DOCSLIB.ORG

Blueprint Genetics Skeletal Dysplasia with Abnormal Mineralization Panel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Skeletal Dysplasia with Abnormal Mineralization Panel Test code: MA1301 Is a 34 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of hypophosphatasia or hypophosphatemic rickets. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel. About Skeletal Dysplasia with Abnormal Mineralization Hypophosphatasia is a rare inherited skeletal dysplasia due to loss of function mutations in the ALPL gene. It is characterized by defective mineralization of bone and/or teeth in the presence of low activity of serum and bone alkaline phosphatase. Clinical features range from stillbirth without mineralized bone at the severe end to pathologic fractures of the lower extremities in later adulthood at the mild end. At least six clinical forms are currently recognized based on age at diagnosis and severity of features. The differential diagnosis of hypophosphatasia depends on the age at which the diagnosis is considered. In utero, osteogenesis imperfecta (OI) type II and campomelic dysplasia are the most common differential diagnoses. Rare conditions such as Stuve–Wiedemann syndrome may also be involved. At birth, OI type II, campomelic dysplasia, and chondrodysplasias with bone mineralization defect are very similar diseases and are challenging to differentiate radiographically. In infancy and childhood, different OI types are the most common differential diagnosis, but rarer disorders such as cleidocranial dysostosis, Cole-Carpenter syndrome, idiopathic juvenile osteoporosis, and renal osteodystrophy should be considered. In adulthood, osteopenia/osteoporosis and more rarely osteoarthritis and pseudogout may be caused by hypophosphatasia. Serum alkaline phosphatase activity can suggest the diagnosis pending confirmation with genetic testing. Hypophosphatemic rickets (HR) is a genetic disorder which prevents sufficient reabsorption of phosphate in the proximal renal tubule, with increased phosphate excretion, resulting in rickets. Rickets is a metabolic disorder of the growing bone which occurs in children before fusion of the epiphysis and is characterized by impaired mineralization of the osteoid matrix during growth. The most common form of HR is inherited in an X-linked manner, but the remaining 20% of familial HR patients belong to the autosomal dominant HR and to the hereditary HR with calciuria types. Availability 4 weeks Gene Set Description Genes in the Skeletal Dysplasia with Abnormal Mineralization Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, AD/AR 78 291 juvenile and adult forms ANKH Calcium pyrophosphate deposition disease (familial chondrocalcinosis AD 13 20 type 2), Craniometaphyseal dysplasia autosomal dominant type B4GALT7 Ehlers-Danlos syndrome, progeroid form AR 8 9 CASR Hypocalcemia, Neonatal hyperparathyroidism, Familial Hypocalciuric AD/AR 104 396 hypercalcemia with transient Neonatal hyperparathyroidism CLCN5 Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, XL 48 272 Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, AD 352 962 Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 https://blueprintgenetics.com/ COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta AD/AR 186 509 type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 COL3A1 Ehlers-Danlos syndrome AD 520 631 COL5A1 Ehlers-Danlos syndrome AD 101 154 COL5A2 Ehlers-Danlos syndrome AD 24 35 CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, AR 12 30 Osteogenesis imperfecta type 4 CYP27B1 Vitamin D-dependent rickets AR 23 73 ENPP1 Arterial calcification, Hypophosphatemic rickets AD/AR 22 72 FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic AD 1465 2679 dysplasia 3 FGF23 Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets AD/AR 10 17 FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44 GALNT3 Tumoral calcinosis, hyperphosphatemic AR 17 35 MGP Keutel syndrome AR 5 8 P3H1 Osteogenesis imperfecta AR 18 63 PHEX Hypophosphatemic rickets XL 263 437 PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23 PLS3 Osteoporosis and osteoporotic fractures XL 1 17 PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, AR 8 13 Osteogenesis imperfecta type 4 PTDSS1 Lenz-Majewski hyperostotic dwarfism AD 5 7 SERPINF1 Osteogenesis imperfecta, type VI AR 9 41 SGMS2 Osteoporosis and osteoporotic fractures, Skeletal dysplasia and disorders AD SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38 SLC39A13 Spondylodysplastic Ehlers-Danlos syndrome AR 2 9 SNX10 Osteopetrosis, autosomal recessive 8 AR 3 13 SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia AD 47 144 (Cooks syndrome) TNFRSF11A Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe AD/AR 8 24 neonatal or infantile forms (OPTB1) TNFRSF11B Paget disease of bone, juvenile AR 8 18 VDR Vitamin D-dependent rickets AD/AR 17 66 https://blueprintgenetics.com/ XYLT2 Spondyloocular syndrome AR 2 10 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic HGVS RefSeq RS-number location HG19 ALPL Chr1:21835920 c.-195C>T NM_000478.4 ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4 ANKH Chr5:14871567 c.-11C>T NM_054027.4 CASR Chr3:121994640 c.1378-19A>C NM_001178065.1 COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505 COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3 COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665 COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3 COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337 COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359 COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351 COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3 COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3 COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354 COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3 COL3A1 Chr2:189872183 c.3256-43T>G NM_000090.3 rs587779667 COL5A1 Chr9:137645685 c.1720-11T>A NM_000093.4 rs863223444 COL5A1 Chr9:137680989 c.2647-12A>G NM_000093.4 COL5A1 Chr9:137686903 c.2701-25T>G NM_000093.4 rs765079080 COL5A1 Chr9:137726806 c.5137-11T>A NM_000093.4 rs183495554 COL5A2 Chr2:189927655 c.1924-11T>C NM_000393.3 https://blueprintgenetics.com/ CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360 FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4 FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4 FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4 FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4 FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4 FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4 FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4 FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4 FBN1 Chr15:48818478 c.863-26C>T NM_000138.4 IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain PMID almost 23240094 all cases of OI type V PHEX ChrX:22076478 c.349+11149A>T NM_000444.4 PHEX ChrX:22113485 c.849+1268G>T NM_000444.4 PHEX ChrX:22237137 c.1701-16T>A NM_000444.4 PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4 PHEX ChrX:22266301 c.*231A>G NM_000444.4 PLS3 ChrX:114856534 c.74-24T>A NM_005032.5 SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519 SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5 SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455 SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5 SOX9 Chr17:70117348 c.-185G>A NM_000346.3 Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available
Recommended publications
  • Atypical Femur Fracture in an Adolescent Boy Treated with Bisphosphonates for X-Linked Osteoporosis Based on PLS3 Mutation Denise M

    Atypical Femur Fracture in an Adolescent Boy Treated with Bisphosphonates for X-Linked Osteoporosis Based on PLS3 Mutation Denise M

    Atypical femur fracture in an adolescent boy treated with bisphosphonates for X-linked osteoporosis based on PLS3 mutation Denise M. van de Laarschot BSc1, M. Carola Zillikens MD PhD 1 1 Department of Internal Medicine, Erasmus MC, Rotterdam, The Netherlands Corresponding author at: Erasmus Medical Centre, PO Box 2040, 3000 CA Rotterdam, The Netherlands. Abstract Long-term use of bisphosphonates has raised concerns about the association with Atypical Femur Fractures (AFFs) that have been reported mainly in postmenopausal women. We report a case of an 18-year-old patient with juvenile osteoporosis based on X-linked osteoporosis due to a PLS3 mutation who developed a low trauma femoral fracture after seven years of intravenous and two years of oral bisphosphonate use, fulfilling the revised ASBMR diagnostic criteria of an AFF. The occurrence of AFFs has not been described previously in children or adolescents. The underlying monogenetic bone disease in our case strengthens the possibility of a genetic predisposition at least in some cases of AFF. We cannot exclude that a transverse fracture of the tibia that also occurred after a minor trauma at age 16 might be part of the same spectrum of atypical fractures related to the use of bisphosphonates. In retrospect our patient experienced prodromal pain prior to both the tibia and the femur fracture. Case reports of atypical fractures in children with a monogenetic bone disease such as Osteogenesis Imperfecta (OI) or juvenile osteoporosis are important to consider in the discussion about optimal
  • Differential Diagnosis: Brittle Bone Conditions Other Than OI

    Differential Diagnosis: Brittle Bone Conditions Other Than OI

    Facts about Osteogenesis Imperfecta Differential Diagnosis: Brittle Bone Conditions Other than OI Fragile bones are the hallmark feature of osteogenesis imperfecta (OI). The mutations that cause OI lead to abnormalities within bone that result in increased bone turnover; reduced bone mineral content and decreased bone mineral density. The consequence of these changes is brittle bones that fracture easily. But not all cases of brittle bones are OI. Other causes of brittle bones include osteomalacia, disuse osteoporosis, disorders of increased bone density, defects of bone, and tumors. The following is a list of conditions that share fragile or brittle bones as a distinguishing feature. Brief descriptions and sources for further information are included. Bruck Syndrome This autosomal recessive disorder is also referred to as OI with contractures. Some people now consider this to be a type of OI. National Library of Medicine Genetics Home Reference: http://ghr.nlm.nih.gov Ehlers-Danlos Syndrome (EDS) Joint hyperextensibility with fractures; this is a variable disorder caused by several gene mutations. Ehlers-Danlos National Foundation http://www.ednf.org Fibrous Dysplasia Fibrous tissue develops in place of normal bone. This weakens the affected bone and causes it to deform or fracture. Fibrous Dysplasia Foundation: https://www.fibrousdysplasia.org ‎ Hypophosphatasia This autosomal recessive disorder affects the development of bones and teeth through defects in skeletal mineralization. Soft Bones: www.softbones.org; National Library of Medicine Genetics Home Reference: http://ghr.nlm.nih.gov/condition Idiopathic Juvenile Osteoporosis A non-hereditary transient form of childhood osteoporosis that is similar to mild OI (Type I) National Osteoporosis Foundation: www.nof.org McCune-Albright Syndrome This disorder affects the bones, skin, and several hormone-producing tissues.
  • WO 2010/115932 Al

    WO 2010/115932 Al

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 14 October 2010 (14.10.2010) WO 2010/115932 Al (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, A61K 31/675 (2006.01) A61K 45/06 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, A61K 38/00 (2006.01) A61P 19/08 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, A61K 39/395 (2006.01) A61P 19/10 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (21) International Application Number: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, PCT/EP20 10/054605 NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (22) International Filing Date: SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 7 April 2010 (07.04.2010) TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, (30) Priority Data: ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, 61/167,688 8 April 2009 (08.04.2009) US TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant (for all designated States except US): NO- MC, MK, MT, NL, NO, PL, PT, RO, SE, SI, SK, SM, VARTIS AG [CH/CH]; Lichtstrasse 35, CH-4056 Basel TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, (CH).
  • Advances in the Pathogenesis and Possible Treatments for Multiple Hereditary Exostoses from the 2016 International MHE Conference

    Advances in the Pathogenesis and Possible Treatments for Multiple Hereditary Exostoses from the 2016 International MHE Conference

    Connective Tissue Research ISSN: 0300-8207 (Print) 1607-8438 (Online) Journal homepage: https://www.tandfonline.com/loi/icts20 Advances in the pathogenesis and possible treatments for multiple hereditary exostoses from the 2016 international MHE conference Anne Q. Phan, Maurizio Pacifici & Jeffrey D. Esko To cite this article: Anne Q. Phan, Maurizio Pacifici & Jeffrey D. Esko (2018) Advances in the pathogenesis and possible treatments for multiple hereditary exostoses from the 2016 international MHE conference, Connective Tissue Research, 59:1, 85-98, DOI: 10.1080/03008207.2017.1394295 To link to this article: https://doi.org/10.1080/03008207.2017.1394295 Published online: 03 Nov 2017. Submit your article to this journal Article views: 323 View related articles View Crossmark data Citing articles: 1 View citing articles Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=icts20 CONNECTIVE TISSUE RESEARCH 2018, VOL. 59, NO. 1, 85–98 https://doi.org/10.1080/03008207.2017.1394295 PROCEEDINGS Advances in the pathogenesis and possible treatments for multiple hereditary exostoses from the 2016 international MHE conference Anne Q. Phana, Maurizio Pacificib, and Jeffrey D. Eskoa aDepartment of Cellular and Molecular Medicine, Glycobiology Research and Training Center, University of California, San Diego, La Jolla, CA, USA; bTranslational Research Program in Pediatric Orthopaedics, Division of Orthopaedic Surgery, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA ABSTRACT KEYWORDS Multiple hereditary exostoses (MHE) is an autosomal dominant disorder that affects about 1 in 50,000 Multiple hereditary children worldwide. MHE, also known as hereditary multiple exostoses (HME) or multiple osteochon- exostoses; multiple dromas (MO), is characterized by cartilage-capped outgrowths called osteochondromas that develop osteochondromas; EXT1; adjacent to the growth plates of skeletal elements in young patients.
  • Post-Traumatic Osteolysis of the Clavicle: a Case Report C

    Post-Traumatic Osteolysis of the Clavicle: a Case Report C

    Arch Emerg Med: first published as 10.1136/emj.3.2.129 on 1 June 1986. Downloaded from Archives of Emergency Medicine, 1986, 3, 129-132 Post-traumatic osteolysis of the clavicle: a case report C. J. GRIFFITHS AND E. GLUCKSMAN Department ofAccident and Emergency Medicine, King's College Hospital, Denmark Hill, London, England SUMMARY A case of post-traumatic osteolysis of the clavicle occurring in a 25-year-old male is described. The condition should be suspected in anyone giving a history of persistent shoulder pain following trauma or intensive sporting activities. Characteristic resorp- tion of the distal tip of the clavicle is found on X-ray. The condition usually responds by copyright. within 2 years to conservative treatment. Previous reports ofthe condition are reviewed, and the possible pathogenesis and differential diagnosis discussed. INTRODUCTION Post-traumatic osteolysis of the clavicle is an uncommon condition characterized by http://emj.bmj.com/ persistent shoulder pain associated with decalcification of the distal tip of the clavicle following trauma to the acromio-clavicular joint (Madsen, 1963; Smart, 1972; Quinn & Glass, 1983). Patients usually give a history of previous trauma to the shoulder, but the condition may follow active sports such as weight training (Cahill, 1982) or the use of pneumatic tools (Ehricht, 1959). The condition usually resolves within 2 years in the absence of further trauma. This article describes a case of post-traumatic osteolysis of on September 28, 2021 by guest. Protected the clavicle, and discusses the diagnosis and possible pathogenesis of the condition. CASE REPORT A 25-year-old medical student (C.G.) was involved in a bicycle accident and received a direct blow to his right shoulder.
  • Management of the 'Young' Patient with Hip Disease

    Management of the 'Young' Patient with Hip Disease

    ARTHROPLASTY OF THE LOWER EXTREMITIES Management of the ‘Young’ Patient with Hip Disease SCOTT A. RITTERMAN, MD; LEE E. RUBIN, MD ABSTRACT abnormalities lead to impingement within the joint, altered Although hip arthritis typically affects older patients, biomechanics and ultimately cartilage loss.2 Secondary there is a rapidly growing population of “young” patients osteoarthritis can be due to an identifiable cause such as experiencing debilitating symptoms from hip disease. trauma to the femoral head, post-infection arthritis, slipped Most commonly, osteoarthritis and avascular necrosis af- capital femoral epiphysis, or hip dysplasia. fect this population, but a variety of other primary struc- As we age, the water content of cartilage increases with tural and metabolic causes can also occur. The expecta- a concomitant decrease in protein content, both leading to tions of these younger patients are often distinct from degeneration. The progressive loss of the cartilage matrix geriatric patients, and the challenges in optimizing their leads to recurrent bouts of inflammation as bone contacts care are unique in this demanding population. Selection bone, and reactive bone called osteophyte forms around the of the implant, bearing surface, and surgical technique joint. In the subchondral bone, hardening and cyst formation can all impact the success and longevity of total hip re- occurs. Repeated bouts of inflammation also extend into the placement. A consideration for respecting the native peri-articular soft tissues leading to deformity and contrac- bone stock is an important consideration that can poten- tures of the capsule, supporting ligaments, and tendons. Put tially reduce some of the future challenges of revision ar- together, these changes lead to pain, stiffness, and gait dis- throplasty in this young population.
  • Prevalence and Incidence of Rare Diseases: Bibliographic Data

    Prevalence and Incidence of Rare Diseases: Bibliographic Data

    Number 1 | January 2019 Prevalence and incidence of rare diseases: Bibliographic data Prevalence, incidence or number of published cases listed by diseases (in alphabetical order) www.orpha.net www.orphadata.org If a range of national data is available, the average is Methodology calculated to estimate the worldwide or European prevalence or incidence. When a range of data sources is available, the most Orphanet carries out a systematic survey of literature in recent data source that meets a certain number of quality order to estimate the prevalence and incidence of rare criteria is favoured (registries, meta-analyses, diseases. This study aims to collect new data regarding population-based studies, large cohorts studies). point prevalence, birth prevalence and incidence, and to update already published data according to new For congenital diseases, the prevalence is estimated, so scientific studies or other available data. that: Prevalence = birth prevalence x (patient life This data is presented in the following reports published expectancy/general population life expectancy). biannually: When only incidence data is documented, the prevalence is estimated when possible, so that : • Prevalence, incidence or number of published cases listed by diseases (in alphabetical order); Prevalence = incidence x disease mean duration. • Diseases listed by decreasing prevalence, incidence When neither prevalence nor incidence data is available, or number of published cases; which is the case for very rare diseases, the number of cases or families documented in the medical literature is Data collection provided. A number of different sources are used : Limitations of the study • Registries (RARECARE, EUROCAT, etc) ; The prevalence and incidence data presented in this report are only estimations and cannot be considered to • National/international health institutes and agencies be absolutely correct.
  • Pathological Fracture of the Tibia As a First Sign Of

    Pathological Fracture of the Tibia As a First Sign Of

    ANTICANCER RESEARCH 41 : 3083-3089 (2021) doi:10.21873/anticanres.15092 Pathological Fracture of the Tibia as a First Sign of Hyperparathyroidism – A Case Report and Systematic Review of the Current Literature ALEXANDER KEILER 1, DIETMAR DAMMERER 1, MICHAEL LIEBENSTEINER 1, KATJA SCHMITZ 2, PETER KAISER 1 and ALEXANDER WURM 1 1Department of Orthopaedics and Traumatology, Medical University of Innsbruck, Innsbruck, Austria; 2Institute for Pathology, INNPATH GmbH, Innsbruck, Austria Abstract. Background/Aim: Pathological fractures are rare, of the distal clavicles, a “salt and pepper” appearance of the suspicious and in some cases mentioned as the first sign of a skull, bone cysts, and brown tumors of the bones (3). malignant tumor. We present an uncommon case with a Primary hyperparathyroidism (PHPT), also known as “brown pathological fracture of the tibia diaphysis as the first sign of tumor”, also involves unifocal or multifocal bone lesions, which severe hyperparathyroidism. Case Report: We report the case represent a terminal stage of hyperparathyroidism-dependent of a female patient who was referred to the emergency bone pathology (4). This focal lesion is not a real neoplasm. In department with a history of progressively worsening pain in localized regions where bone loss is particularly rapid, the lower left leg and an inability to fully bear weight. No hemorrhage, reparative granulation tissue, and active, vascular, history of trauma or any other injury was reported. An x-ray proliferating fibrous tissue may replace the healthy marrow revealed an extensive osteolytic lesion in the tibial shaft with contents, resulting in a brown tumor. cortical bone destruction. Conclusion: Our case, together with Histologically, the tumor shows bland spindle cell very few cases described in the current literature, emphasizes proliferation with multinucleated osteoclastic giant cells and that in the presence of hypercalcemia and lytic lesions primary signs of bone resorption.
  • Orphanet Report Series Rare Diseases Collection

    Orphanet Report Series Rare Diseases Collection

    Marche des Maladies Rares – Alliance Maladies Rares Orphanet Report Series Rare Diseases collection DecemberOctober 2013 2009 List of rare diseases and synonyms Listed in alphabetical order www.orpha.net 20102206 Rare diseases listed in alphabetical order ORPHA ORPHA ORPHA Disease name Disease name Disease name Number Number Number 289157 1-alpha-hydroxylase deficiency 309127 3-hydroxyacyl-CoA dehydrogenase 228384 5q14.3 microdeletion syndrome deficiency 293948 1p21.3 microdeletion syndrome 314655 5q31.3 microdeletion syndrome 939 3-hydroxyisobutyric aciduria 1606 1p36 deletion syndrome 228415 5q35 microduplication syndrome 2616 3M syndrome 250989 1q21.1 microdeletion syndrome 96125 6p subtelomeric deletion syndrome 2616 3-M syndrome 250994 1q21.1 microduplication syndrome 251046 6p22 microdeletion syndrome 293843 3MC syndrome 250999 1q41q42 microdeletion syndrome 96125 6p25 microdeletion syndrome 6 3-methylcrotonylglycinuria 250999 1q41-q42 microdeletion syndrome 99135 6-phosphogluconate dehydrogenase 67046 3-methylglutaconic aciduria type 1 deficiency 238769 1q44 microdeletion syndrome 111 3-methylglutaconic aciduria type 2 13 6-pyruvoyl-tetrahydropterin synthase 976 2,8 dihydroxyadenine urolithiasis deficiency 67047 3-methylglutaconic aciduria type 3 869 2A syndrome 75857 6q terminal deletion 67048 3-methylglutaconic aciduria type 4 79154 2-aminoadipic 2-oxoadipic aciduria 171829 6q16 deletion syndrome 66634 3-methylglutaconic aciduria type 5 19 2-hydroxyglutaric acidemia 251056 6q25 microdeletion syndrome 352328 3-methylglutaconic
  • Mackenzie's Mission Gene & Condition List

    Mackenzie's Mission Gene & Condition List

    Mackenzie’s Mission Gene & Condition List What conditions are being screened for in Mackenzie’s Mission? Genetic carrier screening offered through this research study has been carefully developed. It is focused on providing people with information about their chance of having children with a severe genetic condition occurring in childhood. The screening is designed to provide genetic information that is relevant and useful, and to minimise uncertain and unclear information. How the conditions and genes are selected The Mackenzie’s Mission reproductive genetic carrier screen currently includes approximately 1300 genes which are associated with about 750 conditions. The reason there are fewer conditions than genes is that some genetic conditions can be caused by changes in more than one gene. The gene list is reviewed regularly. To select the conditions and genes to be screened, a committee comprised of experts in genetics and screening was established including: clinical geneticists, genetic scientists, a genetic pathologist, genetic counsellors, an ethicist and a parent of a child with a genetic condition. The following criteria were developed and are used to select the genes to be included: • Screening the gene is technically possible using currently available technology • The gene is known to cause a genetic condition • The condition affects people in childhood • The condition has a serious impact on a person’s quality of life and/or is life-limiting o For many of the conditions there is no treatment or the treatment is very burdensome for the child and their family. For some conditions very early diagnosis and treatment can make a difference for the child.
  • Tracheobronchial Stenosis in Keutel Syndrome

    Tracheobronchial Stenosis in Keutel Syndrome

    C O R R E S P O N D E N C E Tracheobronchial Stenosis in Keutel Syndrome Keutel syndrome is characterized by brachytelephalangism, abnormal cartilage calcification, peripheral pulmonary stenoses, and midfacial hypoplasia. We report the first case from East Asia in an 8-month-old boy who had the typical craniofacial appearance characterized by midfacial hypoplasia with a broad depressed nasal bridge (Fig. 1). The distal phalanges of fingers were thickened. Auscultation FIG.1 Midface hypoplasia is present with a depressed nasal revealed a grade 2-3/6 systolic murmur over heart, bridge and small nose. pronounced in the second and third intercostal space, and an inspiratory and expiratory stridor and wheezing over both lungs. Chest radiograph and computed tomography alternative to surgical resection. Endoscopy has been showed tracheobronchial cartilage calcification and suggested as the first choice for simple stenosis, and tracheobronchial stenosis, confirmed on bronchoscopy. success rate of 96% has been reported. So far, this Echocardiography revealed peripheral pulmonary approach has rarely been used in children. Our patient stenosis. accepted bronchoscopic cryotherapy and balloon dilatation four times, and the diameter of the subglottic Keutel syndrome is a rare autosomal recessive laryngeal stenosis was expanded from 3 mm to 4.5 mm. disease, with 27 reported cases from 19 families in The clinical symptoms improved after endoscopy, but he several countries; mostly from the Middle East. All of died of lung reinfection three weeks after discharge from them showed tracheobronchial calcification, and five of our hospital. them had stenosis of the tracheobronchial tree [1,2]. Our LI-FENG SUN AND XING CHEN, patient is the fifth patient with tracheobronchial stenosis, Department of Pediatrics, Provincial Hospital Affiliated to which should be emphasized as another remarkable Shandong University, Jinan, 250021, China.
  • Osteogenesis Imperfecta: Recent Findings Shed New Light on This Once Well-Understood Condition Donald Basel, Bsc, Mbbch1, and Robert D

    Osteogenesis Imperfecta: Recent Findings Shed New Light on This Once Well-Understood Condition Donald Basel, Bsc, Mbbch1, and Robert D

    COLLABORATIVE REVIEW Genetics in Medicine Osteogenesis imperfecta: Recent findings shed new light on this once well-understood condition Donald Basel, BSc, MBBCh1, and Robert D. Steiner, MD2 TABLE OF CONTENTS Overview ...........................................................................................................375 Differential diagnosis...................................................................................380 Clinical manifestations ................................................................................376 In utero..........................................................................................................380 OI type I ....................................................................................................376 Infancy and childhood................................................................................380 OI type II ...................................................................................................377 Nonaccidental trauma (child abuse) ....................................................380 OI type III ..................................................................................................377 Infantile hypophosphatasia ....................................................................380 OI type IV..................................................................................................377 Bruck syndrome .......................................................................................380 Newly described types of OI .....................................................................377