restriction digest reactions were added to MQ water to a total of 100μl. 10μl of 3M
Sodium acetate (as a “carrier salt”) was added, followed by 100μl of phenol:chloroform, and tube inverted to mix 5 times. Solution was centrifuged at 16,000 g for 5 minutes at
RT, and supernatant (aqueous phase and DNA) was recovered. 3x the supernatant volume of cold (-20°C) ethanol was added, and solution left on dry ice for 20 minutes or at -20°C for one hour. Solution was centrifuged at 16,000 g for 20 minutes, and 100
supernatant discarded. 500μl of 70% ethanol was added to the remaining pellet, and solution then centrifuged at 16,000 g at RT for 5 minutes, before repeating the wash.
Supernatant was discarded, and the remaining pellet air dried for 30 minutes. Pellets were re-suspended in 20-30 μl TE buffer with 1μl RNAse/sample. These samples had
DNA concentrations estimated by spectrophotometer (NanoDrop) and were stored at
4°C (for use within 3 days) or at -20°C.
2.9.8. DNA Ligation
The Tm4 insert digested from the pGEM-T easy vector was ligated into the pHβAPr-4
(PG307) vector (see Figure 2.3) using the T4 DNA ligase enzyme in an 11μl reaction as follows:
2μl digested vector (PG307) DNA 6μl digested insert (Tm4) DNA 2μl 5x ligase buffer 1μl T4 DNA ligase enzyme
The reaction was incubated at 16°C overnight. After incubation, ligations were transformed into E. coli by electroporation. Cultures were prepared by MidiPrep
(Qiagen), and cDNA sequenced using a set of six primers (see Table 2.6.3).
101
Table 2.6.3 Primers for DNA sequencing of rat Tm4 in PG307. Direction Sequence (5' – 3') Forward 5' TAC GT CGA CC ATG GCC GGC CTC AAC TCA C 3'
Forward 5' AGC TGG AGG AGG CAG AGA AG 3'
Forward 5' CAC TGG AGG CTG CTT CTG 3'
Reverse 5' GCT CGG TTC TCT ATC ACC TTC 3'
Reverse 5' T CCG CAA ACTCAGCTCG 3'
Reverse 5' GCGC GGA TCC TTA TAT ACA GTT AAG TTC G 3'
Forward primers are on the plus strand, reverse primers are on the minus strand and resulting sequence must be reversed and complemented to obtain forward sequence. All primers are within the rat Tm4 cDNA sequence.
2.9.9. PCR analyses of mouse brain Tm4
2.9.9.1. RNA trizol extraction
One female mouse adult cerebellum (stored at -80°C) was removed from storage, and refrozen on liquid nitrogen. 2ml TRI Reagent (Sigma Aldrich) was added at RT before tissue was homogenised using a probe tissue homogeniser (Pro200, ProScientific) on setting ‘1’ for 1 minute. 400μl chloroform was added, and the sample kept on ice before being vortexed for 1 minute. After 15 minutes incubation on ice, samples were centrifuged for 15 minutes at 4°C at 18,000 g before the clear supernatant was added to an equal volume of 70% ethanol. This solution was pipetted to mix, and incubated at -
20°C for 1.5 hours. Samples were vortexed, and 700μl of each used for RNA extraction by an RNEasy Mini Kit (Qiagen) according to the manufacturer’s instructions.
102
2.9.9.2. cDNA library transcription
cDNA was transcribed from mouse cerebellum extracted RNA (see Section 2.10.1) using the M-MLV RT (H-) enzyme and 5x reaction buffer (Promega) as follows:
In a sterile, RNAse free 1.5ml centrifuge tube, the reaction was set up:
1μl (500ng) Random Hexamers (500μg/ml, Promega) 1.5μl (1μg) Mouse cerebellum RNA 12.5μl Double distilled water
This reaction was heated to 70°C for 5 minutes (to melt secondary structure within the
RNA template), then incubated on ice for 5 minutes (to prevent secondary structure from reforming). To this reaction the following was added:
5μl M-MLV RT (H-) 5x reaction buffer (Promega) 0.5μl dNTP 10mM mix 1μl M-MLV RT (H-) enzyme (Promega) 4.5μl nuclease free water
This reaction was incubated at 55°C for 60 minutes, then at 70°C for 15 minutes.
This cDNA was then used as template for PCR of the mouse Tm4 product from two different primers within the mouse Tm4 gene (see Table 2.6.4).
103
Table 2.6.4 Primers for amplification of internal mouse Tm4 fragment Direction Primer Sequence (5' to 3') Position in gene Forward 5' CGGAGGTATCTGAACTAAAGTGTG 3' Crossing exons 5 and 6b Reverse 5' CTGGAGTGGAGTTGGTG 3' 3' UTR Forward primer is on the plus strand, reverse primer is on the minus strand and resulting sequence must be reversed and complemented to obtain forward sequence. These primers are within the mouse Tm4 gene sequence.
These primers span a region of 350 base pairs (bp) in the mouse Tm4 gene. These primers were used to amplify transcripts from mouse cerebellum cDNA, with reactions set up as follows:
10μl EconoTaq PLUS Green (Lucigen) 0.1μl Template mouse cerebellum cDNA 0.1μl (10pmol) Forward primer 0.1μl (10pmol) Reverse primer 10μl Nuclease free water
Transcripts were then amplified by PCR using the following protocol: Initial denaturation: 94ºC for 2 minutes, then 36 cycles of: Denaturing: 94ºC for 30 seconds Annealing: 55°C for 30 seconds Extension: 72ºC for 45 seconds Final extension step: 72°C for 5 minutes
PCR products were run on 0.8% high purity low-melt agarose gels, bands were excised and phenol : chloroform cleaned before being either sequenced directly, or cloned into the pGEM-T Easy Vector before sequencing. These reactions were sequenced by the
Ramaciotti Sequencing Centre, UNSW.
104
2.9.10. Sequence analyses
Tm DNA and protein sequences were obtained from the National Center for
Biotechnology Information (NCBI) nucleotide and protein databases found at http://www.ncbi.nlm.nih.gov/, run by the National Center for Biotechnology
Information, U.S. National Library of Medicine. DNA sequence alignments to confirm sequence of cloned Tm isoforms were performed using the NCBI BLAST program
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). Protein alignments for comparison of different
Tm isoforms were performed using the SIM – Alignment tool on the ExPASy
Proteomics Server (http://www.expasy.ch/tools/sim-prot.html) run by the Swiss
Institute of Bioinformatics.
2.9.11. DNA denaturing acrylamide-urea gels
7.5% acrylamide-urea gels were made up (see below for recipe) and poured into glass
1mm plates (BioRad) with no stacking solution; a 10 well comb was placed directly into the liquid denaturing acrylamide-urea gel. When making this gel, the urea, acrylamide and water were combined, then heated to 65°C (for 20 seconds on “high” in a microwave) and, once the solution was clear, passed through a 45μm syringe filter. The freshly made 10% APS and TEMED was added to this filtered solution before gels were poured. Once set, the gel was run using TBE as running buffer for 30 minutes at 200V
(with no samples loaded). Using capillary pipette tips, each well had TBE pipetted thoroughly throughout to displace excess urea. Samples were diluted in acrylamide-urea
DNA denaturing sample buffer, and 50bp DNA ladder (Invitrogen) was made up with the same sample buffer. Once mixed with sample buffer, samples (and ladder) were heated at 65°C for 5 minutes (to denature DNA) and then put directly onto ice (to stop
105
denatured DNA from re-annealing). Gels were run for 1.5 hours at 200V before being stained in ethidium bromide staining solution for 5 minutes, and destained in water for
20 minutes before visualising on a GelDoc (BioRad).
7.5% Denaturing Acrylamide-Urea DNA Gel
9.6g Urea
5ml 30% Acrylamide
2ml 10x TBE
5ml Water
2.10. Statistics
Statistical analyses were performed and graphs made using PASW Statistics 18.0. Tests for homogeneity of variances (Levene’s test) were done before any analyses of variance
(ANOVA) or Student’s T-tests, and sample groups which were heteroscedastic were transformed by square root (+1) or arc sin transformations to equalise variances. In those cases where tests for significance indicated no difference between means of two or more samples, but samples were heteroscedastic and transformation could not overcome this transformation, non-significance is reported as heteroscedasticity does not influence p values > 0.05 (Underwood, 1997). Where there was no significant difference between samples within a treatment (e.g. samples taken at different times) these replicates were pooled for analyses. Statistical significance is reported as p < 0.05.
106
Chapter 3: Defining the repertoire of tropomyosins in adult mouse brain
107
3. Chapter 3: Defining the repertoire of tropomyosins in adult mouse brain
3.1. Introduction
Tm expression can change with developmental stage, tissue type, and subcellular localisation. Tm expression is also altered with cancer, and the profile of expressed Tm isoforms shifts in transformed cells: reduction of HMW products is common in highly malignant cells (Gunning et al., 2005). Tms pose a means by which anti-cancer therapies can specifically target the actin cytoskeleton of cancer cells, due to the reliance of cancer cells on low molecular weight (LMW) Tms, and these Tms have been suggested as targets for chemotherapeutics (Stehn et al., 2006). The targeting of any Tm isoform or subset of isoforms may be complicated by the capacity of Tms to compensate for isoform loss. It has been hypothesized that while muscle Tms are subject to feedback regulation, cytoskeletal Tm isoforms do not autoregulate by such a feedback mechanism (Schevzov et al., 2008).
Three genes produce muscle Tm isoforms: the αTm gene (the αfastTm isoform), βTm gene (the β-Tm isoform) and the γTm gene (the αslowTm isoform). The αfastTm and β-
Tm products are associated with actin in the thin filament of the sarcomere (see Perry,
2001 for review). In differentiated muscle cells, the expression of muscle Tms is regulated to ensure a fixed pool size of protein. While both are detected in adult heart mouse muscle, αfastTm outnumber β-Tm transcripts (Muthuchamy et al., 1993), although only the αfastTm protein is detected there (Schevzov et al., 2005b). There is, however, a feed-back mechanism between these sarcomeric isoforms: the transgenic overexpression of sarcomeric β-Tm in mouse heart results in the reduction of αTm gene products (Muthuchamy et al., 1995). The αfastTm isoform can self-regulate as well: the
108 hemizygous knockout of αfastTm mRNA results in a compensatory upregulation of
αfastTm protein to ensure normal levels of the isoform (Blanchard et al., 1997;
Rethinasamy et al., 1998). This maintenance is limited to muscle Tms: the overexpression of muscle β-Tm in heart does not, for example, impact on the cytoskeletal isoform Tm4 which is found endogenously within cardiac muscle cells.
Similarly, the transgenic overexpression of cytoskeletal isoforms Tm3 or Tm5NM1 does not induce a change in sarcomeric αfastTm levels (Schevzov et al., 2008).
Furthermore, the transgenic overexpression of either of the cytoskeletal Tm3 or
Tm5NM1 isoforms does not induce a change in the amount of other cytoskeletal isoforms being expressed (Schevzov et al., 2008). This results in an enlarged Tm pool, and enlargement of the cytoskeletal pool through overexpression can induce phenotypic consequences (Bryce et al., 2003). This indicates that, unlike for muscle Tms, the total pool of cytoskeletal Tms is not fixed. Indeed, the hemizygous knockout of γ9d exon- containing products (Tm5NM1 and Tm5NM2, two cytoskeletal products of the γTm gene) does not induce an upregulation of protein expression to maintain normal protein levels, nor does it elicit changes in the expression of other cytoskeletal Tms in embryonic stem cells (ESC) or mouse embryonic fibroblasts (MEF) cultured from knockout animals (Schevzov et al., 2008). However, closer inspection suggests cytoskeletal Tm expression may be altered by feedback mechanisms. The γTm gene produces at least 11 isoforms through alternative use of an internal exon 6a/6b and a choice between three alternative C-terminal exons: γ9a, γ9c or γ9d (Dufour et al.,
1998a). Examples of each of these isoform subsets are found in brain (Vrhovski et al.,
2003). The developmental reduction of products containing exon γ9d is concomitant with an increase in products containing a different exon (exon γ9c). This results in a constant pool size of γTm gene protein in developing mouse brain (Vrhovski et al.,
109
2003), suggesting some cross-talk between the different C-terminal exons. The most conclusive evidence that cytoskeletal Tms can autoregulate comes from knockout studies. Knocking out the entire γTm gene in mice results in embryonic lethality (Hook et al., 2004). However, knocking out the γ9c exon-containing isoforms from the γTm gene in mice induces a compensatory increase in exon γ9a containing products in the brains of adult animals (Vrhovski et al., 2004). This compensation ensures that the net pool size of γTm gene products in adults is not perturbed by the loss of one subset of isoforms. Also, this particular compensation is intragenic only: γ9c knockout results in no detectable effect on protein levels of αTm, βTm or δTm gene products (Vrhovski et al., 2004).
In short, loss of the γ9c exon-containing products is compensated for by upregulation of other cytoskeletal Tms in brain (Vrhovski et al., 2004). Loss of the γ9d exon-containing products induces no such upregulation in MEFs or ESCs (Schevzov et al., 2008). The major aim of this chapter was to distinguish whether these divergent effects are due to the cell/tissue type or the different Tm isoforms subsets being investigated. This was done by using the same γ9d knockout mice that were studied by Schevzov and others
(2008), and investigating if cytoskeletal Tms compensate for this loss in brain.
110
3.2. Results
3.2.1. Protein levels of αTm, βTm and δTm gene cytoskeletal isoforms are unaffected by γ9d exon knockout
Whole brain and six adult mouse brain regions (cerebellum, amygdala, olfactory bulb, hippocampus, cortex, hypothalamus) were dissected from each of n = 3 wild type (WT) and n = 3 exon γ9d knockout (KO) adult (3 month old) female littermate mice.
Dissected regions were each lysed and probed by Western blot with a host of antibodies immunoreactive to different Tm isoforms (Antibodies: γ9d: Tm5NM1, Tm5NM2;
αfast9d: Tm6, Tm1, Tm2, Tm5a/5b; WD4/9d: Tm4; Tm311: Tm6, Tm1 TmBr2/Tm2).
The protein levels detected by Western blot in hippocampus, and the relative levels of
γ9d exon-containing isoforms (Tm5NM1 and Tm5NM2) to confirm γ9d exon KO, are presented in Figure 3.1.1. Estimates of the molecular weights of the proteins detected on these Western blots were made by comparison with molecular weight markers (see
Chapter 2). These estimates were compared with known molecular weights of the various Tms (see Schevzov et al., 2005b) to determine the identity of each protein band detected by these Tm antibodies. Protein levels of these Tms were measured relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) loading controls for each blot, and then signal intensities of each compared between wild type (WT) and exon γ9d KO mice brain regions. The αfast9d antibody is immunoreactive to both Tm5a and Tm5b isoforms, which have very similar molecular weights. However, only the Tm5a isoform has been detected in brain (Schevzov et al., 2005b), and so hereafter this molecular weight species is referred to as Tm5a.
In none of the examined brain regions were changes in protein levels between WT and
γ9d KO mice detected for the following Tms: αTm gene products: Tm6, Tm2, Tm3,
TmBr1; the βTm gene product Tm1, or the δTm gene product Tm4 (see Figure 3.1.2; 111 the hippocampus is representative of all brain regions sampled). Note that the Tm6 and
Tm1 isoforms, detected by the αfast9d and Tm311 antibodies, whilst electrophoresing at slightly different molecular weights (see Figure 3.1.1), are not distinct enough on
Western blot for separate densitometry analyses, and so were measured as “Tm1/6”. It is possible that a reciprocal relationship exists between these isoforms, and knocking out the γ9d exon induces an increase in the expression of one of these isoforms, and simultaneously induces a decrease in the expression of the other. However, the appearance of these bands in Western blot immunoblotted with the Tm311 antibody
(see Figure 3.1.1) indicates that knocking out the γ9d exon induces no change in the expression of either isoform (although there is considerable variation among samples within each genotype of both isoforms). Use of the γ9d antibody in Western blot confirmed the knockout of the γ9d exon-containing isoforms Tm5NM1 and Tm5NM2.
The knockout of the γ9d exon-containing Tm5NM1 isoform was also evident in the
Western blot immunoblotted with the αfast9d antibody (see Figure 3.1.1).
112
Figure 3.1.1 Levels of cytoskelelal αTm, βTm and δTm gene products remain unchanged with γ9d exon knockout
Figure 3.1.1 Knockout of the γ9d exon had no detectable effect on levels of other Tm gene products. Western blots of hippocampus are representative of all brain regions and whole brain. Brain region lysates were enriched for Tm proteins by heating at 95°C for 10 minutes. 10μg protein were electrophoresed on 12.5% low bis-acrylamide SDS gels, followed by immunoblotting with the respective antibodies: (A) γ9d (to confirm knockout of the γ9d exon), (B) αfast9d, (C) WD4/9d, (D) Tm311, (E) GAPDH. Note that the αfast9d antibody also detects the Tm5NM1 isoform, which is absent in γ9d exon KO samples. Prior to immunoblotting, membranes were stained with Ponceau solution (F) to confirm equal loadings of samples. One lane represents lysed hippocampus from one individual female adult mouse, n = 3 mice for each of wild type and γ9d KO genotypes. Note that wild type and γ9d KO samples for each region were run on the same gel per antibody, and so quantitation for each antibody was done on one single film. 113
Figure 3.1.2 Expression of αTm, βTm and δTm gene products is not altered with γ9d exon knockout
Figure 3.1.2 Quantitation of cytoskeletal Tm isoforms in hippocampi of WT and γ9d exon KO adult female mice. Levels of each of the αTm gene products TmBr1, Tm2, Tm5a, and Tm6; the βTm gene product Tm1; and the δTm gene product Tm4, relative to GAPDH loading control were measured by densitometry using ImageJ. The signal intensity arbitrary units (A.U.) are ImageJ generated units. Note that Tm1 and Tm6 protein signals were indistinguishable on Western blot (see Figure 3.1.1) and so were assayed as Tm1/Tm6 combined. For each region, WT and KO samples were compared and analysed by one tailed Student’s t-test, and threshold for significance taken as p <0.05. There was no significant difference in protein expression between WT and γ9d exon KO samples for any of the isoforms represented here. Densitometry of hippocampi Western blots are representative of all brain regions assayed. Bars represent mean expression relative to GAPDH, error bars = ±SEM, n = 3 mice for each of wild type and γ9d KO genotypes.
114
3.2.2. Autoregulation of the γTm gene: γ9c exon-containing isoforms are upregulated in response to γ9d exon loss
The same dissected regions listed in Section 3.1.1 were further probed by Western blot with antibodies immunoreactive to different γTm gene isoforms (Antibodies: γ9c:
Tm5NM4, Tm5NM7; CG3: all cytoskeletal γTm gene products). The γ9c antibody used in this study was raised to the entire exon 9c of the γTm gene (Vrhovski et al., 2003), and Western blot with this antibody and subsequent densitometry relative to a GAPDH loading control showed protein levels of γ9c exon-containing products in whole brain and all six brain regions assayed were significantly upregulated in γ9d exon KO relative to wild type mice (n = 3 mice per genotype, see Figures 3.2.1 and 3.2.2).
115
Figure 3.2.1.Knockout of γ9d exon induces upregulation of γ9c exon-containing products
116
Figure 3.2.1. Knockout of γ9d exon induces upregulation of γ9c exon-containing products. Lysates of whole brain and each brain region were enriched for Tm proteins by heating at 95°C for 10 minutes. 10μg protein were electrophoresed on 12.5% low bis-acrylamide SDS gel, followed by immunoblotting with the antibodies γ9d (to confirm knockout of the γ9d exon); γ9c; CG3 (to detect all products of the γTm gene: “total γTm”); GAPDH. The γ9c upregulation occurs in all regions assayed, and total γTm gene products remain constant despite γ9d exon KO. n = 3 mice for each of wild type and γ9d KO genotypes. Note that wild type and γ9d KO samples for each region were run on the same gel per antibody, and so quantitation for each antibody was done on one single film.
117
Figure 3.2.2 Exon γ9d KO induces upregulation of exon γ9c-containing products in brain
Figure 3.2.2 Quantitation of Western blot analyses shows γ9c exon-containing products are significantly increased in γ9d KO mice in each of Whole Brain (WBr) and six brain regions assayed. The signal intensity arbitrary units (A.U.) are ImageJ generated units. Brain regions are as follows: H Hippocampus, CE Cerebellum, A Amygdala, HT Hypothalamus, OB Olfactory Bulb, C Cortex. For each region, wild type and KO samples were compared and analysed by one-tailed Student’s t-test, and threshold for significance taken as p <0.05. In all regions the levels of γ9c signal intensity (relative to GAPDH loading control) were significantly greater in KO than wild type samples. n = 3 mice for each of wild type and γ9d knockout genotypes. Asterisk (*) indicates statistical significance, error bars =±SEM. Note that as different regions were run on different gels, comparisons of absolute levels of protein expression between regions were not made.
118
3.2.3. The relative pool size of total γTm gene products in γ9d knockout versus wild type mice is dependent on brain region
The CG3 antibody was raised to a region of the 1b exon of the γTm gene (Novy et al.,
1993) and is immunoreactive to all cytoskeletal products of the γTm gene (Schevzov et al., 2005b). This antibody has previously been used to investigate whether the total pool of γTm gene products remains constant despite changes in the expression of isoforms containing different C-terminal exons (Vrhovski et al., 2004; Vrhovski et al., 2003). In this current study, the knockout of the γ9d exon resulted in compensatory upregulation of γ9c exon-containing products, sufficient to restore KO levels of total γTm gene products to WT levels in whole brain and five of the six brain regions assayed (see
Figures 3.2.1 and 3.2.3). It should, however, be noted that while the means of the WT and γ9d KO cerebellum were found to be not significantly different, the difference in variances between these samples indicates that a difference in means may be found to be significant if sample sizes (i.e. replicate numbers) were increased. Note also that in the amygdala, apparent changes in the mean levels of total CG3 between WT and γ9d KO samples are accompanied by large variance among replicates within samples. Again, an increase in replicate numbers per sample in future testing may reveal a significant difference between γ9d
KO and WT samples from these regions. Total cytoskeletal γTm gene products in olfactory bulbs (OB) remain significantly greater in WT than KO samples. This indicates that while γ9c products are significantly upregulated in this region in KO mice (see Figures
3.2.1 and 3.2.2), the compensation for γ9d exon loss in OB by γ9c exon products is not sufficient to restore total γTm gene product pool size to WT levels.
119
Figure 3.2.3 Pool size of γTm gene products remains constant despite exon γ9d KO in whole brain and five out of six brain regions
Figure 3.2.3. Expression of total γTm gene products remains constant in whole brain (WBr) and five out of six brain regions assayed despite γ9d exon knockout (KO). Total γTm gene expression was measured by immunoblotting with the CG3 antibody, with densitometry measured relative to GAPDH. The signal intensity arbitrary units (A.U.) are ImageJ generated units. Brain regions are as follows: H Hippocampus, CE Cerebellum, A Amygdala, HT Hypothalamus, OB Olfactory Bulb, C Cortex. For each region, WT and KO samples were compared and analysed by one tailed Student’s t-test, and threshold for significance taken as p <0.05. In all regions, except for OB, the levels of CG3 signal intensity (relative to GAPDH loading control) were not significantly different between KO and WT samples. Note that in OB, the signal intensity of total γTm gene expression in WT is significantly greater than in KO samples. n = 3 mice for each of wild type and γ9d exon KO genotypes. Asterisk (*) indicates statistical significance, error bars = ±SEM.
120
3.2.4. Observation of an alternative product with the δTm gene isoform, Tm4
The WD4/9d antibody was raised to the 9d exon of the δTm gene (Hannan et al., 1998), and Western blot showed the protein levels of the δTm gene product, Tm4, did not change with γ9d exon KO in whole brain or any brain region. However, the WD4/9d antibody used to probe brain region lysates for this isoform detected one band of
~28kDa (the predicted molecular weight of Tm4) and a second, heavier band of ~32 kDa in some regions of brain (including amygdala, see Figure 3.3).
121
Figure 3.3. Detection of a Tm4 associated product in mouse brain
Figure 3.3. Detection of a second product with the δTm gene product Tm4. Lysates of whole brain and each brain region were enriched for Tm proteins by heating at 95°C for 10 minutes. 10μg protein were electrophoresed on 12.5% low-bis SDS gels, followed by immunoblotting with the WD4/9d polyclonal rabbit antibody. Western blot of both WT and γ9d exon KO mice amygdala lysates (A) with the WD4/9d antibody showed the detection of two molecular weight species, differing by ~4kDa. This second species was variably detected in lysates of other brain regions (B) from WT mice. Brain regions are as follows: WBr Whole Brain, C Cortex, CE Cerebellum, H Hippocampus, OB Olfactory Bulb, HT Hypothalamus, A Amygdala. The molecular weight of Tm4 is 28kDa, and it is estimated the lower band (‘2’ in both A and B) is Tm4, and the upper band (‘1’ in both A and B, ~32kDa) is an as yet unindentified Tm4 associated product.
122
3.3. Discussion
3.3.1. Cytoskeletal tropomyosins can autoregulate
Despite the diversity of Tm isoforms, at least three out of the four Tm genes are each required for progression through embryonic development (Blanchard et al., 1997; Hook et al., 2004; Jagatheesan et al., 2010). However some redundancy may exist at the level of individual isoforms. Knockout of the γ9c exon-containing isoform subsets from the
γTm gene is not lethal, and results in the upregulation of γ9a exon-containing products from the same gene in adult mouse brain (Vrhovski et al., 2004). In the current study the
KO of the γ9d exon in mice (isoforms Tm5NM1 and Tm5NM2) was shown to induce upregulation of γTm gene isoforms containing the γ9c exon (isoforms Tm5NM4 and
Tm5NM7) in brains of adult female mice. The γ9a containing products were not conclusively measured in the current study due to problems with sensitivity of the polyclonal γ9a antibody used. The upregulation of γ9c exon-containing products was seen in whole brain and throughout all regions assayed, although the extent of this upregulation was regionally variable.
3.3.2. The γTm gene pool: regional differences in brain
The γ9c upregulation in KO olfactory bulb did not restore the total γTm gene pool to
WT levels, unlike in whole brain and all other regions assayed. The γ9d products
Tm5NM1 and Tm5NM2 each have subcellular distributions in neurons which change with development, and while distributions of the γ9c products Tm5NM4 and Tm5NM7 in immature neurons are yet to be fully characterised, both isoforms are expressed diffusely throughout mature neurons (see Chapter 1, Figure 1.4, and Section 1.4.1.3).
While the protein of γ9c exon containing products are detected in embryos as early as
123
ED15.5 and levels increase into adulthood (Vrhovski et al., 2003), levels of γ9d exon products (detectable in brain from ED11.5) increase until birth, then decrease to lower levels in adult brain (Vrhovski et al., 2003; Weinberger et al., 1996). The olfactory bulbs are a place of intense neural regeneration into adult life (Bayer, 1983; Kaplan and
Hinds, 1977). It is possible that the cellular requirements for γ9d products (which are ostensibly met by γ9c upregulation) come as a function of neuronal differentiation and cellular development, and are less required in a region where cellular turnover is high.
Of course, the differing profiles of Tm compensation may instead be a consequence of other regional functional requirements. The striking similarity between all regions is that within each, γ9c products were upregulated and other cytoskeletal products remained unaffected by γ9d exon KO.
Previous investigations into other cell types show heterozygous γ9d KO ESCs and homozygous γ9d KO MEFs have reduced pool sizes of total γTm-gene products
(Schevzov et al., 2008). The very weak compensation in ESCs from the γ9d KO mice
(Fath et al., 2010), and the lack of compensation seen in MEFs cultured from homozygous γ9d KO animals (Schevzov et al., 2008) suggest that the compensation seen in brain (current study) may be tissue specific.
On the basis of the current study, further investigation was made into the developmental regulation of γ9c compensation. The upregulation of γ9c products in γ9d KO total brain was detected in embryonic (ED13.5) mice, and in neurons from embryonic ED16.5 mice cultured for one day in vitro, but increased in total brain to a peak at adulthood
(Fath et al., 2010). This developmental regulation of γ9c upregulation (the compensation increasing with age of γ9d KO animals) (Fath et al., 2010) suggests that
γTm gene products are spliced (and compensation made) depending on particular
124 requirements of the developmental stage. Expression of the γTm gene C-terminal exon
(γ9a, γ9c or γ9d) variants is self-regulatory; when γ9c or γ9d exons are knocked out in brain, there is an increased expression of isoform subsets containing a different C- terminal exon from the same gene, and this effect is limited to the γTm gene only in both γ9d KO brain (current study) and γ9c KO brain (Vrhovski et al., 2004). The precise mechanism/s behind these compensations remains unknown. Knocking out of the γ9d exon may feedback to induce an increase in the rates of translation of γ9c protein from an unchanged mRNA level, or a feedback to increase the levels of γ9c mRNA transcripts which in turn increase protein levels (with or without a concomitant increase in protein translation rates also). It is also possible that knocking out one subset of isoforms will alter the rates of ubiquitination of other isoforms, and so alter their rates of degradation. Distinguishing between these hypotheses could be addressed firstly by using quantitative PCR to measure total transcript levels of γ9c mRNA in γ9d exon KO versus WT mouse brain, and secondly by measuring the pool of ubiquitinated protein in response to isoform KO, and by testing protein levels after inhibiting the ubiquitination pathway in cells cultured from KO animals. In general, the finding that Tms can compensate for loss of the γ9d exon containing isoforms Tm5NM1 and Tm5NM2 is important information for designing cancer treatment based on targeting these isoforms in malignant cells. The compensation seen amongst cytoskeletal Tms in adult brain indicates that cytoskeletal Tms can compensate for this loss, and potentially in a manner which is developmentally regulated.
3.3.3. The δTm gene product: Tm4
The protein levels of the δTm gene product, Tm4, did not change with γ9d exon KO in any brain region. However, the WD4/9d antibody (raised to the 9d exon of the δTm
125 gene) used to Western blot for this isoform detected two bands of ~28kDa and ~32 kDa.
This doublet was not consistent across all regions of brain, being more prominent in some regions including cerebellum and amygdala, and detection did not alter with γ9d exon KO. Tm4 is the single known LMW mammalian product of the δTm gene, and the identity of the other Tm4 associated product detected by the WD4/9d is explored in
Chapter 4.
126
Chapter 4: The δTm gene product- investigating Tm4 function and characterising a Tm4 associated product
127
4. Chapter 4: The δTm gene product - investigating Tm4 function and characterising a Tm4 associated product
4.1. Introduction
The αTm, βTm, and γTm genes each produce multiple protein products through alternative splicing and promoter use. The δTm gene produces one single LMW product characterised to date: the 248aa long Tm4 isoform (Yamawaki-Kataoka and Helfman,
1987). Alternative splicing can give rise to two variants from non-mammalian δTm gene equivalents, where a 284aa HMW variant is found in chicken heart muscle (Forry-
Schaudies et al., 1990), and a homologue of this variant is also found in Xenopus laevis
(Hardy et al., 1995) and in the axolotl, where it is necessary for heart function (Spinner et al., 2002). Investigations have since also revealed a HMW variant in zebra fish heart
(Zhao et al., 2008): a 284aa long isoform sharing exons 3, 4, 5, 6b 7, and 8 with Tm4, but using the alternative promoter 1a and exon 2b, and carboxy terminal exon 9a
(instead of the 1b promoter and 9d carboxy terminal exon, as in Tm4) (see Figure 4.1).
128
Figure 4.1.Tropomyosin isoforms produced from the δTm gene
Figure 4.1. (A) The mammalian δTm gene is understood to produce one LMW protein product, the Tm4 isoform (figure after Gunning et al., 2005). (B) The identification of the δTm gene HMW striated muscle variant in axolotl, chicken, zebrafish and Xenopus heart indicates that the δTm gene homologues in each of these species are capable of alternative splicing. Figure adapted from Zhao et al., 2008, who found a HMW δTm gene transcript (pV1) including the 1a, 2b, and 9a exons in zebrafish heart.
Despite the striated muscle HMW variants of the δTm gene, in no species has a second
LMW variant of the δTm gene been identified. Evidence of a second product immunoreactive with the WD4/9d antibody (raised to the 9d exon of the δTm gene) is presented in Chapter 3 of this thesis. This product has previously been observed enriched in rat post-synaptic density (PSD) fractions, and found in lysates of whole rat brain (Vrhovski, B & Gunning, P. W., unpublished data). The size of this product is similar to that of Tm4, with an estimated molecular weight of ~32kDa, and so below the size range of the HMW Tms.
Tm4 is found in a range of different tissues including bone (McMichael and Lee, 2007) and skeletal muscle (Vlahovich et al., 2008). In both of these tissues Tm4 is localized to 129 specialised subcellular domains and is associated with changes such as repair or growth: in muscle, Tm4 expression is upregulated when muscle is undergoing repair and regeneration (Vlahovich et al., 2008); in bone, Tm4 is found in the podosomes of osteoclasts and is required for normal bone resorption (McMichael and Lee, 2007). Tm4 mRNA is more abundant in the rat embryonic than in adult brain (Faivre-Sarrailh et al.,
1990; Yamawaki-Kataoka and Helfman, 1987) and more abundant in transformed than normal rat fibroblasts (Yamawaki-Kataoka and Helfman, 1987). Tm4 is present in rat neurons, oligodendrocytes, and astrocytes, and is most highly transcribed in the immature stages of each of these cells (Had et al., 1993). Together, information about these relative abundances indicates Tm4 may have a role in the early developmental stages of cells. It has been suggested that the early developmental transcription of Tm4 indicates its association with cell proliferation or neuronal differentiation, and the increased transcription of Tm4 in transformed cells is evidence that Tm4 may be associated with the proliferative state of the cell (Yamawaki-Kataoka and Helfman,
1987).
In neurons, the distribution of Tm4 changes with development. Initially the protein is localised to the growth cones of both dendrites and axons of cultured rat hippocampal neurons, in those parts where the actin filaments are organized and abundant. Later in development Tm4 is found in the post-synaptic sites of synapses in the cerebellar cortex
(Had et al., 1994). If the assumption is made that these distributions differ because of developmental stage, rather than brain region (hippocampus versus cerebellum), then this shift in localisation represents a potential shift in function. Growth cone localisation indicates Tm4 may have a role in the motile events associated with neurite outgrowth, whereas later PSD localisation may reflect an involvement at the synapse (Had et al.,
1994). It may be that the changing requirements of the neuron throughout differentiation 130 induces this shift in Tm4 localisation; also possible is that the antibody used to describe this shift in localisation was actually detecting two separate isoforms, with two developmental profiles: one enriched in growth cones of immature neurons, and the other enriched at the PSD of mature neurons. A third hypothesis to explain the shift is that each distribution represents one post-translational modification (PTM) state of the
Tm4 isoform.
The function of Tms can be altered by both phosphorylation (e.g. Houle et al., 2007) and acetylation (e.g. Skoumpla et al., 2007). These functional alterations raise the possibility of Tm4 undergoing a developmentally regulated PTM which alters its localisation and function, and gives rise to the Tm4 associated product observed as a heavier molecular weight product. It is of course also possible that a splicing event produces a second LMW isoform from the δTm gene. The reactivity of two different products to an antibody raised to the 9d exon of the δTm gene (WD4/9d) is evident on
Western blot (see Chapter 3 of this thesis), and the apparent duality of distribution seen with Tm4 in neurons may be due to two different LMW δTm isoforms. In this chapter, the identity of the Tm4 associated product was investigated.
To investigate the function of Tm isoforms, previous studies have used a variety of experimental systems, including whole animal models and cell lines (see Chapter 1 of this thesis for review). One such model system used to investigate the function of cytoskeletal Tm isoforms is the neuroblastoma cell line B35 (Bryce et al., 2003). The
B35 cell line was originally cloned from a neoplasm induced in neonatal rats (Schubert et al., 1974). These cells were then characterised as a neuronal-like cell line due to their excitable membrane and expression of some neurotransmitters (Schubert et al., 1975;
Schubert et al., 1974). B35 cells are adherent, but not contact inhibited (Otey et al.,
131
2003) and undergo morphological change when treated with dibutyryl cyclic adenosine monophosphate (dbcAMP) and serum reduction (Schubert et al., 1974). In their clonal untreated state, B35s cycle through mitosis and are referred to as being
“undifferentiated” (Otey et al., 2003). As dbcAMP and serum reduction treatment induces the reduction of the characteristic ruffled membrane of these cells, and the extension of neurites from a rounded cell body, it is often considered that this treatment is inducing a differentiation in these cells (Otey et al., 2003). In this chapter, the function of Tm4 was investigated using a novel Tm4 overexpressing B35 cell line.
The specific aims of this chapter were:
1. To characterise the Tm4 associated product
2. To determine if this product is an alternative splice variant of the δTm gene
3. To generate and characterise a novel line of B35 cells which overexpress the rat
Tm4 protein, and
4. To investigate the effect of Tm4 overexpression on gross cell morphology and
cell proliferation in B35 cells.
132
4.2. Results
4.2.1. Characterising the Tm4 associated product
4.2.1.1. Identification of the protein product using mass spectrometry
Western blotting indicated a LMW Tm4 associated product in mouse brain (see Chapter
3 of this thesis), detected by the Tm4 antibody WD4/9d. Further investigation revealed this product was detected not only in mouse adult whole brain and mouse amygdala samples, but also in mouse embryo (ED16.5) whole brain lysates (see Figure 4.2).
Molecular weights of Tm4 and the associated product were estimated by comparison with protein molecular weight markers (see Chapter 2). Increased separation of Tm4 and the associated product was attempted by altering the composition of gels used for
1D SDS-PAGE. Separation was optimal in gels of 12.5% bis-acrylamide (see Chapter
2) and this composition was used for Tm4 and associated product separation. To help identify the Tm4 associated product, samples of embryo (ED16.5) mouse brain lysate were run on 2 dimensional gel electrophoresis (2D-GE), with two different gels run.
One gel was Western blotted with the WD4/9d antibody; the gel from this Western blot was then Coomassie stained. The second gel was stained with SYPRO Ruby red solution (see Figure 4.3.1). This experiment was run twice (to optimise separation of spots), and from the second experiment spots from the SYPRO stained gel which corresponded spatially to signals from the Western blot (and also the Coomassie stains of proteins on the gel which had transferred to membrane) were excised, digested with trypsin, and sequenced by MALDI (see Figure 4.3.2 and Table 4.1). In total 8 spots were excised and sequenced, including five which corresponded to a molecular weight of 32 kDa (equivalent of the Tm4 associated product detected with WD4/9d WB), and two of which corresponded to the molecular weight of 28kDa (equivalent to the size of
133
Tm4) (see Table 4.1). The eighth spot was excised as a procedural control. All spots were in the isoelectric point (pI) range of 4.5-5.0 (see Figures 4.3.1 and 4.3.2), consistent with the prediction of Tm4 having a calculated pI of 4.65, and a previously observed pI of approximately 4.6 (Matsumura et al., 1983). Note that the signal detected in the 55-70kDA molecular weight range on the 2D gel (see Figure 4.3.1) corresponds to a region of crossreactivity between the WD4/9d antibody and the high molecular weight Tm1 isoform (Schevzov et al., 2005b). All 2D-GE was done with the assistance of Dr. Alamgir Khan and Mrs Vidya Nelaturi, and all MALDI here reported was done by Dr. Alamgir Kahn at the Australian Proteomics Analysis Facility, Macquarie
University.
134
Figure 4.2 Western blotting with the WD4/9d antibody detects the Tm4 associated product in adult and embryo mouse brain
Figure 4.2 The Tm4 associated product is detectable in lysates mouse adult (14 weeks old) amygdala, and in mouse embryo (ED16.5) brain. All samples were heated at 95°C for 5 minutes, and run on 12.5% low bis-acrylamide gels before being transferred to membrane and blotting with the WD4/9d antibody.
135
Figure 4.3.1 Initial 2D gel electrophoresis: WD4/9d Western blot, and Coomassie and SYPRO stained gels of mouse brain lysate
kDa pI 4.0 4.5 5.0 5.5 6.0 6.5 7.0
a
75 50 37
25 20 Coomassie of Blot
b
75 50 37
25 20 Gel stained with SYPRO Ruby
c
75 50 37
25 20 Western Blot for Tm4
Figure 4.3.1 Initial spot matching between WD4/9d Western blot, Coomassie stained gel, and SYPRO Ruby stained gel.(a) shows the Coomassie stained image of the blot from Gel 1. (b) shows the SYPRO Ruby stained Gel 2. (c) shows the corresponding WD4/9d Western blot of Gel 1. The spots corresponding to the 28kDa and 32kDa bands have been identified at an approximate pI of 4.6-4.75 and are magnified in orange boxes. From these magnified images, at least four spots correspond to the top 32kDa band (indicated by the red, yellow, blue and mauve circles) and at least two closely occurring spots (light blue circle, panel (c)) correspond to the 28kDa band. Of the spots identified by Western blot, 2 are clearly visible (red and yellow circles) in the SYPRO ruby stained gel (b), while the others (blue, mauve, and light blue) are too low in abundance to be detected. Note the first lane in each of (a) (b) and (c) is the same mouse brain sample run in one dimension (SDS-PAGE), without the separation according to pI as in the rest of each gel. This experiment was repeated (see Figure 4.3.2).
136
Figure 4.3.2 Spot choice from 2D gel electrophoresis and WD4/9d Western blot of mouse brain lysate for sequencing by MALDI mass spectrometry
A B C
D E
Figure 4.3.2 A repeat of the WD4/9d Western blot (A and B) and SYPRO Ruby stained gel (C) as described in Figure 4.3.1, using an independently taken sample of embryo (ED16.5) mouse brain lysate. Spots were further separated into seven separate areas for excision on the SYPRO Ruby stained gel (C) as according to the spot intensity in WD4/9d Western blot (B and C). All spots are between pI 4.5 and 5.0, including the five (spots 1 – 5, see D for legend) corresponding to ~32 kDa molecular weight and two (spots 6 and 7, see D) corresponding to ~28kDa molecular weight. In addition to these, one spot was randomly chosen as a procedural control (see complete SYPRO Ruby stained gel and white spot in E). These 8 spots were excised, digested with trypsin, and sequenced by MALDI (see Table 4.1).
137
Table 4.1: Summary of the proteins identified by MALDI mass spectrometry
Spot Protein name (Species) Accession Number MOWSE score Matched peptide Sequence coverage (%) Mass (Da) pI (PMF/MSMS) (PMF/MSMS) (PMF/MSMS)
1 14-3-3 protein epsilon –Mus 1433E_MOUSE 70 / 42 18 / 3 58 / 14 29155 4.63 musculus (Mouse) 2 No protein identified N/A N/A N/A N/A N/A N/A 3 No protein identified N/A N/A N/A N/A N/A N/A 4 14-3-3 protein epsilon –Mus 1433E_MOUSE 87 / 85 17 / 4 56 / 15 29155 4.63 musculus (Mouse) 5 Tropomyosin alpha-1 chain –Mus TPM1_MOUSE None / 46 None / 1 None / 4 32661 4.69 musculus (Mouse) 6 14-3-3 protein zeta/delta –Mus 1433Z_MOUSE 41 / None 10 / None 39 / None 27754 4.73 musculus (Mouse) 7 No protein identified N/A N/A N/A N/A N/A N/A (Control) Heat shock protein HSP 90-beta – HS90B_MOUSE 152 / 220 24 / 7 35 / 12 83273 4.97 Mus musculus (Mouse)
Table 4.1: Summary of identifications made by MALDI of 2D-GE spots excised. No identification was possible for spots 2, 3, or 7 due to their low protein abundance. Note that spot 6, which corresponded to the expected molecular weight (28kDa) and pI (~4.6) of Tm4, yielded identification of the signalling molecule 14-3-3, and spot 7(also ~28kDa but slightly more basic) was unable to be identified.
138
The presence of at least two groups of spots of distinct molecular weights (the upper group could be further divided into two groups, with spots 2 and 3 being slightly heavier than spots 1, 4 and 5, see Figure 4.3.2) indicates that the molecular weight difference between Tm4 and the associated product seen in 1D gels is not due to a PTM.
Rather, the separation of these spots in the 1st (pI) dimension of the gel indicates that each of these molecular weight groups undergoes some PTM. The MALDI of these spots identified one (spot number 6, ~28kDa) as being 14-3-3, an abundant signalling molecule, and the other spot was so low in abundance (spot number 7) so as to preclude sequencing by MALDI. No identification of Tm4 was made in these analyses. By comparing the Western blot signals with the SYPRO and Coomassie stained gels
(Figures 4.3.1 and 4.3.2) it is evident that the abundance of other proteins (such as 14-3-
3) within the molecular weight and pI range of Tm4 (and the Tm4 associated products) may have hindered the chances of identifying Tm4 and the Tm4 associated products.
This indicated that other measures were required to test that the Tm4 associated product was a Tm, and also that further purification of these brain lysates was required to aid in identification.
4.2.1.2. Heat stability and purification
The Tms are heat stable proteins (Bailey, 1948), and so to test the hypothesis that the
Tm4 associated product is a Tm (rather than cross reactivity between the WD4/9d antibody and a non-Tm protein) embryo (ED16.5) mouse brain lysates were exposed to a heat-treatment. This treatment eliminated the majority of protein in these lysates, as shown by the Ponceau stain of membranes from Western blot of heat-treated and non heat-treated samples (see Figure 4.4). Despite this, the signal of the WD4/9d detected
Tm4 associated product persisted with heat-treatment, supporting the hypothesis that
139 this product is a Tm. However, Tms are not the only heat stable proteins present in mouse brain. The next hypothesis tested was whether this Tm4 associated product was a splice variant of the δTm gene.
140
Figure 4.4. Heat treatment does not eliminate Tm4 associated product in mouse brain lysate
Figure 4.4 Samples of embryo (ED16.5) wild type whole brain lysates were treated with three 10 minute incubations at 100°C before centrifugation for 30 minutes at 20,000 g (‘Heat Treatment’) before the supernatant was added to sample loading buffer and heated for a further 5 minute incubation at 95°C before loading; or samples were added to loading buffer and heated for 5 minute incubation at 95°C only before loading (as usual treatment for WB of lysate samples for Tms) (‘Control’). Samples were run on 12.5% low bis-acrylamide gels, and transferred to PVDF membrane before staining with Ponceau solution. Membranes were then blotted with the WD4/9d antibody. Ponceau stains of membranes show the reduction in total protein after heat treatment, yet on Ponceau stained membranes there is no visible band around the size of 28kDa (the size of Tm4), which was detected in WB using the WD4/9d antibody. Equal volumes of Control and Heat Treatment supernatant samples were loaded onto each gel. This figure represents three different gels (A, B, and C), each gel a temporal replicate, and each with whole brain lysates of two different wild type mice. Lysate from one mouse was divided into sample for Heat Treatment and sample for Control (in total, gels A, B and C represent material from six different mice). Note the plot of grayscale values (bottom right), showing the presence of two bands in the Heat Treatment lysate probed with WD4/9d (bottom left).
141
4.2.1.3. Investigating splice variants of the δTm gene
All mammalian Tm genes can produce multiple isoforms through alternative promoter use and alternative splicing (see Gunning et al., 2005; Wang and Coluccio, 2010 for reviews). To date, Tm4 is the only LMW product identified from the mammalian δTm gene. In identifying the different isoforms produced from the γTm gene in rat, Dufour and others (1998a) used PCR primers designed around each of the different exons in the
γTm gene, and sequenced PCR reactions of these products to determine the exon composition of different isoforms from the gene. Mouse Tm4 is 2082 bp long, including a coding region of 747 bp. Rather than using primers specific to each exon in the δTm gene, two primers were designed as follows: Forward: bp 470-493 crossing exons 5 and
6b; and Reverse: bp820–804 in the 3' UTR, 20bp downstream of the stop codon. PCR reactions were done using these primers and adult mouse cerebellum cDNA as a template. These reactions were electrophoresed on agarose gels, before staining with ethidium bromide to investigate the sizes of resulting products. Reactions using these primers resulted in two products, one the predicted 330bp size, the other ~30bp longer
(see Figure 4.5). More than 10 attempts at sequencing this longer product always yielded the sequence of Tm4. More than 20 attempts at sequencing the entire PCR reaction also always yielded the sequence of Tm4. Taking this reaction and exposing it to reducing conditions before running on a denaturing acrylamide gel resulted in an elimination of the upper band (see Figure 4.5). This indicates that this band was a secondary product, an artefact resulting from the structural reconformation of DNA transcripts by self-bonding. With no evidence that the Tm4 associated product was a splice variant of Tm4 produced from the δTm gene, attempts were made to further purify and characterise the protein.
142
Figure 4.5 DNA denaturing acrylamide gel eliminates the presence of the upper band in PCR reactions of mouse cerebellum Tm4
Figure 4.5. PCR reactions of Tm4 cDNA isolated from adult mouse brain cerebellum using a forward primer which crossed exons 5 and 6b, and a reverse primer 20bp downstream of the stop codon in the 3'UTR of Tm4. These reactions produced two bands of different apparent base pair number, as seen on DNA 0.8% agarose gels (A and B). Excision and gel purification of each of these products (B) indicated a base pair size difference of ~30bp. As attempts at sequencing invariably reported the Tm4 sequence only, samples were run on DNA denaturing acrylamide gels (C and D). Both the total PCR reaction of mouse cerebellum cDNA (C) and the upper band excised and gel purified (D) resulted in a single band corresponding to the predicted base pair size of this fragment (330 base pairs), and no associated upper band.
143
4.2.1.4. Immunoprecipitation of Tm4 and its associated product
The WD4/9d antibody used to detect the Tm4 associated product (see Figure 4.2) is a polyclonal rabbit antibody. Despite the persistence of the Tm4 associated product through a stringent heat-treatment, there was still a possibility that this band was cross- reactivity from the WD4/9d Western blot. To examine the specificity of the WD4/9d antibody with the Tm4 associated product, both non- and heat-treated samples of adult mouse cerebellum and amygdala lysate were immunoprecipitated (IP) with the WD4/9d antibody. In addition, a control treatment of beads and lysate in the absence of antibody was incubated with these lysates. After IP, the resulting eluate was analysed by Western blot with the WD4/9d antibody (see Figure 4.5). The presence of this Tm4 associated product in WD4/9d IP brain samples is further indication of the strong affinity of the protein for the antibody. To further investigate the identity of this Tm4 associated product, mouse brain lysates were immunoprecipitated with the WD4/9d antibody, with the aim that the resulting precipitant be loaded onto a 1D SDS-PAGE gel, stained with
Coomassie R250 or silver nitrate, and spots corresponding to the molecular weights of
Tm4 (28kDa) and the Tm4 associated product (32kDa) excised for proteomic sequencing by matrix assisted laser desorption ionisation (MALDI). This method yielded protein sufficient to be visualised by Western blot with the WD4/9d antibody, but insufficient in abundance to be visualised on a Coomassie or SYPRO Ruby stained gel (see Figure 4.7), and so insufficient in abundance to be sequenced by MALDI.
144
Figure 4.6 The Tm4 associated product is immunoprecipitated by the WD4/9d antibody in mouse brain lysate
Figure 4.6 Western blot with the WD4/9d antibody of lysates only, and also the WD4/9d immunoprecipitation of mouse adult cerebellum (both heat-treated and non heat-treated) and amygdala (non heat-treated only). All treatments including immunoprecipitation result in the Tm4 associated product visible after Western blot with the WD4/9d antibody.
Figure 4.7 Immunoprecipitation with the WD4/9d antibody does not yield sufficient protein for sequencing by MALDI
Figure 4.7 Coomassie R250 staining of lysates of heat-treated and WD4/9d immunoprecipitated mouse embryo (ED16.5) whole brain on a 12.5% bis acrylamide gel failed to detect Tm4 or the Tm4 associated product. The red box indicates the expected size range of Tm4 and the Tm4 associated product. The one visible band detected between 40 and 50kDa (green box) is consistent with the size of immunoglobulin eluted off during the immunoprecipitation procedure. 145
4.2.1.5. Investigation of Tm4 post translational modifications: acetylation
To test the hypothesis that the Tm4 associated product was N-terminally acetylated
Tm4, proteomics methods were employed. In experiments detailed in Chapter 5 of this thesis, samples of control clones and Tm4 overexpressing B35 cells were analysed by a proteomics method which involved trypsin digestion and subsequently tagging peptides within cell lysates (iTRAQ). These peptides were then analysed by liquid chromatography tandem mass spectrometry (LC-MS/MS), which effectively measures the masses of individual peptides, and through collision induced dissociation (CID), where peptides carrying positive charges fragment along their backbones to produce a series of smaller ions. The spectra of ion masses can be used to identify peptide sequence data. Each of these fragments will contain at least one charge (necessary for detection); ions labelled a, b, or c carry this charge on the N-terminal end. If this charge is on the C-terminal end, ions are labelled x, y, or z (see Figure 4.8.1). A subscript indicates the number of residues in the fragment, and a “+2” indicates the fragment was carrying two charges when detected (Johnson et al., 1987; Roepstorff and Fohlman,
1984).
146
Figure 4.8.1 Collision induced dissociation fragmentation of peptides by LC- MS/MS results in N- and C-terminal ion series
Figure 4.8.1 Fragmentation of peptides produces ions which carry the charge on the N-terminal
(a, b, c) or C-terminal (x, y, z) end of the peptide. Individual residues (Rx) are labelled from the
N-terminal residue (R1).Subscripts indicate which bond is cleaved, counting from the C- or N- terminus respectively, and so also indicate the number of residues in the fragment (e.g. ion
B3contains R1, R2 and R3 residues only). Figure from (Roepstorff and Fohlman, 1984).
Through these LC-MS/MS analyses, Tm4 N-terminal peptides in B35 cell lysates were fragmented, and mass/charge ratios of these “b” and “y” ions are reported in Figure
4.8.2.
N-terminal acetylation involves the transfer of an acetyl group onto the α-amino group of the N-terminal residue of a protein. This modification can occur on the ultimate methionine residue, or on the penultimate residue after amino peptidase cleavage of the
N-terminal methionine residue (Bradshaw et al., 1998; Polevoda and Sherman, 2003).
This acetyl group addition is stable through LC-MS/MS analysis and results in a predictable increase in the weight of the N-terminal peptide (Suckau et al., 1992).
Analyses of control and Tm4 overexpressing cells showed the entire pool of identified
N-terminal peptide (the ‘AGLNSLEAVK’ peptide) was detected as having the ultimate
N-terminal methionine residue cleaved off, and fragment ions each had the increase in mass (42D) consistent with an N-terminal acetylation (See Figure 4.8.2). This indicates 147 that Tm4 is unlikely to exist as a mixed pool of acetylated and unacetylated protein, and so acetylation is unlikely to be the cause of the dual signal (Tm4 and the associated product) in WD4/9d detected samples.
148
Figure 4.8.2 Fragmentation of the Tm4 N-terminal peptide indicates an N-terminal acetylation A
Figure 4.8.2 Fragmentation of the Tm4 N- terminal peptide in B35 cell lysates yielded a series of ions. Mass/charge (m/z) ratios of these ions are displayed in Table A. The ‘b’ ions (counted up by residue from the N-terminus, so in this case ‘b1’ = A, ‘b2’ = AG, ‘b3’ = AGN etc.) and ‘y’ ions (counted down by residue from the C-terminus, so in this case ‘y10’ = AGNLSLEAVK, ‘y9’ = GNLSLEAVK, ‘y8’ = NLSLEAVK, etc.) each indicate fragment masses which correspond to an acetylated state of this peptide. For example, the mass of ‘b1’ (the N-terminal alanine residue only) is 114D, which is the sum of the alanine mass (~71D) and the acetyl group mass (42D). The mass of all residues within one fragment are summed (so in the ‘G’ column of Table A, the 171D mass = alanine (~71D) + glycine (~57D) + the acetyl group (~42D) = ~171D). The ‘b’ and ‘y’ ions represented here indicate fragments which were ionised with one charge only; further validation of these masses is given by the rarer fragments ‘b+2’ and ‘y+2’ which each have two charges (these values listed in Table A are half of that of the corresponding single charged ‘b’ and ‘y’ ions, as the charge has been doubled, and so the mass/charge ratio halved). While only ‘b’ and ‘y’ ion masses are reported (A), the spectra from which these values are taken (B) includes the masses of all fragmented ions (e.g. including ‘a’ ions), as well as the predicted masses of the ‘b’ (green lines) and ‘y’ ions (red lines)
B
.
149
4.2.2. Construction of a Tm4 overexpressing neuroblastoma cell line B35
4.2.2.1. The Tm4 overexpressing construct
With the aim of overexpressing rat Tm4 protein in the B35 cell line, rat Tm4 cDNA was cloned into the pHβApr-4 (sig-) mammalian expression vector under the control of the human β-Actin promoter (Qin and Gunning, 1997). The rat Tm4 cDNA was cloned into the pHβApr-4 (sig-) vector using the SalI (5’) and BamHI (3’) restriction sites (see
Chapter 2 of this thesis).
4.2.2.2. Stable overexpression of rat Tm4 in the B35 cell line
The Tm4 pHβApr-4 (sig-) expression construct was stably transfected into the parental
B35 cell line using Fugene (see Chapter 2 of this thesis). Initially 24 clones were selected, and these were cultured before being divided into samples for freezing (and storage for later use) and those for verification of Tm4 overexpression by Western blot.
These were grown and sampled concurrently with two clones of B35 cells transfected with the empty pHβApr-4 (sig-) expression construct (hereafter referred to as
“controls”). Samples were lysed and had protein levels estimated by BCA before being run on Western blot and probed with the WD4/9d antibody. This antibody was raised to the 9d exon of the δTm gene, and detects recombinant and endogenous Tm4 across a range of tissues (Schevzov et al., 2005b). The WD4/9d signal was quantified relative to
Ponceau stained membranes for each clone by densitometry using ImageJ software. On the basis of initial screening, nine clones were chosen, and each classed as one of three low, medium or high overexpressing clones. The relative Tm4 overexpression levels of each of these clones were confirmed through subsequent Western blotting (see Figure
150
4.9), ensuring at least three independently cultured and lysed samples were analysed by
Western blot with WD4/9d and Ponceau stained membranes to estimate relative Tm4 oxerexpression.
Figure 4.9 Protein expression ranges of Tm4 in nine different Tm4 overexpressing B35 clones
Figure 4.9 The overexpression of Tm4 was quantified in nine Tm4 overexpressing clones relative to control cells. Tm4 clones were classed as high (clones A3.1, D1.2, A2.13), medium (clones D3.2, A3.2, D1.1) or low (clones D3.3, A3.7, A1.4) overexpressors depending on relative Tm4 protein levels. 10μg protein of cell lystaes were run on 12.5% low bis-acrylamide gels, and transferred to PVDF membrane which was stained with Ponceau solution before being blotted with the WD4/9d antibody. Experiments were done three times. The graph shows the quantitation of Tm4 levels relative to Ponceau stain; n = 3 experiments (using independently taken lysates each time), error bars = ± SEM.
151
4.2.2.3. Tm4 overexpression and the levels of endogenous tropomyosins
Tms can autoregulate in response to an altered level of one or more isoforms, as demonstrated previously with knockout mice (Vrhovski et al., 2004). Levels of endogenous Tms were measured by Western blot in Tm4 overexpressing and control
B35 cells to measure the impact of Tm4 overexpression on other Tm isoforms. Western blots of the nine isolated Tm4 overexpressing clones were probed with the following antibodies: WD4/9d (detects: Tm4), αfast9d (detects: Tm6, Tm1, Tm2, Tm3 and
Tm5a/b), CG3 (detects: all cytoskeletal products of the γTm gene), 2G10.2 (detects:
Tm5NM1), Tm311 (detects: Tm6, Tm1, TmBr2/Tm2), and GAPDH. Signal intensities of Tms were quantified relative to Ponceau stains for each membrane. Experiments measuring levels of endogenous Tms were done on two independently taken lysates per clone, and no differences were observed between Tm4 overexpressing versus control clones in the levels of other Tms for all isoforms investigated. Note that some Tm isoforms remained undetected in these blots (e.g. TmBr2/Tm2 signals were weak or non-existent in Tm311 blotted samples).
152
Figure 4.10 Tropomyosin levels in Tm4 overexpressing B35 clones
Figure 4.10 The overexpression of Tm isoforms was quantified in nine Tm4 overexpressing clones relative to control cells. 10μg protein of cell lysates were run on 12.5% low bis- acrylamide gels, and transferred to PVDF membrane which was stained with Ponceau solution before being blotted with the following antibodies: WD4/9d, αfast9d,CG3, 2G10.2 and the Tm311 antibody. Here shown is one Western blot per antibody only;WD4/9d blots were done on three independently taken sets of lysates; all other antibodies were used to Western blot two independently taken sets of lysates.
153
4.2.2.4. Categorisation of B35 morphologies
Previous studies have indicated that overexpression of Tm5NM1, TmBr3 and Tm3 isoforms in B35 cells can impact on cellular morphology (Bryce et al., 2003; Creed et al., 2011). The overexpression of Tm5NM1 induced an increase in cell surface area and large, well-defined stress fibres. Conversely, TmBr3 overexpression induced a decrease in cell surface area, and a reduced number of stress fibres (Bryce et al., 2003); the exogenous expression of the non-neuronal Tm3 isoform in B35 cells induced the extension of multiple filopodia (Creed et al., 2011). Control B35 cells display a range of morphologies, including the common extension of lamellipodia with distinctly ruffled membranes. Initial observations indicated that Tm4 overexpression was typically resulting in the retraction of these lamellipodia and the extension of neurites from the cell body. To quantify morphological changes induced by Tm4 overexpression, a categorisation system was devised to class individual cells based on metric variables.
Neurites were defined as ‘projections which were narrower than the smallest diameter of the nucleus for at least half their length and greater in length than the widest diameter of the nucleus’. Definitions of phenotype categories include:
1. "Fan" phenotype: Clear lamella adjacent to cell soma and nucleus (as defined by a single DAPI stain), lamella extends in a circular perimeter around the cell soma such that a single continuous lamella extends distally in all directions from the soma to encircle the nucleus and soma entirely. Lamella must extend distally (from the nucleus stain) for more than the length of the narrowest diameter of the nucleus.
2. "Broken fan" phenotype: As above, except that a single lamella extends from the soma distally to encircle between 30% and 100% of the soma perimeter. The cell may or may not extend a single neurite. This neurite may not be longer than three times the 154 widest diameter of the nucleus.
Collectively, “Fan” and “Broken Fan” phenotypes are termed “Lamella”
phenotypes.
3. "Stalks” phenotype: Cell soma has two or more stalks of lamella extending distally from the soma. The longest distance between the most distal edge of lamella (i.e. the lamellipodia) and the nucleus is not more than three times the width of the nucleus at its widest point. In addition, soma may extend neurites, but not greater in length than three times the widest diameter of the nucleus.
4. "Pronged" phenotype: The cell extends at least one neurite, and no one neurite is longer than three times the width of the nucleus at its widest diameter. A single (but not multiple) lamella encircling less than 30% of the soma perimeter may or may not extend from the soma.
5. "Stringed" phenotype: At least one neurite extends distally from the soma and at least one neurite is a length exceeding that of three times the diameter of the nucleus at its widest part. The cell may or may not extend lamella in addition to this.
Collectively, “Pronged” and “Stringed” phenotypes are termed “Processes”
phenotypes.
6. “Pygnotic” phenotype: Cells comprising a nucleus, and an immediate lamellal protrusion around the nucleus which does not extend distally at any point more than the length of the narrowest diameter of the nucleus.
See Figure 4.11 for examples of phenotype categories. Where neurites or lamella from two or more cells were indistinguishable (i.e. appear continuous), this presence was used to score the phenotype of both cells. Lamellipodia or neurites which appeared to 155 arise from two or more cells, and extend between two or more nuclei, were counted as the length extending from the soma until the point equidistant between those nuclei.
Cells which were in any part occluded by the perimeter of the field of view were not included, unless that cell was a stringed cell, and the part being occluded was a neurite which had at least a length of three times the width of the nucleus at its widest part within the field of view. When two nuclei were less than the distance of diameter of one nucleus apart, they were considered as undergoing mitosis, and counted as one cell.
156
Figure 4.11 Categories of B35 cell morphologies
Figure 4.11 B35 cell morphologies were categorised according to presence and characteristics of lamellipodia and neurites (see Section 4.2.2.4 for explanation). Cells were cultured for 24 hours in growth media before fixing and staining with WD4/9d (Tm4, green), AC74 (β-Actin, red) and DAPI (nucleus stain, violet).
157
4.2.2.5. Impact of Tm4 overexpression on B35 morphology
Three control clones, three low Tm overexpressing clones and three high Tm overexpressing clones were cultured and fixed on coverslips for imaging and scoring of phenotype categories. All cells within one field of view (FOV) were scored, and the proportions of cells within each category per FOV calculated. This was done for five
FOVs at 20x magnification per coverslip, and three coverslips per clone. This experiment was here done one time only as a pilot, and later repeated to include other
Tm overexpressing clones (see Chapter 5 of this thesis). Analyses of high and low Tm4 overexpressing clones versus controls revealed that high Tm4 overexpressing clones had significantly smaller proportions of cells with intact persistent lamellipodia
(“Lamella” phenotypes), and significantly greater proportions of cells extending neurites (“Processes” phenotypes) than control cells. The low Tm4 overexpressing clones showed this shift in the ratios of phenotypes, but to a lesser extent (and without significant differences to control clones) (see Figure 4.12). This indicates that Tm4 overexpression in B35s induces neurite outgrowth in a dose dependent manner.
158
Figure 4.12 High levels of Tm4 overexpression induce neurite outgrowth
159
Figure 4.12 Phenotypes were scored for each of three control, Tm4 high overexpressing and Tm4 low overexpressing clones. High Tm4 overexpressing clones had significantly smaller proportions of “lamella” phenotypes (A, and D for example) and significantly greater proportions of “processes” phenotypes (C, and F for example) than controls. There was no difference in the proportions of stalks phenotypes (B, and E for example) between controls and Tm4 high overexpressors. Tm4 low overexpressors were not significantly different to controls in the proportions of any of these categories (A, B and C). Asterisk (*) indicates statistical significance p < 0.05, error bars = ±SEM.
4.2.2.6. Impact of Tm4 overexpression of B35 proliferation rate
As high Tm4 overexpression induced neurite outgrowth, it was hypothesised that another aspect of neural differentiation, namely cell cycle exit, was affected also. To test whether proliferation rates were altered by Tm4 overexpression, cells of the highest
Tm4 overexpressing clone (#A3.1) and control cells were seeded and cultured each in multiple wells of 12 well plates, and cell numbers within each of three wells per clone counted on consecutive days. Each day, three replicate wells of each clone were counted, and results from one experiment are graphed in Figure 4.13. This experiment was done three times, with different growth conditions (see Chapter 2 for details), however in each experiment Tm4 overexpressing cells had significantly lower proliferation rates relative to control cells after at least four days in culture.
160
Figure 4.13 Tm4 overexpression slows proliferation in B35 cells
Figure 4.13 Tm4 overexpressing and control cells were each plated at a density of 600 cells per well of a 12 well plate (day zero). Every 24 hours from plating, 3 replicate wells of each clone were trypsinised and cell numbers counted. From day 4 (inclusive), there were significantly greater numbers of control cells than Tm4 overexpressing cells. Asterisk (*) indicates statistical significance p < 0.05.
161
4.3. Discussion
4.3.1. The Tm4 associated product
Aside from alternative splicing and promoter use producing multiple functional variants from the same gene, the function of some Tm isoforms can be further augmented through specific post-translational modifications (PTM). Here reported is evidence of a
Tm4 associated product in embryo and adult mouse brain which is immunoreactive with the WD4/9d antibody and with similar biochemical properties to Tm4. Further insight into the identity of this Tm4 associated product was gained with 2D gel electrophoresis
(2D-GE). In many cases, proteins which have undergone some form of PTM (such as phosphorylation, glycosylation or limited proteolysis) can be located with 2D-GE, as they appear as distinct spot trains in the horizontal (1st dimension) axis of the gel (see
Görg et al., 2004 for review). 2D-GE here indicated that the Tm4 associated product may not be a PTM of Tm4 (or vice versa), but rather that these two products may be distinct proteins of different molecular weights, with each protein having undergone some form of PTM.
Phosphorylation of muscle Tms has been reported in many species including frog (Mak et al., 1978; Ribolow and Bárány, 1977), chicken (Montarras et al., 1981; Montgomery and Mak, 1984), rabbit (Heeley et al., 1982; Mak et al., 1978), rat, and mouse (Heeley et al., 1982). Phosphorylation is not, however, exclusive to muscle Tms. The phosphorylation of the βTm gene HMW cytoskeletal isoform Tm1 (Houle et al., 2003) on the penultimate C-terminal residue (serine 283) is essential for oxidative-stress induced actin stress fibre formation (Houle et al., 2007), indicating that phosphorylation
162 can change the relationship between Tm and actin, or between Tm and other ABPs. To date, no phosphorylation states have been reported for LMW Tms, although rat and mouse Tm4 each have potential sites including multiple tyrosine, threonine and serine residues, and a C-terminal end serine 211 residue.
The here-reported N-terminal acetylation of Tm4 is novel, but not unexpected. Muscle
Tms are acetylated at their N-terminal methionine residue (Cho et al., 1990), and this modification increases the stability of the helical coiled-coil Tm dimer (Greenfield et al., 1994). Acetylation of the N-terminal methionine has been shown to increase the affinity of vertebrate striated muscle Tm with actin (Hitchcock-DeGregori and Heald,
1987; Monteiro et al., 1994; Palm et al., 2003; Urbancikova and Hitchcock-DeGregori,
1994), and was initially hypothesized as being necessary for the head-to-tail polymerisation of Tm (Hitchcock-DeGregori and Heald, 1987; Monteiro et al., 1994).
This prediction was realised with structural studies showing that acetylation at the N- terminus prevents these residues splaying out, and it is believed that this fidelity of the coiled-coil aids in the polymerisation of the N-terminus of one Tm molecule with the C- terminus of another (Brown et al., 2001). Tm is present as a mixed population of both acetylated and non-acetylated states in fission yeast, and as in muscle Tms and Tm1, acetylation increases the affinity of Tm for actin (Skoumpla et al., 2007). Further investigation has shown that the acetylation of fission yeast Tm can provide for two functional variants in vivo which associate with actin filaments at different phases of mitosis, and which differently regulate myosins during mitosis (Coulton et al., 2010).
Here reported is that the entire pool of the identified Tm4 protein was N-terminally acetylated, and so it is unlikely that any acetylation was contributing to a functional dichotomy in these cells at the time of sampling.
163
Other PTMs can give rise to the distinctive pI shifts as seen in 2D-GE in this chapter.
Further assays are required to determine whether these products are glycosylations, phosphorylations, or other PTMs. The identity of the Tm4 associated product is still unknown, although evidence presented here indicates it is a Tm which shares a high homology with the 9d exon of the δTm gene. Further investigation of δTm transcripts may provide useful insight into whether this product is in fact a splice variant of Tm4.
4.3.2. Characterisation of a novel Tm4 overexpressing B35 cell line
B35 cells have been used previously as a model system for examining actin organisation in neural cells (Bryce et al., 2003), and the development here of a novel B35 cell line overexpressing the Tm4 isoform will aid in the understanding of Tm4 function. While the overexpression of Tm5NM1 in B35 cells induces an increase in levels of the αTm gene product Tm5a (Bryce et al., 2003), and the knockout of γ9d exon can induce upregulation of the γTm gene products containing the γ9c exon (see Chapter 3 of this thesis), no alteration of the Tm profile was evident with the overexpression of Tm4.
The high overexpression of Tm4 induced neurite outgrowth, and also a significant reduction in proliferation rates. These effects are suggestive of Tm4 inducing differentiation-like effects in these cells, just as neural progenitors extend neurites and exit the cell cycle when differentiating. Tm4 is expressed in the growth cones of cultured rat cortical neurites (Had et al., 1994) and the here-reported overexpression of
Tm4 in B35s can drive a reorganisation of actin sufficient to induce neurite outgrowth.
Tms have previously been shown to have varying effects on B35 cell morphology
(Bryce et al., 2003), and the categorisation system here-devised provides a method of quantifying the various phenotypes in a given population. In Chapter 5, further analyses
164 are done comparing Tm4 and other Tm overexpressing B35 cells, to test whether neurite outgrowth effects seen here are specific to Tm4, or common to overexpression of any of the Tms.
The Tms can also each have isoform specific effects (e.g. recruitment or competition) on other ABPs (Bryce et al., 2003; Creed et al., 2011), and it is possible that Tm4 can help to reorganise the actin cytoskeleton through mediating the effects of other ABPs.
Further analyses of Tm induced changes in the proteome are presented in Chapter 5.
165
Chapter 5: Characterisation of tropomyosin specific effects on the cytoskeleton, and additional effects on protein expression and cell cycle in the neuroblastoma cell system B35
166
5. Chapter 5. Characterisation of tropomyosin specific effects on the cytoskeleton,
and additional effects on protein expression and cell cycle in the neuroblastoma
cell system B35
5.1. Introduction
Throughout maturation, neurons undergo precise morphological changes. Neuronal differentiation involves coordinated reorganisation of cell structure, resulting in the sprouting and elongation of neurites (the precursors of axons and dendrites). Normal neuronal function depends on the emergence and elongation of these neurites, and the elaboration of branched networks of neurites which span between neurons (see Cohen-
Cory, 2002 for review). While extracellular cues are able to stimulate or inhibit neurite outgrowth and branching, it is the reorganisation of the actin cytoskeleton which ultimately drives morphological change (see Da Silva and Dotti, 2002 for review).
During neuritogenesis, actin networks (lamellipodia) and bundles (filopodia) organise into structural bases of growing neurites. During outgrowth, neurites are guided by growth cones at their distal tips, and the motility and directional movement of these organelles relies on dynamic reorganisations of the actin within (Pak et al., 2008; Smith,
1988). Neuritogenesis is heavily influenced by the extracellular environment, for example extracellular matrix proteins such as laminin (Ichikawa et al., 2009; Tucker et al., 2005), and axonal guidance factors such as the Slit family of ligands (Ypsilanti et al., 2010). Cues can be transduced from extracellular ligands through their receptors (in the examples of laminin and Slit, the integrins and Roundabout (Robo) receptors respectively). These receptors in turn can signal via the Rho GTPases and their actin binding protein (ABP) effectors to the actin cytoskeleton (see Luo, 2000 for review). 167
Molecular cues can initially guide growth cones and their corresponding neurites to regional destinations, but the regulation of arbours feeding synaptic networks can continue while neurites have stalled in elongation, or after primary neurites have arrived at their destinations (Luo and O'Leary, 2005). Arborisation can be influenced by, for example, extracellular cues and synaptic activity (Mizuno et al., 2010; Uesaka et al.,
2005). Like primary neurite outgrowth and growth cone dynamics, the initiation and elongation of secondary neurites (branch points extending from primary neurites) requires coordinated restructuring of the actin cytoskeleton.
As actin has a central role in neuritogenesis, understanding mechanisms of actin organisation can provide valuable insight into the processes governing normal neuronal development and function. Previous studies have highlighted the importance of particular actin binding proteins (ABP) in neuritogenesis. The actin depolymerising proteins, actin depolymerising factor (ADF) and cofilin, can influence neuritogenesis, with evidence suggesting a multifaceted involvement. Using adenoviral infection of variously active ADF/cofilin constructs in chick spinal cord and rat cortical neurons, increasing ADF/cofilin activity has been shown to induce neurite outgrowth, potentially through increasing actin turnover, promoting growth cone lamellipodial extension, and allowing microtubule-based growth cone extension (Meberg and Bamburg, 2000).
Similarly, neurite extension is inhibited by knockdown or attenuation of ADF/cofilin in both PC12 cells and chick dorsal root ganglia neurons (Endo et al., 2007). Altering the levels of upstream signalling molecules can affect growth cone motility and size through perturbing signalling cascades to downstream effectors. Knocking out the myelin-associated neurite outgrowth-inhibiting molecule Nogo can increase growth cone size and motility, perhaps through increasing LIM Kinase phosphorylation,
168
decreasing cofilin activity, and decreasing expression of cytoskeletal Tms (Montani et al., 2009). ADF/cofilin activity can also be regulated in an isoform specific manner by the Tms: in the B35 neuroblastoma cell line, increasing Tm5NM1 expression can increase the inactive (phosphorylated) fraction of ADF/cofilin, an effect not seen with overexpression of TmBr3 (Bryce et al., 2003).
Tms can influence the levels and activity of other ABPs, including the fascins. Fascins can crosslink actin filaments into parallel bundles (Edwards and Bryan, 1995; Ishikawa et al., 2003) and are important in the formation and maintenance of filipodia in growth cones (Cohan et al., 2001), and in normal neurite outgrowth and pathfinding (Kraft et al., 2006). The non-neuronal Tm isoform Tm3 interacts with fascin, and exogenous expression of Tm3 induces filopodial outgrowth in the B35 cell line (Creed et al., 2011).
The interactions between neuronal Tms and fascin remain unknown. While these ABPs help to reorganise actin to evoke morphological change, in neurite outgrowth changes in the actin cytoskeleton are also accompanied by microtubule (MT) organisation.
Microtubule-associated protein 2 (MAP2) is one member of a family of developmentally regulated proteins associated with neuronal differentiation, which can influence neurite outgrowth through MT stabilisation and actin cytoskeletal organisation
(Caceres et al., 1986). The MAP2a and 2b isoforms are markers of dendritic fate
(Bernhardt and Matus, 1984), whereas the smaller MAP2c isoform is also found in developing axons (Meichsner et al., 1993). MAP2c is considered a “juvenile” isoform, the expression of which is more abundant in neonatal than adult brain (Garner et al.,
1988; Riederer and Matus, 1985), and is found in developing neurites (Meichsner et al.,
1993) where it can stabilise the microtubule cytoskeleton (Weisshaar et al., 1992). In a
169
phospho-dependent manner, MAP2c can also bind actin (Ozer and Halpain, 2000) and can bundle actin filaments through its MT binding domain, a process necessary for the initiation of neurite outgrowth in N2a mouse neuroblastoma cells (Roger et al., 2004).
MAP2c expression can be sufficient to promote neurite outgrowth in undifferentiated
N2a cells (Dehmelt et al., 2006); and in murine embryonic stem cells, MAP2c expression can be induced by knockdown of the actin regulating RhoA kinase ROCK, and is concomitant with the generation of neural progenitor cells (Chang et al., 2010). In these capacities, MAP2c can be considered both a marker of neuronal priming, and also a means by which microtubule stabilisation and the actin cytoskeleton are linked during neurite outgrowth.
To investigate the functions in neurite outgrowth and branching of neuronally expressed
Tm isoforms, and the Tm isoform specific effects on expression of other proteins, B35 cells expressing different Tm isoforms were analysed. The specific aims of this chapter were:
1. To characterise the morphological consequences of overexpression of each of these
Tms in B35 cells (with and without treatment inducing cell cycle exit), specifically the impacts of Tm overexpression on neurite outgrowth, branching, and growth cone size;
2. To identify proteins which are altered in their levels with different Tm isoform overexpression by using quantitative proteomics;
3. To measure the activity of the actin severing ADF/cofilin with Tm overexpression; and
4. To determine the Tm effects on cell cycle exit using flow cytometry and cell cycle analyses.
170
Investigations concomitant with these were made into the effect of Tm overexpression on the neuronal marker MAP2c, and these will be considered in the context of other consequences of Tm overexpression. Reported here are data showing that ADF/cofilin activity, fascin protein levels, and cell cycle exit can be regulated in an isoform specific manner by the Tms.
171
5.2. Results:
5.2.1. Tropomyosins induce neurite outgrowth: phenotype categories
To quantify the morphological consequences of Tm overexpression, clones of B35 cells overexpressing one of the αTm gene products TmBr1, TmBr2, TmBr3, or the δTm gene product Tm4 were compared with cells transfected with the empty pHβAPr3 (sig-) vector (control cells). Cells were plated on poly-D-lysine coated glass, and after 24 hours incubation in growth media at 37°C and 5% CO2 were fixed and stained for tubulin or β-actin. Images of cells were scored for numbers of phenotypes seen within each field of view (see Chapter 2 for different phenotype category definitions). Cells sampled under these conditions are hereafter referred to as “uninduced cells”. This experiment was repeated three times, and within each experiment at least 55 cells were scored per clone (for a total of ≥165 cells per clone). Within each experiment, controls had a significantly greater proportion of cells with intact lamella and lamellipodia
(“Lamella” phenotypes, see Chapter 2), whereas each Tm overexpessing clone had signficantly greater proportions of cells which had reduced lamella and lamellipodia and extended neurites (“Processes” phenotypes, see Chapter 2) (see Figure 5.1). Previous work indicates that this is not a general phenomenon of Tm overexpression, as
Tm5NM1 overexpression in uninduced B35 cells retards neurite outgrowth (Bryce et al., 2003).
Initial experiments were carried out using two different clones overexpressing
Tm5NM1 (clones #314.9 and #314.7). Clone #314.9 showed a two-fold higher expression than clone #314.7 (data not shown), and analyses revealed that clone #314.7 displayed neurite formation whereas clone #314.9 did not (see Figure 5.2). Where
172
available, different clones were also analysed for each of the other Tm overexpressing isoforms. In the case of TmBr1 overexpressing cells, the clone which had previously been identified as the highest overexpressor (clone #1.9) had the greatest level of cell to cell heterogeneity of TmBr1 expression, and so use of this clone was discontinued, and morphological analysis experiments were repeated using a different high overexpressing clone of TmBr1 (clone #1.18). See Appendix 3 for details of each clone used. Only
TmBr1 had significant inter-clonal variation of phenotypes. Here reported are the analyses of one clone per Tm isoform overexpression only.
173
Figure 5.1. Overexpression of tropomyosin isoforms TmBr1, TmBr2, TmBr3, and Tm4 each promote neurite outgrowth in uninduced cells
Figure 5.1. A. Mean proportions of “Lamella” phenotypes in uninduced control versus Tm overexpressing cells (mean proportions: control = 0.66 ±0.09; TmBr2 = 0.19 ±0.06; TmBr3 = 0.07 ±0.03; Tm4 = 0.03 ±0.02). Note that experiments comparing the TmBr1 overexpressing and corresponding control cells were done at different times to all other clones (mean proportions: control = 0.66 ±0.08; TmBr1 = 0.12 ±0.06). B. Mean proportions of “Processes” phenotypes in uninduced control versus Tm overexpressing cells (mean proportions: control = 0.14 ±0.03; TmBr2 = 0.77 ±0.06; TmBr3 = 0.87 ±0.04; Tm4 = 0.76 ±0.05). Note that the TmBr1 overexpressing (and corresponding control) experiments were done at different times to all other clones (mean proportions: control = 0.25 ±0.09; TmBr1 = 0.91 ±0.04). Differences between control and Tm overexpressing cells were significant and in the same direction at each time. Experiments were done three times. Graphs show data from one experiment representative of all three. Double asterisk (**) indicates statistical significance of p < 0.001, error bars = ±SEM.
174
Figure 5.2. Phenotypes of uninduced Tm5NM1 overexpressing B35s vary with clone
Figure 5.2. The phenotypes of Tm5NM1 high overexpressing clones 314.9 (A, C) and 314.7 (B, D). Cells were fixed and stained with β-actin antibody before fluorescence imaging. All cells are uninduced. Note the neurite outgrowth evident in 314.7 clone, and absent from the 314.9 clone. Scale bar = 50μm.
175
5.2.2. Tropomyosins differently affect neurite outgrowth
To further compare effects of Tm overexpression in B35 cells, cells were treated with
0.5mM dbcAMP and serum reduction for 24 hours (hereafter referred to as “induced cells”) and their responses in specific variables of neurite outgrowth were measured (see
Chapter 2 for definitions of neurites; all neurites ≥8.5μm in length were assayed). Both the Tm4 and TmBr3 overexpressing cells had a significantly greater mean number of neurites per cell than control cells, however there was no difference in the number of neurites extended by either TmBr1 or TmBr2 overexpressing cells relative to control cells (see Figure 5.3). To stop this effect confounding measures of neurite branching, branching was measured as the number of branch points (≥3μm in length) per primary neurite, rather than branching per cell. Both Tm4 and TmBr3 overexpressing cells had a significantly greater mean number of primary neurites with multiple branch points, and
TmBr3 overexpressing cells also had a significantly greater mean number of primary neurites with single branch points relative to control cells (see Figure 5.4). While
TmBr2 overexpression had no effect on branching, TmBr1 overexpression promoted decrease in numbers of neurites with multiple branch points which failed to reach statistical significance (see Figure 5.4). This arborisation was not associated with the length of primary neurites, as neither TmBr3, Tm4 (or TmBr1) overexpression induced changes in primary neurite length, while TmBr2 overexpression (which had no effect on neurite branching) resulted in significantly greater mean lengths of primary neurites relative to controls (see Figure 5.5). Thus the effects of Tm overexpression on morphology of induced B35 cells is highly isoform specific (see Figure 5.6). Measures of neurite length, branching and number were made with the assistance of Andrea
Connor. 176
Figure 5.3. Tm4 and TmBr3 overexpression each result in increased numbers of primary neurites per cell
.
Figure 5.3 After 24 hours serum reduction and dbcAMP treatment both Tm4 and TmBr3 overexpressing cells had a significantly greater mean number of primary neurites per cell than did control cells (control mean = 2.1 ±0.2; TmBr3 mean = 2.8 ±0.2, p < 0.05; Tm4 mean = 2.7 ±0.16, p<0.05). Neither TmBr1 nor TmBr2 (TmBr2 mean = 2.1 ±0.11, ns) overexpressing cells were significantly different to control cells in mean primary neurite number. Note that TmBr1 and corresponding control (control = 2.08 ±1.73, TmBr1= 2.6 ±0.17, ns) experiments were done at different times to all other clones. Differences between control and each of Tm4 and TmBr3 overexpressing cells were significant and in the same direction at each time. Experiments were done three times. Graphs show data from one experiment, representative of all three. Numbers of primary neurites per cell were compared for 50 cells per clone per experiment over 3 experiments for a total of 150 cells per clone. Asterisk (*) indicates statistical significance of p < 0.05, error bars = ±SEM. 177
Figure 5.4. Tm4 and TmBr3 overexpression each result in increased branching
Figure 5.4. After 24 hours serum reduction and dbcAMP treatment only TmBr3 overexpressing cells had a significantly greater proportion of neurites with single branch points relative to control cells (control mean = 0.13 ±0.03; TmBr3 mean = 0.31 ±0.02 p < 0.05). TmBr3 and Tm4 overexpressing cells each had a significantly greater proportion of primary neurites with multiple branch points relative to control cells (control mean = 0.02 ±0, TmBr3 mean = 0.09 ±0.03, p<0.05; Tm4 mean = 0.07 ±0.1, p<0.05). Note that TmBr1 overexpression resulted in a trend towards a decrease in neurites with multiple secondary neurites relative to controls (control mean = 0.06 ±0.02; TmBr1 mean = 0.02 ±0.1, ns), and that experiments analysing TmBr1 overexpressing cells and corresponding control samples were done at different times to all others. Experiments were done three times. Graphs show data from one experiment, representative of all three. Over 3 experiments 50 neurites per clone per experiment for a total of 150 neurites per clone were scored as to whether they had no branch points, one branch point (white bars), or multiple branch points (grey bars). Asterisk (*) indicates statistical significance of p < 0.05,error bars = ±SEM. 178
Figure 5.5. TmBr2 overexpression results in increased neurite length
Figure 5.5. After 24 hours serum reduction and dbcAMP treatment primary neurites of TmBr3 and Tm4 overexpressing cells were no different in length relative to primary neurites of control cells (control mean = 22.7μm ±1.1; TmBr3 mean = 28.6μm ±1.7, ns; Tm4 mean = 25.7μm ±1.4, ns). Primary neurites of TmBr2 overexpressing cells (TmBr2 mean = 33.7μm ±2.2) were significantly longer than those of control cells (p < 0.001). Lengths of 50 primary neurites per clone per experiment (over 3 experiments for a total of 150 primary neurites per clone) were compared. TmBr1 overexpression induced no change in primary neurite length. Note that experiments comparing TmBr1 overexpressing and corresponding control (control mean = 31.9 ±1.73μm; TmBr1 mean = 31.1 ±1.4 μm, ns) cells were done at different times to all other clones. Experiments were done three times. Graphs represent data pooled from all three experiments. Double asterisk (**) indicates statistical significance of p < 0.001, error bars = ±SEM.
179
Figure 5.6. Tropomyosins impact on cell morphology of induced B35 cells in an isoform specific manner
Figure 5.6. All cells imaged after 24 hours incubation with serum reduction and dbcAMP treatment, fixation and staining with β-tubulin. Note the increase in neurite length with TmBr2 (C) overexpression, and the increase in neurite branching with TmBr3 (D) and Tm4 (E) overexpression, compared with TmBr1 (B) overexpressing and control (A) clones. Scale bar = 25μm.
180
5.2.3. Increased neurite branching, but not length, is associated with changes in growth cone area of tropomyosin overexpressing cells
Investigations were made into whether Tm induced changes in either neurite branching or neurite length were associated with changes in growth cone area. Induced cells were imaged and numbers of neurites terminating in growth cones (versus those which tapered off at their distal tips) were scored, and the areas of 21 growth cones per clone per experiment (over three experiments for a total of 63 growth cones measured per clone) were measured with the analysis program ImageJ. All measurements of growth cone areas were done by Hannah Freittag. No Tm isoform overexpression resulted in a change in the numbers of neurites terminating in growth cones (data not shown).
However the two clones which had significantly increased neurite branching, Tm4 and
TmBr3 overexpressing cells (see Figure 5.4), each had significantly larger mean growth cone areas than control cells (see Figure 5.7). TmBr1 overexpressing cells, which showed a trend towards fewer neurites with multiple branch points (see Figure 5.4), had a significantly smaller mean growth cone area than control cells (see Figure 5.7).
TmBr2 overexpressing cells, which showed an increase in mean neurite length relative to controls (see Figure 5.5), but no change in arborisation (see Figure 5.4), showed no change in growth cone area relative to control cells. Tm effects on growth cone area were isoform specific (see Figure 5.7), and Tm induced changes in neurite branching, but not neurite length, were associated with changes in growth cone area.
181
Figure 5.7. Effects of Tm isoform overexpression on growth cone area in induced B35 cells are isoform specific 1.
2.
182
Figure 5.7. 1. After 24 hours serum reduction and dbcAMP treatment, both TmBr3 (D) and Tm4 (E) overexpressing cells had larger growth cones, and TmBr1 (B) overexpressing cells had smaller growth cones than control cells (A). TmBr2 (C) overexpressing cells show no significant difference in growth cone sizes relative to control cells. Scale bar = 5μm. 2. TmBr3 overexpression and Tm4 overexpression each resulted in a significant increase in growth cone area relative to controls (control mean = 13.4 ±0.8 μm2; TmBr3 mean = 15.3 ±0.7μm2, p<0.05; Tm4 mean = 17.1 ±1.1μm2, p<0.05). TmBr1 overexpression resulted in a significant decrease in growth cone area. Note that experiments comparing TmBr1 overexpressing and corresponding control (control mean = 14.5 ±0.9μm2, TmBr1 mean = 11.2 ±0.6μm2, p<0.05) cells were done at different times to all other experiments. In each experiment 21 growth cones per clone were measured, over three experiments for a total of 63 growth cones per clone. Experiments were done three times, graph (1) represents data pooled from all three experiments. Asterisk (*) indicates statistical significance of p < 0.05, error bars = ±SEM. Growth cone measurements were done by Hannah Freittag.
5.2.4. Tropomyosin overexpression can affect levels of other proteins
Tropomyosin isoforms can differentially influence the organisation of actin filaments in distinct subcellular compartments through their differing relationships with ABPs (see
Gunning 1998, 2008, and Chapter 1 for reviews). To screen for changes in levels of other proteins with Tm overexpression, sample lysates of uninduced Tm4, TmBr1,
TmBr2, TmBr3 and Tm5NM1 overexpressing and control cells were analysed by isobaric tags for relative and absolute quantitation (iTRAQ) and subsequent liquid chromatography tandem mass spectrometry (LC- MS/MS). Experiments were run twice, with cell lysates of two Tm4 overexpressing and two control samples included in each experiment, and two TmBr1, TmBr2, TmBr3 and Tm5NM1 overexpressing samples
(each sample hereafter referred to as a biological replicate) each included in one experiment each. Data were compiled using the proteomics software ProteinPilot.
Autobias ratios are ProteinPilot estimates of the relative levels of total protein between two samples, and the corrections made for discrepancies in total protein loading 183
between samples. In these studies all comparisons are made relative to control samples, and these autobias ratios are listed in Table 5.1. Within each experiment samples were analysed twice (i.e. two technical replicates), resulting in a total of 8 runs (with one run being one biological replicate analysed in one technical replicate) for each of control and Tm4 overexpressing samples, and 4 runs for all other Tm overexpressing samples
(see Figure 2.2, Chapter 2 for flow diagram of experimental design). Because of problems previously discussed with the TmBr1 overexpressing clone initially used in this investigation (see Section 5.2.1), and the great variability between biological replicates of the TmBr1 samples used, data from TmBr1 overexpressing cell samples are not reported here. By comparing all other clones across two experiments,
ProteinPilot analyses identified an average of 4573 proteins before grouping, representing an average of 10,961 distinct peptides (≥95% confidence) and 21,931 spectra identified. This data reduced into an average of 1259 proteins identified after grouping. All iTRAQ LC-MS/MS was done with the assistance of Anne Poljak at the
Bioanalytical Mass Spectometry Facility, UNSW.
184
Table 5.1. Autobias correction values for iTRAQ labeled TmBr2, TmBr3, Tm4 and Tm5NM1 samples relative to control samples
Experiment 1 Experiment 2 1st run 2nd run 1st run 2nd run Reporter Cells: 113 121 113 121 Cells: 113 121 113 121 ion: 114 Tm4 0.4882 0.3438 0.4928 0.3409 Tm4 0.7983 0.7791 0.8117 0.7944 118 Tm4 2.1322 1.5297 2.1439 1.5287 Tm4 1.1215 1.0987 1.1049 1.0903 115 Tm5NM1 0.9894 0.6982 0.9977 0.7091 TmBr3 0.9927 0.9743 1.0013 0.9746 119 Tm5NM1 0.2904 0.2059 0.2974 0.202 TmBr3 1.1001 1.0795 1.1302 1.1119 116 TmBr2 1.4447 1.0458 1.4729 1.0462 117 TmBr2 0.3929 0.2790 0.4011 0.277
Table 5.1. Autobias correction values relative to each of two biological replicate control samples, labeled with 113 and 121 reporter ions respectively, within each technical duplicate of each experiment (1st and 2nd runs). These ratios represent the relative protein loading of one sample versus the control. In general, autobias correction values of between 0.7 and 1.4 are considered reliable indicators that loading discrepancy will not influence other estimates of protein level differences between samples. Note the larger spread of ratios in Experiment 1 versus Experiment 2, probably due to the introduction of a second step in the second experiment for protein determination (a Coomassie stained gel to compare protein estimates of 10μg per sample, in addition to a BCA assay for protein level estimation).
185
Reporter ion (iTRAQ) ratios represent the estimated level of deregulation of a given protein between two treatments. For example, the protein fascin was identified in Tm4 overexpressing and control samples, and in one run the iTRAQ ratio was Tm4 sample : control sample = 1.32, indicating that this Tm4 sample contained 32% more fascin than this control sample. Statistical significance of deregulation was estimated from
ProteinPilot produced ‘Error Factors’ (EF). The EF can be used to calculate confidence intervals as follows: lower confidence interval = autobias ratio/EF, upper confidence interval = autobias ratio x EF. When only those iTRAQ ratios ≤0.8 or ≥1.2 relative to control samples, and also only those significantly different to control samples were considered, numbers of proteins deregulated in Tm overexpressing samples relative to control samples reduced drastically (57 in Tm4, 47 in TmBr3, 45 in Tm5NM1, and 40 in TmBr2 overexpressing samples). When again more rigorous criteria were applied, such that only those proteins which were significantly deregulated relative to controls in two or more runs (for TmBr2, TmBr3 or Tm5NM1 overexpressing samples) or four or more runs (for Tm4 overexpressing samples) were considered, these numbers were further reduced. These significantly deregulated proteins were sorted according to function using Database for Annotation, Visualisation, and Integrated Discovery
(DAVID) (Huang et al., 2008, 2009). The DAVID Functional annotation clustering tool uses the number of different proteins identified in a sample which contribute to a given pathway, relative to the total number of proteins identified in that sample. This association is tested for significance using scores from a modified Fisher’s Exact test, and highly related pathways are grouped together into “clusters”. An additional
“enrichment” score is assigned to each cluster based on the probability that a subset of x proteins from a list of y total proteins being in a given cluster is greater than that found by chance, if the total number of X proteins in that pathway relative to the total number
186
of Y proteins in the genome are considered. As many proteins have more than one function, the different clusters which one protein contributes to are reported. A shortlist of proteins deregulated in each group of Tm overexpressing samples, and the DAVID estimated functional pathways they are associated with, is provided in Appendix 1.
From these, a list of significantly deregulated cytoskeletal-related proteins was compiled in Table 5.2. Note that not all proteins identified in iTRAQ shortlists were grouped according to functional annotation clustering (for example the actin bundling protein fascin was significantly degregulated in TmBr3 samples, but was not included in any DAVID assigned clusters in TmBr3 altered protein shortlists).
5.2.4.1. Tropomyosin isoforms Tm5NM1 and TmBr3 are N- terminally acetylated
The iTRAQ procedure identified an N-terminal acetylation of the Tm4 isoform in B35 cells (see Chapter 4). Total pools of Tm5NM1 and TmBr3 isoforms were also found to be N-terminally acetylated in overexpressing B35 cells (see Appendix 2). The lack of identification of TmBr2 or TmBr1 as being N-terminally acetylated may come as a function of the insufficient peptide coverage of these isoforms in LC-MS/MS.
187
Table 5.2. Tropomyosins differently alter the expression of other cytoskeletal related proteins
Total Name of gene International Tm4 : Control TmBr3 : Control TmBr2: Control Tm5NM1: Control (protein ID Protein iTRAQ EF p- iTRAQ EF p- iTRAQ EF p- iTRAQ EF p- confidence) Index (IPI) ratio value ratio value ratio value ratio value Accession 75.82 LOC683788 Fascin IPI00896761.2 1.30 1.03 <0.001 1.16 1.03 <0.001 - ns - ns
69.92 Vim Vimentin IPI00230941.5 1.29 1.03 0.01 1.07 1.03 <0.001 1.16 1.03 0.005 - ns 91.31 Actg1;LOC100361457 IPI00360356.1 1.23 1.06 <0.001 1.11 1.05 <0.001 1.52 1.05 0.04 2.72 1.04 <0.001 Actin, cytoplasmic 2
66.7 Flna Filamin, alpha IPI00951791.1 0.94 1.05 0.04 0.94 1.06 0.04 1.28 1.06 0.007 1.94 1.81 0.03 (Predicted), isoform CRA_a
Table 5.2. Selected cytoskeletal related proteins which are altered with Tm overexpression. Note that results of significance are only reported if criteria are met as stated in section 5.2.4. All protein quantification was performed using at least five spectra, and in the majority of cases >20 spectra. Proteins with iTRAQ ratios relative to controls of between 0.8 and 1.2 were excluded from functional cluster annotation. For comparison, ratios falling in this range are here reported, if in at least one Tm overexpressing cell line the ratio is ≤0.8 or ≥1.2. A p-value <0.05 for iTRAQ ratios relative to control samples was accepted as the threshold for statistical significance (“ns” in the p value column indicates non significance of protein levels relative to controls).
188
5.2.5. Tropomyosins differently affect ADF/cofilin activity
In uninduced B35 cells, Tm overexpression resulted in neurite outgrowth (see Figure
5.1), and differently altered the levels of other cytoskeletal related proteins (see Table
5.2). ADF/cofilin are important in the processes of growth cone structure and neurite outgrowth, and overexpression of the cytoskeletal isoform Tm5NM1 has previously been shown to reduce ADF/cofilin activity and retard neurite outgrowth in B35 cells
(Bryce et al., 2003). It was therefore hypothesised that overexpression of other Tm isoforms would alter the activity of ADF/cofilin. Cell lysates of uninduced TmBr1,
TmBr2, TmBr3, Tm4, Tm5NM1 overexpressing and control cells were analysed by
Western blotting with antibodies for total ADF/cofilin, and (inactive) phospho-
ADF/cofilin (see Figure 5.8). Densitometry quantitation relative to Ponceau stains of membranes done with ImageJ software revealed that Tm overexpression of any of these isoforms did not result in a change in the pool size of total ADF/cofilin, although overexpression of Tm4 resulted in a significant increase relative to controls in the pool of phospho-ADF/cofilin (see Figure 5.8). Tm5NM1 overexpression resulted in an increase in phospho-ADF/cofilin which was not significant, and the overexpression of
TmBr1, TmBr2 and TmBr3 each had no effect on total or phospho-ADF/cofilin levels relative to controls (see Figure 5.8). Western blotting for ADF/cofilin was done with the assistance of Melissa Desouza.
189
Figure 5.8. ADF/cofilin phosphorylation is influenced by Tm overexpression in uninduced B35 cells in an isoform dependent manner
A
B
190
Figure 5.8. A. Western blotting indicated no change in the pool size of total ADF/cofilin with overexpression of any Tm, but both Tm4 and Tm5NM1 overexpressing cells had increases in levels of phospho-ADF/cofilin. B. Tm4 overexpressing cells had significantly greater levels of phospho-ADF/cofilin relative to controls. Overexpression of TmBr1, TmBr2 or TmBr3 did not affect total or phospho-ADF/cofilin pool sizes. Quantitation of phospho-ADF/cofilin and total ADF/cofilin were each done relative to membrane Ponceau stain. Due to a loading discrepancy, a greater amount of total protein was loaded into each of the lanes 1, 2 and 3 than into each of the lanes 4 and 5 (see A). Differences in protein loading were accounted for by quantifying ADF or phospho-ADF protein levels of each lysate, relative to total protein loaded for that same lysate. For example, the intensity of total ADF signal from one replicate lysate of the Tm5NM1 clone was divided by the intensity of total protein loaded for this same lysate. This ratio, of total ADF signal/ total protein was calculated for three replicate lysates within each clone. The "% Relative to Controls" (in B, above) displays these ratios which were then compared between Tm overexpressing clones and WT clones. This procedure was done independently for total ADF signal and phospho-ADF (calculated as phospho-ADF signal/total protein). No clone had a significant difference in amount of total ADF relative to WT clones. The Tm4 overexpressing clone had significantly greater levels of phospho-ADF relative to WT. n = 3 independently taken lysates of each clone. Asterisk (*) indicates p < 0.05, error bars = ±SEM.
5.2.6. Tropomyosins differently affect cell cycle exit
As Tm overexpression in uninduced cells resulted in morphological characteristics commonly associated with differentiation (e.g. lamellipodial retraction and neurite outgrowth), it was hypothesised that Tm overexpression was also inducing another aspect of neuronal differentiation: cell cycle exit. To measure the proportion of cells undergoing division, samples were stained with the DNA marker propidium iodide (PI) before being analysed by fluorescence activated cell sorting (FACS). This provides an estimate of numbers of cells in the G0/G1 growth phase (immediately following mitotic division), the S phase (in which cells undergo DNA synthesis), and the G2 and Mitosis
(M) phases (in which cells are preparing for and undergoing mitosis respectively).
Differentiation is induced in B35 cells by dbcAMP addition and serum reduction, and 191
stimulating both Tm overexpressing cells and control cells with this treatment resulted in Tm overexpressing cells having morphological impacts distinct from those in control cells (see Figures 5.3 – 5.6). It was therefore further hypothesised that Tm overexpression would promote withdrawal from the cell cycle. This would be reflected by a decreased proportion of cells in S+G2/M phases in Tm overexpressing cells compared with control samples. In uninduced cells, TmBr2 overexpression increased the proportion of cells in S+G2/M phases relative to control samples, whereas Tm4 overexpression had no effect (Figure 5.9.1). In 24 hours post dbcAMP induced cells there was no difference in proportions of cells in S+G2/M phases between control and
Tm4 or TmBr2 overexpressing samples (Figure 5.9.2). At 48 hours post dbcAMP treatment, both Tm4 and TmBr2 overexpressing samples had significantly smaller proportions of cells in S+G2/M phases than control samples (Figure 5.9.3). It is therefore concluded that TmBr2 and Tm4 can each enhance withdrawal from the cell cycle, but only in cells pre-treated for two days to induce differentiation.
192
Figure 5.9.1: Flow cytometry cell cycle analysis of uninduced Tm4, TmBr2 and control cell samples
Figure 5.9.1. Uninduced cells were stained with propidium iodide and analysed by FACS. Populations were gated to include cells within the oval gates on (A, B and C). After gating, numbers of control (A ,D); TmBr2 overexpressing (B, E); and Tm4 overexpressing (C, F) cells within each of G1, S, and G2/M phases were counted. Horizontal bars (D, E, F) indicate G0/G1 phases (orange), S phase (cyan) and G2/M phases (magenta). Cells in phases G2/M and S were combined for analyses; bar graphs represent mean proportions of cells in S+G2/M phases from n = 3 independent experimental replicates per clone. TmBr2 (but not Tm4) overexpressing cells had a significantly lower mean proportion of cells (counted “events”) in S+G2/M phases relative to control cells (G). Asterisk (*) indicates statistical significance (p<0.05), error bars = ± SEM. 193
Figure 5.9.2: Flow cytometry cell cycle analysis of 24 hours induced Tm4, TmBr2 and control cell samples
Figure 5.9.2. Cells treated with 0.5mM dbcAMP and serum reduction for 24 hours were stained with propidium iodide and analysed by FACS. Populations were gated to include cells within the oval gates on (A, B and C). After gating, numbers of control (A, D); TmBr2 overexpressing (B, E); and Tm4 overexpressing (C, F) cells within each of G1, S, and G2/M phases were counted. Horizontal bars (D, E, F) indicate G0/G1 phases (orange), S phase (cyan) and G2/M phase (magenta). Cells in phases S and S+G2/M were combined for analyses; bar graphs represent mean proportions of cells (counted “events”) in S+G2/M phase from n = 3 independent experimental replicates per clone. Neither Tm4 or TmBr2 overexpressing samples had significantly different mean proportions of cells in S+G2/M phases relative to control samples (G); error bars = ± SEM.
194
Figure 5.9.3: Flow cytometry cell cycle analysis of 48 hours induced Tm4, TmBr2 and control cell samples
Figure 5.9.3. Cells treated with 0.5mM dbcAMP and serum reduction for 48 hours were stained with propidium iodide and analysed by FACS. Populations were gated to include cells within the oval gates on (A, B and C). After gating, numbers of control (A, D); TmBr2 overexpressing (B, E); and Tm4 overexpressing (C, F) cells within each of G1, S, and G2/M phases were counted. Horizontal bars (D, E, F) indicate G0/G1 phases (orange), S phase (cyan) and G2/M phase (magenta). Cells in phases S and G2/M were combined for analyses; bar graphs represent mean proportions of cells in S+G2/M phases from n = 3 independent experimental replicates per clone. Both Tm4 and TmBr2 overexpressing samples had significantly lower mean proportions of cells in S+G2/M phases than control samples (G). Asterisk (*) indicates statistical significance (p<0.05), error bars = ± SEM. 195
5.3. Discussion
5.3.1. Tropomyosins differently affect neurite outgrowth and arborisation
During neuronal maturation, the initial extension of neurites is followed by branching of these neurites to develop either a dendritic or axonal tree. In this way neurite extension and arborisation can occur sequentially (Luo and O'Leary, 2005), and are regulated by both intrinsic cell autonomous factors (such as age of the neuron) and extrinsic extracellular cues (de Luca et al., 2009). In this current investigation, neurite extension and arborisation were regulated separately by Tm overexpression: for example, TmBr2 overexpression in induced cells resulted in increased neurite length with no detectable effect on neurite arborisation. The developmental regulation of TmBr2 expression is to date unknown, although in rat embryonic hindbrain neurons and mouse cortical neurons, mRNA transcripts are distributed in a non-polarised, uniform fashion which does not change with development (Hannan et al., 1995). TmBr2 transcripts are present at the point of differentiation of PC12 cells (Weinberger et al., 1996), indicating a potential role in the driving of neurite extension at a growth stage preceding neurite arborisation. Conversely, expression of TmBr3 occurs in developing axons of rat and mouse embryo brain (Had et al., 1994; Weinberger et al., 1996), and in PC12 cells is transcribed only once cells have been induced to differentiate and neurites have already been extended (Weinberger et al., 1993). In the current study, TmBr3 overexpression in induced cells resulted in increased neurite arborisation but not neurite length, indicating a potential role of TmBr3 in the later developmental processes of arborisation. The Tm4 protein is expressed in the growth cones of immature neurons, and also at the post- synapses of mature neurons (Had et al., 1994). Despite the growth cone-associated
196
localisation of the Tm4 isoform, Tm4 overexpression here induced no change in neurite length, but like TmBr3, increased neurite arborisation. Because of the previously known localisation of Tm4 to the growth cone, and the effects of Tm4 on branching here shown, it is possible that this branching may be mediated through processes at the growth cone.
5.3.2. Tropomyosins and growth cone size
There exist a number of different reported relationships between growth cone size and arborisation. Metalloproteinase inhibitors can induce an increase in growth cone size concomitant with a decrease in arborisation (Ould-yahoui et al., 2009), whereas inhibiting the myosin II-actin filament interaction through blebbistatin can decrease growth cone size and simultaneously increase filopodial extension, neurite outgrowth and branching (Rösner et al., 2007). Additionally, growth-cone like “waves” can travel along neurites, engorging filopodia along the neurite shaft to form branchpoints, or travel to the ends of neurites and enhance the size of existing growth cones (Flynn et al.,
2009). These studies indicate potentially multiple mechanisms by which neurites form branch points: a simultaneous increase in growth cone area and branching suggest that growth cones may be bifurcating to form branch points, or that waves are contributing to both, whereas an increase in branching unrelated to growth cone size (or associated with reductions in growth cone size) suggest nodes may be branching from primary neurites independently of the growth cone. In the current study, Tm overexpression in induced cells resulted in growth cone area changes which correlated with arborisation, suggesting Tms may be contributing to a mechanism (such as waves) which affects both variables together, or that branching nodes are nucleated from Tm-induced large growth cones. While overexpression of the TmBr3 and Tm4 isoforms each had increased mean 197
growth cone areas relative to controls, and each increased in arborisation, they had a slightly differing impact on branching in induced cells. While TmBr3 and Tm4 overexpression each resulted in more neurites with multiple branch points, TmBr3 overexpression also resulted in more neurites with single branch points. As Tms are capable of regulating actin structure through isoform specific relationships with other
ABPs (Bryce et al., 2003; Creed et al., 2011), this difference in magnitude of branching is compatible with these Tm isoforms differently regulating other ABPs.
5.3.3. Tms differently alter the levels of other proteins: iTRAQ
Neurite outgrowth and branching can be influenced differently by a number of ABPs, in a complex integrated system responsible for effecting precise morphological change.
Data here shown indicate that the contribution Tms make to morphological change is highly isoform specific. Proteomic iTRAQ analyses measure changes in levels of specific proteins in response to a given treatment - in this case, the overexpression of
TmBr2, TmBr3, Tm4 or Tm5NM1 relative to control cells. Additional criteria were applied to iTRAQ data to reduce the size of shortlists of identified proteins in these samples, and to illustrate those proteins which were most changed in their levels in response to treatment (detailed in Section 5.2.4).
These criteria left shortlists of proteins which were changed in their levels for each of
Tm4, TmBr2, TmBr3, and Tm5NM1 overexpressing samples relative to control samples. Caution should be taken when considering TmBr2 and Tm5NM1 overexpressors, as the autobias ratios for this experiment (Experiment 1, see Table 5.1) fall outside of commonly accepted values of between 0.7 and 1.4 (relative to controls), indicating loading discrepancies between these and control samples. Similarly for Tm4 198
in Experiment 1, although independent Tm4 overexpressing samples were analysed in the Experiment 2, with autobias ratios falling in the range of 0.7 to 1.4 relative to controls. These lists were then grouped according to function, using the DAVID functional annotation clustering tool. One problem with these clusters is due to an inherent weakness in iTRAQ analysis, namely that different peptides hold different probabilities of being tagged and detected. This does not affect the measures of relative protein levels between those samples in an experiment, but does mean that certain proteins are unlikely to ever be reported in any sample. So a population of unreported proteins may be those which would influence downstream functional annotation clustering, seeing identified proteins “clustered” as contributing to one versus another functional pathway. While iTRAQ is a useful tool to garner multiple candidate proteins which change in their levels with different Tm overexpression, and functional annotation clustering gives an initial guide as to the pathways which may be affected, these are screening processes only and should be followed with further validation. In this current study, candidates for further inspection have been chosen based on involvement in cytoskeletal processes, and particularly those which are implicated in neurite outgrowth or neuronal development.
Within growth cones, actin bundles form emergent filopodia which are involved with directional growth and pathfinding. The extension of these filopodia rely on retrograde flow - the movement of actin filaments towards the proximal centre of the growth cone, and the simultaneous transport of actin monomers to the distal tips of filopodia and their association with the barbed ends of actin filaments there (Mallavarapu and Mitchison,
1999). Filopodia which emerge from the cell soma can dilate to form neurites in cortial neurons (Dent et al., 2007), and filopodia can also form the basis of branch points along
199
existing neurites (Flynn et al., 2009). In this study one protein heavily implicated in filopodia formation and deregulated by Tms in an isoform specific manner is the ABP fascin.
200
5.3.3.1. Fascin
Fascin levels can be influenced by Tms: overexpression of the HMW Tm3 in fibroblasts resulted in increased levels of fascin, and Tm3-associated actin filaments are bundled by fascin, concomitant with the large increase in filopodial outgrowth in these cells (Creed et al., 2011). In the current study, iTRAQ analyses of uninduced cell samples revealed fascin levels were consistently increased in both Tm4 and TmBr3 overexpressing cells relative to controls. These cells each had increases in neurite outgrowth, and it is possible that fascin recruitment to Tm-associated filaments in these cells promotes actin filament bundling, helping to reorganise the actin within distinct lamellipodia of control
B35 cells into filopodia to form the bases of emerging neurites. The two morphological characteristics found in Tm4 and TmBr3 (but not TmBr1 or TmBr2) overexpressing cells after 24 hours induction were an increase in growth cone area, and an increase in arborisation. Testing for fascin involvement in neurite outgrowth in Tm4 and TmBr3 overexpressing cells (and their dbcAMP induced hyper-branching and enlarged growth cone phenotypes) could be achieved through knockdown of fascin in these cells, with a rescue of any phenotype indicating that the Tms are mediating these effects on actin remodeling at least in part through fascin regulation. Neurite outgrowth represents major cytoskeletal restructuring, and is accompanied by changes in levels and activity of many proteins. Aside from fascin, ABPs critically involved in actin filament dynamics in growth cones and emerging neurites include the actin depolymerising factor (ADF) and cofilin proteins.
201
5.3.3.2. ADF/Cofilin
While ADF/cofilin levels were not identified as having changed in the current iTRAQ analyses, previous work has shown that the activity of ADF/cofilin can also be regulated by the Tms. Tm5NM1 overexpression in B35 cells increases the pool of phosphorylated (inactive) ADF/cofilin (ostensibly by displacing active ADF/cofilin from actin filaments, freeing the protein so as to be a substrate for phosphorylation), and resulting phenotypes include characteristic dominant stress fibres and lack of filopodial extension (Bryce et al., 2003).
ADF/cofilin family members (hereafter refered to as “ADF/cofilin”) have a number of functions, including the alteration of actin dynamics by increasing the off rates of actin monomers from the pointed ends of actin filaments (Carlier et al., 1997), and by severing actin filaments (Bobkov et al., 2004; McGough et al., 1997). ADF/cofilin activity can mediate growth cone motility and turning through various axon guidance pathways (Marsick et al., 2010; Piper et al., 2006), and increases in ADF/cofilin activity induce increased neurite extension and length (Meberg and Bamburg, 2000). A number of factors can regulate ADF/cofilin activity, but perhaps the best characterised are the phosphorylation (inactivation) by the LIM Kinases and the dephosphorylation
(activation) by the Slingshot phosphatases (see Kuhn et al., 2000 for review). Previous work has indicated that ADF/cofilin levels and activity are positively correlated with neurite outgrowth (Endo et al., 2007; Meberg and Bamburg, 2000; Meberg et al., 1998).
However, overexpressing the ADF/cofilin negative regulator LIM Kinase also induces increases in growth cone size, and increases in early neurite lengths, which are concomitant with increases in (inactive) phosphorylated cofilin and also F-actin levels
202
(Rosso et al., 2004). Similarly, knocking down LIM Kinase decreases neurite length in hippocampal neurons (Tursun et al., 2005), PC12 cells and chick DRG neurons (Endo et al., 2007). However, the overexpression of LIM Kinase 1 can drastically suppress growth cone motility and neurite extension, while increasing the levels of cofilin phosphorylation (Endo et al., 2003). These discrepancies have previously been interpreted as evidence that a proper balance of phosphorylation and dephosphorylation is required to regulate ADF /cofilin activity for growth cone extension and motility
(Endo et al., 2007).
In this current study, we have seen similar phenotypes (in TmBr3 and Tm4 overexpressing cells) which are accompanied by differing regulations of ADF/cofilin activity. Tm4 overexpression resulted in an increase in the phosphorylated (inactive) pool of ADF/cofilin; while TmBr3 overexpression had no effect. Tm4 overexpressors, with increased neurite outgrowth and growth cone size (in this study), and Tm5NM1 overexpressing B35s, with a radically different phenotype of reduced neurite outgrowth and growth cones (Bryce et al., 2003), both displayed reduced active fractions of
ADF/cofilin. And TmBr3 overexpressing cells, with phenotypes most resembling Tm4 overexpressing cells, had no reduction in active ADF/cofilin. This suggests that the levels or activity of one ABP alone is insufficient as a predictor of cell morphology, and that Tms are capable of simultaneous divergent effects on multiple ABPs. The proteomics screen presented in this chapter illustrates that Tm isoforms can indeed alter levels of a multitude of different proteins. To unravel the different mechanisms by which Tm isoforms effect morphological change requires insight into multiple proteins which are affected by Tm expression. One protein more commonly associated with
203
neuronal differentiation and the microtubule cytoskeleton which is increased in response to Tm overexpression is MAP2c.
204
5.3.4. Neuronal cell fate and differentiation
Microtubule-associated protein 2c (MAP2c) is found in developing axons (Meichsner et al., 1993) and dendrites (Kaech et al., 2001; Morales and Fifkova, 1989), and is associated with neurite outgrowth (Dehmelt et al., 2003; Roger et al., 2004) and the transition of stem cells to neuroprogenitor cells (Chang et al., 2010). While the colocalisation of MAP2c with actin filaments has been controversial (Kaech et al.,
2001; Morales and Fifkova, 1989), evidence of actin binding (Ozer and Halpain, 2000) and actin bundling (Roger et al., 2004) functions have illustrated the importance of
MAP2c not only as a microtubule (MT) stabiliser, but as a protein which may coordinate the reorganisation of both MTs and actin during neurite outgrowth (Boucher et al., 1999; Conde and Caceres, 2009; Rodriguez et al., 2003; Roger et al., 2004). In this study, overexpressing each of the Tms in uninduced B35 cells resulted in neuronal characteristics of lamellipodial reduction and neurite outgrowth. In control uninduced
B35 cells MAP2c protein is undetectable, but is expressed after 24 hours or more of dbcAMP and serum reduction treatment. Concomitant with this project, experiments done by others in the Gunning laboratory showed that overexpressing any of TmBr1,
TmBr2, TmBr3 or Tm4 in uninduced cells is sufficient to promote MAP2c expression.
MAP2c can bind MT or actin through the same domain, depending on its phosphorylation state: dephosphorylated MAP2c binds to MTs, phosphorylation allows interaction between MAP2c and actin filaments (Ozer and Halpain, 2000). In neurite outgrowth, the order of actin-MT organisation has been shown to occur in one of two ways: the reorganisation of actin filaments can act as a precursor to MT assembly in emerging neurites (Schaefer et al., 2008), or MAP2c may initiate MT stabilisation as a precursor to actin remodelling (Dehmelt et al., 2006).
205
Tm overexpression may act to firstly upregulate MAP2c which initially stabilises MT, with actin organisation following. However given the well documented regulation of the actin cytoskeleton by the various Tms (see Gunning et al., 2008; Gunning et al., 2005 for review), it is perhaps more plausible that Tms affect actin organisation through means additional to and preceding MT organisation. While measuring levels of phoshphorylated versus total MAP2c in Tm overexpressing cells would provide insight into the substrate (i.e. actin or MTs) of this protein, the results discussed here are only levels of total MAP2c. Interactions between actin filaments and MTs may be important in MT transport throughout growth cones (Schaefer et al., 2002), and can influence assembly rates of MTs (Rodriguez et al., 2003). It is possible that Tm overexpression drives an initial reorganisation of lamellipodial actin into neurites by regulation of other
ABPs, such as fascin and ADF/cofilin, with such organisation secondarily inducing
MAP2c upregulation and mediated MT stabilisation. However, evidence comparing the contributions of actin versus MT bundling in emerging neurites (Weisshaar et al., 1992) suggests that it is the actin binding function of MAP2c which is important in neurite initiation (Gordon-Weeks, 2004). Tms have here been shown to influence the levels and activity of conventional ABPs, such as fascin and ADF/cofilin, and also an initiator of neurite outgrowth, MAP2c, which effectively remodels both the actin and MT cytoskeletons. In addition to neurite outgrowth and MAP2c upregulation, it was hypothesised that Tm overexpression was inducing another characteristic of neuronal differentiation: cell cycle exit.
This study has shown that two aspects of neuronal differentiation, namely neurite outgrowth and cell cycle exit, can be regulated differently: Tm4 overexpression
206
significantly increased neurite outgrowth in uninduced cells, without affecting rates of proliferation. However, TmBr2 overexpressing uninduced cells also had significantly increased neurite outgrowth, accompanied with significantly smaller proportions of cells in S+G2/M phases of the cell cycle relative to control cells. This indicates that
TmBr2 (but not Tm4) expression increases the fraction of cells in G0/G1, and so reduces cell proliferation. There is agreement between these data and those found by cell counts over a seven day period (see Section 4.2.2.6). When cells are untreated with dbcAMP and cell numbers counted daily, a difference in proliferation rates are detected from day 4 post plating, and not before. This raises the possibility that the slowing effect on mitotic division by Tm4 evident with cell counting was not detected by FACS analyses here because the FACS time scale was limited to a 24 hour period only.
Tms are required for normal contractile ring assembly in fission yeast (Skau et al.,
2009) and can regulate interactions between actin and myosin II (Stark et al., 2010).
Mutations in Tms can perturb cell division by disrupting contractile ring assembly
(Skau and Kovar, 2010), and the overexpression of Tm1 in astrocytoma cells induces cytokinesis defects and multinucleated cells with mitotic spindle defects (Thoms et al.,
2008). Overexpression of human recombinant Tm3 or Tm5 in Chinese hamster ovary cells induces cells to cycle through cytokinesis more rapidly, potentially by activating myosin ATPase (Eppinga et al., 2006). If Tm overexpression induces cells to progress through mitosis at a faster rate, without affecting the time they remain in growth
(G0/G1) phase, then a reduction in Tm overexpressing cells in S+G2/M phases would be seen. However, considering Tm overexpressing cells are assuming characteristics of differentiating neurons – neurite outgrowth and MAP2c expression – it is perhaps more likely that Tm overexpression is inducing another feature of neuronal differentiation,
207
cell cycle exit, rather than speeding the cycling of cells through division stages. Specific inhibitors can block cAMP synthesis (Borasio et al., 1995; Liu et al., 2010); treating uninduced and dbcAMP induced Tm overexpressing cells with such inhibitors would be one method of determining whether Tms are inducing cell cycle arrest through cAMP- mediated or alternative pathways.
In this chapter evidence has been presented of the highly isoform-specific relationships between Tms and ABPs. Tms can differentially regulate those proteins which remodel the cytoskeleton, and this is accompanied by specific morphological changes. The data reported here detail that Tms can influence expression of multiple ABPs: the ability of
Tms to regulate ABP expression underpins their ability to drive alterations to cellular architecture.
208
Chapter 6: General discussion
209
6. General discussion:
6.1. Tropomyosin regulation and compensation
The regulation of Tm isoforms is complex. In adult brain, loss of the γ9d exon containing isoforms Tm5NM1 and Tm5NM2 induced a compensatory upregulation of other products from the same gene, the γ9c containing products Tm5NM4 and
Tm5NM7. This compensation is analogous to that seen in γ9c knockout adult mice, which show elevated protein levels of γ9a containing isoforms in brain (Vrhovski et al.,
2004). This indicates some mechanism among cytoskeletal γTm gene products of autoregulation for isoform loss. This compensation is developmentally regulated in γ9d
KO mice; levels of γ9c isoforms increase with the age of animals (Fath et al., 2010). It may therefore be the case that the lack of this compensation in MEFs or ES cells
(Schevzov et al., 2008) is due to these cells being cultured before the developmental stage at which γ9d products (and so compensation for their loss) are required.
Alternatively, the compensation of these products may be cell-type specific.
The finding that γ9c exon containing products can compensate for γ9d exon KO in mouse brain raises the question of whether γ9c products can assume the functional roles of γ9d products. The knockout of γ9d products is not without phenotypic consequence, as hippocampal neurons cultured from these animals display an increase in neurite arborisation (Fath et al., 2010). Preliminary analyses have indicated that γ9d KO animals can progress through development to adulthood with no gross changes in brain histology. However, the characterisation of these animals has not yet extended to behavioural phenotyping. Immunofluorescence observations of Tm5NM1show it localises to the post-synapse (Thomas Fath, unpublished data), suggesting that knocking out of this isoform may induce a phenotype associated with synaptic function, a
210 hypothesis which could be tested with electrophysiological assays of γ9d KO neurons and wild type neurons. Alternatively, the function provided for by the γ9d exon containing products may be achieved by γ9c exon containing isoforms. Further investigation into the functional compensation of these isoforms could start by investigating whether the γ9c products assume the distinctive localisation patterns of
γ9d isoforms in KO mice. The observation of γ9c compensation at the level of brain region has been made, and more insight can be gained by examining whether this regional compensation occurs at the subcellular compartment level, specifically the post-synapse.
6.2. Regulation of cytoskeletal versus muscle Tms
The transgenic overexpression (Schevzov et al., 2008) or knockout (current study, and
Vrhovski et al., 2004) of cytoskeletal Tms did not have detectable inter-gene compensatory effects. However, muscle Tms can regulate in this way: overexpression of the βTm gene muscle isoform, β-Tm, results in a downregulation of the αTm gene muscle isoform, αfastTm (Muthuchamy et al., 1995). One possible reason for this difference is the relative diversities of muscle versus cytoskeletal Tms. The βTm and
αTm genes produce only one muscle Tm isoform each. When levels of the βTm gene muscle isoform β-Tm are experimentally altered there is no option for a different muscle Tm from the same gene to compensate. The diversity of γTm gene products, however, means that even when a subset of isoforms is knocked out, there are different cytoskeletal isoforms normally produced from this same gene which can compensate for this loss. This intra-gene mechanism of compensation is lacking in the muscle Tms.
Functions of these γTm gene cytoskeletal isoforms may differ, although products of
211 each of the three subsets of isoforms (containing either γ9a, γ9c or γ9d exons) are found in brain (see Chapter 1, section 1.4.1.1-3).
The βTm gene also produces a cytoskeletal isoform, Tm1 (MacLeod et al., 1985). While cytoskeletal Tms regulate the cytoskeleton of muscle cells (Vlahovich et al., 2008) the function of muscle Tms and cytoskeletal Tms are distinct, and the overexpression of cytoskeletal Tms in muscle can have severe phenotypic consequences such as dystrophy
(Kee et al., 2009; Kee et al., 2004). The components of the sarcomere, including muscle
Tms, actin and troponin, are tightly regulated to ensure muscle function. Conversely, cytoskeletal Tms contribute to subcellular compartments with a greater range of functions; cytoskeletal actin is required to be dynamic, and so cytoskeletal Tms may be more flexible in their protein level maintenance to contribute to this range of function
(Schevzov et al., 2008). The observation of compensation in γ9d exon KO mouse brain, and the lack of compensation when particular cytoskeletal Tms are overexpressed
(discussed in Section 6.3), indicate that there are potentially divergent regulations of different cytoskeletal Tm isoforms.
6.3. Tm overexpression in B35 cells: identifying mechanisms of Tm function
The novel Tm4 overexpressing B35 cell line reported here had no detectable change in the protein levels of other Tms, indicating that cytoskeletal Tms do not necessarily compensate for protein level changes. This may also suggest that compensation for loss amongst cytoskeletal Tms is an intra-genic mechanism, one which the δTm gene (which produces a limited repertoire of isoforms) is incapable of. The overexpression of Tm4 in the neuroblastoma cell line (B35) resulted in a slowed proliferation rate, and reformation of lamellipodia into extending neurites in these cells. These effects are similar to the dbcAMP induced differentiation of these cells (Otey et al., 2003). The 212 gross morphological remodelling of neurite outgrowth was also observed with the overexpression of each of the αTm gene isoforms TmBr1, TmBr2, and TmBr3 in these cells. Neurite morphology, however, differed with the Tm isoform being overexpressed.
That different Tm isoforms can have different (and in some cases, opposing) effects on arborisation, neurite length, growth cone size and neurite number reflects the diverse effects that Tms can have on the cytoskeleton. The previously reported effects in primary neurons from Tm KO and overexpressing mice also point towards in vivo roles in neurite outgrowth (Fath et al., 2010; Schevzov et al., 2005a).
All investigations into Tm function undertaken in this thesis relied on the stable overexpression of these proteins. The use of Tm knockdown, or cells cultured from Tm knockout animals, could help to establish if converse phenotypes result from the exclusion of these isoforms. However, functional investigation which relies on the knocking out or knocking down of particular Tm isoforms suffers from the basic problem that Tms can compensate for isoform loss (e.g. see Vrhovski et al., 2004 and
Chapter 3 of this thesis), and so functional conclusions about specific isoforms become complex. One remedy to this may be to firstly overexpress a Tm isoform and then knockdown protein to endogenous levels using siRNA in culture, and assess whether phenotypes can be rescued. Knockdown experiments using siRNA were attempted during the course of this project, however knockdown was always accompanied by off- target effects on other Tm isoforms. This non-specificity may have been due to either secondary effects of Tm isoform knockdown, or primary non-specific knockdown due to the high sequence homology between various isoforms. At the time of writing this thesis, experiments using siRNA-mediated Tm knockdown were ongoing. Even in their absence, the Tm overexpression studies in B35 cells provide evidence of the dramatic phenotypic consequences that different Tm isoforms can induce. 213
The strict developmental and subcellular spatial regulation of Tms (Gunning et al.,
2005; Schevzov et al., 1997), coupled with these highly specific impacts on cellular architecture, indicate that Tms can drive subcellular compartment morphology at particular developmental time points. The idea that cytoskeletal Tm isoforms are limiting, and so changes in the protein levels of individual Tm isoforms can result in these morphological changes (Schevzov et al., 1997), can therefore explain the results seen in the B35 cells. Despite this, the investigations into Tm knockout mice suggest that cytoskeletal Tms can also be regulated to compensate for protein level changes
(current study, and Vrhovski et al., 2004). Together these studies indicate that Tm protein levels can be regulated in a number of ways. The overexpression of Tms in B35 cells also point to a number of different and specific effects of different isoforms on the organisation of the actin cytoskeleton. One key to this diversity of function lies in the relationships that different Tm isoforms have with other actin binding proteins (ABP).
6.4. Tropomyosin isoforms differentially alter expression of multiple actin binding proteins
While Tm specific relationships with ABPs, and Tm effects on actin structure have been reported previously (Bryce et al., 2003; Creed et al., 2008; Creed et al., 2011), data presented in this thesis show for the first time the major finding that Tm isoforms can direct isoform specific expression of whole profiles of other proteins (including ABPs).
Proteomic analyses of Tm overexpressing B35 cells were undertaken to investigate whether isoform specific impacts on cellular architecture were accompanied by changes in the protein levels of other ABPs. Analyses by isobaric tagging for relative and absolute quantitation (iTRAQ) reported a number of proteins which were altered in their levels with Tm overexpression, and these changes were in some cases highly dependent
214 on the Tm isoform being overexpressed. In particular, here reported are Tm isoform specific changes in the levels of the actin bundling protein fascin, the actin crosslinking protein filamin, the intermediate filament protein vimentin, and actin itself. While total pool sizes of the key actin regulating proteins ADF/cofilin did not change, further analyses showed Tms could differently alter the activity of these proteins. These results signal the abilities of Tms to orchestrate expression and activity changes of cytoskeletal proteins and other ABPs.
Some indications of how the Tms are able to alter expression levels of other proteins are seen by examining the broader profile of protein changes in these cells. Tm overexpression alters many diverse functional groups of protein, including those involved with protein complex assembly, transport, and translation. This suggests a mechanism of actin regulation whereby different Tm isoforms can differentially alter the machinery of protein expression, assembly and transport, and in turn selectively change ABP protein expression levels. Tms can differentially affect the activity of other proteins- as shown here (and previously, see Bryce et al., 2003) for ADF/cofilin. This may be due to Tm isoforms outcompeting ADF/cofilin off the actin filament, increasing the size of the free (ie not bound to actin filaments) pool available to undergo a phosphorylation switch to inactive states. The exact mechanism by which the Tms can alter the levels of other proteins (e.g. fascin and filamin, as shown here), as opposed to activity levels only, is unknown. Levels of ABP expression may be increased by feedback which increases the translation or transcription of these ABPs, or by a mechanism which reduces the clearance and catabolism of these ABPs. For example, by recruiting fascin to bind the actin filament, Tm4 may be decreasing the pool of free fascin which is readily available for degradation or catabolism, so increasing the total pool size of the protein. Conversely, the increased level of binding of fascin to actin 215 filaments may be concomitant with increases in the concentrations of other proteins upstream of transcriptional regulation of fascin, which then increase transcription of fascin mRNA, in turn increasing the total pool of fascin protein. It is also possible that the Tms can differentially alter the ubiquitination rates of other proteins. For example, when Tm4 is associated with fascin, it may reduce the processing of fascin for ubiquitination, and so reduce the rate of degradation of the total pool of fascin, such that a greater fascin protein level persists.
While the exact mechanism of the altering of Tm expression is unknown, the obvious hypothesis drawn from these data is that Tm isoforms can change ABP expression, and these ABPs then alter actin filament structure, and so cell shape. For example, increases in the actin bundling protein fascin, highly implicated in filopodial outgrowth (Dent et al., 2007) occurred in Tm4 and TmBr3 overexpressing cells and was concomitant with increases in neurite number and neurite branching. Also reported is that the activity or expression levels of a single ABP are insufficient as predictors of cell architecture (as seen with the activity levels of ADF/cofilin, which decrease with Tm4, but not with
TmBr3 overexpression, both of which induce extensive neuritogenesis and increases in growth cone size). Concomitant with this project, other investigations have showed that overexpression of Tms in undifferentiated B35 cells can induce the expression of the normally developmentally regulated neuronal microtubule (MT) and actin bundling protein MAP2c (Thomas Fath, unpublished data).
If the activity of ADF/cofilin (reduced in Tm4 overexpressing cells) and the induction of MAP2c expression in these cells are considered together, hypotheses of a coordinated system of actin regulation can be formed. These proteins have each been previously shown to contribute to neurite initiation and outgrowth. One hypothesis is that the
216 association of Tm4 or TmBr3 with actin filaments recruit fascin, which bundles actin and reorganises the meshwork of lamellipodia, inducing filopodial formation.
Additionally, Tm4 can prevent ADF/cofilin from binding actin filaments, so protecting filaments within these Tm induced filopodia from severing. Filopodia are increased in size and stability by the additional binding of MAP2c, which consolidates filopodia into bona fide neurites emerging from the leading edge of developing neurons. In this context MAP2c does not bind MT, but the reorganisation of cortical actin allows for the incorporation of stable MT into neurite shafts and subsequent neurite extension. Tm4 or
TmBr3 associated actin filaments continue to recruit fascin, forming bundles of actin filaments adjacent to the neurite shaft which nucleate branch points. Conversely, TmBr2 and TmBr1 associated actin filaments are each bound and bundled by MAP2c, but not fascin, thus reducing the number of branch points on emerging neurites in cells overexpressing these isoforms. Alternatively, Tms may help to re-organise the actin cytoskeleton independently of MAP2c, which could act to bundle MTs secondarily to the coordination of the actin cytoskeleton in initiating neurite outgrowth.
It is the ability of different Tm isoforms to differentially coordinate multiple other ABPs which underpins their regulation of actin structure and so cell morphology. While the alternative splicing of each of the four Tm genes gives rise to different isoforms which can differently alter cell morphology, one aim of this thesis was to characterise an as yet unidentified Tm associated product.
6.5. Characterisation of a Tm4 associated product is mouse brain: functional diversity from the δTm gene?
The observation of a Tm4 associated product in adult mouse brain (Chapter 3) was followed by a series of experiments to characterise this product. Previous
217 immunofluorescence observations of developmentally regulated distributions of Tm4 in neurons (Had et al., 1994) raised the possibility of two functional variants of Tm4 that were being detected and reported as Tm4 only. The Tm4 associated product was initially hypothesized as being a post-translational modification (PTM) of Tm4. N- terminal acetylation is one modification which is required for normal muscle Tm function (Cho et al., 1990; Greenfield et al., 1994), and acetylation can effectively produce two functional Tm variants in yeast, where mixed populations of unacetylated and acetylated Tm are found (Coulton et al., 2010; Skoumpla et al., 2007). Analyses of
Tm4 overexpressing B35 cells by liquid chromatography tandem mass spectrometry
(LC-MS/MS) indicated that the entire pool of Tm4 was N-terminally acetylated, and so did not account for the different species observed in gel electrophoresis. Tms can undergo other PTMs; phosphorylation of cardiac α-Tm can be developmentally regulated, with levels decreasing from ~70% in foetal rat 10 days before birth, and falling to an adult level of ~30% by PND30, with developmental decreases also seen in mouse heart (Heeley et al., 1982). However, a range of two dimensional gel electrophoresis (2D-GE) analyses indicated that the Tm4 associated product may not be a phosphorylation of Tm4, but rather that Tm4 and the associated product were either two separate proteins of differing molecular weights, or one protein which had undergone extensive PTM (such as glycosylation), resulting in a molecular weight shift.
These gels further indicated that Tm4 and the Tm4 associated product had each undergone some PTM, as evidenced by the trains of spots separated by isoelectric point
(pI) in the 1st dimension of these gels. While it is possible that Tm4 or the associated product (or both) had undergone phosphorylation, this hypothesis explains only the shifts seen in pI. While attempts at sequencing alternative transcripts produced by the
δTm gene did not yield evidence of a second low molecular weight transcript, a more
218 extensive investigation of all the exon combinations of this gene may elucidate a splicing event which has produced this associated product. Aside from this possibility, a range of glycosylation states may account for the duality of molecular weights seen in
Tm4 and the associated product. The striking isoform diversity of the α- and γTm genes has not been observed for the δTm gene, and it is possible that the multiple products which associated with the δTm gene isoform Tm4 represent a mechanism separate from alternative splicing which allows this gene to produce multiple functionally diverse products. The reported developmental localisation shift of Tm4 (from growth cones of axons and dendrites to being predominantly post-synaptic, Had et al., 1994) may represent distinct localisations (growth cones versus the post-synapse) of two (or more) functionally distinct δTm gene products. This diversity may also contribute to mechanisms of actin diversification on a much finer spatial scale. Through immunofluorescence studies, both Tm5NM1 and Tm4 have been observed at the post- synapse (Thomas Fath, unpublished data). Post-synaptic dendritic spines can accommodate intense morphological change, associated with the potentiation-based morphogenesis which is the basis for ongoing synaptic plasticity in mature neurons.
Through two photon microscopy came evidence that actin in the dendrite spine head, spine neck, and shaft is comprised of distinct pools (Honkura et al., 2008), and with the recent advent of super-resolution microscopy (see Hess, 2009 for overview), these divisions have been shown to contribute to multiple foci of filamentous actin with distinct dynamic properties, even within the dendrite spine neck itself (Frost et al.,
2010). Tms help to arrange the tight spatial regulation of actin in other subcellular compartments (see Gunning et al., 2008 for review).The localisation of Tm4 and
Tm5NM1 to the post-synapse raises the possibility that these isoforms are defining actin filament sub-populations with different dynamics within sub-compartments of the
219 dendrite spine head. The characterisation of a number of products associated with Tm4 further raises the exciting possibility that δTm gene products can undergo PTM to diversify function, and contribute to the heterogeneity of actin sub-populations at the synapse. The first step in elucidating the roles of these Tm4 associated products is their identification, and further investigation into possible alternative splicing of the δTm gene should be accompanied by investigation into PTM of Tm4, including glycosylation and phosphorylation assays.
6.6. Limitations of this work
This study has provided an overview of some Tm isoform specific effects on cell morphology in a neuroblastoma cell line, B35. Tm overexpression was shown to have isoform specific effects on cell morphology, cell cycle exit, and regulation of other protein levels, as measured by immunofluorescence, FACS, and iTRAQ respectively.
While some hypotheses have been here conclusively tested, so too have questions been raised which remain unanswered. By their nature, neurites and growth cones are motile organelles, and this study into their structure using fixed cells has not addressed questions of Tm involvement in dynamic processes. Such questions can be addressed using live cell approaches to track, for example, the protrusion and retraction of growth cones in each of the Tm overexpressing cell lines. It is possible that TmBr2 overexpression drives an increase in growth cone motility (but not size) which predisposes neurites to increase in length, and hypotheses of this sort cannot be tested by using the methods detailed in this thesis. Additionally some aspects of growth cone morphology can only be measured on spatial scales finer than those examined here. In
Chapter 5 of this thesis, a study into the morphologies of growth cones illustrated Tm isoform dependent changes in size. One protein which was identified in the iTRAQ
220 screen as changing with Tm overexpression was fascin, an actin bundler which has been previously implicated in growth cone motility and neurite outgrowth. Fascin-mediated bundling of actin filaments in filopodia underlies its involvement in growth cones and neurites, however in the current study the coarser variable of growth cone size was examined. Future investigations into Tm regulation of fascin would be aided by measuring filopodial outgrowth from growth cones and neurites, and the colocalisation of, for example, Tm4 and fascin in actin bundles in these structures.
Many experiments presented in this thesis have examined the roles of Tms in driving morphological changes. One limitation of the work presented here is that quantitation of changes due to the overexpression of different Tm isoforms were done on one clone per
Tm isoform only (except for some assays done on multiple Tm4 overexpressing clones, see Chapter 4). Therefore, observed changes may have been due to interclonal variation, rather than the effects of Tm isoform expression. As replication at the level of clone was necessary to eliminate this possibility, concurrently with the work presented in this thesis, experiments presented here were also done in multiple clones overexpressing each Tm isoform. These analyses were done in the main by Hannah Freittag, and represent a considerable body of work in their own right. For this reason, these data have not been presented here. However, these data do confirm the generality of results presented here, and demonstrate that conclusions drawn about the ability of specific
Tms to drive morphological change (e.g. the ability of TmBr3 and Tm4 overexpression to each induce an increase in the mean number of neurites per cell, but no effect of
TmBr1 or TmBr2 overexpression on this variable) reported in this thesis are due to the effects of these individual Tm isoforms, rather than the confounding effects of interclonal variation.
221
6.7. Conclusions and further study
In mouse brain, the knockout of one subset of Tm isoforms (γ9d exon containing isoforms Tm5NM1 and Tm5NM2, products of the γTm gene) induced a compensatory upregulation of other isoforms (γ9c exon containing isoforms Tm5NM4 and Tm5NM7) from this same gene. Conversely, the ability of B35s to tolerate an enlarged Tm pool indicated these cells employed no such compensation for altered Tm protein levels, and the overexpression of different Tm isoforms (TmBr1, TmBr2, TmBr3 and Tm4) in these cells had specific diverse effects on phenotype. This study has characterised these specific morphological effects and shown that Tms can regulate cellular architecture to produce precise morphological changes; effects of overexpression on neurite and growth cone morphology differ between Tm isoforms. The highly isoform dependent effects suggested Tm specific orchestration of other ABPs contributed to these distinctive morphological changes. Proteomic analyses of Tm overexpressing B35s provides evidence as to the profound and specific effects that Tm isoforms can have on the expression levels of multiple other proteins, including a host of ABPs. Additionally,
Tms can promote cell cycle exit in addition to that induced by dbcAMP treatment, and the tightly regulated developmental expression of Tms in vivo may represent early events in neuronal differentiation cascades. Further investigation of precise subcellular localisations can aid in determining whether individual Tm isoforms are, for example, recruiting fascin and MAP2c to particular subpopulations of actin, and occluding
ADF/cofilin access to actin filaments. Here reported is evidence that the Tms can effectively control actin filament organisation, and the expression of various other proteins. The challenge with further research is to understand how Tms exert this
222 control, and the precise mechanisms by which Tm isoforms drive actin filament organisation, in real time, in neurons.
The recent advances in super-resolution microscopy allow for the imaging of proteins on nanometer length spatial scales in living cells. Some of those ABPs which are altered by Tm expression have here been identified. By imaging actin, Tms, and these associated ABPs in living neurons, the precise and multifaceted methods by which Tms can orchestrate cytoskeletal architecture can begin to be understood.
223
7. References
Ackermann, M., and Matus, A. (2003). Activity-induced targeting of profilin and stabilization of dendritic spine morphology. Nat Neurosci 6, 1194-1200.
Altman, J. (1972). Postnatal development of the cerebellar cortex in the rat. II. Phases in the maturation of Purkinje cells and of the molecular layer. J Comp Neurol 145, 399-463.
Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano, T., Matsuura, Y., and Kaibuchi, K. (1996). Phosphorylation and activation of myosin by rho-associated kinase (rho-kinase). J Biol Chem 271, 20246-20249.
Andrianantoandro, E., and Pollard, T.D. (2006). Mechanism of actin filament turnover by severing and nucleation at different concentrations of ADF/cofilin. Mol Cell 24, 13-23.
Arber, S., Barbayannis, F.A., Hanser, H., Schneider, C., Stanyon, C.A., Bernard, O., and Caroni, P. (1998). Regulation of actin dynamics through phosphorylation of cofilin by LIM-kinase. Nature 393, 805-809.
Bailey, K. (1948). Tropomyosin: A new asymmetric protein component of the muscle fibril. Biochemical Journal 43, 271 - 279.
Bassell, G.J., Zhang, H., Byrd, A.L., Femino, A.M., Singer, R.H., Taneja, K.L., Lifshitz, L.M., Herman, I.M., and Kosik, K.S. (1998). Sorting of beta -Actin mRNA and Protein to Neurites and Growth Cones in Culture. J Neurosci 18, 251-265.
Bayer, S.A. (1983). 3h-thymidine-radiographic studies of neurogenesis in the rat olfactory bulb. Experimental Brain Research 50, 329-340.
Bernard, O. (2007). Lim kinases, regulators of actin dynamics. Int J Biochem Cell Biol 39, 1071-1076.
Bernhardt, R., and Matus, A. (1984). Light and electron microscopic studies of the distribution of microtubule-associated protein 2 in rat brain: A difference between dendritic and axonal cytoskeletons. The Journal of Comparative Neurology 226, 203- 221.
Birbach, A. (2008). Profilin, a multi-modal regulator of neuronal plasticity. BioEssays 30, 994-1002.
Blanchard, E.M., Iizuka, K., Christe, M., Conner, D.A., Geisterfer-Lowrance, A., Schoen, F.J., Maughan, D.W., Seidman, C.E., and Seidman, J.G. (1997). Targeted ablation of the murine {alpha}-tropomyosin gene. Circ Res 81, 1005-1010.
224
Blanchoin, L., Pollard, T.D., and Hitchcock-DeGregori, S.E. (2001). Inhibition of the Arp2/3 complex-nucleated actin polymerization and branch formation by tropomyosin. Current Biology 11, 1300-1304.
Bobkov, A.A., Muhlrad, A., Shvetsov, A., Benchaar, S., Scoville, D., Almo, S.C., and Reisler, E. (2004). Cofilin (adf) affects lateral contacts in f-actin. Journal of Molecular Biology 337, 93-104.
Borasio, P.G., Pavan, B., Fabbri, E., Ginanni-Corradini, F., Arcelli, D., and Poli, A. (1995). Adenosine analogs inhibit acetylcholine release and cyclic amp synthesis in the guinea-pig superior cervical ganglion. Neuroscience Letters 184, 97-100. Boucher, M., Bélanger, D., Beaulieu, C., and Leclerc, N. (1999). Tau-mediated process outgrowth is differentially altered by the expression of map2b and map2c in sf9 cells. Cell Motility and the Cytoskeleton 42, 257-273.
Bradshaw, R.A., Brickey, W.W., and Walker, K.W. (1998). N-terminal processing: The methionine aminopeptidase and n[alpha]-acetyl transferase families. Trends in Biochemical Sciences 23, 263-267.
Brown, J., and Bridgman, P.C. (2003). Role of myosin ii in axon outgrowth. J Histochem Cytochem 51, 421-428.
Brown, J.H., Kim, K.-H., Jun, G., Greenfield, N.J., Dominguez, R., Volkmann, N., Hitchcock-DeGregori, S.E., and Cohen, C. (2001). Deciphering the design of the tropomyosin molecule. Proceedings of the National Academy of Sciences of the United States of America 98, 8496-8501.
Bryce, N.S., Schevzov, G., Ferguson, V., Percival, J.M., Lin, J.J., Matsumura, F., Bamburg, J.R., Jeffrey, P.L., Hardeman, E.C., Gunning, P., and Weinberger, R.P. (2003). Specification of actin filament function and molecular composition by tropomyosin isoforms. Mol Biol Cell 14, 1002-1016.
Butler-Cole, C., Wagner, M.J., Da Silva, M., Brown, G.D., Burke, R.D., and Upton, C. (2007). An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion protein. Journal of Virology Jul 24; 4.
Caceres, A., Banker, G., and Binder, L. (1986). Immunocytochemical localization of tubulin and microtubule-associated protein 2 during the development of hippocampal neurons in culture. The Journal of Neuroscience 6, 714-722.
Carlier, M.-F., Laurent, V., Santolini, J., Melki, R., Didry, D., Xia, G.-X., Hong, Y., Chua, N.-H., and Pantaloni, D. (1997). Actin depolymerizing factor (adf/cofilin) enhances the rate of filament turnover: Implication in actin-based motility. The Journal of Cell Biology 136, 1307-1322.
225
Chang, T.-C., Chen, Y.-C., Yang, M.-H., Chen, C.-H., Hsing, E.-W., Ko, B.-S., Liou, J.-Y., and Wu, K.K. (2010). Rho kinases regulate the renewal and neural differentiation of embryonic stem cells in a cell plating density–dependent manner. PLoS ONE 5, e9187.
Cho, Y.J., Liu, J., and Hitchcock-DeGregori, S.E. (1990). The amino terminus of muscle tropomyosin is a major determinant for function. Journal of Biological Chemistry 265, 538-545.
Chrzanowska-Wodnicka, M., and Burridge, K. (1996). Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. Journal of Cell Biology 133, 1403-1415.
Cingolani, L.A., and Goda, Y. (2008). Actin in action: the interplay between the actin cytoskeleton and synaptic efficacy.[erratum appears in Nat Rev Neurosci. 2008 Jun;9(6):494]. Nature Reviews Neuroscience 9, 344-356.
Cohan, C.S., Welnhofer, E.A., Zhao, L., Matsumura, F., and Yamashiro, S. (2001). Role of the actin bundling protein fascin in growth cone morphogenesis: Localization in filopodia and lamellipodia. Cell Motil Cytoskeleton 48, 109-120.
Cohen-Cory, S. (2002). The developing synapse: Construction and modulation of synaptic structures and circuits. Science 298, 770-776.
Collins, J.H., and Elzinga, M. (1975). The primary structure of actin from rabbit skeletal muscle. Completion and analysis of the amino acid sequence. Journal of Biological Chemistry 250, 5915-5920.
Conde, C., and Caceres, A. (2009). Microtubule assembly, organization and dynamics in axons and dendrites. Nat Rev Neurosci 10, 319-332.
Conti, M.A., and Adelstein, R.S. (2008). Nonmuscle myosin II moves in new directions. Journal of Cell Science 121, 11-18.
Cooley, B.C., and Bergtrom, G. (2001). Multiple Combinations of Alternatively Spliced Exons in Rat Tropomyosin-[alpha] Gene mRNA: Evidence for 20 New Isoforms in Adult Tissues and Cultured Cells. Archives of Biochemistry and Biophysics 390, 71-77.
Coulton, A.T., East, D.A., Galinska-Rakoczy, A., Lehman, W., and Mulvihill, D.P. (2010). The recruitment of acetylated and unacetylatedtropomyosin to distinct actin polymers permits the discrete regulation of specific myosins in fission yeast. J Cell Sci 123, 3235-3243.
Coumans, J.V.F., Poljak, A., Raftery, M.J., Backhouse, D., and Pereg-Gerk, L. (2009). Analysis of cotton (Gossypium hirsutum) root proteomes during a compatible interaction with the black root rot fungus Thielaviopsis basicola. PROTEOMICS 9, 335-349.
226
Cox, P.R., Fowler, V., Xu, B., Sweatt, J.D., Paylor, R., and Zoghbi, H.Y. (2003). Mice lacking tropomodulin-2 show enhanced long-term potentiation, hyperactivity, and deficits in learning and memory. Molecular and Cellular Neuroscience 23, 1-12.
Creed, S.J., Bryce, N., Naumanen, P., Weinberger, R., Lappalainen, P., Stehn, J., and Gunning, P. (2008). Tropomyosin isoforms define distinct microfilament populations with different drug susceptibility. European Journal of Cell Biology 87, 709-720.
Creed, S.J., Desouza, M., Bamburg, J.R., Gunning, P., and Stehn, J. (2011). Tropomyosin isoform 3 promotes the formation of filopodia by regulating the recruitment of actin-binding proteins to actin filaments. Experimental Cell Research 317, 249-261.
Da Silva, J.S., and Dotti, C.G. (2002). Breaking the neuronal sphere: regulation of the actin cytoskeleton in neuritogenesis. Nat Rev Neurosci 3, 694-704.
Da Silva, J.S., Medina, M., Zuliani, C., Di Nardo, A., Witke, W., and Dotti, C.G. (2003). RhoA/ROCK regulation of neuritogenesis via profilin IIa–mediated control of actin stability. The Journal of Cell Biology 162, 1267-1279.
Dabrowska, R., Kulikova, N., and Gagola, M. (2004). Nonmuscle caldesmon: its distribution and involvement in various cellular processes. Review article. Protoplasma 224, 1-13.
De Arcangelis, A., Georges-Labouesse, E., and Adams, J.C. (2004). Expression of fascin-1, the gene encoding the actin-bundling protein fascin-1, during mouse embryogenesis. Gene Expression Patterns 4, 637-643. de Luca, A., Vassallo, S., Benitez-Temino, B., Menichetti, G., Rossi, F., and Buffo, A. (2009). Distinct modes of neuritic growth in purkinje neurons at different developmental stages: Axonal morphogenesis and cellular regulatory mechanisms. PLoS ONE 4, e6848.
Dehmelt, L., Nalbant, P., Steffen, W., and Halpain, S. (2006). A microtubule-based, dynein-dependent force induces local cell protrusions: Implications for neurite initiation. Brain Cell Biology 35, 39-56.
Dehmelt, L., Smart, F.M., Ozer, R.S., and Halpain, S. (2003). The role of microtubule-associated protein 2c in the reorganization of microtubules and lamellipodia during neurite initiation. J Neurosci 23, 9479-9490.
Dent, E.W., Kwiatkowski, A.V., Mebane, L.M., Philippar, U., Barzik, M., Rubinson, D.A., Gupton, S., Van Veen, J.E., Furman, C., Zhang, J., Alberts, A.S., Mori, S., and Gertler, F.B. (2007). Filopodia are required for cortical neurite initiation. Nat Cell Biol 9, 1347-1359.
227
Di Nardo, A., Gareus, R., Kwiatkowski, D., and Witke, W. (2000). Alternative splicing of the mouse profilin II gene generates functionally different profilin isoforms. J Cell Sci 113, 3795-3803.
DiNubile, M.J., and Huang, S. (1997). Capping of the barbed ends of actin filaments by a high-affinity profilin–actin complex. Cell Motility and the Cytoskeleton 37, 211- 225.
Dufour, C., Weinberger, R.P., and Gunning, P. (1998a). Tropomyosin isoform diversity and neuronal morphogenesis. Immunol Cell Biol 76, 424-429.
Dufour, C., Weinberger, R.P., Schevzov, G., Jeffrey, P.L., and Gunning, P. (1998b). Splicing of two internal and four carboxyl-terminal alternative exons in nonmuscle tropomyosin 5 pre-mRNA is independently regulated during development. Journal of Biological Chemistry 273, 18547-18555.
Edwards, R.A., and Bryan, J. (1995). Fascins, a family of actin bundling proteins. Cell Motility and the Cytoskeleton 32, 1-9.
Egelman, E.H. (1985). The structure of F-actin. Journal of Muscle Research and Cell Motility 6, 129-151. Endo, M., Ohashi, K., and Mizuno, K. (2007). Lim kinase and slingshot are critical for neurite extension. J Biol Chem 282, 13692-13702.
Endo, M., Ohashi, K., Sasaki, Y., Goshima, Y., Niwa, R., Uemura, T., and Mizuno, K. (2003). Control of growth cone motility and morphology by lim kinase and slingshot via phosphorylation and dephosphorylation of cofilin. J Neurosci 23, 2527- 2537.
Eppinga, R.D., Li, Y., Lin, J.L.C., and Lin, J.J.C. (2006). Tropomyosin and caldesmon regulate cytokinesis speed and membrane stability during cell division. Archives of Biochemistry and Biophysics 456, 161-174.
Erba, H.P., Gunning, P., and Kedes, L. (1986). Nucleotide sequence of the human γ cytoskeletal actin mRNA: anomalous evolution of vertebrate non-muscle actin genes. Nucleic Acids Research 14, 5275-5294.
Faivre-Sarrailh, C., Had, L., Ferraz, C., Sri Widada, J., Liautard, J.P., and Rabié, A. (1990). Expression of tropomyosin genes during the development of the rat cerebellum. Journal of Neurochemistry 55, 899-906.
Fath, T., Chan, Y.-K.A., Vrhovski, B., Clarke, H., Curthoys, N., Hook, J., Lemckert, F., Schevzov, G., Tam, P., Watson, C.M., Khoo, P.-L., and Gunning, P. (2010). New aspects of tropomyosin-regulated neuritogenesis revealed by the deletion of Tm5NM1 and 2. European Journal of Cell Biology 89(7): 489-498.
Fath, T., Fischer, R.S., Dehmelt, L., Halpain, S., and Fowler, V.M. (2011). Tropomodulins are negative regulators of neurite outgrowth. European Journal of Cell Biology 90, 291-300. 228
Fischer, R.S., and Fowler, V.M. (2003). Tropomodulins: life at the slow end. Trends in Cell Biology 13, 593-601.
Flynn, K.C., Pak, C.W., Shaw, A.E., Bradke, F., and Bamburg, J.R. (2009). Growth cone-like waves transport actin and promote axonogenesis and neurite branching. Dev Neurobiol 69, 761-779.
Forry-Schaudies, S., Gruber, C., and Hughes, S. (1990). Chicken cardiac tropomyosin and a low-molecular-weight nonmuscle tropomyosin are related by alternative splicing. Cell Growth Differ 1, 473-481.
Fowler, V.M. (1987). Identification and purification of a novel Mr 43,000 tropomyosin-binding protein from human erythrocyte membranes. Journal of Biological Chemistry 262, 12792-12800.
Fraley, S.I., Feng, Y., Krishnamurthy, R., Kim, D.-H., Celedon, A., Longmore, G.D., and Wirtz, D. (2010). A distinctive role for focal adhesion proteins in three- dimensional cell motility. Nat Cell Biol 12, 598-604.
Frost, N.A., Shroff, H., Kong, H., Betzig, E., and Blanpied, T.A. (2010). Single- molecule discrimination of discrete perisynaptic and distributed sites of actin filament assembly within dendritic spines. Neuron 67, 86-99.
Galloway, P.G., Perry, G., and Gambetti, P. (1987). Hirano body filaments contain actin and actin-associated proteins. J Neuropathol Exp Neurol 46, 185-199.
Garner, C.C., Brugg, B., and Matus, A. (1988). A 70-kilodalton microtubule-associted protein (map2c), related to map2. Journal of Neurochemistry 50, 609-615.
Garner, C.C., Brugg, B., and Matus, A. (1988). A 70-kilodalton microtubule-associted protein (map2c), related to map2. Journal of Neurochemistry 50, 609-615.
Gimona, M., Vandekerckhove, J., Goethals, M., Herzog, M., Lando, Z., and Small, J.V. (1994). Beta-actin specific monoclonal antibody. Cell Motil Cytoskeleton 27, 108-116.
Goldman, J. (1983). Immunocytochemical studies of actin localization in the central nervous system. J Neurosci 3, 1952-1962.
Gordon-Weeks, P.R. (2004). Actin dynamics: Re-drawing the map. Nat Cell Biol 6, 390-391.
Görg, A., Weiss, W., and Dunn, M.J. (2004). Current two-dimensional electrophoresis technology for proteomics. Proteomics 4, 3665-3685.
229
Greenfield, N.J., Stafford, W.E., and Hitchcock-Degregori, S.E. (1994). The effect of n-terminal acetylation on the structure of an n-terminal tropomyosin peptide and αα- tropomyosin. Protein Science 3, 402-410.
Gregorio, C.C., and Fowler, V.M. (1995). Mechanisms of thin filament assembly in embryonic chick cardiac myocytes: tropomodulin requires tropomyosin for assembly. Journal of Cell Biology 129, 683-695.
Gunning, P., Hardeman, E., Jeffrey, P., and Weinberger, R. (1998). Creating intracellular structural domains: spatial segregation of actin and tropomyosin isoforms in neurons. Bioessays 20, 892-900.
Gunning, P., O'Neill, G., and Hardeman, E. (2008). Tropomyosin-based regulation of the actin cytoskeleton in time and space. Physiological Reviews 88, 1-35.
Gunning, P.W., Schevzov, G., Kee, A.J., and Hardeman, E.C. (2005). Tropomyosin isoforms: divining rods for actin cytoskeleton function. Trends in Cell Biology 15, 333-341.
Had, L., Faivre-Sarrailh, C., Legrand, C., and Rabié, A. (1993). The expression of tropomyosin genes in pure cultures of rat neurons, astrocytes and oligodendrocytes is highly cell-type specific and strongly regulated during development. Molecular Brain Research 18, 77-86.
Had, L., Faivre-Sarrailh, C., Legrand, C., Mery, J., Brugidou, J., and Rabie, A. (1994). Tropomyosin isoforms in rat neurons: the different developmental profiles and distributions of TM-4 and TMBr-3 are consistent with different functions. Journal of Cell Science 107, 2961-2973.
Hannan, A.J., Gunning, P., Jeffrey, P.L., and Weinberger, R.P. (1998). Structural compartments within neurons: developmentally regulated organization of microfilament isoform mRNA and protein. Molecular & Cellular Neurosciences 11, 289-304.
Hannan, A.J., Schevzov, G., Gunning, P., Jeffrey, P.L., and Weinberger, R.P. (1995). Intracellular localization of tropomyosin mRNA and protein is associated with development of neuronal polarity. Molecular & Cellular Neurosciences 6, 397-412.
Hardy, S., Thézé, N., Lepetit, D., Allo, M.-R., and Thiebaud, P. (1995). The Xenopus laevis tm-4 gene encodes non-muscle and cardiac tropomyosin isoforms through alternative splicing. Gene 156, 265-270.
Heeley, D.A., Moir, A.J.G., and Perry, S.V. (1982). Phosphorylation of tropomyosin during development in mammalian striated muscle. FEBS Letters 146, 115-118.
Herman, I.M. (1993). Actin Isoforms. Current Opinion in Cell Biology 5, 48 - 55.
Hess, S.T. (2009). Red lights, camera, photoactivation! Nat Meth 6, 124-125.
230
Higgs, H.N., and Pollard, T.D. (2001). Regulation of actin filament network formation through ARP2/3 complex: activation by a diverse array of proteins. Annu Rev Biochem 70, 649-676.
Hill, M., and Gunning, P. (1993). Beta and gamma actin mRNAs are differentially located within myoblasts. The Journal of Cell Biology 122, 825-832.
Hitchcock-DeGregori, S.E., and Heald, R.W. (1987). Altered actin and troponin binding of amino-terminal variants of chicken striated muscle alpha-tropomyosin expressed in Escherichia coli. Journal of Biological Chemistry 262, 9730-9735.
Holmes, K.C., Popp, D., Gebhard, W., and Kabsch, W. (1990). Atomic model of the actin filament. Nature 347, 44-49.
Honkura, N., Matsuzaki, M., Noguchi, J., Ellis-Davies, G.C., and Kasai, H. (2008). The subspine organization of actin fibers regulates the structure and plasticity of dendritic spines. Neuron 57, 719-729.
Honoré, B., Madsen, P., Andersen, A.H., and Leffers, H. (1993). Cloning and expression of a novel human profilin variant, profilin II. FEBS Letters 330, 151-155.
Hook, J., Lemckert, F., Qin, H., Schevzov, G., and Gunning, P. (2004). Gamma tropomyosin gene products are required for embryonic development. Molecular & Cellular Biology 24, 2318-2323.
Horiuchi, K.Y., and Chacko, S. (1988). Interaction between caldesmon and tropomyosin in the presence and absence of smooth muscle actin. Biochemistry 27, 8388-8393.
Houle, F., Poirier, A., Dumaresq, J., and Huot, J. (2007). Dap kinase mediates the phosphorylation of tropomyosin-1 downstream of the erk pathway, which regulates the formation of stress fibers in response to oxidative stress. J Cell Sci 120, 3666- 3677.
Houle, F., Rousseau, S., Morrice, N., Luc, M., Mongrain, S., Turner, C.E., Tanaka, S., Moreau, P., and Huot, J. (2003). Extracellular signal-regulated kinase mediates phosphorylation of tropomyosin-1 to promote cytoskeleton remodeling in response to oxidative stress: Impact on membrane blebbing. MolBiol Cell 14, 1418-1432.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2008). Systematic and integrative analysis of large gene lists using david bioinformatics resources. Nat Protocols 4, 44- 57.
Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009). Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research 37, 1-13.
231
Ichikawa, N., Iwabuchi, K., Kurihara, H., Ishii, K., Kobayashi, T., Sasaki, T., Hattori, N., Mizuno, Y., Hozumi, K., Yamada, Y., and Arikawa-Hirasawa, E. (2009). Binding of laminin-1 to monosialoganglioside gm1 in lipid rafts is crucial for neurite outgrowth. J Cell Sci 122, 289-299.
Ishikawa, R., Sakamoto, T., Ando, T., Higashi-Fujime, S., and Kohama, K. (2003). Polarized actin bundles formed by human fascin-1: Their sliding and disassembly on myosin ii and myosin v in vitro. Journal of Neurochemistry 87, 676-685.
Ishikawa, R., Yamashiro, S., Kohama, K., and Matsumura, F. (1998). Regulation of Actin Binding and Actin Bundling Activities of Fascin by Caldesmon Coupled with Tropomyosin. Journal of Biological Chemistry 273, 26991-26997.
Jagatheesan, G., Rajan, S., and Wieczorek, D.F. (2010). Investigations into tropomyosin function using mouse models. Journal of Molecular and Cellular Cardiology 48, 893-898.
Johnson, R.S., Martin, S.A., Biemann, K., Stults, J.T., and Watson, J.T. (1987). Novel fragmentation process of peptides by collision-induced decomposition in a tandem mass spectrometer: Differentiation of leucine and isoleucine. Analytical Chemistry 59, 2621-2625.
Kaech, S., Parmar, H., Roelandse, M., Bornmann, C., and Matus, A. (2001). Cytoskeletal microdifferentiation: A mechanism for organizing morphological plasticity in dendrites. Proceedings of the National Academy of Sciences of the United States of America 98, 7086-7092.
Kaplan, M.S., and Hinds, J.W. (1977). Neurogenesis in the adult rat: Electron microscopic analysis of light radioautographs. Science 197, 1092-1094.
Kee, A.J., Gunning, P.W., and Hardeman, E.C. (2009). A cytoskeletal tropomyosin can compromise the structural integrity of skeletal muscle. Cell Motility and the Cytoskeleton 66, 710-720. Kee, A.J., Schevzov, G., Nair-Shalliker, V., Robinson, C.S., Vrhovski, B., Ghoddusi, M., Qiu, M.R., Lin, J.J.C., Weinberger, R., Gunning, P.W., and Hardeman, E.C. (2004). Sorting of a nonmuscle tropomyosin to a novel cytoskeletal compartment in skeletal muscle results in muscular dystrophy. The Journal of Cell Biology 166, 685- 696. Ketschek, A.R., Jones, S.L., and Gallo, G. (2007). Axon extension in the fast and slow lanes: Substratum-dependent engagement of myosin ii functions. Developmental Neurobiology 67, 1305-1320.
Kira, M., Tanaka, J., and Sobue, K. (1995). Caldesmon and low Mr isoform of tropomyosin are localized in neuronal growth cones. Journal of Neuroscience Research 40, 294-305.
Korn, E.D. (1982). Actin polymerization and its regulation by proteins from nonmuscle cells. Physiological Reviews 62, 672-737. 232
Korn, E.D., Carlier, M.F., and Pantaloni, D. (1987). Actin Polymerization and ATP Hydrolysis. Science 238, 638 - 644.
Korobova, F., and Svitkina, T. (2008). Arp2/3 complex is important for filopodia formation, growth cone motility, and neuritogenesis in neuronal cells. Mol Biol Cell 19, 1561-1574.
Kostyukova, A.S. (2008a). Capping complex formation at the slow-growing end of the actin filament. Biochemistry (Mosc) 73, 1467-1472.
Kostyukova, A.S. (2008b). Tropomodulins and tropomodulin/tropomyosin interactions. Cell Mol Life Sci 65, 563-569.
Kovar, D.R. (2006). Cell polarity: formin on the move. Curr Biol 16, R535-538.
Kovar, D.R., Sirotkin, V., and Lord, M. (2011). Three's company: the fission yeast actin cytoskeleton. Trends in Cell Biology 21, 177-187.
Kraft, R., Escobar, M.M., Narro, M.L., Kurtis, J.L., Efrat, A., Barnard, K., and Restifo, L.L. (2006). Phenotypes of drosophila brain neurons in primary culture reveal a role for fascin in neurite shape and trajectory. The Journal of Neuroscience 26, 8734-8747.
Kraft, R., Escobar, M.M., Narro, M.L., Kurtis, J.L., Efrat, A., Barnard, K., and Restifo, L.L. (2006). Phenotypes of drosophila brain neurons in primary culture reveal a role for fascin in neurite shape and trajectory. The Journal of Neuroscience 26, 8734-8747.
Kuhn, T.B., and Bamburg, J.R. (2008). Tropomyosin and ADF/cofilin as collaborators and competitors. Advances in Experimental Medicine & Biology 644, 232-249.
Kuhn, T.B., Meberg, P.J., Brown, M.D., Bernstein, B.W., Minamide, L.S., Jensen, J.R., Okada, K., Soda, E.A., and Bamburg, J.R. (2000). Regulating actin dynamics in neuronal growth cones by adf/cofilin and rho family gtpases. Journal of Neurobiology 44, 126-144.
Landis, D.M., and Reese, T.S. (1983). Cytoplasmic organization in cerebellar dendritic spines. Journal of Cell Biology 97, 1169-1178.
Lees-Miller, J.P., Yan, A., and Helfman, D.M. (1990). Structure and complete nucleotide sequence of the gene encoding rat fibroblast tropomyosin 4. Journal of Molecular Biology 213, 399-405.
Lehman, W., and Craig, R. (2008). Tropomyosin and the steric mechanism of muscle regulation. Advances in Experimental Medicine & Biology 644, 95-109.
Lessard, J.L. (1988). Two monoclonal antibodies to actin: one muscle selective and one generally reactive. Cell Motil Cytoskeleton 10, 349-362. 233
Liu, X., Yang, J.-M., Zhang, S., Liu, X.-Y., and Liu, D. (2010). Induction of cell cycle arrest at g1 and s phases and camp-dependent differentiation in c6 glioma by low concentration of cycloheximide. BMC Cancer 10, 684.
Luo, L. (2000). Rho gtpases in neuronal morphogenesis. Nat Rev Neurosci 1, 173- 180.
Luo, L., and O'Leary, D.D.M. (2005). Axon retraction and degeneration in development and disease Annual Review of Neuroscience 28, 127-156.
MacLeod, A.R., Houlker, C., Reinach, F.C., Smillie, L.B., Talbot, K., Modi, G., and Walsh, F.S. (1985). A muscle-type tropomyosin in human fibroblasts: Evidence for expression by an alternative rna splicing mechanism. Proceedings of the National Academy of Sciences of the United States of America 82, 7835-7839.
Majoul, I., Shirao, T., Sekino, Y., and Duden, R. (2007). Many faces of drebrin: from building dendritic spines and stabilizing gap junctions to shaping neurite-like cell processes. Histochemistry & Cell Biology 127, 355-361.
Mak, A.S., Smillie, L.B., and Barany, M. (1978). Specific phosphorylation at serine- 283 of alpha tropomyosin from frog skeletal and rabbit skeletal and cardiac muscle. Proceedings of the National Acadamy of Sciences, USA 75, 3588-3592.
Mallavarapu, A., and Mitchison, T. (1999). Regulated actin cytoskeleton assembly at filopodium tips controls their extension and retraction. The Journal of Cell Biology 146, 1097-1106.
Marsick, B.M., Flynn, K.C., Santiago-Medina, M., Bamburg, J.R., and Letourneau, P.C. (2010). Activation of adf/cofilin mediates attractive growth cone turning toward nerve growth factor and netrin-1. Developmental Neurobiology 70, 565-588.
Matsumura, F., and Yamashiro-Matsumura, S. (1985). Purification and Characterization of Multiple Isoforms of Tropomyosin from Rat Cultured Cells. The Journal of Biological Chemistry 260, 13851 - 13859.
Matsumura, F., Lin, J.J., Yamashiro-Matsumura, S., Thomas, G.P., and Topp, W.C. (1983). Differential expression of tropomyosin forms in the microfilaments isolated from normal and transformed rat cultured cells, pp. 13954-13964.
Matus, A., Ackermann, M., Pehling, G., Byers, H.R., and Fujiwara, K. (1982). High actin concentrations in brain dendritic spines and postsynaptic densities. Proceedings of the National Academy of Sciences of the United States of America 79, 7590-7594.
McGough, A., Pope, B., Chiu, W., and Weeds, A. (1997). Cofilin changes the twist of f-actin: Implications for actin filament dynamics and cellular function. The Journal of Cell Biology 138, 771-781.
234
McMichael, B.K., and Lee, B.S. (2007). Tropomyosin 4 regulates adhesion structures and resorptive capacity in osteoclasts Experimental Cell Research doi:10.1016/j.yβexcr.2007.10.018.
Meberg, P.J., and Bamburg, J.R. (2000). Increase in neurite outgrowth mediated by overexpression of actin depolymerizing factor. J Neurosci 20, 2459-2469.
Meberg, P.J., Ono, S., Minamide, L.S., Takahashi, M., and Bamburg, J.R. (1998). Actin depolymerizing factor and cofilin phosphorylation dynamics: Response to signals that regulate neurite extension. Cell Motility and the Cytoskeleton 39, 172- 190.
Medeiros, N.A., Burnette, D.T., and Forscher, P. (2006). Myosin ii functions in actin- bundle turnover in neuronal growth cones. Nat Cell Biol 8, 215-226.
Meichsner, M., Doll, T., Reddy, D., Weisshaar, B., and Matus, A. (1993). The low molecular weight form of microtubule-associated protein 2 is transported into both axons and dendrites. Neuroscience 54, 873-880.
Mello, C.F., Sultana, R., Piroddi, M., Cai, J., Pierce, W.M., Klein, J.B., and Butterfield, D.A. (2007). Acrolein induces selective protein carbonylation in synaptosomes. Neuroscience 147, 674-679.
Millward, G.R., and Woods, E.F. (1970). Crystals of tropomyosin from various sources. Journal of Molecular Biology 52, 585-586.
Mizui, T., Kojima, N., Yamazaki, H., Katayama, M., Hanamura, K., and Shirao, T. (2009). Drebrin e is involved in the regulation of axonal growth through actin–myosin interactions. Journal of Neurochemistry 109, 611-622.
Mizuno, H., Hirano, T., and Tagawa, Y. (2010). Pre-synaptic and post-synaptic neuronal activity supports the axon development of callosal projection neurons during different post-natal periods in the mouse cerebral cortex. European Journal of Neuroscience 31, 410-424.
Mockrin, S.C., and Korn, E.D. (1980). Acanthamoeba profilin interacts with G-actin to increase the rate of exchange of actin-bound adenosine 5'-triphosphate. Biochemistry 19, 5359-5362.
Montani, L., Gerrits, B., Gehrig, P., Kempf, A., Dimou, L., Wollscheid, B., and Schwab, M.E. (2009). Neuronal nogo-a modulates growth cone motility via rho-gtp/limk1/cofilin in the unlesioned adult nervous system. Journal of Biological Chemistry 284, 10793-10807.
Montarras, D., Fiszman, M.Y., and Gros, F. (1981). Characterization of the tropomyosin present in various chick embryo muscle types and in muscle cells differentiated in vitro. Journal of Biological Chemistry 256, 4081-4086.
235
Monteiro, P.B., Lataro, R.C., Ferro, J.A., and Reinach, F.d.C. (1994). Functional alpha-tropomyosin produced in escherichia coli. A dipeptide extension can substitute the amino-terminal acetyl group. Journal of Biological Chemistry 269, 10461-10466.
Montgomery, K., and Mak, A.S. (1984). In vitro phosphorylation of tropomyosin by a kinase from chicken embryo. Journal of Biological Chemistry 259, 5555-5560.
Morales, M., and Fifkova, E. (1989). Distribution of map 2 in dendritic spines and its colocalization with actin. Cell and Tissue Research 256, 447-456.
Mullins, R.D., Heuser, J.A., and Pollard, T.D. (1998). The interaction of Arp2/3 complex with actin: nucleation, high affinity pointed end capping, and formation of branching networks of filaments. Proceedings of the National Academy of Sciences of the United States of America 95, 6181-6186.
Muthuchamy, M., Grupp, I.L., Grupp, G., Toole, B.A.O., Kier, A.B., Boivin, G.P., Neumann, J., and Wieczorek, D.F. (1995). Molecular and physiological effects of overexpressing striated muscle beta-tropomyosin in the adult murine heart. Journal of Biological Chemistry 270, 30593-30603.
Muthuchamy, M., Pajak, L., Howles, P., Doetschman, T., and Wieczorek, D.F. (1993). Developmental analysis of tropomyosin gene expression in embryonic stem cells and mouse embryos. Mol Cell Biol 13, 3311-3323.
Nakamura, F., Stossel, T.P., and Hartwig, J.H. (2011). The filamins: Organizers of cell structure and function. Cell Adhesion & Migration 5, 160 - 169.
Naumanen, P., Lappalainen, P., and Hotulainen, P. (2008). Mechanisms of actin stress fibre assembly. Journal of Microscopy 231, 446-454.
Nicholson-Flynn, K., Hitchcock-DeGregori, S.E., and Levitt, P. (1996). Restricted expression of the actin-regulatory protein, tropomyosin, defines distinct boundaries, evaginating neuroepithelium, and choroid plexus forerunners during early CNS development. J Neurosci 16, 6853-6863.
Niwa, R., Nagata-Ohashi, K., Takeichi, M., Mizuno, K., and Uemura, T. (2002). Control of actin reorganization by Slingshot, a family of phosphatases that dephosphorylate ADF/cofilin. Cell 108, 233-246.
Novy, R.E., Sellers, J.R., Liu, L.-F., and Lin, J.J.-C. (1993). In vitro functional characterization of bacterially expressed human fibroblast tropomyosin isoforms and their chimeric mutants. Cell Motility and the Cytoskeleton 26, 248-261.
Nyman-Huttunen, H., Tian, L., Ning, L., and Gahmberg, C.G. (2006). {alpha}- Actinin-dependent cytoskeletal anchorage is important for ICAM-5-mediated neuritic outgrowth. J Cell Sci 119, 3057-3066.
Ono, S., and Ono, K. (2002). Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics. Journal of Cell Biology 156, 1065-1076.
236
Otey, C.A., Boukhelifa, M., and Maness, P. (2003). B35 neuroblastoma cells: An easily transfected, cultured cell model of central nervous system neurons. In Methods in cell biology (Academic Press), pp. 287-304.
Otomo, T., Otomo, C., Tomchick, D.R., Machius, M., and Rosen, M.K. (2005). Structural basis of Rho GTPase-mediated activation of the formin mDia1. Mol Cell 18, 273-281.
Ould-yahoui, A., Tremblay, E., Sbai, O., Ferhat, L., Bernard, A., Charrat, E., Gueye, Y., Lim, N.H., Brew, K., Risso, J.-J., Dive, V., Khrestchatisky, M., and Rivera, S. (2009). A new role for timp-1 in modulating neurite outgrowth and morphology of cortical neurons. PLoS ONE 4, e8289.
Ozer, R.S., and Halpain, S. (2000). Phosphorylation-dependent localization of microtubule-associated protein map2c to the actin cytoskeleton. Mol Biol Cell 11, 3573-3587.
Pak, C.W., Flynn, K.C., and Bamburg, J.R. (2008). Actin-Binding Proteins Take the Reins in Growth Cones. Nature Reviews 9, 136 - 147.
Palm, T., Greenfield, N.J., and Hitchcock-DeGregori, S.E. (2003). Tropomyosin ends determine the stability and functionality of overlap and troponin t complexes. Biophysical Journal 84, 3181-3189.
Pantaloni, D., and Carlier, M.-F. (1993). How profilin promotes actin filament assembly in the presence of thymosin [beta]4. Cell 75, 1007-1014.
Pavalko, F.M., and Burridge, K. (1991). Disruption of the actin cytoskeleton after microinjection of proteolytic fragments of alpha-actinin. The Journal of Cell Biology 114, 481-491.
Percival, J.M., Hughes, J.A., Brown, D.L., Schevzov, G., Heimann, K., Vrhovski, B., Bryce, N., Stow, J.L., and Gunning, P.W. (2004). Targeting of a tropomyosin isoform to short microfilaments associated with the Golgi complex. Mol Biol Cell 15, 268- 280.
Perry, S.V. (2001). Vertebrate tropomyosin: Distribution, properties and function. Journal of Muscle Research and Cell Motility 22, 5-49.
Pilo Boyl, P., Di Nardo, A., Mulle, C., Sassoe-Pognetto, M., Panzanelli, P., Mele, A., Kneussel, M., Costantini, V., Perlas, E., Massimi, M., Vara, H., Giustetto, M., and Witke, W. (2007). Profilin2 contributes to synaptic vesicle exocytosis, neuronal excitability, and novelty-seeking behavior. EMBO Journal 26, 2991-3002.
Piper, M., Anderson, R., Dwivedy, A., Weinl, C., van Horck, F., Leung, K.M., Cogill, E., and Holt, C. (2006). Signaling mechanisms underlying slit2-induced collapse of xenopus retinal growth cones. Neuron 49, 215-228.
Pittenger, M.F., Kazzaz, J.A., and Helfman, D.M. (1994). Functional properties of non-muscle tropomyosin isoforms. Current Opinion in Cell Biology 6, 96-104. 237
Polevoda, B., and Sherman, F. (2003). N-terminal acetyl transferases and sequence requirements for n-terminal acetylation of eukaryotic proteins. Journal of Molecular Biology 325, 595-622.
Pollard, T.D., and Cooper, J.A. (1984). Quantitative analysis of the effect of Acanthamoeba profilin on actin filament nucleation and elongation. Biochemistry 23, 6631-6641.
Popowicz, G.M., Schleicher, M., Noegel, A.A., and Holak, T.A. (2006). Filamins: promiscuous organizers of the cytoskeleton. Trends in Biochemical Sciences 31, 411- 419.
Pring, M., Weber, A., and Bubb, M.R. (1992). Profilin-actin complexes directly elongate actin filaments at the barbed end. Biochemistry 31, 1827-1836.
Qin, H., and Gunning, P. (1997). The 3'-end of the human [beta]-actin gene enhances activity of the [beta]-actin expression vector system: Construction of improved vectors. Journal of Biochemical and Biophysical Methods 36, 63-72.
Rethinasamy, P., Muthuchamy, M., Hewett, T., Boivin, G., Wolska, B.M., Evans, C., Solaro, R.J., and Wieczorek, D.F. (1998). Molecular and physiological effects of {alpha}-tropomyosin ablation in the mouse. Circ Res 82, 116-123.
Ribolow, H., and Bárány, M. (1977). Phosphorylation of tropomyosin in live frog muscle. Archives of Biochemistry and Biophysics 179, 718-720.
Riederer, B., and Matus, A. (1985). Differential expression of distinct microtubule- associated proteins during brain development. Proceedings of the National Academy of Sciences of the United States of America 82, 6006-6009.
Rodriguez, O.C., Schaefer, A.W., Mandato, C.A., Forscher, P., Bement, W.M., and Waterman-Storer, C.M. (2003). Conserved microtubule-actin interactions in cell movement and morphogenesis. Nat Cell Biol 5, 599-609.
Roepstorff, P., and Fohlman, J. (1984). Letter to the editors. Biological Mass Spectrometry 11, 601-601. Roger, B., Al-Bassam, J., Dehmelt, L., Milligan, R.A., and Halpain, S. (2004). Map2c, but not tau, binds and bundles f-actin via its microtubule binding domain. Current Biology 14, 363-371.
Roger, B., Al-Bassam, J., Dehmelt, L., Milligan, R.A., and Halpain, S. (2004). Map2c, but not tau, binds and bundles f-actin via its microtubule binding domain. Current Biology 14, 363-371.
Rösner, H., Möller, W., Wassermann, T., Mihatsch, J., and Blum, M. (2007). Attenuation of actinomyosinii contractile activity in growth cones accelerates filopodia-guided and microtubule-based neurite elongation. Brain Research 1176, 1- 10.
238
Rosso, S., Bollati, F., Bisbal, M., Peretti, D., Sumi, T., Nakamura, T., Quiroga, S., Ferreira, A., and Caceres, A. (2004). Limk1 regulates golgi dynamics, traffic of golgi- derived vesicles, and process extension in primary cultured neurons. Mol Biol Cell 15, 3433-3449.
Sasaki, Y., Hayashi, K., Shirao, T., Ishikawa, R., and Kohama, K. (1996). Inhibition by Drebrin of the Actin-Bundling Activity of Brain Fascin, a Protein Localized in Filopodia of Growth Cones. Journal of Neurochemistry 66, 980-988.
Schaefer, A.W., Kabir, N., and Forscher, P. (2002). Filopodia and actin arcs guide the assembly and transport of two populations of microtubules with unique dynamic parameters in neuronal growth cones. J Cell Biol 158, 139-152.
Schaefer, A.W., Schoonderwoert, V.T., Ji, L., Mederios, N., Danuser, G., and Forscher, P. (2008). Coordination of actin filament and microtubule dynamics during neurite outgrowth. Dev Cell 15, 146-162.
Schevzov, G., Bryce, N.S., Almonte-Baldonado, R., Joya, J., Lin, J.J., Hardeman, E., Weinberger, R., and Gunning, P. (2005a). Specific features of neuronal size and shape are regulated by tropomyosin isoforms. Mol Biol Cell 16, 3425-3437.
Schevzov, G., Fath, T., Vrhovski, B., Vlahovich, N., Rajan, S., Hook, J., Joya, J.E., Lemckert, F., Puttur, F., Lin, J.J.C., Hardeman, E.C., Wieczorek, D.F., O'Neill, G.M., and Gunning, P.W. (2008). Divergent regulation of the sarcomere and the cytoskeleton. J Biol Chem 283, 275-283.
Schevzov, G., Gunning, P., Jeffrey, P.L., Temm-Grove, C., Helfman, D.M., Lin, J.J., and Weinberger, R.P. (1997). Tropomyosin localization reveals distinct populations of microfilaments in neurites and growth cones. Mol Cell Neurosci 8, 439-454.
Schevzov, G., Lloyd, C., and Gunning, P. (1992). High level expression of transfected beta- and gamma-actin genes differentially impacts on myoblast cytoarchitecture. The Journal of Cell Biology 117, 775-785.
Schevzov, G., Vrhovski, B., Bryce, N., Elmir, S., Qui, M.R., O'Neill, G.M., Yang, N., Verrills, N.M., Kavallaris, M., and Gunning, P.W. (2005b). Tissue-specific tropomyosin isoform composition. Journal of Histochemistry and Cytochemistry 53, 557 - 570.
Schmoller, K.M., Lieleg, O., and Bausch, A.R. (2009). Structural and Viscoelastic Properties of Actin/Filamin Networks: Cross-Linked versus Bundled Networks. Biophysical Journal 97, 83-89.
Schollmeyer, J.V., Rao, G.H., and White, J.G. (1978). An actin-binding protein in human platelets. Interactions with alpha-actinin on gelatin of actin and the influence of cytochalasin B. American Journal of Pathology 93, 433-446.
Schubert, D., Carlisle, W., and Look, C. (1975). Putative neurotransmitters in clonal cell lines. Nature 254, 341-343.
239
Schubert, D., Heinemann, S., Carlisle, W., Tarikas, H., Kimes, B., Patrick, J., Steinbach, J.H., Culp, W., and Brandt, B.L. (1974). Clonal cell lines from the rat central nervous system. Nature 249, 224-227.
Sekino, Y., Kojima, N., and Shirao, T. (2007). Role of actin cytoskeleton in dendritic spine morphogenesis. Neurochem Int 51, 92-104.
Sellers, J.R. (1981). Phosphorylation-dependent regulation of Limulus myosin. Journal of Biological Chemistry 256, 9274-9278.
Sharma, A., Lambrechts, A., Hao, L.t., Le, T.T., Sewry, C.A., Ampe, C., Burghes, A.H.M., and Morris, G.E. (2005). A role for complexes of survival of motor neurons (SMN) protein with gemins and profilin in neurite-like cytoplasmic extensions of cultured nerve cells. Experimental Cell Research 309, 185-197.
Shaw, A.E., Minamide, L.S., Bill, C.L., Funk, J.D., Maiti, S., and Bamburg, J.R. (2004). Cross-reactivity of antibodies to actin- depolymerizing factor/cofilin family proteins and identification of the major epitope recognized by a mammalian actin- depolymerizing factor/cofilin antibody. Electrophoresis 25, 2611-2620.
Sjöblom, B., Salmazo, A., and Djinović-Carugo, K. (2008). α-Actinin structure and regulation. Cellular and Molecular Life Sciences 65, 2688-2701.
Skau, C.T., and Kovar, D.R. (2010). Fimbrin and tropomyosin competition regulates endocytosis and cytokinesis kinetics in fission yeast. Current Biology 20, 1415-1422.
Skau, C.T., Neidt, E.M., and Kovar, D.R. (2009). Role of tropomyosin in formin- mediated contractile ring assembly in fission yeast. Mol Biol Cell 20, 2160-2173.
Skoumpla, K., Coulton, A.T., Lehman, W., Geeves, M.A., and Mulvihill, D.P. (2007). Acetylation regulates tropomyosin function in the fission yeast schizosaccharomyces pombe. J Cell Sci 120, 1635-1645.
Smith, S.J. (1988). Neuronal cytomechanics: The actin-based motility of growth cones. Science 242, 708-715.
Spinner, B.J., Zajdel, R.W., McLean, M.D., Denz, C.R., Dube, S., Mehta, S., Choudhury, A., Nakatsugawa, M., Dobbins, N., Lemanski, L.F., and Dube, D.K. (2002). Characterization of a tm-4 type tropomyosin that is essential for myofibrillogenesis and contractile activity in embryonic hearts of the mexican axolotl. Journal of Cellular Biochemistry 85, 747-761.
Stamm, S., Casper, D., Lees-Miller, J.P., and Helfman, D.M. (1993). Brain-specific tropomyosins TMBr-1 and TMBr-3 have distinct patterns of expression during development and in adult brain. Proceedings of the National Academy of Sciences of the United States of America 90, 9857-9861.
Stark, B.C., Sladewski, T.E., Pollard, L.W., and Lord, M. (2010). Tropomyosin and myosin-ii cellular levels promote actomyosin ring assembly in fission yeast. Mol Biol Cell 21, 989-1000. 240
Stehn, J.R., Schevzov, G., O'Neill, G.M., and Gunning, P. (2006). Specialisation of the tropomyosin composition of actin filaments provides new potential targets for chemotherapy. Current Cancer Drug Targets 6, 245 - 256.
Straub, F.B., and Feuer, G. (1989). Adenosinetriphosphate. The functional group of actin. 1950. Biochimica et Biophysica Acta, 180-195.
Suckau, D., Mak, M., and Przybylski, M. (1992). Protein surface topology-probing by selective chemical modification and mass spectrometric peptide mapping. Proceedings of the National Academy of Sciences of the United States of America 89, 5630-5634.
Svitkina, T.M., and Borisy, G.G. (1999). Arp2/3 complex and actin depolymerizing factor/cofilin in dendritic organization and treadmilling of actin filament array in lamellipodia. Journal of Cell Biology 145, 1009-1026.
Svitkina, T.M., Verkhovsky, A.B., McQuade, K.M., and Borisy, G.G. (1997). Analysis of the Actin-Myosin II System in Fish Epidermal Keratocytes: Mechanism of Cell Body Translocation. J Cell Biol 139, 397-415.
Thoms, J.A.I., Loch, H.M., Bamburg, J.R., Gunning, P.W., and Weinberger, R.P. (2008). A tropomyosin 1 induced defect in cytokinesis can be rescued by elevated expression of cofilin. Cell Motility and the Cytoskeleton 65, 979-990.
Tilney, L.G., Bonder, E.M., Coluccio, L.M., and Mooseker, M.S. (1983). Actin from Thyone sperm assembles on only one end of an actin filament: a behavior regulated by profilin. The Journal of Cell Biology 97, 112-124.
Tondeleir, D., Vandamme, D., Vandekerckhove, J., Ampe, C., and Lambrechts, A. (2009). Actin isoform expression patterns during mammalian development and in pathology: Insights from mouse models. Cell Motility and the Cytoskeleton 66, 798- 815.
Tseng, Y., An, K.M., Esue, O., and Wirtz, D. (2004). The Bimodal Role of Filamin in Controlling the Architecture and Mechanics of F-actin Networks. Journal of Biological Chemistry 279, 1819-1826.
Tucker, B.A., Rahimtula, M., and Mearow, K.M. (2005). Integrin activation and neurotrophin signaling cooperate to enhance neurite outgrowth in sensory neurons. The Journal of Comparative Neurology 486, 267-280.
Tursun, B., Schluter, A., Peters, M.A., Viehweger, B., Ostendorff, H.P., Soosairajah, J., Drung, A., Bossenz, M., Johnsen, S.A., Schweizer, M., Bernard, O., and Bach, I. (2005). The ubiquitin ligase rnf6 regulates local lim kinase 1 levels in axonal growth cones. Genes Dev 19, 2307-2319.
241
Uesaka, N., Hirai, S., Maruyama, T., Ruthazer, E.S., and Yamamoto, N. (2005). Activity dependence of cortical axon branch formation: A morphological and electrophysiological study using organotypic slice cultures. The Journal of Neuroscience 25, 1-9.
Ujfalusi, Z., Vig, A., Hild, G., and Nyitrai, M. (2008). The effect of tropomyosin on formin-bound actin filaments. Biophys Journal.
Underwood, A.J. (1997). Experiments in Ecology: Their Logical Design and Interpretation Using Analysis of Variance (Cambridge University Press).
Urbancikova, M., and Hitchcock-DeGregori, S.E. (1994). Requirement of amino- terminal modification for striated muscle alpha-tropomyosin function. Journal of Biological Chemistry 269, 24310-24315. van der Flier, A., and Sonnenberg, A. (2001). Structural and functional aspects of filamins. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1538, 99- 117.
Vandekerckhove, J., and Weber, K. (1978a). Actin Amino-Acid Sequences. European Journal of Biochemistry 90, 451-462.
Vandekerckhove, J., and Weber, K. (1978b). The amino acid sequence of Physarum actin. Nature 276, 720-721.
Verkhovsky, A.B., Chaga, O.Y., Schaub, S., Svitkina, T.M., Meister, J.-J., and Borisy, G.G. (2003). Orientational Order of the Lamellipodial Actin Network as Demonstrated in Living Motile Cells. Mol Biol Cell 14, 4667-4675.
Vlahovich, N., Schevzov, G., Nair-Shaliker, V., Ilkovski, B., Artap, S.T., Joya, J.E., Kee, A.J., North, K.N., Gunning, P.W., and Hardeman, E.C. (2008). Tropomyosin 4 defines novel filaments in skeletal muscle associated with muscle remodelling/regeneration in normal and diseased muscle. Cell Motility & the Cytoskeleton 65, 73-85.
Vrhovski, B., Lemckert, F., and Gunning, P. (2004). Modification of the tropomyosin isoform composition of actin filaments in the brain by deletion of an alternatively spliced exon. Neuropharmacology 47, 684 - 693.
Vrhovski, B., Schevzov, G., Dingle, S., Lessard, J.L., Gunning, P., and Weinberger, R.P. (2003). Tropomyosin isoforms from the gamma gene differing at the C-terminus are spatially and developmentally regulated in the brain. Journal of Neuroscience Research 72, 373-383.
Wallar, B.J., and Alberts, A.S. (2003). The formins: active scaffolds that remodel the cytoskeleton. Trends in Cell Biology 13, 435-446.
Wang, C.L. (2008). Caldesmon and the Regulation of Cytoskeletal Functions. Advances in Experimental Medicine and Biology 644, 250-272.
242
Wang, C.L.A., and Coluccio, L.M. (2010). New insights into the regulation of the actin cytoskeleton by tropomyosin. In International review of cell and molecular biology, W.J. Kwang, ed. (Academic Press), pp. 91-128.
Wang, Y.C., and Rubenstein, P.A. (1992). Splicing of two alternative exon pairs in beta-tropomyosin pre-mRNA is independently controlled during myogenesis. Journal of Biological Chemistry 267, 12004-12010.
Watakabe, A., Kobayashi, R., and Helfman, D.M. (1996). N-tropomodulin: a novel isoform of tropomodulin identified as the major binding protein to brain tropomyosin. Journal of Cell Science 109 ( Pt 9), 2299-2310.
Watanabe, H., Kislauskis, E., Mackay, C., Mason-Savas, A., and Marks, S. (1998). Actin mRNA isoforms are differentially sorted in normal osteoblasts and sorting is altered in osteoblasts from a skeletal mutation in the rat. J Cell Sci 111, 1287-1292.
Wawro, B., Greenfield, N.J., Wear, M.A., Cooper, J.A., Higgs, H.N., and Hitchcock- DeGregori, S.E. (2007). Tropomyosin regulates elongation by formin at the fast- growing end of the actin filament. Biochemistry 46, 8146-8155.
Weber, A., Pennise, C.R., Babcock, G.G., and Fowler, V.M. (1994). Tropomodulin caps the pointed ends of actin filaments. Journal of Cell Biology 127, 1627-1635.
Weinberger, R., Schevzov, G., Jeffrey, P., Gordon, K., Hill, M., and Gunning, P. (1996). The molecular composition of neuronal microfilaments is spatially and temporally regulated. Journal of Neuroscience 16, 238-252.
Weinberger, R.P., Henke, R.C., Tolhurst, O., Jeffrey, P.L., and Gunning, P. (1993). Induction of neuron-specific tropomyosin mRNAs by nerve growth factor is dependent on morphological differentiation. Journal of Cell Biology 120, 205-215.
Weisshaar, B., Doll, T., and Matus, A. (1992). Reorganisation of the microtubular cytoskeleton by embryonic microtubule-associated protein 2 (map2c). Development 116, 1151-1161.
Wyszynski, M., Kharazia, V., Shanghvi, R., Rao, A., Beggs, A.H., Craig, A.M., Weinberg, R., and Sheng, M. (1998). Differential Regional Expression and Ultrastructural Localization of α-Actinin-2, a Putative NMDA Receptor-Anchoring Protein, in Rat Brain. The Journal of Neuroscience 18, 1383-1392.
Wyszynski, M., Lin, J., Rao, A., Nigh, E., Beggs, A.H., Craig, A.M., and Sheng, M. (1997). Competitive binding of [alpha]-actinin and calmodulin to the NMDA receptor. Nature 385, 439-442.
Yamakita, Y., Ono, S., Matsumura, F., and Yamashiro, S. (1996). Phosphorylation of Human Fascin Inhibits Its Actin Binding and Bundling Activities. Journal of Biological Chemistry 271, 12632-12638.
243
Yamashiro-Matsumura, S., and Matsumura, F. (1988). Characterization of 83- kilodalton nonmuscle caldesmon from cultured rat cells: stimulation of actin binding of nonmuscle tropomyosin and periodic localization along microfilaments like tropomyosin. Journal of Cell Biology 106, 1973-1983.
Yamawaki-Kataoka, Y., and Helfman, D.M. (1987). Isolation and characterization of cDNA clones encoding a low molecular weight nonmuscle tropomyosin isoform. Journal of Biological Chemistry 262, 10791-10800.
Yang, N., Higuchi, O., Ohashi, K., Nagata, K., Wada, A., Kangawa, K., Nishida, E., and Mizuno, K. (1998). Cofilin phosphorylation by LIM-kinase 1 and its role in Rac- mediated actin reorganization. Nature 393, 809-812.
Yao, W., and Sung, L.A. (2009). Specific expression of E-Tmod (Tmod1) in horizontal cells: implications in neuronal cell mechanics and glaucomatous retina. Molecular and Cell Biomechanics 6, 71-82.
Ypsilanti, A.R., Zagar, Y., and Chédotal, A. (2010). Moving away from the midline: New developments for slit and robo. Development 137, 1939-1952.
Zhang, X.-F., Schaefer, A.W., Burnette, D.T., Schoonderwoert, V.T., and Forscher, P. (2003). Rho-dependent contractile responses in the neuronal growth cone are independent of classical peripheral retrograde actin flow. Neuron 40, 931-944.
Zhao, L., Zhao, X., Tian, T., Lu, Q., Skrbo-Larssen, N., Wu, D., Kuang, Z., Zheng, X., Han, Y., Yang, S., Zhang, C., and Meng, A. (2008). Heart-specific isoform of tropomyosin4 is essential for heartbeat in zebrafish embryos, pp. 200-208.
244
Appendices
245
Appendix 1: Functional annotation clustering of proteins significantly deregulated with Tm5NM1, Tm4, TmBr2 or TmBr3 overexpression Table A1.aFunctional clusters of proteins significantly deregulated in iTRAQ analysed Tm5NM1 overexpressing cell samples.
Accession: IPI Name Total iTRAQ p value EF Total % No. Clusters ratio Coverage runs Tm5NM1: control 1. Ribosome/Non-Membrane Bounded Organelle Enrichment Score: 2.11 IPI00896224.1 Actin, 1,2 Gamma 1.23 0.019 1.17 43.23 83.78 2/4 IPI00206624.1 Heat Shock 1,2,3 Protein 5 0.70 0.003 1.24 69.19 37.54 2/4 IPI00371270.1 Proliferation 1,3 -Associated 2G4 1.55 0.006 1.29 6.8 32.99 2/4 IPI00230939.4 Ribosomal 1,2 Protein L24 0.68 0.004 1.20 69.19 38.39 2/4 IPI00767436.1 Ribosomal 1 Protein L29 0.63 0.037 1.51 1.01 48.07 2/4 IPI00231693.5 Similar to 1,2,3 40s Ribosomal Protein S3a 1.23 0.009 1.16 11.53 57.57 2/4 2. Regulation of Apoptosis/Regulation of Cell Death/Phosphoprotein Enrichment Score:1.22 IPI00569885.2 Heat Shock 2 Protein 1 1.40 0.039 1.36 10.68 54.11 3/4 3. Organelle Lumen Enrichment Score:0.91
246
Table A1.a All clusters which a single protein contributes to are listed in the “Total Clusters” column. For example, Ribosomal Protein L24 is identified both in the “Ribosome/Non- Membrane Bounded Organelle” cluster (listed as number 1) and the “Regulation of Apoptosis/Regulation of Cell Death/Phosphoprotein” cluster (listed as number 2); in the “Total Clusters” column, Ribosomal Protein L24 is listed as 1,2. Note that all proteins present in the “3. Organelle Lumen” cluster are present in other clusters, and so are not listed together beneath this cluster title. All protein quantification was performed using at least five spectra, and in the majority of cases >20 spectra. Proteins with iTRAQ ratios relative to controls of between 0.8 and 1.2 were excluded from functional cluster annotation. A p-value <0.05 was accepted as the threshold for statistical significance.‘‘Total (protein ID confidence)’’ is a ProteinPilot generated value for the level of confidence in protein identification. It can be converted to a percentage confidence score using the following formula: ProtScore = -log(1-percentage confidence/100). As an approximate guide, ProteinPilot total scores give the following percentage levels of confidence; “Total” score >1.3 (>95% confidence), score >2 (>99% confidence), score >3 (>99.9% confidence). “No. Runs” refers to the total number of runs (see Section 5.2.4 for explanation) in which the protein had been significantly deregulated relative to controls (in the case of Tm5NM1 samples this is out of a total of 4 runs). iTRAQ ratios in blue indicate downregulation, and red indicate upregulation of the corresponding protein in Tm5NM1 overexpressing samples relative to control samples. See Section 5.2.4 for explanation of DAVID assigned “Enrichment Score” values.
247
Table A1.b Functional clusters of proteins significantly deregulated in iTRAQ analysed Tm4 overexpressing cell samples.
Accession: IPI Name TotalClu iTRAQ p value EF Total % No. sters ratio Coverage runs Tm4: control 1. Cytosol/Soluble Fraction/Cell Fraction Enrichment Score: 1.75 IPI00189819.1 Actin, Beta 1,2,6 1.23 <0.001 1.06 99.1 80 4/8 IPI00332042.9 Aldehyde 1,2,3 Dehdrogenase 1 family, member A1 1.27 <0.001 1.06 45.3 60.87 8/8 IPI00191728.1 Calreticulin 1,2,3,4,5 0.79 0.004 1.16 22.7 58.89 6/8 IPI00951963.1 Cofilin 1, 1,2,4,6 Non-muscle 1.21 <0.001 1.05 35.1 66.37 4/8 IPI00230941.5 Vimentin 1,2,6 1.34 <0.001 1.03 80.3 85.40 4/8 IPI00896761.2 Fascin 1,2 1.26 <0.001 1.03 83.1 78.49 8/8 2. Intracellular Organelle Lumen/Cell Projection/Plasma Enrichment Membrane/Cytoskeleton Score:1.59 IPI00471835.1 Heat Shock 2,6 105kDa/110k Da Protein 1 1.2 <0.001 1.09 19.1 26.34 4/8 IPI00421874.4 Voltage- 2,6 Dependent Anion Channel 1 1.23 0.002 1.13 6 22.18 5/8 IPI00776882.1 Calumenin 2,5 0.74 0.011 1.22 16.2 50.79 4/8 IPI00471889.7 Annexin A5 2,3,5 0.68 <0.001 1.16 26.6 65.83 5/8 3. Protein Complex Assembly Enrichment Score:1.16 4. Protein Transport/Localisation Enrichment Score:1.02 IPI00769110.2 Ribosome 4 Binding Protein 1 0.67 <0.001 1.22 7.4 38.81 6/8 5. Metal Ion Binding Enrichment Score:0.91 IPI00230788.6 Carbonic 5 Anhydrase 3 1.46 0.003 1.22 8.6 21.15 4/8 IPI00231137.5 Cysteine and 5 Glycine-Rich Protein 2 0.63 0.001 1.01 4 27.97 4/8 IPI00192188.4 Cysteine-Rich 5 Intestinal Protein 0.79 <0.001 1.10 11.0 84.41 7/8 6. Nucleotide Binding/Phosphoprotein Enrichment Score:0.42
248
Table A1.c Functional clusters of proteins significantly deregulated in iTRAQ analysed TmBr2 overexpressing cell samples. Accession: IPI Name Total iTRAQ p value EF Total % No. Clusters ratio Coverage runs TmBr2: control 1. Translation/Translational Elongation/Cytosol Enrichment Score: 1.86 IPI00196994.1 Rho GDP 1 Dissociation Inhibitor (GDI) alpha 1.44 0.021 1.34 8.01 45.10 2/4 IPI00332042.9 Aldehyde 1 Dehydrogenas e 1 family, member A1 1.20 0.007 1.14 32.76 58.48 4/4 IPI00471525.2 Eukarytoic 1,2 Translation Elongation Factor 1 delta (Guanine Nucleotide Exchange Protein) 1.33 0.014 1.19 7.15 26.26 2/4 IPI00230939.4 Ribosomal 1,2,3 Protein L24 0.70 <0.001 1.10 4.29 50.31 3/4 IPI00767436.1 Ribosomal 1,3 Protein L29 0.63 0.008 1.25 1.01 48.07 2/4 IPI00230941.5 Vimentin 1,2,3,4 1.22 <0.001 1.10 61.22 77.03 2/4 2. Myofibril/Phosphoprotein/Contractile Fibre Enrichment Score:1.63 IPI00896224.1 Actin, Gamma 2,3 1 1.57 0.006 1.36 86.9 84.26 3/4 IPI00475874.5 Alpha- 2,3 Spectrin 2 0.67 0.008 1.28 7.07 19.25 3/4 IPI00201586.1 Heat Shock 2 Protein 1 1.52 0.009 1.32 8.88 48.05 3/4 3. Cytoskeleton/Non-Membrane Bounded Organelle/Structural Enrichment Molecule Activity Score:1.22 IPI00371270.1 Proliferation- 3,4 Associated 2G4 1.50 0.001 1.20 6.8 32.99 3/4 4. Enzyme Binding/Organelle Lumen Enrichment Score:0.61 IPI00392886.4 Alpha-2- 5 Macroglobulin 0.75 0.028 1.26 2.46 12.29 3/4
249
Table A1.d Functional clusters of proteins significantly deregulated in iTRAQ analysed TmBr3 overexpressing cell samples.
Accession: IPI Name TotalCl iTRAQ p value EF Total % No. usters ratio Coverage runs TmBr3: Control 1. Acetylation/Regulation of Apoptosis/Cytosol/Cytoplasm Enrichment Score: 1.93 IPI00231690.5 Cysteine and 1,3,4 Glycine- Rich Protein 1 0.77 0.003 1.13 6.01 35.75 4/4 IPI00332042.9 Aldehyde 1,2,3 Dehydrogen ase 1 family, member A1 1.20 <0.001 1.06 45.35 60.88 4/4 IPI00211216.4 Eukaryotic 1,3 Translation Initiation Factor 5a 0.76 0.0012 1.15 11.77 45.45 3/4 IPI00231643.5 Superoxide 1,2,3,4 Dismutase1, Soluble 0.73 <0.001 1.14 17.2 87.03 4/4 2. Response to Extracellular Stimulus/Response to Endogenous Enrichment Stimulus/Oxidation Reduction Score:1.74 IPI00950385.2 Cytochrome 2,4 P450, Family 2, Subfamily C, Polypeptide 7 0.73 0.004 1.13 0.12 6.35 4/4 3. Cytosol/Cell Projection/Phosphoprotein/Plasma Membrane Enrichment Score:1.03 4. Metal Ion Binding Enrichment Score:0.51
250
Appendix 2: Fragmentation of the Tm5NM1 and TmBr3 N-terminal peptides indicate N-terminal acetylation
A B
251
Appendix 2: Fragmentation of the Tm5NM1 and TmBr3 N-terminal peptides indicate N-terminal acetylation (continued)
C D
Appendix 2. Mass charge ratios of Tm5NM1 (A, B) and TmBr3 (C, D) N-terminal peptides as detected by LC-MS/MS. Mass shifts (A, C) indicate fragment masses which correspond to acetylated states of these peptides. For example, the mass of “b1” (the N-terminal alanine residue only) is ~114D in each peptide, which is the sum of the alanine mass (~71D) and the acetyl group mass (~42D). See Figure 4.8.2 and Section 4.2.1.5 of Chapter 4 for more detail.
252
Appendix 3. Details of the different clones discussed in Section 5.2.1
Clone name Tm isoform Absolute level of Fold increase as Source transgene expression compared to (ng/ug total Control (WT) protein) cells 1.9 TmBr1 0.20ng N/A Gunning Lab 1.18 TmBr1 0.45ng N/A Gunning Lab 2.8 TmBr2 0.10ng N/A Gunning Lab 3.5 TmBr3 1.30ng N/A Gunning Lab (Bryce et al., 2003) A3.1 Tm4 2.45ng 11.7 Gunning Lab (this thesis) D1.2 Tm4 1.23ng 5.9 Gunning Lab (this thesis) 314.7 Tm5NM1 2.65ng 9 Gunning Lab 314.9 Tm5NM1 4.61ng 18.5 Gunning Lab (Bryce et al., 2003)
Note that the “Fold increase as compared to control (WT) cells” reads N/A for TmBr1, TmBr2 and TmBr3 clones. This is because the expression of the endogenous isoforms in control cells for these isoforms was below the detection limit of the assay used for the comparison.
253