Spectrum of Mutations in MMAB Identified by High Resolution Melting Analysis

Margaret Lamb Illson

Department of Human Genetics McGill University Montréal, Québec, Canada

August 2012 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Masters of Science

DEDICATION

To all of my family and friends,

but especially John, for their encouragement, support and understanding.

ACKNOWLEDGMENTS

I would like to express my appreciation to my mentor, David Rosenblatt, for providing me the opportunity, not only once but twice, to be actively engaged in a field of personal interest. Being a member of the Rosenblatt team provides the friendship, support and unquestioning assistance of a very special group of colleagues headed by Dr.David Watkins. He points us in the right direction, gives valuable information and offers only the kindest critiques when asked. Memorable days have been passed in the company of Alison Brebner, Jaesung Kim and Laura Dempsey Nunez, and former lab mates who occasionally make welcome appearances. They have always been available for science discussions and troubleshooting, IT assistance and quirky bits of fun. The successful completion of this project was due to the training, mentoring and support of a large cast of people. My co-supervisor, Dr. Brian Gilfix, and committee members, Dr. Ron Agatep and Dr. George Chong helped us wade through all challenges with very practical advice. Many members of Dr. Carl Wittwer’s Lab (Department of Pathology , University of Utah, Salt Lake City, UT) put aside time to first train us, and then offer continued support. Thank you Carl, Dr. Bob Palais, Quiying Huang, Jana Kent, Luming Zhou and Zach Dwight. I would also like to thank Gail Dunbar, Maria Galvez, Junhui Liu, Leah Ladorez and Jocelyne Lavallé, Kandance Springer, Thomas Leslie, Ross MacKay and Laura Benner for help in their areas of expertise, and smiling faces even when they saw me coming. I also appreciate the willingness of Francis Petrella, Kush Prithipaul, Dylan Tanzer and Tracy Wang to do countless, but not thankless tasks. However, the biggest contributer in helping me achieve my personal goal was Laura Dempsey Nunez who never tired of joining forces and brains to work our way through this project together.

Thank you all!

iii

TABLE OF CONTENTS

DEDICATION ...... ii ACKNOWLEDGMENTS...... iii TABLE OF CONTENTS ...... iv LIST OF TABLES ...... vi LIST OF FIGURES...... vii LIST OF ABBREVIATIONS ...... viii ORIGINAL CONTRIBUTIONS TO SCIENCE...... ix ABSTRACT...... x ABRÉGÉ...... xii Introduction and Objectives of Study...... 14 CHAPTER 1: Cobalamin ...... 15 1.1 Significance...... 15 1.2 Identification of cobalamin...... 15 1.3 The cobalamin molecule...... 16 1.4 Clinical Impact ...... 17 1.5 Cobalamin Metabolism ...... 17 1.5.1 Extracellular Metabolism...... 18 1.5.2 Intracellular Metabolism...... 19 1.6 Inherited Cobalamin Disorders (Complementation groups)...... 21 1.6.1 Combined methylmalonic aciduria and homocystinuria...... 23 1.6.2 Isolated homocystinuria ...... 26 1.6.3 Isolated Methylmalonic Aciduria (MMA) ...... 28 CHAPTER 2: Isolated Methylmalonic Aciduria...... 30 2.1 Organic Aciduria (acidemia): an overview...... 31 2.2 Etiology of Methylmalonic Aciduria...... 31 2.3 Clinical spectrum – Isolated MMA ...... 33

2.4 Vitamin B12 Responsiveness ...... 35 CHAPTER 3: The MMAB gene ...... 36 3.1 Historical Overview...... 36 3.2 Identification of gene responsible for cblB disorders ...... 36 3.3 Location and Structure ...... 37 3.4 Function of ATR...... 38 3.5 Spectrum of Variants...... 39 3.6 Genotype / Phenotype correlation ...... 40 CHAPTER 4: Mutation detection for cblB type disorders...... 42 4.1 Overview of screening methods ...... 42 4.2 Screening by functional assays...... 42 4.3 New advances in sequencing technology ...... 43 4.4 High Resolution Melting Analysis ...... 44 4.4.1 Simultaneous gene scanning and genotyping for common polymorphisms...... 46

4.4.2 HRMA Analysis...... 46 4.4.3 Interpretation of HRMA results ...... 48 4.5 Considerations in choosing a screening method...... 48 CHAPTER 5: Rationale for evaluating HRMA as a cblB screening tool...... 50 5.1 Gene scanning to detect unidentified variants...... 51 5.2 Genotyping of common polymorphisms...... 52 CHAPTER 6: Methods and Materials...... 53 6.1 Optimization...... 53 6.1.1 Assay design ...... 53 6.1.2 PCR optimization...... 55 6.2 Cell line selection ...... 56 6.2.1 DNA quality control and preparation...... 57 6.3 Assay protocol with mixing...... 59 6.4 Protocol for genotyping with snapback primers ...... 59 6.5 Analysis...... 60 6.6 Confirmation of results...... 61 CHAPTER 7: Results...... 62 7.1 Variant detection by HRMA analysis...... 62 7.1.1 Scanning of reference population...... 62 7.2 Validation of the HRMA scanning assay for MMAB ...... 63 7.2.1 Amplicons with a large number of variants ...... 66 7.2.2 Distribution of mutations ...... 68 7.3 Scanning of Undiagnosed MMA samples ...... 69 7.3.1 A summary of the 2 patients with compound heterozygous variants...... 70 7.3.2 A summary of the four patients with a single heterozygous variant ...... 76 7.3.3 Detection of additional variants ...... 79 7.4 High Resolution Melting Analysis (HRMA) as a clinical tool...... 80 CHAPTER 8: Discussion ...... 83 8.1 Molecular findings of HRMA Positive Results...... 83 8.1.1 Characterization of exonic variants...... 83 8.1.2 Functional characterization of atypical cblB patients...... 85 8.2 Presentation of a clinical phenotype with a single MMAB variant ...... 88 APPENDIX I Spectrum of known MMAB mutations ...... 95 APPENDIX II Prepresentative Melting Analysis...... 96 APPENDIX III Validation results for MMAB cohort...... 97 APPENDIX IV Results for patients with unresolved MMA...... 98 LIST OF REFERENCES ...... 101 APPENDIX V: Presentations...... 108 APPENDIX VI : Certificates ...... 111

LIST OF TABLES

Table 1 MMAB Primers for HRMA assay ...... 54

Table 2 PCR reagents...... 55

Table 3 PCR amplification program...... 56

Table 4 Samples tested for assay validation ...... 64

Table 5 Variants identified during assay validation ...... 65

Table 6 Sensitivity and Specificity of Assay...... 67

Table 7 Distribution of mutation type...... 68

Table 8 Variants identified in patients with unresolved MMA ...... 69

Table 9 MMA patients with compound heterozygous MMAB mutations ...... 71

Table10 MMA patients with a single heterozygous MMAB mutation ...... 72

Table11 Summary of benign variants...... 80

Table12 Pathogenicity Prediction for exonic variants...... 84

LIST OF FIGURES

Figure 1 Cobalamin Molecule ...... 16

Figure 2 ATP:Cobalamin Transferase ...... 20

Figure 3: Intracellular Disorders of Cobalamin Metabolism...... 22

Figure 4 Etiology of Methylmalonic Acidurua...... 32

Figure 5 Summary of MMAB mutations and common polymorphisms ...... 39

Figure 6 Simultaneous scanning and genotyping using a snapback primer ...... 47

Figure 7 [14C]-Propionate Incorporation of atypical cblB’s ...... 86

Figure 8 Cobalamin distribution of atypical cblB samples...... 87

vii

LIST OF ABBREVIATIONS

AdoCbl 5’-deoxyadenosylcobalamin ATP Adenosine Triphospahte ATR ATP:Cobalamin(I) Transferase Cbl Cobalamin CNCbl Cyanocobalamin Cob(I)alamin Oxidation state +1 of the cobalt atom in cobalamin Cob(II)alamin Oxidation state +2 of the cobalt atom in cobalamin Cob(III)alamin Oxidation state +3 of the cobalt atom in cobalamin DMB 5,6-dimethylbenzamidizole HRMA High Resolution Melting Analysis HC Haptocorrin IF Intrinsic factor FN False Negative MAF Minor allele frequency MCEE Methylmalonyl-CoA epimerase MCM Methylmalonyl-CoA mutase MeCbl Methylcobalamin MethylTHF N-5-methyltetrahydrofolate MMA Methylmalonic aciduria MS Methionine synthase MTHFR Methyltetrahydrofolate reductase MSR Methionine synthase reductase NBS Newborn Screening OHCbl Hydroxycobalamin PCR Polymerase Chain Reaction SAM S-adenosylmethionine SCS-A SuccinylCoA synthetase TC Transcobalamin, transcobalamin II TCA Tricarboxylic acid TCblR Transcobalamin receptor THF Tetrahydrofolate

Tm Melting point TP True Positive

viii

ORIGINAL CONTRIBUTIONS TO SCIENCE

Development of a high resolution melting assay to scan for variants in the

MMAB, the gene responsible for the subclass of vitamin B12-responsive methylmalonic aciduria.

Identification of variants in the MMAB gene by high resolution melting analysis in a small number of atypical cblB patients, characterized by an isolated methylmalonic aciduria, who remain undiagnosed following somatic cell studies.

ABSTRACT

Pathogenic variants in the MMAB gene (OMIM 607958) are responsible

for the cblB class of cobalamin-responsive methylmalonic aciduria

(MMA) (OMIM 251110). MMAB encodes cobalamin

adenosyltransferase, a mitochondrial enzyme responsible for the formation

of adenosylcobalamin (AdoCbl). AdoCbl subsequently functions as a

cofactor for methylmalonyl-CoA mutase (MCM) during the isomerization of L-methylmalonyl-CoA to succinyl-CoA. Somatic cells studies have

been used to evaluate patient samples for cobalamin related disorders.

Due to high basal levels of propionate incorporation, some patients with

mild MMA biochemical phenotypes cannot be diagnosed by

complementation analysis. A high resolution melting analysis (HRMA) assay was developed to rapidly scan the coding exons and flanking intronic regions for variants in the MMAB gene.

Three cohorts of samples were scanned by HRMA: an unaffected reference population, 42 samples assigned to the cblB by complementation analysis and 181 patients with unresolved isolated MMA. HRMA correctly identified all of the previously reported mutations in the cblB

cohort as well as seven additional variants including a novel nonsense

variant (c.12C>A, p.C4X). Scanning of the unresolved MMA cohort

identified six samples containing MMAB variants. Two samples, WG3948

and WG4034, contained compound heterozygous variants. They shared a

c.572 G>A (p.R191Q) mutation. WG3948, the index case for this study,

was found to have c.398 C>T (p.S133F) as the second mutation, and

WG4034, the second patient, contained a novel variant c.394 C>T

(p.C132R). Samples from four other affected patients contained a single variant. The c.572 G>A (p. R191Q) was found in both WG3546 and

WG4090. WG3759 contained a c.521C>T ( p.S174L) substitution, and

WG4029 contained a novel c.185 C>T (p.T62M) substitution.

The identification of two patients with compound heterozygous variants in the MMAB gene suggests the existence of an infrequent but distinct atypical cblB phenotype. This subclass is characterized by levels of propionate incorporation and of AdoCbl synthesis within reference ranges, preventing diagnosis by somatic cell studies.

ABRÉGÉ

Des variantes pathogéniques dans le gène MMAB (OMIM 607958) sont responsables de la classe cblB d’acidurie méthylmalonique (AMM) respondant à la cobalamine (OMIM 251110). MMAB encode cobalamine adénosyltranférase, une enzyme mitochondriale responsable de la formation de l’adénosylcobalamine (AdoCbl). AdoCbl fonctionne par la suite en tant que cofacteur pour méthylmalonyl-CoA mutase (MCM) durant l’isomérisation de L-méthylmalonyl-CoA vers succinyl-CoA. Des analyses sur des cellules somatiques ont été utilisées pour évaluer des

échantillons de patients pour des troubles reliés à la cobalamine. En raison de niveaux de base élevés d’incorporation de propionate, certains patients présentant des phénotypes biochimiques bénins d’AMM ne peuvent être diagnostiqués par analyse de complémentation. Une analyse de fusion à haute résolution (AFHR) a été développée pour balayer rapidement les exons codants et les régions introniques avoisinnantes pour des variantes dans le gène MMAB.

Trois cohortes d’échantillons ont été balayées par AFHR : une population de référence non-affectée, 42 échantillons assignés au groupe cblB par analyse de complémentation et 181 patients avec une AMM isolée sans diagnostique. L’AFHR a correctement identifié toutes les mutations précédemment rapportées dans la cohorte cblB ainsi que sept variantes additionelles, incluant une nouvelle variante non-sens (c.12C>A, p.C4X).

Le balayage de la cohorte avec de l’AMM isolée a identifié six

xii

échantillons contenant des variantes dans MMAB. Deux échantillons,

WG3948 et WG4034, étaient des porteurs de variantes hétérozygotes

composés. Ils partageaient la mutation c.572G>A (p.R191Q). WG3948, le

cas index pour cette étude, était porteur du c.398C>T (p.S133F) pour la

deuxième mutation et WG4034, le deuxième patient, contenait une nouvel

variante c.394C>T (p.C132R). Les échantillons provenant de quatre autres

patients atteints contenait une seule variante. Le c.572G>A (p.R191Q) a

été trouvé dans WG3546 et WG4090. WG3759 contenait une substitution

c.52C>T (p.S174L), et WG4029 contenait une nouvelle substitution

c.185C>T (p.T62M).

L’identification de deux patients avec des variantes hétérozygotes

composées dans le gène MMAB suggère l’existence d’un phénotype rare mais distinct de cblB. Cette sous-classe est charactérisée par des niveaux d’incorporation de propionate et de synthèse d’AdoCbl dans les valeurs normales, empêchant le diagnostique par analyse des cellules somatiques.

xiii

Introduction and Objectives of Study

Pathogenic variants in the MMAB gene are responsible for the cblB class of cobalamin-responsive methylmalonic aciduria. MMAB encodes cobalamin adenosyltransferase, a mitochondrial enzyme responsible for the formation of adenosylcobalamin (AdoCbl), an essential coenzyme for the mitochondrial enzyme, methylmalonyl CoA mutase (MCM). Mutations in MMAB and five additional genes (MMAA, MMADHC variant 2, MUT, MCEE or SUCLA2) can result in isolated methylmalonylic aciduria (MMA). More than 350 archived patients with isolated MMA remain undiagnosed after somatic cell studies. One patient in this cohort was later discovered to have compound heterozygous mutations by sequencing.

High Resolution Melting Analysis (HRMA) was utilized as a fast and inexpensive method to scan the MMAB gene in an additional 181 patients with unresolved methylmalonic aciduria (MMA) to identify any causal variants. The development of a fast and simple PCR-based assay with the ability to screen targeted genes of the vitamin B12 pathway for sequence variation could be of benefit both as a research and diagnostic tool.

CHAPTER 1: Cobalamin

1.1 Significance

Cobalamin (Cbl), commonly known as vitamin B12, belongs to the family of water soluble B vitamins that are vital in mammalian metabolic pathways. Mammals cannot synthesize Cbl directly, so it must be acquired through dietary intake of animal products containing vitamin B12. Cbl is processed and transported through the digestive and circulatory systems by a series of complex steps before entering the cell to be further metabolized to produce two essential mammalian coenzymes, adenosylcobalamin (AdoCbl) and methylcobalamin (MeCbl).

Deficiencies in Cbl metabolism can result in isolated homocystinuria, isolated methylmalonic aciduria (MMA), or a combined presentation of the two.

1.2 Identification of cobalamin

A severe anemia was described by Thomas Addison in the mid 19th century, and became known as pernicious anemia. George Whipple experimented with an effective treatment in the 1920’s by administering liver extracts to correct anemia in dogs. Georges Minot and William Murphy attempted the treatment of human subjects with the “extrinsic factor” from liver, but some patients did not respond.

It was William Castle who recognized that treatment of anemia required the presence of both an “extrinsic factor” from liver extract and an “intrinsic factor” contained in gastric juice. . In the late 40’s, vitamin B12 was isolated by Karl

Folkers, Lester Smith and Mary Shorb, and successful treatment of patients confirmed the identity of the extrinsic factor as vitamin B12. Dorothy Hodgkins

began work on the crystallization of the molecule and by 1955 had solved the crystal structure of the cyanocobalamin (CNCbl) molecule using X-ray diffraction

(see Figure 1). This brief history was summarized from a reviews written by

Kunio Okuda (Okuda, 1999) and H.P.C Hogenkamp (Hogenkamp, 1999).

1.3 The cobalamin molecule

Figure 1 Cobalamin Molecule

The Cbl molecule has a planar corrin ring surrounding a central cobalt atom. The rare Co atom of this organometallic molecule coordinates with four nitrogen atoms in a planar corrin ring and with both a lower () and upper () ligand. In the  position, 5,6-dimethylbenzamidizole base (DMB) is covalently linked below the corrin ring and also coordinated to the cobalt ion. Several chemical groups can be found in the  axial position and each forming a functionally distinct derivative including: cyanocobalamin (CNCbl), hydroxocobalamin (OHCbl), adenosylcobalamin (AdoCbl), and methylcobalamin (MeCbl). Illustration from (Froese & Gravel, 2010)

The reactivity of the Cbl molecule is primarily due the presence of the labile cobalt to carbon (Co-C) bond, a stable but relatively weak bond (Pratt, 1999). The cobalt metal ion lowers the energy required to break the C-C bonds during Cbl metabolism and alternates among three oxidation states, from +3 to the reactive fully reduced +1 level.

1.4 Clinical Impact

Cbl disorders may result from dietary deficiencies or inherited errors in metabolism. Since vitamin B12 cannot be synthesized in man it must be ingested and then metabolized to form sufficient quantities of two essential Cbl derivatives, MeCbl and AdoCbl. Both function as cofactors for two mammalian enzymes, methionine synthase (MS) found in the cytoplasm and MCM located in the mitochondria (Watkins & Rosenblatt, 2011a). Deficiencies in Cbl absorption, transport or metabolism can result in isolated homocystinuria, isolated MMA or a combined presentation of both. Elevated levels of MMA can cause potentially lethal metabolic acidosis.

1.5 Cobalamin Metabolism

Once the vitamin is ingested, metabolism proceeds by a complex series of steps to absorb and transport this large hydrophilic molecule through the digestive and circulatory systems, before delivering it to cells for processing into the AdoCbl and MeCbl derivatives.

1.5.1 Extracellular Metabolism

Dietary Cbl enters the body bound to food proteins. In the digestive tract, the protein becomes dissociated in the acid environment of the stomach, and Cbl is re-bound by a series of transporting proteins. The exchange of carrier proteins facilitates the movement of Cbl efficiently through the different environments found in each organ (Fowler, Leonard, and Baumgartner, 2008).

First, haptocorrin (HC), which is present in saliva, binds Cbl in the stomach. The

TCN1 gene encodes HC and defects do not produce any known clinical defects.

The HC/Cbl complex dissociates in the intestine, and Cbl is rebound by intrinsic factor (IF) which is excreted from the gastric parietal cells. Defects in the gene encoding intrinsic factor (GIF) result in an inborn error of cobalamin uptake, intrinsic factor deficiency. A block may also occur in the uptake of the IF/Cbl complex due to defects in two receptor genes, CUBN and AMN resulting in

Imerslund–Gräsbeck syndrome. Both disorders of Cbl uptake are characterized by serum Cbl deficiency, megaloblastic anemia and developmental delay.

Normal metabolism of Cbl proceeds when the IF-Cbl complex binds with the

CUBAM receptor and enters the distal ileal enterocytes by endocytosis. It is digested in the lysosome and the free Cbl is transferred across the basal membrane to the circulatory system in a process thought to include the multiple drug resistance protein (MRP1) (Morkbak, Poulsen, and Nexo, 2007). There it binds to both HC and transcobalamin (TC), forming both HC-Cbl and TC-Cbl complexes

(Fowler et al.,2008; Watkins & Rosenblatt, 2011a). While HC, produced by the

TCN1 gene, carries 70-90% of the Cbl in the circulatory system (Froese &

Gravel, 2010; Watkins & Rosenblatt, 2011a). The source of the HC-Cbl complex remains unclear, however its role may be to bind and clear biologically inactive

Cbl derivatives from the body (Morkbak et al., 2007). The remaining 10 – 30% of circulating Cbl forms a complex with TC. The TC-Cbl complex is transported into most cells of the body and becomes the substrate for further intracellular processing of Cbl for coenzyme formation. Transcobalamin is encoded by the

TCN2 gene. A deficiency is characterized by failure to thrive and megaloblastic anemia as well as immunological and neurological complications in untreated patients. The TC-Cbl complex enters the body's peripheral cells by receptor mediated endocytosis through the TC receptor (TCblR) (Quadros, Lai, Nakayama,

Sequeria, Wang, Jacobsen, Fedosov, Wright, Gallagher, Anastasio, Watkins and

Rosenblatt, 2010), which is encoded by the CD320 gene. A defect in the TCblR receptor results in decreased cellular uptake, but little or no clinical impact has been identified to date.

1.5.2 Intracellular Metabolism

After entering the cell, the TC-Cbl complex is broken down in the lysosome.

Cbl is transported and reduced from the cob(III)alamin state by the products of a series of four genes (LMBRD1, ABCD4, MMACHC, MMADHC). The pathway diverges into two independent branches in order to form the two derivatives

MeCbl and AdoCbl. The functional role of each cofactor is determined by the moiety bound.

The MeCbl derivative serves as the cofactor for the enzyme MS during the conversion of homocysteine to methionine in a two step process. First, a methyl group is transferred from N-5-methyltetrahydrofolate (MethylTHF) to the upper  axial position of the MS-bound cob(I)alamin molecule. The methyl group is then passed to homocysteine producing methionine (Watkins & Rosenblatt, 2011a).

The amino acid methionine is essential for human metabolism, and once activated by ATP, it produces S-adenosylmethionine (SAM). SAM is a substrate required for a wide variety of essential mammalian methyl transfer reactions including nucleic acids and neurotransmitter synthesis (Durand, Prost, Loreau, Lussier-

Cacan, and Blache, 2001). A deficiency in MeCbl or a defect in MS leads to elevated levels of homocysteine.

AdoCbl is the cofactor for the mitochondrial enzyme MCM. This Cbl derivative is formed through the action of the enzyme ATP:Cobalamin(I) Transferase

(ATR) (Padovani, Labunska, Palfey, Ballou, and Banerjee, 2008) and is depicted in Figure 2.

When the DMB ligand is absent, AdoCbl is referred to as base off. The derivative becomes more reactive and is available for binding to MCM (Banerjee, 1999).

Activation of MCM by the binding of AdoCbl facilitates the conversion of

L-methylmalonylCoA into succinylCoA. The AdoCbl/MCM complex functions as an isomerase facilitating the exchange of a hydrogen atom and carbonylCoA group between two adjacent atoms (Banerjee, 1999). This conversion must take place for the normal catabolism of branched-chain amino acids and odd-chain fatty acids in preparation for entry into the TCA cycle. Any block that prevents

this exchange leads to elevated levels of methylmalonic acid.

Figure 2 ATP:Cobalamin Transferase

An adenosyl moiety is transferred from ATP to the upper axial  position of cobalamin by cobalamin adenosyltransferase (Saridakis et al., 2004)

1.6 Inherited Cobalamin Disorders (Complementation groups)

There are currently fourteen different inborn errors of Cbl transport and metabolism with the recent identification of the cblJ complementation class

(Kim, Coelho, Miousse, Fungi, du Molin, Buers, … and Rosenblatt, 2011).

Typically, the metabolic effects are more severe for defects affecting intracellular metabolism than extracellular disorders.

Figure 3: Intracellular Disorders of Cobalamin Metabolism

Intracellular Disorders of Cobalamin

Isolated Homocystinuria

MTR

HomocysteineCEL L ME MBRANE Methionine Combined Honocystinuria MeCbl and Methylmalonic Aciduria MTRR

1 t n me a soso ri Ly a V CD320 LMRBD1 MMACHC MMADHC V a r ia n t ABCD4 2

Familia l ~ 25% MMAB

MMAA D‐Methylmalonyl CoA

MCEE AdoCbl L‐Methylmalonyl CoA Succinyl CoA MUT

Isolated Methylmalonic Aciduria

Intracellular disorders of Cbl metabolism can be divided into 3 broad functional categories on the basis of two biomarkers, MMA and homocysteine. Gene defects result in disorders characterized by: 1) Isolated homocystinuria if the cytosolic branch of the pathway utilizing MeCbl coenzyme is affected; 2) Isolated MMA if the mitochondrial branch of the pathway utilizing AdoCbl is affected 3) Combined homocystinuria and MMA.

Defects at specific points in the pathway can disrupt extracellular Cbl absorption, transport, or uptake into the cells for intracellular processing. These disorders are inherited in an autosomal recessive manner and gene defects in the pathway have

been well characterized. Disorders associated with defects in the genes of the pathway are classified into nine functional complementation groups, cblA thru cblG, cblJ and mut as depicted in Figure 3 (Gravel, Mahoney, Ruddle, and

Rosenberg, 1975; Watkins & Rosenblatt, 2011a) . Samples with gene defects are assigned to a complementation group by complementation analysis.

Complementation Analysis

During analysis, the fibroblasts of the undiagnosed patient are fused with fibroblasts containing a known gene defect creating a heterokaryon. If the combined DNA is able to correct the defect and rescue cell function, the DNA of each cell cannot have defects at the same loci. The DNA of the undiagnosed patient is able to compensate for the known defective loci and rescue function.

Function is measured by ability of the fused cells to incorporate [14C]-propionate.

Failure of the patient’s fibroblast to complement the defective loci indicates that the patient’s fibroblast belongs to the same complementation group as both fibroblasts must contain the same defective loci.

1.6.1 Combined methylmalonic aciduria and homocystinuria

The cblC, cblD, cblF and cblJ groups of disorders result in combined MMA and homocystinuria. Defects in lysosomal export of free Cbl are found in cblF and cblJ patient fibroblasts. Both cblC and cblD fibroblast cells show normal Cbl export from the lysosomes with defects occurring before the synthesis of AdoCbl and MeCbl.

cblF (MIM #277380)

Defects in the LMBRD1 gene block the export of free Cbl into the cytoplasm

(Rutsch, Gailus, Suormala, & Fowler, 2011). In vitro studies demonstrate that only small amounts of exogenous [57Co] CN-Cbl added to cultured fibroblasts of cblF patients are converted into the Cbl derivatives, AdoCbl and MeCbl. The majority accumulates as unbound CNCbl (Fons, Sempere, Sanmarti, Arias, Poo,

Pineda, … and Campistol, 2009; Fowler et al., 2008; Rosenblatt, Laframboise,

Pichette, Langevin, Cooper and Costa, 1986).

These patients present early in life with failure to thrive, feeding difficulties, and some may have hematological disorders including macrocytic anemia, neutropenia, and pancytopenia. Minor facial anomalies and congenital heart defects have been seen (Fons et al., 2009; Rutsch, Gailus, Suormala and Fowler,

2011; Watkins & Rosenblatt, 2011b).

cblJ

Defects in the ABCD4 gene mimic the effects of the cblF complementation group, also resulting in the failure to release vitamin B12 from lysosomes, and affect synthesis of both Cbl cofactors. The gene was recently identified by microcell mediated chromosome transfer and exome sequencing. The partial rescue of function in cblF cells by ABCD4 overexpression suggests LMBRD1 and ABCD4 function together in the export of Cbl into the cytoplasm (Kim et al., 2011).

cblC (MIM #277400)

Defects in the MMACHC gene are the most common cause of inborn errors of intracellular Cbl metabolism (Lerner-Ellis, Anastasio, Liu, Coelho, Suormala,

Stucki … and Fowler, 2009), with over 500 cases reported (Watkins &

Rosenblatt, 2011b). A decrease in the production of AdoCbl and MeCbl is observed, affecting the function of both MCM and MS. It is thought the gene product serves as a Cbl chaperone and also has a role in cleaving the upper axial ligands from the -ligand position breaking the carbon-cobalt bond. (Kim,

Gherasim, & Banerjee, 2008; Kim, Hannibal, Gherasim, Jacobsen, and Banerjee,

2009). The MMACHC gene product interacts with MMADHC (Plesa, Kim,

Paquette, Gagnon, Ng-Thow-Hing, Gibbs, … Coulton, 2011). Current studies suggest that MMACHC utilizes a combination of adjacent binding pockets and a dimer structure to process all Cbl derivatives by either reductive decyanation or dealkylation into a common intermediary form for further processing (Froese,

Krojer, Wu, Shrestha, Kiyani, von Delft, … and Yue, 2012; J. Kim et al., 2009).

Patients with cblC disorders have a variable age of presentation. The early onset phenotype is severe resulting in either death or neurological defects while the later onset phenotype is milder. Secondary complications are diverse and include: megaloblastic anemia, neurological concerns, ocular involvement and cardiac defects (Carrillo-Carrasco, Chandler, & Venditti, 2012).

cblD (MIM #277410)

The gene product of the MMADHC gene is associated with three phenotypes and results in the pathway diverging into two independent branches. The reduced Cbl molecule is highly reactive and normal metabolism proceeds with the simultaneous production of both AdoCbl and MeCbl in mitochondria and cytosol respectively. Patients with cblD disorders may present with a combined elevation of both homocysteine and methylmalonic acid or an isolated deficiency of one or the other metabolites (Navarro-Sastre, Tort, Stehling, Uraska, Arranz, Del Toro,

… and Lill 2011). Mutations in the N-terminus of the gene are associated with

AdoCbl deficiency (cblD variant 2) while mutations at the C-terminus are responsible for MeCbl related disorders (cblD variant 1). Patients present with developmental delay, seizures, megaloblastic anemia, ataxia, metabolic acidosis, hypotonia, and encephalopathy.

1.6.2 Isolated homocystinuria

The cblE, cblG and cblD variant 1disorders result in isolated homocystinuria.

Defects affecting MeCbl production or the enzyme MS are found in patient fibroblasts.

cblE (MIM #236270)

The protein product of the MTRR gene encodes methionine synthase reductase

(MSR). The +1 oxidative state of Cbl is unstable and is easily oxidized to a less reactive +2 state blocking the conversion of homocysteine to methinione. MTRR can reactivate Cbl by reducing it back to MeCbl, with the transfer of a methyl

group from adensoylmethionine. The repeated cycling between Cbl forms bound to MS, MeCbl and cob(II)alamin ensures continued production of methionine.

(Leclerc, Wilson, Dumas, Gafuik, Song, Watkins, … Gravel, 1998). Symptoms include megaloblastic anemia, developmental delay, ataxia, cerebral atrophy, seizures and visual defects were seen in at least one case (Watkins & Rosenblatt,

2011b) .

cblG (MIM #250940)

The protein product of the MTR gene encodes the enzyme MS (Gulati, Baker, Li,

Fowler, Kruger, Brody and Banerjee, 1996; Leclerc, Campeau, Goyette, Adajalla,

Christensen, Ross, … Gravel; 1996; Li, Gulati, Baker, Brody, Banerjee and

Kruger, 1996). Defects in this gene can impact either folate or Cbl metabolism as the pathways intersect during the conversion of homocysteine to methionine by

MS in a cyclic reaction. MethylTHF transfers its methyl group to Cbl forming

MeCbl and regenerating tetrahydrofolate (THF) in the process. MeCbl in turn transfers the newly acquired methyl group to homocysteine producing methionine. A Cbl deficiency perturbs the cycle resulting in a methylTHF trap blocking the conversion of homocysteine and (Watkins & Rosenblatt, 2011b) preventing further demethylation of MTHFR. The result is a deficiency of THF

(Hoffbrand & Jackson, 1993) blocking the regeneration of 5,10 methylene- tetrahydrofolate that is essential for pyrimidine synthesis and megaloblastic anemia develops. The production of SAM, a major mammalian methyl donor, is also affected (see section 1.5.2).

1.6.3 Isolated Methylmalonic Aciduria (MMA)

The cblA, cblB, mut, epimerase and cblD variant 2 disorders result in isolated

MMA. Defects affecting AdoCbl production or the enzyme MCM perturb the intricate interactions among the MUT, MMAA and MMAB proteins. In addition, defects in upstream genes MCEE and cblD variant 2 can result in isolated MMA either by producing defective methylmalonylCoA epimerase (MCEE) or inhibiting the complete reduction of Cbl (Stucki, Coelho, Suormala, Burda,

Fowler and Baumgartner, 2012). Defects in a downstream gene, SUCLA2, produce a mitochondrial DNA depletion disorder, but can also be responsible for elevations in MMA.

mut ¯ / o (MIM #251000) Mutations in the MUT gene, are the most common cause of MMA. AdoCbl must be bound to functional MCM for the conversion of methylmalonylCoA to succinylCoA (Worgan, Niles, Tirone, Hofmannm Verner, Sammak, … and

Rosenblatt, 2006). Two classes of the MCM protein product have been identified: a partially active MCM enzyme (mut_ ) and a totally dysfunctional product (mut o). The severity of MCM disorders is dependent on the residual enzymatic activity each sequence variant produces. Patients are susceptible to often fatal episodes of metabolic acidosis and can also experience metabolic strokes causing neuronal and renal damage, blood marrow suppression causing leukopenia and anemia (Manoli & Venditti, 2011) and dysfunction in mitochondrial oxidative processes (Chandler, Zerfas, Shanske, Sloan, Hoffmann

DiMauro, … Venditti, 2009).

cblB (MIM #251110)

The MMAB gene product facilitates the transfer of an adenosyl moiety from ATP to the free  ligand of Cbl to form AdoCbl. It is also hypothesized that ATR serves as a chaperone to direct AdoCbl to its target MCM (Yamanishi, Vlasie, &

Banerjee, 2005). The AdoCbl / MCM complex facilitates the isomerasation of methylamlonylCoA to succinylCoA. An expanded description is provided in chapter 3.

cblA (MIM #251100)

The human MMAA gene was identified by searching for orthologs to bacterial genes located in the same operon as MCM (Dobson, Wai, Leclerc, Kadir, Narang,

Lerner-Ellis, … and Gravel, 2002a). Continuing studies on the bacterial orthologs, MeaB, indicate that MMAA has both a protection and stabilization role for MCM (Padovani et al., 2008). Ongoing studies to determine MMAA’s precise function include crystallization studies which demonstrated that MMAA binds to

MCM (Froese et al., 2012) and acts as a chaperone preventing MCM inactivation

(Takahashi-Iniguez, Garcia-Arellano, Trujillo-Roldan, & Flores, 2011). Patients with a cblA disorder typically present during infancy, and experience failure to thrive, developmental delay, periods of metabolic acidosis and seizures along with possible hematological and neurological concerns (Horster, Baumgartner,

Viardot, Suomala, Bugard, Fowler, … and Baumgartner, 2007; Merinero, Perez,

Perez-Cerda, Rincon, Desviat, Martinez, … and Ugarte, 2008).

Epimerase deficiency (MIM# 251120)

Methylmalonyl CoA epimerase was the first Cbl related gene to be identified on the basis of prokaryotic gene arrangements (Bobik & Rasche, 2004). Defects in

MCEE prevent the racemization of D-methylmalonyl CoA to

L-methylmalonylCoA impairing the production of succinyl CoA. MMA can result even in the presence of fully functional MMAB, MMAA and MUT genes

(Gradinger, Belair, Worgan, Li, Lavallee, Roquis, … and Rosenblatt 2007).

Patients present with a range of clinical phenotypes including moderate elevations of methylmalonic acid (Matsui, Mahoney, & Rosenberg, 1983). They can experience metabolic acidosis and symptoms include ataxia, hypotonia and seizures (Manoli & Venditti, 2011).

Succinate CoA ligase deficiency

A small number of patients were identified with mild urinary excretion of MMA, progressive encephalopathy and decreased mitochondrial respiratory chain activity. Having excluded more common molecular lesions, mutations were discovered in a gene encoding an enzyme downstream of the methylmalonyl CoA to succinyl CoA conversion, SUCLA2 (MIMC603921). The protein product encodes the  subunit of succinyl CoA synthatase (SCS-A) (Carrozzo, Piemonte,

Tessa, Lucioli, Rizza, Meschini, … and Santorelli, 2007). SCS-A catalyses a reversible reaction in the TCA cycle which converts succinyl CoA and ADP to succinate and ATP. The function of SUCLA2 overlaps with another gene,

SUCLG1 (MIM 611224), which encodes the  subunit of the same enzyme

SCS-A (Ostergaard, 1993).

CHAPTER 2: Isolated Methylmalonic Aciduria

2.1 Organic Aciduria (acidemia): an overview

Proteins are metabolized into amino acids during digestion and serve as small building blocks for growth, cell maintenance and DNA repairs. Any surplus amino acids are further catabolized as excess levels are toxic to the body. The amino acids are deaminated in the liver to remove and excrete the nitrogen atom from the amino group as urea. The remaining carbon skeleton can enter the Krebs cycle, undergo gluconeogenesis or serve as a substrate for fatty acid synthesis.

Defects in catabolism result in classic organic aciduria / organic acidemia.

Organic acid disorders result when defective or missing enzymes make it impossible for the body to degrade amino acids and odd chain fatty acids properly. Ultimately the organic acid that accumulates is determined by which substrate precedes the dysfunctional enzyme (Perez-Duenas, Angaroni, Sanchez-

Alcudia, Merinero, Perez-Cerda, Specola, … and Ugarte,2011).

2.2 Etiology of Methylmalonic Aciduria

Three independent pathways lead to the production of methylmalonic acid: the catabolism of branched chain fatty acids, the -oxidation of odd chain fatty acids and catabolism of cholesterol’s side chain. (Duane, Levitt, Mueller, & Behrens,

1983). PropionylCoA is an intermediate for all three and is carboxylated to form methylmalonylCoA which is then converted to succinylCoA (see Figure 4).

MethylmalonylCoA must be isomerzied to its “L” form before it can be converted to succinylCoA through the action of Cbl and the MCM, MMAA and MMAB proteins. Isolated MMA disorders result from defects of the MCM apoenzyme, or

Figure 4 Etiology of Methylmalonic Aciduria

Catabolism of Branched Chain Fatty Acids  Oxidation of Odd Chain Fatty Isoleucine,Methionine Acids Th i V li Catabolism of Cholesterol Independent pathways

Propionyl-CoA

Propionyl- CO2 CoA

Methylmalonyl Co-A MUT MMAB Methylmalonyl-CoA AdoCbl Mutase MMAA

Succinyl-CoA

Normal catabolism of the amino acids isoleucine, valine, methionine or threonine all produce propionylCoA as an end product. Other sources of propionylCoA are the -oxidation of odd chain fatty acids and the cleavage of the three terminal carbons from the cholesterol side chain during its oxidation to bile acid. PropionylCoA is converted to D-methylmalonylCoA through the action of propionylCoA carboxylase and biotin. D- methylmalonylCoA is then converted to succinylCoA. Biochemical defects that impact the conversion of methylmalonylCoA to succinylCoA create an accumulation of methylmalonic acid in blood and urine.

a reduction in the amount or inability of AdoCbl to function as a coenzyme

(Horster et al., 2007; Nicolaides, Leonard, & Surtees, 1998). Defects create an accumulation of methylmalonic acid in the blood and urine.

2.3 Clinical spectrum – Isolated MMA

The wide range of clinical phenotypes associated with isolated MMA reflect the variety of underlying defects in enzyme function (Horster et al., 2007). The defining biochemical phenotype is an accumulation of methylmalonic acid in blood and urine. Elevated levels of methylmalonic acid are responsible for anemia, leukopenia and thrombocytopenia resulting from the suppression of bone marrow activity and metabolic strokes involving the basal ganglia. Secondary complications of MMA can target multiple organ systems and include variable levels of developmental delay, progressive renal failure, an impaired immune system and pancreatitis (Manoli & Venditti, 2011). There is also evidence that

MMA is responsible for deficient energy metabolism (Chandler et al., 2009).

Elevated levels of methylmalonic acid can inhibit oxidative metabolism and deplete free ATP. Finally, depletion of the free CoA pool, impacts the synthesis of myelin, urea and glucose (Perez-Duenas, Sempere, Campistol, Alonso-

Colmenero, Diez, Gonzalez, … and Artuch, 2011).

Clinical phenotypes can be correlated with age of onset and complementation group. Early onset MMA disorders appear shortly after birth and severely affect the patient. They are marked by lethargy, failure to thrive, vomiting, respiratory distress, hypotonia and possible seizures indicative of neurological complications

that can lead to coma (Matsui et al., 1983). Complementation groups, assigned by cell fusion and biochemical studies, presume that samples containing identical mutations will produce the same phenotype. While exceptions are found, samples within the same group display similar ages of onset, share comparable long term outcomes and responses to supplementation with OHCbl.

All patients with defects in MCM are assigned to a single complementation group, mut, but can have a partially functional enzyme (mut ) or have a null enzyme

(mut o) (Cosson, Benoist, Touati, Dechaux, Royer, Grndin, … and de Lonay,

2009; Horster et al., 2007). Patients with mut o disorders typically present symptoms in the first month of life, and display the most severe phenotypes which may lead to severe acidosis, hyperammonemia and can lead to coma and death if left untreated (Merinero et al., 2008). Patients with the mut  subtype retain some enzyme activity perhaps explaining a milder clinical and biochemical phenotype (Merinero et al., 2008). Mut  patients have a less severe disease course than cblB patients.

Patients with cblB disorders have a neonatal onset with a significant risk of mortality and neurological complications (Horster et al., 2007) placing their disease course and long term outcome between the most severe mut o and the milder cblA phenotypes (Horster et al., 2007; Matsui et al., 1983).

Typically patients with cblA disorders have a milder presentation of MMA with a later age of onset but still within the first few months. Infants are at risk for a metabolic crisis in times of stress until the diagnosis is established and treatment

initiated. They have the best long term outcome perhaps due to the less severe symptoms and ability to respond to OHCbl supplementation.

The mildest presentation is seen in atypical MMA patients. Atypical MMA phenotypes can be as mild as increased urinary excretion of methylmalonate with only a slight risk of metabolic decompensation (Manoli & Venditti, 2011).

2.4 Vitamin B12 Responsiveness

In some cases, the risks and clinical effects associated with MMA can be lowered with treatment. Differences in response to treatment became evident very early when Oberholzer (Oberholzer, Levin, Burgess, & Young, 1967) and Stokke

(Stokke, Jellum, Eldjarn, & Schnitler, 1973) reported some patients responded to pharmacological doses of Cbl and others did not. In vivo response to parenteral

Cbl supplementation was evaluated by recording changes in urinary and serum methylmalonic acid levels for the different complementation groups (Matsui et al., 1983). Patients with the most common form of MMA, mut o and mut  have little or no response to treatment with OHCbl. The cblB patients show variable but low levels of vitamin B12 (Cbl) responsiveness, and patients with cblA disorders are the most responsive.

CHAPTER 3: The MMAB gene

3.1 Historical Overview

In the mid 1970’s two MMA phenotypes were distinguished: defects in the synthesis of AdoCbl alone, or defects in the synthesis of both AdoCbl and MeCbl.

Defects in the synthesis of AdoCbl were subsequently subdivided by the ability of cell extracts from wild type cells to rescue AdoCbl synthesis in broken cell assays which contained exogenous reducing agents. Those cells whose function could be rescued were given the cblA designation and those cells which remained defective were assigned to the cblB group (Mahoney, Hart, Steen, & Rosenberg, 1975). It was confirmed that fibroblast from cblB patients lacked ATR activity (Fenton &

Rosenberg, 1981).

3.2 Identification of gene responsible for cblB disorders

Identification of the causal gene resulted from a search for functional homologs in bacteria. CobA-type, EutT-type and PduO-type adenosyltransferases are specific to their bacterial genera (Roth, Lawrence, & Bobik, 1996). Recognizing that in bacteria, genes in the same metabolic pathway are frequently found in the same operon, human homologs to genes that clustered with MCM in bacterial operons were identified and evaluated for their ability to function as an adenosyltransferase. A gene was identified on chromosome 12 that was homologous to a Pdu-O type ATR (Dobson, Wai, Leclerc, Kadir, Narang, Lerner-

Ellis, … and Gravel, 2002b; Leal, Park, Kima, & Bobik, 2003). Northern blot

analysis revealed its product was expressed in both liver and muscle. Mutational analysis of this gene by heteroduplex analysis, DNA sequencing and restriction digest confirmed that mutations in this gene resulted in loss of ATR activity verifying the discovery of the MMAB gene (Dobson et al., 2002b). Corroborating evidence was obtained by screening a bovine liver cDNA expression library and identifying clones that complemented an ATR-deficient bacteria. Homologous human cDNA was identified and used to demonstrate that patients with cblB disorders show decreased expression of ATR when compared with normal individuals. (Leal et al., 2003).

3.3 Location and Structure

The structure and location of the MMAB gene was deduced by identifying human homologs as described above (Dobson et al., 2002b). A gene with nine exons was identified on chromosome 12q24 that encoded a 250 amino acid protein. The gene spans 18.87 kb and shares a promoter region with the mevalonate kinase

(MVK) gene. The gene product encodes ATP:cob(I)alamin adenosyltransferase, a protein that catalyzes the final step of AdoCbl biosynthesis. The monomeric gene product has 5 five helices ( 1 – 5) and interacts with two identical monomers folding into a homotrimeric structure through a combination of ionic and hydrophobic interactions. Identifying the location of highly conserved residues in a 3-D structure targeted the location of putative functional sites on monomer interfaces. Crystallization of a MMAB homolog, Thermoplasma acidophilum, a member of the bacterial PduO family, with 32% sequence identity, identified enzyme active sites at the interfaces where helices interact with adjacent

monomers (Saridakis, Yakunin, Xu, Anadakumar, Pennycooke, Gu, … and

Christendat, 2004). Crystallization of hATR with ATP bound, pointed to the position of binding sites at trimer interfaces and the presence of invariant residues adjacent to these ATP binding sites corroborated their hypothesized location

(Schubert & Hill, 2006). Examination of the ATP / hATR MMAB complex also revealed the reorganization of previously unstructured

N-terminus residues with the binding of ATP. The residues formed a structural cleft of the appropriate size and shape able to both bind ATP and also accommodate a Cbl sized molecule (Schubert & Hill, 2006).

3.4 Function of ATR Understanding how ATR’s two binding partners, ATP and Cbl, impact the intricate structure of ATR is vital to understanding the mechanism of hATR’s function(s). Three binding sites had been identified. Only two of the three active sites bind ATP, leaving the third binding site free (Schubert & Hill, 2006). When an ATP molecule binds to the third site, the AdoCbl bound to ATR is released from its cleft (Padovani & Banerjee, 2009), leaving AdoCbl free to bind to MCM.

AdoCbl is bound to ATR in a “base off” conformation increasing the reactivity of the Co+ and lowering the energy required to bind to ATR (Yamanishi et al.,

2005). Upon binding to MCM, AdoCbl is found in a “base off / His on” conformation. A histidine residue from MCM binds to the carbon of AdoCbl at the now unoccupied lower axial position. The presence or absence of different binding partners may be related to the dual functions of ATR (Lofgren &

Banerjee, 2011). In addition to converting the reduced form of Cbl into AdoCbl,

it is also hypothesized that the MMAB protein may also act as a chaperone ensuring AdoCbl’s delivery to its target, MCM (Yamanishi et al., 2005).

3.5 Spectrum of Variants

To date 25 variants have been reported in the literature and are depicted on the gene map below in Figure 5. Appendix I contains a list of 23 mutations and two common polymorphisms, c.56_57 GC>AA (p.R19Q) and c.716 T>A (p.M239K) that are currently documented in literature (Dobson et al., 2002b).

Figure 5 Summary of MMAB mutations and common polymorphisms

 Structural mutations at invariant residues 63,64,66 91,97,175,191,194,215  Cbl Binding region ATP Binding region

Location of 23 MMAB mutations and two common polymorphisms. The number of mutations per exon and putative functional role for each is indicated. Exon 7 has 12 mutations and nine SNPs clustered in the 65bp exon 7 that is part of the putative active site of the ATR enzyme (Lerner- Ellis et al., 2006).

The two most frequently occurring MMAB mutations are c.556 C>T and c.700

C>T. Both mutations are predicted to substantially affect protein structure and/or function by creating defects within the active ATP and Cbl binding sites. There is some correlation between certain variants in the MMAB active sites and the severity of the phenotype (Lerner-Ellis, Gradinger, Watkins, Tirone, Villeneuve,

Dobson, … and Rosenblatt, 2006). For example, the c.556 mutation, responsible for the R186W protein change, may affect Cbl binding by perturbing the invariant arginine nucleotide which projects into the Cbl binding cleft (Schubert & Hill,

2006). The location of the c.700 mutation in exon 9, results in a stop codon

(p.Q234X) and disrupts a loop between the two helixes at the location of the active cleft (Schubert & Hill, 2006).

3.6 Genotype / Phenotype correlation

No strong genotypic / phenotypic correlation has been described for the MMAB gene. However, the two most common mutations, c.556 C>T and c.700 C>T share similar clinical phenotypes. The age of onset is usually within the first year with a severe disease course (Lerner-Ellis et al., 2006). Interestingly, there seems to be little relationship between the in vitro findings and the in vivo clinical presentation for the c.700 nonsense mutation. The cultured fibroblasts from patients with this mutation show only a mild reduction in [14C]-propionate incorporation, with a moderate increase in the presence of OHCbl (Lerner-Ellis et al., 2006). This is rarely translated into an in vivo response with OH-Cbl supplementation. A second example of an inconsistency between in vitro and in

vivo responses is found with the splice site mutation, c.197-1 G>T. The c.197-

1G>T variant, which should seemingly produce a harsh phenotype, is associated with a milder late onset disorder (Lerner-Ellis et al., 2006). Splice site mutations are often leaky, creating the potential for variable expression which could help explain this result (Rogan, Faux, & Schneider, 1998). In addition, discrepencies between clinical presentation and in vitro results, suggest there are other factors affecting gene expression. Such factors could include: the influence of common polymorphisms; variants in the untranslated regions (UTR), introns or promoter regions; and epigentic modifications.

Complementation class serves as a better predictor of clinical phenotypes than a specific molecular change. Patients with mut0 and cblB defects have an earlier onset of symptoms, a higher frequency of complications and deaths, and a more pronounced urinary excretion of methylmalonic acid than those with mut− and cblA defects. In addition, long-term disease outcome was found to be dependent on the age cohort and Cbl responsiveness (Horster et al., 2007). In addition, mut0 and cblB patients have a higher frequency of morbidity, mortality, and neurological complications (Matsui et al., 1983).

CHAPTER 4: Mutation detection for cblB type disorders

4.1 Overview of screening methods

Direct sequence analysis has long been regarded as the gold standard in identifying gDNA variations. However, diagnostic sequence analysis of a heterogeneous group of genes or large number of patients can be expensive and time consuming. Classic electrophoretic techniques use physical differences in size, shape or charge between wild type and variant alleles to make a diagnosis.

Commonly used methods include: single strand conformation polymorphism

(SSCP), conformation sensitive gel electrophoresis (CSGE), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis and restriction site digests.

Each technique is capable of detecting allele heterogeneity and identifying pathogenic mutations but all share the disadvantage of requiring extensive sample manipulation during multi-step testing (Nollau & Wagener, 1997). Diagnostic techniques such as somatic cell testing have been used to provide a functional diagnosis for Cbl disorders of metabolism.

4.2 Screening by functional assays

Somatic cell studies are traditionally used to identify which gene(s) in the intracellular vitamin B12 pathway are defective (Gravel et al., 1975). The diagnostic protocol used in the Department of Medical Genetics at the McGill

University Health Center evaluates enzymatic function and the uptake of Cbl and its conversion into derivative forms as first tier testing for errors in intracellular

Cbl metabolism. The function of the two enzymes, MS and MCM, is evaluated by measuring the incorporation of the radio-labelled enzyme substrates,

[14C]-methyltetrahydrofolate and [14C]-propionate respectively, into high molecular weight cellular proteins (Fowler et al., 2008). The ability of the patient’s fibroblast to import Cbl is determined by measuring the uptake of [57 Co]

CN-Cbl. The imported Cbl is then extracted and purified to evaluate the cells’ ability to convert Cbl into the major derivative forms : MeCbl, AdoCbl, CNCbl and hydroxocobalamin (OHCbl). Other ligands that are detectable include: sulfite, glutathione and other thiols, nitrite and nitrate. (Hannibal, Axhemi, Gluschenko,

Moreira, Brasch, and Jacobsen, 2008).

Values which deviate from reference values for all three studies indicate which gene(s) may be defective. Complementation studies (see section 1.6) are indicated when the samples tested demonstrate deficient enzymatic biochemical finding.

However, after 35+ years of testing samples in the Vitamin B12 Laboratory in

Medical Genetics at the McGill University Health Center, approximately 355 cases with isolated MMA remain undiagnosed.

4.3 New advances in sequencing technology

Next generation sequencing platforms are able to sequence DNA faster and at a lower cost than Sanger sequencing. HRMA also shares these benefits, but is next generation sequencing as efficient as HRMA for diagnosing inborn error of cobalamin metabolism? Modern sequencing technologies can provide extensive quantities of data for molecular variants and even information related to their

function. This wealth of data may not be necessary to make a diagnosis and may unnecessarily slow down the analysis process. A practical screening assay for Cbl disorders may not need to provide information concerning all variants contained in each patient’s genome or even exome. A useful tradeoff may be a simple reduction in analysis time for a smaller, but adequate, amount of data and the ability to eliminate wild type amplicons from further testing.

4.4 High Resolution Melting Analysis

In contrast to other techniques, scanning HRMA offers a rapid and a processing reduced method to detect SNP’s and mutations. HRMA is used to identify variants located in any area of interest defined by the location of forward and reverse primers. In HRMA, the sample of interest is PCR amplified in the presence of an intercalating fluorescent reporter, and denatured on a high resolution instrument. Real time changes in fluorescence level are continuously recorded as the sample denatures through an increasing temperature range. The melting data generates a characteristic melting profile consisting of both a melting curve and a melting point (Tm ). The shape of the curve reflects melting behaviour along the entire length of the amplicon while the Tm is a single temperature point at which 50% of normalized fluorescence is recorded. The presence of sequence variations in DNA are identified by observing changes in a sample’s melting profile.

Unknown variants may be detected anywhere along the entire length of the amplicon of interest. The scanning assay is designed to scan all nucleotides, and differences are most easily observed by noting difference to the shape of the curve

compared to a reference sample(s). An assay designed to genotype a known variant examines a single, or limited number of nucleotide(s), and changes are most easily observed by noting shifts in the Tm. that are caused by the differing thermodynamic stabilities of the variable nucleotide. Genotyping may be achieved using several techniques including small amplicon, unlabeled probes, labelled probes and snapback primers. The method used is dependent on the information desired and the physical nature of the gene of interest. For example, small amplicon analysis may be difficult to analyze in highly polymorphic regions and an unlabeled probe can provide detailed data for the area under the probe.

Mutations that are homozygous may be more challenging to detect if changes in

Tm are small. Amplification of heterozygous samples results in the formation of three products, two homoduplexes (wild type and mutant) and heteroduplexes that are easily detected on melting. If the Tm difference between a homozygous wild type and homozygous mutant sample is small, the two curves may be impossible to distinguish. This can be circumvented by mixing the homozygous sample with known homozygous wild type DNA, and denaturing the mixture to allow for random re-naturation. If the sample being tested is wild type, no changes to the melting curve will be seen. If a sample is homozygous for the minor allele, random annealing after denaturation will allow four different parings of alleles to occur. Heteroduplex curves will be observed in addition to both homozygous wild type and mutant curves.

4.4.1 Simultaneous gene scanning and genotyping for common polymorphisms

Snapback primers which are illustrated in Figure 6 provide genotype data for a specific variant and scan the remainder of the amplicon for variants in the same reaction. Snapback primers incorporate a probe element directly onto the 5’ end of a standard primer circumventing potential technical issues associated with multiple primers. The probe element is an oligonucleotide that is complimentary to the immediate area (approximately a total of 16-20 nucleotides) surrounding the variant of interest. The snapback functions as both primer and probe. The 5’ primer tail, or probe portion, can fold or snap back, hybridizing to the 3’ extension production forming a loop structure on ssDNA. Both DNA loop structure and full length amplicon duplexes are formed (Zhou, Errigo, Lu, Poritz, Seipp, and

Wittwer, 2008). Melting of these products reveals both a low temperature peak(s) and a higher temperature peak(s). The lower temperature melting peak results from the shorter loop structure which genotypes the variant of interest. The high temperature peak provides scanning data for the longer length full amplicon.

4.4.2 HRMA Analysis

Data is collected by monitoring the denaturation of PCR amplified DNA in real time on the LightScanner® 96 (Idaho Technologies, Inc., Salt Lake City, UT).

Two analysis methods were used: a program provided by Idaho Technologies

Inc., the Light Scanner® Call-IT; and a method utilizing differences observed in

Figure 6 Simultaneous scanning and genotyping using a snapback primer

PROBE MELTING FULL AMPLICON MELTING Genotype Variant of Interest Scan Amplicon for Variants

Method 1. The sample is amplified in the presence of a snapback primer and an intercalating fluorescent dye 2. Full amplicon formation due to strong intermolecular binding 3. 8-10X Dilution, allows strengthening of intramolecular forces during denaturation and random annealing 4. A combination of hairpin loops (snapback primer) and full amplicon duplexes allows genotyping of the common polymorphism (the probe to melt at a lower temperature) and the full amplicon duplexes that will denature at higher temperatures

melting data after normalization and exponential background subtraction (Palais

& Wittwer, 2009). Both protocols normalize the data and generate a normalized

curve with fluorescent values between 0 and 100%. The data is further adjusted for temperature variations by aligning the high temperature regions of the normalized curves creating shifted melting curves. Superimposing the curves on each other emphasizes the differences in shape, allowing samples with small differences to be easier to visualize (see Appendix II for representative analysis results). The data can be further converted into a difference curve using the derivative. It tracks the rate of change and makes it quite easy to determine the

Tm (Palais, Liew, & Wittwer, 2005).

4.4.3 Interpretation of HRMA results

The goal of analysis of a scanning HRMA assay is to identify any samples that display changes in melting curve shape as compared to a wild type reference. If the melting curve agrees (clusters) with both the in silico predictions and clusters with the reference samples (i.e. the wild type cluster), the scan is negative. This indicates the absence of any variants, and no further testing is required. Positive samples display differences in comparison to the reference and need further investigation to determine if they are due to a benign, common or pathogenic variant.

4.5 Considerations in choosing a screening method

Of primary concern in choosing a clinical screening method is ability of the test to accurately identify both positive and negative results. Clinicians calculate the

sensitivity and specificity of an assay to evaluate the efficacy of diagnostic tests.

Sensitivity measures the probability that a person with the disease will be correctly identified by the test used and is calculated by dividing the total of true positive (TP) tests by the total number of tests, both TPs and false negatives (FN)

(Reed, Kent, & Wittwer, 2007).

An assay with high sensitivity can be used to rule out a disease when the patient has a negative result. Conversely, specificity is used to evaluate the certainty that a positive test result accurately translates to an affected patient. Specificity predicts the percentage of negative test results that are correctly identified. The calculation divides the number of true negative tests (TN) by the number of TNs plus false positives (FP). The calculated sensitivity and specificity of a newly developed assay should be compared to the sensitivity and specificity of the currently accepted gold standard to determine its efficacy.

In addition, an increasing number of samples are arriving at clinical laboratories as a result of expanded newborn screening programs. Current studies reveal that only approximately 1 of 50 are true positives (Kwon & Farrell, 2000). A pre- screening method to improve specificity would be both economical and prevent laboratories from becoming overburdened.

CHAPTER 5:

Rationale for evaluating HRMA as a cblB screening tool

Somatic cells studies have been used to evaluate more than 1,700 samples for Cbl related disorders at the Medical Genetics Laboratory of the Montreal General

Hospital. A total of 375 samples with MMA were successfully assigned to complementation groups. The complementation group distribution was: 245 of the samples were assigned to the mut complementation group, 74 to the cblA complementation group, 49 assigned to the cblB complementation group and five to cblD variant 2 as well one sample with mutations in MCEE. Approximately

474 samples with elevations in MMA alone or in combination with elevated homocysteine remain undiagnosed. Determining an exact number of undiagnosed samples with isolated MMA is not possible as the amount of clinical information for each referral is variable. There are approximately 355 samples with isolated

MMA (no mention of homocystinurua in the clinical notes on the referral form) that did not receive a diagnosis after testing with functional studies.

The index case for this study provides an example of an affected case which remained undiagnosed after somatic cell studies. A female infant, identified as having an abnormal newborn screen (NBS), began having generalized seizures at two months of age. She presented mild but persistent MMA, normal homocysteine, serum B12 and was non-responsive to vitamin B12 treatment.

Biochemical analysis determined that all test values were within the reference range, and the return of results stated that no inborn errors of Cbl had been

identified. Subsequently, through private communications with the physician, we learned that two heterozygous MMAB mutations had been identified: p.S133F

(c.398 C >T) and p.R191Q (c.572 T >C). A valid diagnostic approach had been followed and yet failed to reveal the underlying cause of this child’s MMA. This case highlights the benefits of evaluating alternate techniques to further interrogate samples with basal incorporation levels of [14C]-propionate that are too high to be diagnosed by complementation studies. The development of a fast and simple PCR-based assay with the ability to screen targeted genes of the vitamin B12 pathway for sequence variation could be of great benefit.

A HRMA scanning assay has the ability to provide fast, low cost test results with minimal sample manipulation. To date all nine exons and adjacent introns of 181 samples with unresolved MMA have been scanned using the experimental protocol outlined below. The goal of this project is to scan all archived samples

(approximately 355) with isolated MMA to determine if causal variants in the

MMAB gene can be identified.

5.1 Gene scanning to detect unidentified variants

Gene scanning would be able to identify any unknown variant located between the forward and reverse primers in all amplicons. The presence of a heterozygous variant could be easily detected due to changes in the shape of the curve compared to a reference wild type cluster. The extent of the deviation was determined by the nature of the specific mismatch. Detection of samples that were homozygous for the minor allele could be difficult if the Tm difference

between variants was small (< 0.5º C). All samples were mixed with an equivalent amount of PCR amplified wild type gDNA to ensure detection of all variants, as described in section 6.3.

5.2 Genotyping of common polymorphisms

Snapback primers were designed for exons 1 and 9 to genotype p.R19Q and p.M239K polymorphisms respectively. An assay ultizing snapback primers would be able to genotype non-pathogenic polymorphisms, such as p.R191Q and p.M239K eliminating unnecessary confirmation of their identity with sequencing.

The use of snapback primers will allow simultaneous scanning the full amplicon for unknown variants and genotyping, providing both sets of data in a single assay.

CHAPTER 6: Methods and Materials

The development of a clinical assay requires three phases: optimization; validation of the assay; and the testing of unknown samples.

6.1 Optimization

Optimization was conducted to identify a robust amplification program and ensure the absence of non-specific binding.

6.1.1 Assay design

Gene Annotation

A variety of databases were used to annotate all known variants, common polymorphisms and physical features that might affect amplification and analysis:

Exome Variant Server (Need, Shashi, Hitomi, Schoch, Shianna, MacDonald, … and Goldstein, 2012) (http://evs.gs.washington.edu/EVS/); UCSC database

(Kent, Sugnet, Furey, Roskin, Pringle, Zahler, and Haussler, 2002)

(http://genome.ucsc.edu/); the Single Nucleotide Polymorphism database (dbSNP)

(Sherry, Ward, Kholodov, Baker, Phan, Smigielski, and Sirotkin, 2001)

(http://www.ncbi.nlm.nih.gov/projects/SNP/) ;and Ensembl’s 1000 genome project (The1000 Genomes Project Consortium, 2010)

(http://www.1000genomes.org/).

Primer design

Light Scanner  Primer Design Software (version 1.0) was used to design two independent sets of primers (see Table 1). Primers were designed for all nine

exons including at least 15 adjacent intronic base pairs and generated PCR products that were less than 400bp (Reed et al., 2007). Designed primers were evaluated using OligoCalc software to minimize self complementation and homology (http://www.basic.northwestern.edu/biotools/oligocalc.html) (Kibbe,

2007). Simultaneous evaluation of multiple primer sets minimized the time required for optimization. In silico predictions using uMeltSM and uViewSM

(http://www.dna.utah.edu/#) (Dwight, Palais, & Wittwer, 2011) were used to predict number of melting domains, approximate Tm and the overall curve shape.

Deviations from the expected profile would indicate insufficient optimization.

Table 1: MMAB Primers for HRMA assay

Primers used in this study

Snap Exon Forward Primer Reverse Primer bp G/C 5’ 3’ 5’ 3’ back AAGCCTGCGCGGGTGCGGTGTTC 1** AACCTGGCGGGGTCAGGT 215 69% Yes GAGTTGCCCTT

2 CCCTCTGTGTAAGCCATCC TGTATGCCATGAGTATTTCTTT 161 46%

3 CAGAATCTTAATTTGGGTGGCT ACTGACTCAAACGCAAC 189 42%

4 AGGGACATTACATTACAGGCA AGCTTGGGTGAGATGGTGTTA 130 40%

5 TGTCCAGCCCATCTCACATA AACACCCACAGGAGTTTG 153 56%

6 CTCATGGCAGTTCCCTCT TGTGTCTGTCACTGAACCT 195 60%

7* GCTCCTGGAGGCAGAACA TCCTCTCCCTCTCCCTTG 144 65%

8 GTTGAGCCCCATAATGTCA GGCTTTCAGAGAGGAACCC 145 54%

TCAAATATACATGAAAAATGAGA 9 AGACCCAGTTAGCGTTGATC 166 49% Yes TCCTCCAAGCTCCCAC

*Needs addition of 5% DMSO ** Needs addition of 7.5% DMSO Primer pairs selected on the basis of optimization / Primers are HPLC purified

6.1.2 PCR optimization

Temperature gradient trials were conducted on a MJ Research PTC-200 thermocycler (Bio-Rad Laboratories Ltd. Mississauga, ON) using the reagents described in Table 2. An annealing temperature of 67o C was found to amplify all amplicons well using the amplification program described in Table 3. Two exons,

1 and 7 with G/C contents of 69% and 65% respectively, required the addition of dimethyl sulfoxide (DMSO) 7.5% for exon 1 and 5% for exon 7 to the PCR reaction in order to prevent non-specific binding. Non-specific binding in exon 3 was eliminated by lowering the primer concentration to 3.5M.

Table 2: PCR reagents

Reaction Mixture l l Reagent Master 4 2 2.5x Light Scanner Idaho Technologies Mix Forward 1 0.5 concentration range 3.5 -5 5M Primer Reverse 1 0.5 concentration range 3.5 -5 5M Primer H20 2 (1.25) 1 (0.625) (volume of H20 after DMSO (1.5) (0.75) adjustment) DMSO – 0.75 0.375 Exon 1 EXONS 0.5 0.25 Exon 7 1 & 7 only gDNA 2 1 Concentration of 25ng/l Total 10 5

Volumes are given for one reaction. To make master mix multiply volumes by the number of reactions being tested plus one. During testing of the unresolved MMA samples, a smaller reaction volume of 5l was tested and validated as a reagent saving measure.

Table 3 PCR amplification program

Amplification Program Temp. Time 1 cycle 95o C 3 min 40 cycles of Denature Anneal Extension 3 steps 95o C 15 sec 67o C 10 sec 76o C 10 sec 1 cycle 76o C 1 min Cool to 10o C

Shortened stages provide better specificity and decrease the time required for the assay

6.2 Cell line selection

Assay Validation

A set of archived gDNA from 42 patients diagnosed with cblB disorders were selected for use during validation (see section 7.2) and represented 20 of 23 mutations found in literature (see appendix I) . These samples were scanned to ensure assay optimization, identify any common polymorphisms that may affect analysis, and confirm that experimental melting curves were in agreement with in silico predictions.

Unknown samples

DNA samples from 181 patients with unresolved isolated MMA were chosen to be evaluated due to a basal level of propionate incorporation that was too high to allow complementation analysis. Genomic DNA for these lines was obtained from three sources: gDNA samples stored at -20C; or gDNA extracted from either cells stored at -80C or fresh fibroblast cultures using the Puregene Cell Kit

(Qiagen Inc., Toronto, Ontario). Fibroblast cell lines were obtained from the

Repository for Mutant Human Cell Strains of the Montreal Children’s Hospital

(http:// www. cellbank.mcgil.ca/).

6.2.1 DNA quality control and preparation

Experimental variation must be minimized in order to ensure that melting curve differences are the result of molecular variants alone (Perez et al., 2010). Quality assurance for each phase of assay development is described below.

Normal Reference samples

Reference samples, 96 UK Caucasian DNA, Human Random Control (HRC1), were purchased from Sigma-Aldrich Canada Ltd. (Oakville, Ontario)

Assay Validation samples – diagnosed cblB samples

Approximately 20% of archived samples from our lab were found to be functionally insufficient during the development of a previous HRMA assay in the laboratory of Dr. Carl Wittwer (Huang, personal communication, 2009). All cblB samples used during assay validation were whole genome amplified using the Illustra GenomiPhi HY DNA Amplification Kit (Product #25-660020, GE

Healthcare Waukesha, WI, USA) to ensure both adequate quantity and quality.

All 42 cblB samples were amplified and tested for quality by qPCR at Dr. Carl

Wittwer’s Laboratory (Department of Pathology/School of Medicine, University of Utah, Salt Lake City, UT, USA).

Unknown samples

Quantitative PCR was performed on the Rotor-Gene RG-3000 (Corbett,

San Francisco, California USA) and was used to evaluate DNA quality after long term storage. A standard curve was generated using five-fold dilutions of the housekeeping ERK1 gene ( Forward primer 5’GCGCTGGCTCACCCCTACCT3’ and reverse 5’GCCCCAGGGTGCCAGAGATGTC3’) and SYBR green (Life

Technologies, Inc., Carlsbad, California). The amplification program 95o C for 15 sec / 40 cycles (94o C for 15 sec / 65o C for 30 sec / 72o C for 30 sec) / 95o C for 1

o minute followed by melting from 72 - 95 C provided Ct value for all dilutions.

Testing each dilution in an HRMA assay demonstrated that function in an HRMA assay was lost between the 1/5 and 1/25 dilution. The Ct value of the 1 in 5 dilution for each assay was used as the baseline cut-off. Samples with a higher Ct value were reserved for whole genome amplification for later testing with samples of similar quality.

Stock sample plate preparation

Experimental variation among assays was reduced by preparing standard sample plates containing 50ng of 96 individual DNA samples in each well. In all cases the DNA concentration was adjusted to 25ng/l in TE’ buffer (10Mm Tris-HCl /

0.1mM EDTA pH 8.0) using the Nanodrop spectrophotometer ND1000 (Thermo

Scientific, Wilmington, DE, USA).

A multichannel pipette was used to dispense 2l of diluted gDNA into each well on a 96 well PCR Plate (Bio-Rad HSP9665 Bio-Rad Laboratories, Inc.

Hercules, CA, USA.). The plates were allowed to air dry overnight and stored in a sealed container at room temperature. One amplicon was tested per plate and enough plates were prepared to complete testing of all nine MMAB amplicons.

6.3 Assay protocol with mixing

A master mix was prepared for each amplicon using the primers listed in Table 1 and according to reagents outlined in Table 2. A volume of water equal to the

DNA volume listed was added to compensate for the volume that had been dried onto the stock plates. The reaction mixture per plate was 400 l Light Scanner

2.5x Master Mix (Idaho Technologies, Inc., Salt Lake City, UT, USA), 100 l forward primer, 100 l reverse primer and 400 l water. Each well on the stock plate received 10 l of master mix, was placed on a shaker for 5 minutes, protected from light and cooled with a freezer pack placed on top. Forty l of light mineral oil (8042-47-5 Fisher Scientific, Hamptom, NH,USA) was added to each well. The plate covered with an adhesive seal (95.1994 Starstedt AG & Co.,

Nümbrecht, Germany) and spun at 1,500g for 3 minutes before amplification.

After amplification (see program Table 3), the plate was centrifuged again and melted using the Light Scanner System 96 from Idaho Technologies, Inc. (Salt

Lake City, UT, USA) with a melting range at least 7 degrees below and 5 degrees above the predicted Tm. After an initial melting to identify any failed reactions, 5

l of each sample was mixed with a 5l of equivalent quantity of wild type DNA which had also been amplified using Light Scanner 2.5x Master Mix (Rivera,

Merinero, Martinez-Pardo, Arroyo,Ruiz-Sala, Bornstein, … and Martin, 2010).

The plate was centrifuged at 1,500g for 3 minutes and denatured at

97 oC for 3 minutes to allow random re-naturation before melting and subsequent analysis.

6.4 Protocol for genotyping with snapback primer

Amplicons 1 and 9 required additional processing to genotype the common variants using snapback primers.. Five l of the amplification product was transferred and mixed with 5 l wild type DNA as described above. The remaining 5l was diluted with water (1:8 for amplicon 1 and 1:10 for amplicon

9). The plate was centrifuged at 1,500g for 3 minutes and denatured at 97 o C for

3 minutes to allow random re-naturation before melting and subsequent analysis..

The melting range was extended (48-98o C) to capture data for the snapbacks which melt at a significantly lower temperature.

6.5 Analysis

Analysis was conducted using two methods. The LightScanner 96® has integral data analysis, Call-IT®. (Idaho Technologies Inc., Salt Lake City, UT, USA) A second method detected the presence of variants by observing a greater than 5% difference in comparison to a reference melting after normalization and exponential background subtraction (Palais & Wittwer, 2009) This analysis method also provided a useful quality score index to assess uniformity among reference samples. A quality score less than one was the standard acceptable

levels of sample and assay variation. This ensured that melting curve differences reflected the presence of variants during scanning analysis. Both methods were in agreement in identifying all variants. A range of  5% for samples after mixing was established as the acceptable deviation due to normal variation during training at the laboratory of Dr. Carl Wittwer (University of Utah, Salt Lake City,

UT, USA). Samples with a higher deviance were sent for confirmation.

6.6 Confirmation of results

HRMA is a non-destructive technique allowing for direct confirmation of assayed samples. All samples with a potential variant were sequenced at the McGill

University and Genome Quebec Innovation Center using Sanger Sequencing

Platform (Montreal, Canada). The location of the scanning primers used for

HRMA assays were too close to the intron / exon boundaries to allow sequencing of the complete exon. A second set of primers placed at least 60bp outside the intron/ exon boundary was used (Lerner-Ellis et al., 2006) to sequence amplicons in both directions.

CHAPTER 7: Results

7.1 Variant detection by HRMA analysis 7.1.1 Scanning of reference population

Analysis of the reference population, 96 UK Caucasian DNA samples, (Human

Random Control (HRC1) Sigma-Aldrich Canada Ltd., Oakville, Ontario) demonstrated that experimental melting profiles were in agreement with in silico predictions (Dwight et al., 2011) and formed tight clustering patterns confirming the assay’s ability to detect all changes to the melting profile.

Two variants, p.R19Q and p.M239K found in exons 1 and 9 of MMAB, provided a challenge for analysis due to the frequency of these two common polymorphisms. Since the assay will detect all variants, both pathogenic and benign, the assay may generate a high percentage of “false” positives causing time and money to be spent on unnecessary confirmations.

In evaluating the assay’s ability to genotype the first of these polymorphisms, p.R19Q (rs36013132) in exon 1, the pattern of clusters observed was suspicious due to the absence of a cluster containing samples homozygous for the minor allele (post mixing). The NHLBI Exome Sequencing Project (ESP) Exome

Variant Server cited a minor allele frequency (MAF) of 0.307 for the variant

(Need et al., 2012). Using the Hardy-Weinberg model, at least nine samples homozygous for the minor allele would have been expected in a cohort of 96 patients. In addition, when the samples from each cluster were tested, sequencing revealed that both wild type and heterozygous genotypes were found in both

clusters. The resolution of the current assay was insufficient to assign genotypes based on clustering patterns.

A small amplicon assay was designed in order to improve resolution (Liew, Pryor,

Palais, Meadows, Erali, Lyon and Wittwer, 2004). Shortening of the amplicon from 331bp to 109bp allowed accurate genotyping of p.R19Q, but clinically its use would be inefficient. Clinical diagnosis would require two separate assays: one to scan the entire amplicon and this second small amplicon assay to genotype the polymorphism.

A new approach, the use of snapback primers to provide simultaneous genotype data for known polymorphisms and full amplicon scanning for unknown variants

(Zhou et al., 2008) was tested. After designing the snapback primer for this amplicon, the assay was optimized in collaboration with the Dr. Carl Wittwer’s lab (Department of Pathology, University of Utah, UT, USA). Sequencing confirmed the samples’ genotypes were in agreement with the HRMA clustering patterns. Consequently, a second snapback primer was designed for the second common polymorphism, p.M239K, in exon 9 (rs9593). Once again sequencing also confirmed the accuracy of the clustering patterns observed. Use of the snapback primer assays was implemented for analysis of p.R19Q in exon 1 and p.M239K in exon 9.

7.2 Validation of the HRMA scanning assay for MMAB

A blinded study of 48 samples was conducted including 42 patients who had been assigned to the cblB group by complementation analysis plus three controls, one repeat sample and two patients of interest (see Table 4). Information on the

mutations was available for 37 samples which had received full Sanger sequencing with 36 patients having at least two mutations identified, and only a single mutation was discovered in the 37th (WG1680) (Lerner-Ellis et al., 2006).

The five additional cblB samples were tested by restriction digest for three common mutations (c.556 C>T, c.700 C>T and c.567_571dup CCGCC). A genotypically matched sibling (WG2488) was substituted for the original sample

(WG2487) due to mycoplasm contamination. Additional samples included a repeat sample that had receivied a separate ID, three controls and finally two samples of interest. WG1997 appeared to complement some cblA lines, but the correction was suspect as it occurred both with and without fusion of the cells.

This sample was later diagnosed to have compund heterozygous samples in

Table 4 Samples tested for assay validation

A summary of samples used for validation of the MMAB HRMA assay. 42 of 48 samples had been diagnosed by complementation. Six additional samples included: two patients of interest, one duplicate sample and three controls.

SUCLA2 by exome sequencing. WG4138, the second patient of interest, remains undiagnosed.

Data was analyzed after scanning using the protocol described in chapter 6.5. A more stringent approach was taken during validation and all samples deviating more then 3% (not 5%) from reference sample s, both before and after mixing with wild type DNA were sent for validation by sequencing.

The results confirmed that 33 of 36 cblB samp les had been correctly identified as containing the known variants in the appropriate exon by HRMA. Investigation revealed that clerical errors were responsible for the three erroneous results. An unclear label caused an incorrect sample to be tested for WG1586, and the remaining two errors were due to a sample switch between WG2345 and

WG2350. A new extraction of gDNA from these three stored samples was tested and confirmed the suspected errors had transpired. The new samples provided the

Table 5 Variants identified during assay validation

Previously Identified as a result Identified as a result identified by of HRMA of HRMA Restriction Enzyme WG1680 c.700 C>T p.Q234X c.571 C>T (p.R191W) WG3430 -- c.569 G>A (p.R190H) WG3574 c.556 C>T p.R186W WG3826 -- c.291-1 G>A c.571 C>T (p.R191W) WG3979 c.556 C>T p.R186W c.12 C>A (p.C4X) WG4070 -- c.291-1 G>A

Six cblB patients had none or a single variant identified. Six previously undetected mutations were discovered as a result of HRMA

correct results for all three samples resulting in 42 of 42 known samples from cblB patients being correctly identified and validating the assay for the detection of variants in the MMAB gene (see Appendix III). Only three of twelve mutations had been identified by restriction endonuclease (RE) analysis in the rema ining six samples (fi ve patients recently identified by complementation and WG1680 from the above study). Six additional mu tations were discovered using HRMA and are listed in Table 5. All patients had at least a single mutation identified (three with two mutations identified and three with one mutation discover ed). No mutations were identified in either the two patients of interest or the three control samples

(see Appendix III). Of note was the identification of a novel sequence variant, c.12 C>A (p.C4X) in WG3979. The patient was discovered on newborn screening and had no pertinent clinical manifestations. Follow-up testing revealed an unusual biochemical phenotype for this patient, given the absence of a clinical phenotype. Testing revealed low AdoCbl synthesis, a slight decrease in [14C]- propionate incorporation, and a brisk response to OHCbl. In conclusion, variants in all 43 patient samples (42 +1 repeat) were correctly detected, indicating HRMA is well suited for clinical use.

7.2.1 Amplicons with a large number of variants

Analysis of exons 7 and 9 was difficult due to the large number of variants in these two exons for this cohort of affected cblB patients. Exon 7 contains the most common MMAB mutation, c.556 C>T (p.R186W), and an additional 11 mutations plus nine SNP’s have been reported in the literature. For this cohort, 29

of the 48 samples contained variants in exon 7. All samples with variants were easily distinguishable from the wild type cluster consisting of 19 samples, and consequently would have been sent for confirmation by sequencing. Exon 9 contains the 2nd most common mutation, c.700 C>T (p.Q234X), as well as the common polymorphism, p.M239K, and 2 additional mutations. Variants were identified in 25 of 43 (42 +1 repeat) cblB samples in exon 9. Nine of these 43 samples had variants different than p.M239K. All variants in exon 9 were distinguishable from the wild type cluster.

After unblinding the study, samples identified as having possible variants in exons

7 and 9 by HRMA were compared to known mutations. If the test result and record were in agreement, the sample was considered to be a true positive. The

Table 6 Sensitivity and Specificity of Assay

Exon Sensitivity Specificity False + False - + 1 100% 100% 0 0 2 100% 100% 0 0 3 100% 97.6% 1 0 4 100% 97.6% 1 0 5 100% 100% 0 0 6 100% 97.8% 1 0

*7 100% 100% 0 0 8 100% 100% 0 0 + * 9 100% 100% 0 0 Overall 100% > 99% 3 0 * Samples with variants clustered separately from wild type + Use of snapback primer to genotype polymorphism and scan

Three samples were identified as possible variants and were shown to be false positives after sequencing resulting in an overall sensitivity of 100% and specificity > 99%.

observed change in the melting profile would have indicated a positive result, and the sample would have been sequenced to confirm and identify the variant. All samples were in a greement fo r these two exon s. Positive samples in the remaining exons (1,2,3,4,5,6 and 8) were sent for sequenc ing as conf irmation, making it possib le to calculat e the sensitivity a nd specificity for each exon (see

Table 6).

7.2.2 Distribution of mutations

Eighty-three of 86 alleles in 43 samples (42 + 1 repeat) from patients with the cblB disorders were found to contain a mutation in the MMAB gene as summarized in Table 7. The mutations represent 21 individual mutations types.

The most common mutations were missense mutations and included c.556 C>T at

30.2% (26/86) and c.700 C>T at 11.6% (10/36). In total 54.7% (47/86) were missense mutations, 12.8% (11/86) were nonsense mutations, 19.8% (17/86) were

Table 7 Distribution of mutation type

Types of Mutations # of types % of total alleles

Missense variants 11 54.7 Nonsense 2 12.8 Splice Site 3 19.8 Duplication 1 9.3 Insertion 2 Deletions 2 Undiagnosed n/a 3.4

21 individual mutations types have been identified by HRMA

splice site mutations, 9.3% (8/86) were deletions, insertions and duplications, and

3.4% (3/86) remain undiscovered.

7.3 Scanning of Undiagnosed MMA samples

All nine exons of the MMAB gene were scanned for variants in 181 different isolated MMA patients using the HRMA assay. Two patients (1.1% of total) were found to contain two mutations in the MMAB gene. A single heterozygous mutation was d iscovered in four additiona l patients (2.2% of total). Results for all patients are found in Appendix IV. Results for the eight variants discovered in all six patients represent five different missense changes and are listed in Table 8.

Table 8 Variants identified in patients with unresolved MMA

1st Mutation 2nd Mutation Ethnicity

WG3948 c.572 G>A R191Q c.398 C>T S133F White

WG4034 c.572 G>A R191Q c.394 T>C C132R White

None None WG3546 c.572 G>A R191Q Detected Detected White

WG4090 c.572 G>A R191Q None None White Detected Detected None None African WG4029 c.185 C>T T62M Detected Detected American None None Asiatic WG3759 c.521 C>T S174L Detected Detected Indian

A total of five exonic missense variants were identified in six patients identifying two compound heterozygous patients not previously detected.

Four o f six clinically affected patients share a common mutation in exon 7, c.572 G>A (p.R191Q), and all are described as white. Two of the four patients have had a second variant identified (see Table 9), while the other two remain with only a single variant identified (see Table 10).

The two patients with a single variant are not described as white and had variants different from p.R191Q identified. A patient summary and characterization of variants will fo llow in section 7.3.1 and 7.3.2.

7.3.1 A summary of the two patients with compound heterozygous variants

Clincial Summary

WG3948

Patient WG3948 is a white female infant who was identified as a result of an abnormal newborn screen. Persistent seizures began at one to two months of age.

The following workup revealed a mild but persistent MMA which did not resolve after a vitamin B12 injection, and had normal homocysteine levels. Her serum

MMA level was 1391pg/ml (normal 200 -1,100 pg/ml) and serum vitamin B12 was 470 pg/ml (normal range for a newborn 60 - 1300 pg/ml). Somatic cell studies showed that incorporation of propionate and methylTHF were within normal limits, making complementation analysis infeasible. Cbl uptake was above the reference range, but is suspected to be a result of erroneous cell counts.

No inborn errors of Cbl could be diagnosed. Scanning by HRMA revealed two

Table 9 A summary of MMA patients with compound heterozygous MMAB mutation

WG3948 WG4034 Average value for cblB 1st Mutation R191Q R191Q

2nd Mutation S133F C132R Ethnicity White White Age of onset 2 months 13 month [14C] propionate 14.6  14 12.2  12.6 1.3  2.0 -OHCbl  +OHCbl nmoles / mg protein / 18hr 14 [ C] MethylTHF 379  697 320  385 190  370 -OHCbl  +OHCbl nmoles / mg protein / 18hr Synthesis of AdoCbl adequate adequate

Synthesis of MeCbl adequate adequate [57Co] CNCbl in PG 60.8 8.2 10.3 ± 4.7 PG / 106 cells

B12 Distribution

7.2 2.6 8.35 3.9 OHCbl ±

CNCbl 23.4 21.1 11.27 ± 6.9 AdoCbl 11.1 10.8 15.29 ± 4. 2 MeCbl 56.3 63.2 61.6 ± 6.7 Others 2 2.3 7.18 ± 2.7

A summary of somatic cell test re sults performed by Maria Galv ez, Jocelyn Lavallé and Dr. David Watkins in the Medical Genetics Laboratory at the Montreal General Hospital. Tests are described in section 4.2.

Values for [14C]-propionate and [14C]-MethylTHF are presented as without OHCbl supplementation With OHCbl supplementation to evaluate if exogenous Cbl can rescue fibrobl ast function.

Table 10 A summary of MMA patients with one heterozygous MMAB mutation

Avg cblB WG3546 WG4090 WG4029 WG3759 Values 1st Mutation R191Q R191Q T62M S174L Other Variant(s) R19Q M239K I96I M239K homozygous homozygous R19Q heterozygous polymorphism polymorphism heterozygous African Ethnicity White White East Indian American Age of onset 2 months ? Tested 1yr 3 months [14C] propionate 13.5  16 -OHCbl  +OHCbl 7.4  8 6.7  6.6 16.5  17.6 1.3  2.0 nmoles / mg protein / 16.3 17.6 [18h14C] MTHFR -OHCbl  +OHCbl 194  324 320  385 383  600 168  406 190  370 pmoles / mg protein / [57Co] CnCbl 6 10.3 ± 4.7 PG / 10 cells 19.5 8.2 5.4 3.4 Synthesis of AdoCbl adequate adequate adequate lower Synthesis of MeCbl adequate adequate adequate adequate Control B12 Distribution Values 8.35 3.9 OHCbl 5.6 1.4 1.4 4.7 ± 11.27 ± 6.9 CNCbl 6.3 15.7 15.4 9.2 15.29 ± 4.2 AdoCbl 12.2 7.6 11.4 12 and 3 64.4 66.3 66 61.6 61.6 ± 6.7 MeCbl 7.18 ± 2.7 Others 11.5 9 5.8 21.5

A summary of somatic cell test results performed by M aria Galvez, Jocelyn Lavallé and Dr. David Watkins in the Medical Genetics Lab oratory at the Montrea l General Hospital. Tests are described in section 4.2.

Values for [14C]-propionate and [14C]-MethylTHF are presented as without OHCbl supplement ation With OHCbl suppl ementation

variants. The first, p.R191Q, was present in exon 7, a putative active site, and has been described in the literature as one of several substitutions at this position.

The second, p.S133F, was identified in exon 5 and has not been described in the literature.

WG4034

Patient WG4034 is a white female, who was the only child of her healthy biological mother and an anonymous sperm donor. Seizures began at approximately six months and are controllable with medication, but break through with fevers. The clinical information notes “moderate” MMA as well as “mild

Homocystinuria”. She has a variant of unknown significance in a seemingly unrelated sodium channel gene, SCNN1A, and a synonymous homozygous variant in the MMACHC gene. Follow-up at three and a half years revealed developmental delay but normal growth. Findings of somatic cell studies were all within the reference range. HRMA scanning revealed two variants including a p.R191Q substitution in exon 7 and a p.C132R substitution in exon 7, which has not been described in the literature.

Characterization of variants identified

R191Q

The missense change, p.R191Q is found at an invariant arginine residue. There are multiple substitutions at this location which is involved with interactions between trimer interfaces (Schubert & Hill, 2006). Although the frequency of the

R191Q variant is unknown, the discovery of a heterozygous variant in four of 181 patients with isolated MMA (2% of samples) suggests that this variant may be significant. The levels of [14C]-propionate incorporation in patients containing the variant lies midway between the low mean levels found in cblB affected patients and those levels found in normal controls.

Functional studies have been conducted in Thermoplasma acidophilum (TA1434) to study the affects of protein changes at this location (Saridakis et al., 2004). The p.R191W (c.571 C>T) substitution had reduced stability compared to wild type samples demonstrating an approximately 70% reduction in activity (Zhang,

Dobson, Wu, Lerner-Ellis, Rosenblatt and Gravel, 2006). The location of this amino acid may be key in determining pathogenicity as it projects into the central cavity of the trimeric structure and is involved with trimer interactions through hydrogen bounding (Jorge-Finnigan et al., 2010). While these studies were conducted on mutant proteins for the p.R191W variant (Jorge-Finnigan et al.,

2010), any observations based on the location of the variants could be pertinent to the p.R191Q (c.572 G>A) substitution as well. Any significant amino acid changes at this position could affect enzyme activity by disrupting overall stability of the trimer caused by disruptions to the physical interactions among subunits. It is also worth noting that all four patients with the p.R191Q mutation are ethnically described as white.

S133F

The conservation at this position reveals that the amino acid is highly conserved and mutational prediction software indicates a p.S133F substitution would be

damaging (Adzhubei, Schmidt, Peshkin, Ramensky, Gerasimova, Bork, … and

Sunyaev, 2010). The p.S133F substitution changes a nucleophilic amino acid, serine, to an aromatic amino acid, phenylalanine. This variant is located in the same set of ordered residues as another documented pathogenic substitution, p.A135T (Dobson et al., 2002b) (Manoli & Venditti, 2011). Similar to p.A135T, this variant is found in combination with a heterozygous mutation at an invariant arginine residue, (R191Q) in this sample.

C132R

The p.C132R substitution is predicted to be a benign variant by several prediction software programs (Adzhubei et al., 2010; Li, Krishnan, Mort, Xin, Kamati,

Cooper, … and Radivojac, 2009; Ng & Henikoff, 2001) even though it is immediately adjacent to the “damaging” substituion, p.S133F, and also found in same set of ordered residues as the previously described p.A135T. While the p.C132R amino acid is non-conserved (Kent et al., 2002), the nearby p.A135T amino acid is also a non-conserved position and was considered to be pathogenic

(Dobson et al., 2002b; Schubert & Hill, 2006). The amino acid substitution results in a significant amino change. It replaces a nucleophilic cysteine amino acid to arginine, a basic amino, and eliminates a very reactive sulfhydrl group during the process. The strongest indication that this variant should be further evaluated for pathogenicity is the observation that was found in a clinically affected patient in whom only one known causal mutation for a cblB disorder was identified.

7.3.2 A summary of the four patients with a single heterozygous variant

Clincial Summary

WG3546

Patient WG3546 presented with acute seizures at two months of age and was treated for gastroduodnum reflux at three months of age. She was born to healthy non-consanguineous parents with no family history of metabolic disorders, and has a healthy sibling. The referral form describes her ethnicity as white but also notes a Spanish / Italian heritage. MMA levels of 172 and 300 ng/ml in blood were reduced to 27 ng/ml after OHCbl injections. The results from somatic cell results were all within the normal range (see Table 10) preventing complementation studies. HRMA scanning revealed variants in exons 1 and 7.

Sequencing confirmed the variants to be the p.R191Q mutation in exon 7.and a homozygous substitution for the common polymorphism p.R19Q in exon 1.

WG3759

Patient WG3759 presented with developmental delay, hypotonia and a history of seizures. He is East Indian, has an unaffected sister and non-consanguineous parents with a healthy family history. He had normal serum vitamin B12 and homocysteine, but a “mild” elevation in MMA. Somatic cell testing was repeated due to a questionable result for synthesis of AdoCbl, but on repeat it was found to be in the control range (see Table 10). No inborn error of metabolism was detected. HRMA scanning revealed variants in exons 7 and 9. Sequencing

confirmed the presence of a novel variant p.S174L in exon 7, an active site of the

MMAB gene, and a heterozygous polymorphism in exon 9, p.M239K.

WG4029

Patient WG4029 was a one year old African American female being evaluated for an elevation in glutaric acid. Clinical notes indicate she is developmentally delayed, has a heart murmur and maculopathy. Results from somatic cell testing were all within the reference range (see Table 10) and consequently no inborn error of Cbl metabolism could be diagnosed. Scanning with HRMA revealed three variants, a novel missense change in exon 2, p.T62M, and a synonymous change, p.I96I both in exon 2 as well as a heterozygous variant for the common polymorphism, p.19Q, in exon 1.

WG4090

Patient WG4090 is a white female, unique to this cohort due to her age of 28 years. Her mother died at the early age of 36, and she also has a deceased brother.

She has bilateral hearing loss and a “low” vitamin B12 level with a slight response to supplementation. All somatic cell studies were within the normal range and no diagnosis could be provided. Scanning HRMA revealed two variants. A missense mutation, p.191Q, in exon 7 that is predicted to be pathogenic, and a homozygous variant for the common polymorphism, p.M239K, in exon 9.

Characterization of variants identified

T62M

The novel variant p.T62M is immediately adjacent to two amino acids, p.G63 and p.D64, known to play a structural role in trimer formation. The amino acid change replaces a small nucleophilic amino acid with a sulfur containing hydrophobic residue. The T62M change is located at a highly conserved position and is predicted to be probably damaging using in silico software prediction.

The p.T62M substitution is found in conjunction with an I96I synonymous variant located in the 1 helix. A non-synonymous substitution at this amino acid position, p.I96T, is found to disrupt the stability of the structure and binding of the substrates without affecting trimer structure (Jorge-Finnigan, Aguado, Sanchez-

Alcudia, Abia, Richard, Merinero, … and Perez, 2010). While it would not be expected that the synonymous substitution would have an impact, the I96I substitution has been observed in four of 181 samples.

S174L

The S174L missense variant changes the nucleophilic amino acid serine to leucine a hydrophobic amino acid. The change occurs near the enzyme active site and may affect enzyme function. This is the fourth example of a missense substitution in this small group of five variants (others p.C132R, p.S133F and p.

T62M) which eliminates a nucleophilic amino acid. There are several enzymatic mechanisms by which catalysis proceeds. Covalent catalysis requires the presence of a nucleophile in the active site, which facilitates the reaction by transiently binding to the substrate. The S174L substitution creates the loss of a

hydroxo group, which can serve as a nucleophile in enzyme active sites, and may impact the catalytic ability of the enzyme.

7.3.3 Detection of additional variants

HRMA will detect any variant located between the forward and reverse primers.

The sensitivity (100%) and specificity (>99%) demonstrated during the validation phase of development (see Table 6) indicates that all variants present in the exonic regions and splice site regions should have been detected.

A summary of eight additional variants, considered to be non-pathogenic was identified during the course of this study (three exonic and five intronic) and is presented in Table 11. Of the eight variants found, five have been documented in the dbSNP database (Sherry et al., 2001), but no information was available on the remaining three. The two common variants, p.R19Q and p.M239K, are described as normal allelic variants (Manoli & Venditti, 2011). No reports were found in the literature to suggest the p.I96I synonymous variant was pathogenic. All intronic variants are well outside the splice area and are likely to be benign.

The majority, 87.3% of samples (158/181), contain at least one variant (see

Appendix IV). The most frequently observed variants are the result of two common polymorphisms c.716 T>A (p.M239K) and c.56_57 GC>AA (p.R19Q).

The p.M239K polymorphism, (rs9353) was found in 153 of 181 samples (84.5%) with the distribution being 15.6% wild type, 56.6% heterozygous and 27.8 % homozygous for the minor allele. The p.R19Q polymorphism (rs10774775 and rs10774774 / combined rs36013132) was found in 93 of 181 samples (51.4%)

Table 11 Detection of Non-causal variants

ID# # of samples Variant Location Expected frequency identified Type Exonic 74 Heterozygous c.56_57 GC>AA rs10774774 Exon 1 p.R19Q (MAF 0.307) 16 Homozygous Missense Minor Allele rs62000414 c.288 T>C 4 Exon 3 (MAF 0.30) p.I96I Synonymous rs9593 102 Heterozygous c.716 T>A Exon 9 (MAF 0.402) p.M239K 50 Homozygous Missense Minor Allele Intronic

c.1-17 T>C 1 rs66580225 c.135-24 T> C 14 IVS1 (MAF 0.0521) c.349 -17 T>C 5 IVS4

c.584+24 A>G 28 Heterozygous IVS 7 rs78599682 4 Homozygous (MAF 0.048) IVS 7 Minor allele

IVS8-173 G>A 1 IVS8

Detection of intronic variants outside the splice sites regions (± 15bp) were incidental findings based on primer placement.

with a distributi on of 50% wild type, 41.1% hete rozygous and 8.9% homozygous for the minor allele.

7.4 High Resolution Melting Analysis (HRMA) as a clinical tool

Scanning HRMA for patients with isolated MMA has proven to be a valuable tool in the identification of mutations in atypical cblB patients. It ha s been

demonstrated that the current diagnostic protocol at the Medical Genetics

Laboratory (MUHC) using somatic cell studies has been unable to identify two patients with isolated MMA. While these functional somatic cell studies are able to diagnose patients with severe reductions in the level of propionate incorporation, there are limitations in evaluating patients who present with less severe phenotypes. In addition, somatic cell studies require time consuming protocols involving multiple manipulations. In contrast, HRMA was able to correctly and efficiently identify all known mutations previously reported in our laboratory and also identify a total of eight additional variants in six patients with isolated MMA. These variants are either documented in the literature to be pathogenic (p.R191Q and S174L) or predicted to be pathogenic for the reasons discussed in sections 7.3.1 and 7.3.2.

The design of an HRMA scanning assay for MMAB required extensive optimization, but once validated, the assay is able to quickly and inexpensively identify sequence variants with minimal sample manipulation. After gDNA is extracted, a scanning HRMA assay for each amplicon can be run and analyzed within a single working day. MMAB has multiple exons that may be amplified under common conditions, which allows amplicons to be run concurrently and further reduces the time required to evaluate the entire gene. Variant confirmation has been conducted by Sanger sequencing to date, requiring a total turn around time projection of 10 – 14 days for testing and confirmation. Diagnosis by a private sequencing based diagnostic lab, GeneDx, Inc. (Gaithersburgh, MD, USA)

quotes a turn around time of four weeks to complete their sequence based approach.

As an added benefit to the diagnostic process, HRMA effectively pre-screens all samples and identifies exons containing variants. Exons without variants do not need additional evaluation allowing the focus to be directed to positive samples.

With the increased number of samples arriving at diagnostic labs due to positive newborn screening results, both time and cost saving are critical to prevent overburdening diagnostic laboratories.

The ability of the assay to detect both heterozygous and homozygous mutations was well documented through the validation of the assay with our previously characterized cblB samples. All previously identified mutations in the cblB patients were detected in addition to the identification of four new potentially pathogenic mutations

Sensitivity and specificity can only be calculated when the patient’s disease state is already known. In general, a more useful clinical measure is the predictive power of the assay, which evaluates the ability of the test to accurately predict disease state. Predictive value depends on the sensitivity and specificity as well as the frequency of the disease in the population. The positive predictive value

(probability that a positive test indicates a true disease state) decreases when the prevalence of the disease in the population is low (Moran, Rivera, Sanchez-

Arago, Blazquez, Merinero, Ugalde, … and Martin, 2010) and may not be useful when discussing HRMA.

CHAPTER 8: Discussion

The spectrum of variants in the MMAB gene was investigated in 181 patients with unresolved isolated MMA using HRMA. HRMA is a technique based on detecting the differences between the physical properties of molecular variants.

Functionally based somatic cell studies were not possible because the fibroblasts from these patients demonstrated a basal level of [14C]-propionate incorporation that was too high to allow for complementation analysis. Consequently, these patients were not able to receive a diagnosis for possible intracellular errors of Cbl metabolism. During HRMA, two samples with an atypical presentation of the cblB type disorder were detected, and an additional four samples containing single heterozygous mutations were identified.

8.1 Molecular findings of HRMA Positive Results

Of the 181 isolated MMA patients tested, six (3.3%) were identified to have known mutations or potentially pathogenic variants in the MMAB gene (see Table

9 and 10). In addition, two common polymorphisms, one synonymous variant and five intronic variants were identified (see Table 11) resulting in 158 of 181 samples (87.3%) containing at least one variant detected by HRMA scanning.

8.1.1 Characterization of exonic variants

In total eight exonic variants were discovered in six individual samples from patients with clinical isolated MMA phenotypes.. The five missense variants

were evaluated for pathogenicity using mutation prediction software (Adzhubei et al., 2010) and conservation of the variant nucleotide (Kent et al., 2002). The results are summarized in Table 12. An additional three variants were detected including: two normal allelic variants, p.R19Q and p.M239K, (minor allele frequencies (MAF) of 0.301 and 0.402 respectively) (Manoli & Venditti, 2011), and a third synonymous variant was found in exon 3, p.I96I.

Table 12 Pathogenicity of exonic variants identified by HRMA

 of Polyphen Prediction Ethnicity Conservation Patients Score

R191Q 4 White Probably damaging Highly 1.0 conserved

C132R 1 White Benign Conserved to 0.001 opossum S133F 1 White Probably damaging Highly 0.949 Conserved African Probably Damaging Highly T62M 1 American 1.0 conserved S174L 1 Asiatic Probably Damaging Highly Indian 1.0 conserved

Five different exonic variants were identified in six patients with isolated MMA. p.R191Q was found in four of six patients all described as white. Four of five we re predicted t o be pathogenic and were highly conserved.

While functional assays would be needed to confirm their impact on function, the missense changes listed above are predicted to disrupt biochemical activity of the

MMAB protein. The nature of all five amino acid substitutions was significant and their location in the 3D structure of the trimeric protein is consistent with a deleterious impact to the function of the ge ne prod uct. Operating from the

premise that clinical phenotypes for Mendelian disorders are related to the pathogenicity of variants identified, these amino acid substitutions may all be considered as playing a possible casual role for the patients isolated MMA.

HRMA was able to identify compound heterozygous mutations in two patients, but only a single mutation was identified by HRMA in the remaining four. These four patients present a biochemical phenotype consistent with isolated MMA yet only one of two mutations had been identified for this recessively inherited group of Cbl disorders. Similar examples in which only a single heterozygous mutation has been identified in patients with isolated MMA have been demonstrated for other genes in the vitamin B12 pathway namely MUT (Worgan et al., 2006) and

MCEE (Gradinger et al., 2007).

8.1.2 Functional characterization of atypical cblB patients

Somatic cell data for the six samples containing the putative missense mutations discussed above has been summarized in Tables 9 and 10. The data from the

[14C]-propionate incorporation assay and Cbl distribution study which provides an indirect measure of AdoCbl synthesis could be useful in determining if samples with a specific phenotype would benefit from diagnosis by HRMA. A graph of the data for all six samples in comparison to the MUHC historical cblB reference range is found in Figure 7.

Figure 7 [14C]-Propionate Incorporation of atypical cblB’s me po n prot es / m Nm lgei g ol

In vitro [14C]-propionate incorporation of fibroblasts from six atypical cblB’s patients were compared to mean values for cblB (bold line with the shaded box indicating a ± 2 SD range n=41) A normal reference range is indicated by controls at the far right of the graph. *Means and SD’s compiled by Dr. David Watkins

The mean [14C]-propionate incorporation value for 41 known cblB patients

diagnosed by complementation analysis was determined to be 1.3 ± 1.1

nmoles/mg of protein without OHCbl supplementation rising to 2.0 ± 2.0

nmoles/mg of protein with OHCbl supplementation. The mean

[14C]-propionate incorporation for the six atypical samples was 12.3 rising to

12.7 with OHCbl supplementation. This places the mean level of propionate

incorporation well above the accepted value of two standard deviations for

determining significance. In fact, the mean for the six atypical cblB samples fell

within ± 2 SD’s of the normal controls making them indistinguishable from

normal patients on the basis of [14C]-propionate incorporation. Figure 7

demonstrates why patients with atypical cblB disorders were not able to be

identified by complementation analysis.

Figure 8 Cobalamin distribution of atypical cblB samples fT l Cobalamin % of To ta

Cbl distributions provide an indirect measure of AdoCbl synthesis The bold line indicates the mean value of cblB fibroblasts for each Cbl derivative form with the shaded box indicating a ± 2 SD range.

Historic means and SD’s compiled from control fibroblast cell lines by Dr. David Watkins, Medical Genetics Laboratory, Montreal General Hospital

The synthesis of AqCbl, CNCbl and MeCbl for the six atypical cblB patients are all within ± 2SD’s of the cblB mean value (see Figure 8). However, the synthesis of AdoCbl lies between the mean percentage (3.1 ± 2.4%) for known cblB patients and the mean percentage for control fibroblast lines (15.3 ± 4.2 %). The mean of AdoCbl synthesis compared to total Cbl for all six atypical cblB samples

was 9.35%. While both compound heterozygous patients (WG3928 and

WG4034) have a level of AdoCbl synthesis that was closer to the cblB cohort, the four patients with a single variant did have a significantly higher level of synthesis. Figure 8 indicates that AdoCbl synthesis in atypical cblB fibroblasts is significantly higher than AdoCbl synthesis of classic cblB patients. This question arises: does an in vitro responsiveness to OHCbl translate into less severe in vivo clinical phenotypes for atypical cblB patients?

Functional studies evaluating MMAB expression would be needed to confirm these observations that were based on only a small number of samples. Once verified, the observation that [14C]-propionate incorporation and AdoCbl synthesis is significantly higher in atypical cblB patients could provide a convenient metric to determine when HRMA of cblB patients is a more efficacious diagnostic technique than complementation analysis.

8.2 Presentation of a clinical phenotype with a single MMAB variant

Four of five variants identified in Table 8 are predicted to be damaging and are likely responsible for the clinical phenotypes seen in isolated MMA patients as discussed in sections 7.3.1 and 7.3.2, outlined in Table 12 and demonstrated using somatic cell studies in section 8.1.2. The fifth variant, p.C132R, could also be pathogenic given its location and significant amino acid change. However, four of the six samples identified by HRMA contain only single mutations and fall short of the accepted standard requiring two identified mutations to diagnose a

recessive disorder. In order to resolve this inconsistency, it is logical to consider that second variant affecting gene expression is located in a non-exonic location outside of the regions scanned. Gene expression can be affected by: variants located in non-protein coding regions including elements that regulate transcription or intronic variants that induce alternative splicing. Alternative splicing is post-transcriptional event that influences gene expression by creating additional mRNA isoforms. Alternate isoforms can regulate gene expression by changing the intronic or exonic sequences that are then translated into modified protein products. Changes can affect protein function, activity or interactions or create truncated proteins due to premature stop codons. In the absence of a second undetected variant, there maybe additional modifiers that could be responsible for influencing the clinical phenotype including: synergistic heterozygosity, modulating polymorphisms, epigenetic modifications, or structural features related to functional features of the MMAB gene product.

Synergistic Heterozygosity

The concept of synergistic heterozygosity suggests that the mutations discovered in MMAB may work in cooperation with mutations with another gene in the vitamin B12 pathway to regulate gene expression (Vockley, P, Bennett, Matern, &

Vladutiu, 2000). If synergy among genes was responsible for the clinical phenotypes found, the MUT and/or MMAA genes(s) are the two most likely candidates to be functional partners. The same 181 samples with unresolved

MMA tested in this study were also scanned in a separate project for MMAA variants. Only a single heterozygous variant was found in one of 181 samples and

no MMAB variants were identified in that same sample indicating there is no synergy with MMAA. These samples have not yet been screened for MUT.

While the MMAB common polymorphisms, p.R19Q and p.M239K, are not considered to pathogenic by themselves (Manoli & Venditti, 2011), it is interesting to consider that they may have a synergistic role.

Modulating polymorphisms

Three SNPs, all considered to be non-pathogenic, were identified in these six samples, two non-synonymous common polymorphisms, p.R19Q and p.M239K and a synonymous p.I96I variant. The p.I96I variant should not affect activity and will not be discussed here except to note that another substitution at this residue p.I96T results in misfolding of the protein (Jorge-Finnigan et al., 2010), indicating that any change at this position could impact function.

Of higher probability is the consideration that either or both of the common polymorphisms could impact gene expression. A synergistic role has been demonstrated for a polymorphism in another gene associated with an inborn error of Cbl metabolism, MSR. The function of this gene is affected by the combined presence of a mutation and polymorphism. This opens the door for discussion that p.M239K could similarly affect the expression of MMAB. At least one of two common polymorphisms in the MSR product, p.I22M and p.S175L (with frequencies of 0.51 and 0.61 respectively) impact the expression of a rare pathogenic mutation, c.166G>A (p.V56M) (Gherasim, Rosenblatt, & Banerjee,

2007). The circumstances are similar to those associated with p.M239K in

MMAB, where both variants were demonstrated to be physiologically equivalent

in their ability to synthesise AdoCbl in vivo (Leal et al., 2003). The MSR study demonstrated that both variants of the p.V56M mutation had kinetic properties that were also physiologically in the reference range. However, when the p.V56M mutation was present on an allele containing the common polymorphism, p.I22M, MSR activity was reduced four to seven fold due to a proposed weakening in interactions between MSR and MS products (Gherasim et al.,

2007). Functional assays monitoring the expression of MCM containing pathogenic mutations, with and without the presence of the p.M239K variant, would be needed to determine if the polymorphism may impact enzyme function.

Initial observations indicated the frequency of both MMAB polymorphisms was noticeably higher in the cohort of 181 isolated MMA patients than the reference group. Unsuccessful attempts were made to calculate a “p” value from the genotype data provided by the use of the snapback primers. The data was skewed by the use a Caucasian reference population and our reliance on sporadic reports of ethnic background in clinical reports. Better controls would be needed before a determination could be made.

Epigenetic modifications

The p.R19Q polymorphism is both located in the mitochondrial leader sequence

(Magrane, 2011: available from http://www.uniprot.org/uniprot/Q96EY8) and contained in a large CpG island covering exon 1 (Kent et al., 2002). A mutation in this region could have the ability to reduce gene expression if a disruption in the leader sequence reduces the amount of Cbl imported into the mitochondria.

Also worth considering is that the presence of a variant could allow increased

levels of methylation to occur. DNA methylation, a well known epigenetic modification, frequently occurs in the cytosines found in CpG island such as the one noted at the 5’ end of the MMAB gene. The ability of methylation to reduce gene expression was demonstrated to affect both the uptake of Cbl and MCM function for another gene, MMACHC, required for the intracellular conversion of

Cbl into both AdoCbl and MeCbl (Loewy, Niles, Anastasio, Watkins, Lavoie,

Lerner-Ellis, … and Rosenblatt, 2009). Epigenetic changes could also affect the p.M239K polymorphism and be responsible for gene suppression at the protein level. While several post translational epigenetic changes are possible, arginine and lysine residues are known to be susceptible to protein methylation which in turn reduces enzyme activity (Smith & Denu, 2009) The p.M239K substitution may be a benign change at the molecular level, but it is worth considering its functional impact on the MMAB protein. Assays to evaluate the methylation status of both polymorphisms in affected patients would be useful in determining they affect function.

Structural features

Unique structural features of the MMAB gene may also allow a single heterozygous variant to contribute to a disease phenotype. The characterization of the p.191Q, p.T62M and p.S174L variants indicate that these variants are pathogenic, and they have been identified as a heterozygous variant in clinically affected patients. It is possible that a single pathogenic allele may interfere with the function of a separate wild type allele especially if the functional gene product needs to form a multimer to ensure normal function. The MMAB gene product

functions as a trimer creating active sites between the interfaces of the interacting monomer subunits. A mutation in one subunit could impact overall function. In patients with a single heterozygous mutation, one half of the alleles will be affected. Since there are three subunits in the final gene product, the effect is magnified three-fold ( ½ x ½ x ½ ). The cumulative result is that only 1/8 of the total trimers contain three wild type monomers. If the enzyme function were reliant on a monomeric protein product, a 50% ( ½ X) reduction of enzyme activity would be insufficient to create a clinical phenotype. However the enzyme function associated with a trimeric gene product such as MMAB would be projected to have a 12.5% ( 1/8 ) of the total enzyme activity increasing the probability it would be pathogenic.

The identification of MMAB variants in patients who remained undiagnosed after somatic cell studies, demonstrates the usefulness of HRMA as a clinical technique. Investigation of the variants identified may also provide a clearer understanding of intracellular errors of cobalamin metabolism.

Summary and Conclusion

The spectrum of variants in the MMAB gene was investigated in 181 patients with unresolved isolated MMA by HRMA. HRMA detected exonic variants in a total of six samples. Compound heterozygous variants were identified in two of six samples. The p.R191Q missense change, shared by both patients, is known to be pathogenic. The second variant in each patient results in a significant amino acid

change, is located at an active site and is likely to be causal. Samples from the remaining four clinically affected patients contained single variants that were predicted to be pathogenic. This suggests the existence of additional molecular defects in MMAB gene outside the coding region or non-molecular factors that contribute to the cblB disease state.

An infrequent but distinct atypical cblB class of intracellular disorders of cobalamin metabolism has been identified and can be detected using HRMA.

The HRMA technique is well suited to provide fast and accurate clinical results.

A scanning HRMA assay allows the concurrent analysis of a large number of samples concurrently making it possible to uncover unrecognized molecular patterns that may add to the understanding of metabolic disease mechanisms.

APPENDIX I

SPECTRUM OF KNOWN MUTATION ANDS PUTATIVE FUNCTIONS

Protein Function Variant change Mitochondrial leader sequence c.56_57delGCinsAA p.R19Q c.197-1G>T c.287T>C (Martínez) p.I96T Improper slicing affects the last base of exon 3 p.G97E c.290 G>A+ Invariant residue – disrupt 3/4 loop in active site c.291-1G>A* p.I117_Q118 c. 349-1 G>C $ del c.403G>A * p.A135T Non-conserved c.454 G>T p. E152X Replace conserved residues in region of active site p.S174L c.521 C>T+ Invariant residue – disrupt 3/4 loop in active site Replace conserved residues in region of active site c.539C>G+ p.S180W Nonconserved by Schubert Invariant arginine residue in putative active site c.556C>T * p. R186W No interaction with ATP but cobalamin? Invariant arginine residue in putative active site c.557 G>A p.R186Q No interaction with ATP but cobalamin? c.558_559 del GGinsC Pospisilova c.563_577 dupTGTGC Insertion of 5 amino acids within the active site p186_190dup CGCCGGGCCG+ c.567_571 Truncated protein lacking part of the putative enzyme p.R191PfsX25 dupCCGCC+ active site Invariant arginine residue in putative active site c.568C>T * p.R190C Forms H bonds with ATP Invariant arginine residue in putative active site c.569G>A* p.R190H Forms H bonds with ATP c.571C>T * p.R191W Invariant residue affecting trimer interface c.572G>A * p.R191Q Invariant arginine residue in putative active site c.575 G>A p.E193K Invariant residue – Hydrogen bonds c.585-2 A>C+ Alternate splicing at beginning of exon 8 c.656A>G * p.Y219C Nonconseved c.656_659 del + p. Y219fsX4 Stop codon creates instability of truncated protein p.Q234X c.700C>T * Invariant residue – disrupt 3/4 loop in active site c.716T>A* p.M239K

References for further information on mutations * (Manoli & Venditti, 2011)  (C. M. Dobson et al., 2002) + (Lerner-Ellis et al., 2006)  (Schubert & Hill, 2006)

APPENDIX II

REPRESENTATIVE MELTING EXPERIMENT

EXON 5 MMAB UNKNOWN SAMPLES

WG3948 Index case for study c.398 C>T p.S133F

Melting Curves

Difference Curves

WG4086 / WG4010 WG4034 nd Intronic Variant 2 Compound Heterozygous Patient c.349-17 T>C c.394 T>C / p.C132R

Analys is using Light Scanner® Call-IT software (Idaho Technolog ies, Inc.)

Top pane - Raw data is presented as melting c urve. Bottom pane – The derivative curve is plotted after background fluorescence was subtracted and raw data normalized. The grey cluster contains 91 wild type sample s. Also present are t wo samples containing intronic variants (red cluster), one sample with a p.S133F missense change tested in duplicate (blue sample) and one sample with a p.C132R m issense change (green sample).

APPENDIX III

Results for Assay Validation (cblB know ns)

WG # Identified Identified by HRMA by HRMA Notes 1st Mutation 2nd Mutation Polymorphisms p.R19Q p.M239K Patients with 2 mutations identified Homozygous 117 √ c.700 C>T √ c.700 C>T HOM 1185 √ c.556 C>T √ c.556 C>T 1493 √ c.556 C>T √ c.556 C>T 1586 c.556 C>T c.556 C>T het Clerical Error 1641 √ c.700 C>T √ c.700 C>T HOM 1771 √ c.556 C>T √ c.556 C>T 1792 √ c.556 C>T √ c.556 C>T 2147 √ c.577 ins 9 √ c.577 ins 9 2186 √ c.556 C>T √ c.556 C>T HOM 2235 c.521 C>T c.521 C>T het 2350 c.291-1 G>A c.291-1 G>A HOM Sample Switch 2816 √ c.197-1 G>T √ c.197-1 G>T 2846 √ c.556 C>T √ c.556 C>T 3117 √ c.556 C>T √ c.556 C>T 3176 √ c.197-1 G>T √ c.197-1 G>T 3224 √ C.571 INS 4 √ C.571 INS 4 3230 √ c.585-2 A>C √ c.585-2 A>C HOM 3274 √ c.557 G>A √ c.557 G>A 3293 √ c.197-1 G>T √ c.197-1 G>T 3296 √ C.569 G>A √ C.569 G>A het 3522 √ C.563_77 √ C.563_77 HOM Compound Heterozygous 1879 √ C.569 G>A √ c.556 C>T het het 2027 √ c.291-1 G>A √ c.556 C>T 2127 √ C.654_7 del 3 √ c.700 C>T het 2268 √ c.585-2 A>C √ c.556 C>T het Sample Switch 2345 c.700 C>T c.556 C>T het HOM √ c.403 G>A 2488 √ c.571 C>T √ c.656 G>A het HOM Sibling of 2487 2492 √ c.571 C>T √ c.700 C>T √ c.403 G>A 2523 √ c.197-1 G>T √ c.557 G>A het het 2545 √ c.290 G>A √ c.394 C>T het het 2633 √ C.572_6 del6 c.556 C>T 2776 √ c.700 C>T √ c.556 C>T het 2779 √ c.572 G>A √ c.556 C>T het het 2980 √ c.539 C>G √ c.568 C>T 3185 √ c.290 G>A √ c.568 C>T het 3332 √ c.291-1 G>A √ c.700 C>T het Patient with 1 mutation identified 1680 √ c.700 C>T √ c.571 C >T het HOM 3574 c.556 C>T none het het 3979 √ c.556 C>T √ c.12 C>A p.C4X het het Patients with NO mutations identified 3430 c.569 G >A none 3826 c.291-1 G>A c.571 C >T 4070 c.291-1 G>A none het het Repeat Sample 3982 √ c.291-1 G>A √ c.556 C>T =WG2027 Patients of Interest 1997 none none 4138 none none het Controls 24 none none het het 39 none none 64 none none none Distribution of √ Indicates HRMA identified known mutation Polymorphisms cates previously undiscovered muta 30 WT 19 WT 12 het 15 het 0 HOM 8 HOM

APPENDIX IV

Variants identified in unresolved MMA Patients (1 of 3)

Variants identified in unresolved MMA Patients (2 of 3)

Variants identified in unresolved MMA Patients (3 of 3)

100

LIST OF REFERENCES

Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., . . . Sunyaev, S. R. (2010). A method and server for predicting damaging missense mutations. Nat Methods, 7(4), 248-249. doi: 10.1038/nmeth0410-248 Banerjee, R., (1999). Methylmalonyl Co-A mutase. In R. Banerjee (Ed.), Chemistry and Biochemistry of B12 (pp. 707 -729). New York: John Wiley and Sons, Inc. Bobik, T. A., & Rasche, M. E. (2004). Purification and partial characterization of the Pyrococcus horikoshii methylmalonyl-CoA epimerase. Appl Microbiol Biotechnol, 63(6), 682-685. doi: 10.1007/s00253-003-1474-5 Carrillo-Carrasco, N., Chandler, R. J., & Venditti, C. P. (2012). Combined methylmalonic acidemia and homocystinuria, cblC type. I. Clinical presentations, diagnosis and management. J Inherit Metab Dis, 35(1), 91-102. doi: 10.1007/s10545-011-9364-y Carrozzo, R., Piemonte, F., Tessa, A., Lucioli, S., Rizza, T., Meschini, M. C., . . . Santorelli, F. M. (2007). Infantile mitochondrial disorders. Biosci Rep, 27(1-3), 105-112. doi: 10.1007/s10540-007-9039-y Chandler, R. J., Zerfas, P. M., Shanske, S., Sloan, J., Hoffmann, V., DiMauro, S., & Venditti, C. P. (2009). Mitochondrial dysfunction in mut methylmalonic acidemia. FASEB J, 23(4), 1252-1261. doi: 10.1096/fj.08-121848 Cosson, M. A., Benoist, J. F., Touati, G., Dechaux, M., Royer, N., Grandin, L., . . . de Lonlay, P. (2009). Long-term outcome in methylmalonic aciduria: a series of 30 French patients. Mol Genet Metab, 97(3), 172-178. doi: 10.1016/j.ymgme.2009.03.006 Dobson, C. M., Wai, T., Leclerc, D., Wilson, A., Wu, X., Dore, C., . . . Gravel, R. A. (2002a). Identification of the gene resposible for the cblA complementation groups of vitamin B12-responsive methylmaloinc acidemia beased on the analysis of prokaryotic gene arrangements. Proceedings of the National Acadmeny of Sciences US, 99(24), 15554-15559. Dobson, C. M., Wai, T., Leclerc, D., Kadir, H., Narang, M., Lerner-Ellis, J. P., . . . Gravel, R. A. (2002b). Identification of the gene responsible for the cblB complementation group of vitamin B12-dependent methylmalonic aciduria. Hum Mol Genet, 11(26), 3361-3369. Duane, W. C., Levitt, D. G., Mueller, S. M., & Behrens, J. C. (1983). Regulation of bile acid synthesis in man. Presence of a diurnal rhythm. J Clin Invest, 72(6), 1930- 1936. doi: 10.1172/jci111157 Durand, P., Prost, M., Loreau, N., Lussier-Cacan, S., & Blache, D. (2001). Impaired homocysteine metabolism and atherothrombotic disease. Lab Invest, 81(5), 645- 672. Dwight, Z., Pala is, R., & Wittwer, C. T. (2011). uMELT: prediction of high-resolution melting curves and dynamic melting profiles of PCR products in a rich web application. Bioinformatics, 27(7), 1019-1020. doi: 10.1093/bioinformatics/btr065

101

Fenton, W. A., & Rosenberg, L. E. (1981). The defect in the cblB class of human methylmalonic acidemia: deficiency of cob(I)alamin adenosyltransferase activity in extracts of cultured fibroblasts. Biochem Biophys Res Commun, 98(1), 283-289. Fons, C., Sempere, A., Sanmarti, F. X., Arias, A., Poo, P., Pineda, M., . . . Campistol, J. (2009). Epilepsy spectrum in cerebral creatine transporter deficiency. Epilepsia, 50(9), 2168-2170. doi: 10.1111/j.1528-1167.2009.02142.x Fowler, B., Leonard, J. V., & Baumgartner, M. R. (2008). Causes of and diagnostic approach to methylmalonic acidurias. J Inherit Metab Dis, 31(3), 350-360. doi: 10.1007/s10545-008-0839-4 Froese, D. S., & Gravel, R. A. (2010). Genetic disorders of vitamin B12 metabolism: eight complementation groups--eight genes. Expert Rev Mol Med, 12, e37. doi: 10.1017/s1462399410001651 Froese, D. S., Krojer, T., Wu, X., Shrestha, R., Kiyani, W., von Delft, F., . . . Yue, W. W. (2012). Structure of MMACHC reveals an arginine-rich pocket and a domain- swapped dimer for its B12 processing function. Biochemistry. doi: 10.1021/bi300150y Gherasim, C., Rosenblatt, D. S., & Banerjee, R. (2007). Polymorphic background of methionine synthase reductase modulates the phenotype of a disease-causing mutation. Hum Mutat, 28(10), 1028-1033. doi: 10.1002/humu.20563 Gradinger, A., Belair, C., Worgan, L., Li, C. D., Lavallee, J., Roquis, D., . . . Rosenblatt, D. S. (Producer). (2007). Atypical Methylmalonic Aciduria: Frequency of Mutations in the Methylmalonyl CoA Epimerase Gene (MCEE). Mutation in Brief. Gravel, R. A., Mahoney, M. J., Ruddle, F. H., & Rosenberg, L. E. (1975). Genetic complementation in heterokaryons of human fibroblasts defective in cobalamin metabolism. Proceedings of the National Acadmeny of Sciences USA, 72(8), 3181-3185. Gulati, S., Baker, P., Li, Y. N., Fowler, B., Kruger, W., Brody, L. C., & Banerjee, R. (1996). Defects in human methionine synthase in cblG patients. Hum Mol Genet, 5(12), 1859-1865. Hannibal, L., Axhemi, A., Glushchenko, A. V., Moreira, E. S., Brasch, N. E., & Jacobsen, D. W. (2008). Accurate assessment and identification of naturally occurring cellular cobalamins. Clin Chem Lab Med, 46(12), 1739-1746. doi: 10.1515/cclm.2008.356 Hoffbrand, A. V., & Jackson, B. F. (1993). Correction of the DNA synthesis defect in vitamin B12 deficiency by tetrahydrofolate: evidence in favour of the methyl- folate trap hypothesis as the cause of megaloblastic anaemia in vitamin B12 deficiency. Br J Haematol, 83(4), 643-647. Hogenkamp, H. P. C. (1999). B12: 1948-1998 In R. Banerjee (Ed.), Chemistry and Biochemistry of B12 (pp. 3-8). New York: John Wiley and Sons, Inc. Horster, F., Baumgartner, M. R., Viardot, C., Suormala, T., Burgard, P., Fowler, B., . . . Baumgartner, E. R. (2007). Long-term outcome in methylmalonic acidurias is influenced by the underlying defect (mut0, mut-, cblA, cblB). Pediatr Res, 62(2), 225-230. doi: 10.1203/PDR.0b013e3180a0325f Huang, Q., August 2009). [Assistant Professor Xiamen Univerity].

102

Jorge-Finnigan, A., Aguado, C., Sanchez-Alcudia, R., Abia, D., Richard, E., Merinero, B., . . . Perez, B. (2010). Functional and structural analysis of five mutations identified in methylmalonic aciduria cblB type. [Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't]. Hum Mutat, 31(9), 1033-1042. doi: 10.1002/humu.21307 Kent, W. J., Sugnet, C. W., Furey, T. S., Roskin, K. M., Pringle, T. H., Zahler, A. M., & Haussler, D. (2002). The human genome browser at UCSC. Genome Res, 12(6), 996-1006. doi: 10.1101/gr.229102. Article published online before print in May 2002 Kibbe, W. A. (2007). OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res, 35(Web Server issue), W43-46. doi: 10.1093/nar/gkm234 Kim, J., Gherasim, C., & Banerjee, R. (2008). Decyanation of vitamin B12 by a trafficking chaperone. Proc Natl Acad Sci U S A, 105(38), 14551-14554. doi: 0805989105 [pii] 10.1073/pnas.0805989105 Kim, J., Hannibal, L., Gherasim, C., Jacobsen, D. W., & Banerjee, R. (2009). A human vitamin B12 trafficking protein uses glutathione transferase activity for processing alkylcobalamins. J Biol Chem, 284(48), 33418-33424. doi: 10.1074/jbc.M109.057877 Kim, J. C., Coelho, D., Miousse, I., Fung, S., Moulin, M. d., Buers, I., . . . Rosenlatt, D. S. (2011). Novel inborn error pf vitamin B12 metabolism caused by mutations in ABCD4. Paper presented at the 12th International Congress of Human Genetics, Montreal, Quebec. Kwon, C., & Farrell, P. M. (2000). The magnitude and challenge of false-positive newborn screening test results. Arch Pediatr Adolesc Med, 154(7), 714-718. Leal, N. A., Park, S. D., Kima, P. E., & Bobik, T. A. (2003). Identification of the human and bovine ATP:Cob(I)alamin adenosyltransferase cDNAs based on complementation of a bacterial mutant. J Biol Chem, 278(11), 9227-9234. doi: 10.1074/jbc.M212739200 Leclerc, D., Campeau, E., Goyette, P., Adjalla, C. E., Christensen, B., Ross, M., . . . Gravel, R. A. (1996). Human methionine synthase: cDNA cloning and identification of mutations in patients of the cblG complementation group of folate/cobalamin disorders. Hum Mol Genet, 5(12), 1867-1874. doi: 6w0265 [pii] Leclerc, D., Wilson, A., Dumas, R., Gafuik, C., Song, D., Watkins, D., . . . Gravel, R. A. (1998). Cloning and mapping of a cDNA for methionine synthase reductase, a flavoprotein defective in patients with homocystinuria. Proc Natl Acad Sci U S A, 95(6), 3059-3064. Lerner-Ellis, J. P., Anastasio, N., Liu, J., Coelho, D., Suormala, T., Stucki, M., . . . Fowler, B. (2009). Spectrum of mutations in MMACHC, allelic expression, and evidence for genotype-phenotype correlations. Hum Mutat, 30(7), 1072-1081. doi: 10.1002/humu.21001 Lerner-Ellis, J. P., Gradinger, A. B., Watkins, D., Tirone, J. C., Villeneuve, A., Dobson, C. M., . . . Rosenblatt, D. S. (2006). Mutation and biochemical analysis of patients belonging to the cblB complementation class of vitamin B12-dependent

103

methylmalonic aciduria. Mol Genet Metab, 87(3), 219-225. doi: 10.1016/j.ymgme.2005.11.011 Li, B., Krishnan, V. G., Mort, M. E., Xin, F., Kamati, K. K., Cooper, D. N., . . . Radivojac, P. (2009). Automated inference of molecular mechanisms of disease from amino acid substitutions. Bioinformatics, 25(21), 2744-2750. doi: 10.1093/bioinformatics/btp528 Li, Y. N., Gulati, S., Baker, P. J., Brody, L. C., Banerjee, R., & Kruger, W. D. (1996). Cloning, mapping and RNA analysis of the human methionine synthase gene. Hum Mol Genet, 5(12), 1851-1858. Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., & Wittwer, C. (2004). Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin Chem, 50(7), 1156-1164. doi: 10.1373/clinchem.2004.032136 Loewy, A. D., Niles, K. M., Anastasio, N., Watkins, D., Lavoie, J., Lerner-Ellis, J. P., . . . Rosenblatt, D. S. (2009). Epigenetic modification of the gene for the vitamin B12 chaperone MMACHC can result in increased tumorigenicity and methionine dependence. Mol Genet Metab, 96(4), 261-267. doi: 10.1016/j.ymgme.2008.12.011 Lofgren, M., & Banerjee, R. (2011). Loss of allostery and coenzyme B12 delivery by a pathogenic mutation in adenosyltransferase. Biochemistry, 50(25), 5790-5798. doi: 10.1021/bi2006306 Mahoney, M. J., Hart, A. C., Steen, V. D., & Rosenberg, L. E. (1975). Methylmalonicacidemia: biochemical heterogeneity in defects of 5'-deoxyadenosylcobalamin synthesis. Proc Natl Acad Sci U S A, 72(7), 2799- 2803. Manoli, I., & Venditti, C. P. (2011). Methylmalonic Acidemia. In R. A. Pagon, T. D. Bird, C. R. Dolan & K. Stephens (Eds.), GeneReviews. Seattle WA: University of Washington, Seattle. Magrane, M., Uniprot Consortium. (2011). Uniprot Knowledgebase: a hub of integrated protein knowledge. Database, Vol 2011, Article bar009, doi:10.1093/database/bar009. Matsui, S. M., Mahoney, M. J., & Rosenberg, L. E. (1983). The natural history of the inherited methylmalonic acidemias. N Engl J Med, 308(15), 857-861. doi: 10.1056/nejm198304143081501 Merinero, B., Perez, B., Perez-Cerda, C., Rincon, A., Desviat, L. R., Martinez, M. A., . . . Ugarte, M. (2008). Methylmalonic acidaemia: examination of genotype and biochemical data in 32 patients belonging to mut, cblA or cblB complementation group. J Inherit Metab Dis, 31(1), 55-66. doi: 10.1007/s10545-007-0667-y Moran, M., Rivera, H., Sanchez-Arago, M., Blazquez, A., Merinero, B., Ugalde, C., . . . Martin, M. A. (2010). Mitochondrial bioenergetics and dynamics interplay in complex I-deficient fibroblasts. Biochim Biophys Acta, 1802(5), 443-453. doi: 10.1016/j.bbadis.2010.02.001 Morkbak, A. L., Poulsen, S. S., & Nexo, E. (2007). Haptocorrin in humans. Clin Chem Lab Med, 45(12), 1751-1759. doi: 10.1515/cclm.2007.343

104

Navarro-Sastre, A., Tort, F., Stehling, O., Uzarska, M. A., Arranz, J. A., Del Toro, M., ... Lill, R. (2011). A fatal mitochondrial disease is associated with defective NFU1 function in the maturation of a subset of mitochondrial Fe-S proteins. Am J Hum Genet, 89(5), 656-667. doi: 10.1016/j.ajhg.2011.10.005 Need, A. C., Shashi, V., Hitomi, Y., Schoch, K., Shianna, K. V., McDonald, M. T., . . . Goldstein, D. B. (2012). Clinical application of exome sequencing in undiagnosed genetic conditions. J Med Genet. doi: 10.1136/jmedgenet-2012-100819 Ng, P. C., & Henikoff, S. (2001). Predicting deleterious amino acid substitutions. Genome Res, 11(5), 863-874. doi: 10.1101/gr.176601 Nicolaides, P., Leonard, J., & Surtees, R. (1998). Neurological outcome of methylmalonic acidaemia. Arch Dis Child, 78(6), 508-512. Nollau, P., & Wagener, C. (1997). Methods for detection of point mutations: performance and quality assessment. IFCC Scientific Division, Committee on Molecular Biology Techniques. Clin Chem, 43(7), 1114-1128. Oberholzer, V. G., Levin, B., Burgess, E. A., & Young, W. F. (1967). Methylmalonic aciduria. An inborn error of metabolism leading to chronic metabolic acidosis. Arch Dis Child, 42(225), 492-504. Okuda, K. (1999). Discovery of vitamin B12 in the liver and its absorption factor in the stomach: a historical review. J Gastroenterol Hepatol, 14(4), 301-308. Ostergaard, E. (1993). SUCLA2-Related Mitochondrial DNA Depletion Syndrome, Encephalomyopathic Form, with Mild Methylmalonic Aciduria. In R. A. Pagon, T. D. Bird, C. R. Dolan, K. Stephens & M. P. Adam (Eds.), GeneReviews. Seattle WA: University of Washington, Seattle. Padovani, D., & Banerjee, R. (2009). A rotary mechanism for coenzyme B12 synthesis by adenosyltransferase. Biochemistry, 48(23), 5350-5357. doi: 10.1021/bi900454s Padovani, D., Labunska, T., Palfey, B. A., Ballou, D. P., & Banerjee, R. (2008). Adenosyltransferase tailors and delivers coenzyme B12. Nat Chem Biol, 4(3), 194- 196. doi: 10.1038/nchembio.67 Palais, R., & Wittwer, C. T. (2009). Mathematical algorithms for high-resolution DNA melting analysis. Methods Enzymol, 454, 323-343. doi: 10.1016/s0076- 6879(08)03813-5 Palais, R. A., Liew, M. A., & Wittwer, C. T. (2005). Quantitative heteroduplex analysis for single nucleotide polymorhpism genotyping. Analytical Biochemistry, 346(1), 167-175. Perez, B., Angaroni, C., Sanchez-Alcudia, R., Merinero, B., Perez-Cerda, C., Specola, N., . . . Ugarte, M. (2010). The molecular landscape of propionic acidemia and methylmalonic aciduria in Latin America. J Inherit Metab Dis, 33(Suppl 2), S307-314. doi: 10.1007/s10545-010-9116-4 Perez-Duenas, B., Sempere, A., Campistol, J., Alonso-Colmenero, I., Diez, M., Gonzalez, V., . . . Artuch, R. (2011). Novel features in the evolution of adenylosuccinate lyase deficiency. Eur J Paediatr Neurol. doi: 10.1016/j.ejpn.2011.08.008 Plesa, M., Kim, J., Paquette, S. G., Gagnon, H., Ng-Thow-Hing, C., Gibbs, B. F., . . . Coulton, J. W. (2011). Interaction between MMACHC and MMADHC, two human proteins participating in intracellular vitamin B metabolism. Mol Genet Metab, 102(2), 139-148. doi: 10.1016/j.ymgme.2010.10.011

105

Pratt, J. M. (1999). The Roles of Co,Corrin and Protein. I. The Roles of Co, Corrin, and Protein. In R. Banerjee (Ed.), Chemistry and Biochemistry of B12 (pp. 73 - 112). New York: John Wiley and Sons, Inc. Quadros, E. V., Lai, S. C., Nakayama, Y., Sequeira, J. M., Hannibal, L., Wang, S., . . . Rosenblatt, D. S. (2010). Positive newborn screen for methylmalonic aciduria identifies the first mutation in TCblR/CD320, the gene for cellular uptake of transcobalamin-bound vitamin B(12). Hum Mutat, 31(8), 924-929. doi: 10.1002/humu.21297 Reed, G. H., Kent, J. O., & Wittwer, C. T. (2007). High-resolution DNA metling analysis for simple and efficient molecular diagnotsitcs. Pharmacogenomics. Rivera, H., Merinero, B., Martinez-Pardo, M., Arroyo, I., Ruiz-Sala, P., Bornstein, B., . . . Martin, M. A. (2010). Marked mitochondrial DNA depletion associated with a novel SUCLG1 gene mutation resulting in lethal neonatal acidosis, multi-organ failure, and interrupted aortic arch. Mitochondrion, 10(4), 362-368. doi: 10.1016/j.mito.2010.03.003 Rogan, P. K., Faux, B. M., & Schneider, T. D. (1998). Information analysis of human splice site mutations. Hum Mutat, 12(3), 153-171. doi: 10.1002/(sici)1098- 1004(1998)12:3<153::aid-humu3>3.0.co;2-i Rosenblatt, D. S., Laframboise, R., Pichette, J., Langevin, P., Cooper, B. A., & Costa, T. (1986). New disorder of vitamin B12 metabolism (cobalamin F) presenting as methylmalonic aciduria. Pediatrics, 78(1), 51-54. Roth, J. R., Lawrence, J. G., & Bobik, T. A. (1996). Cobalamin (coenzyme B12): synthesis and biological significance. Annu Rev Microbiol, 50, 137-181. doi: 10.1146/annurev.micro.50.1.137 Rutsch, F., Gailus, S., Suormala, T., & Fowler, B. (2011). LMBRD1: the gene for the cblF defect of vitamin B12 metabolism. J Inherit Metab Dis, 34(1), 121-126. doi: 10.1007/s10545-010-9083-9 Saridakis, V., Yakunin, A., Xu, X., Anandakumar, P., Pennycooke, M., Gu, J., . . . Christendat, D. (2004). The Structural Basis for Methylmalonic Aciduria. The Journal of Biological Chemistry, 279(22), 23646-23653. Schubert, H. L., & Hill, C. P. (2006). Structure of ATP-bound human ATP:cobalamin adenosyltransferase. Biochemistry, 45(51), 15188-15196. doi: 10.1021/bi061396f Sempere, A., Arias, A., Farre, G., Garcia-Villoria, J., Rodriguez-Pombo, P., Desviat, L. R., . . . Campistol, J. (2010). Study of inborn errors of metabolism in urine from patients with unexplained mental retardation. J Inherit Metab Dis, 33(1), 1-7. doi: 10.1007/s10545-009-9004-y Sherry, S. T., Ward, M. H., Kholodov, M., Baker, J., Phan, L., Smigielski, E. M., & Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic Acids Res, 29(1), 308-311. Smith, B. C., & Denu, J. M. (2009). Chemical mechanisms of histone lysine and arginine modifications. Biochim Biophys Acta, 1789(1), 45-57. doi: 10.1016/j.bbagrm.2008.06.005 Stokke, O., Jellum, E., Eldjarn, L., & Schnitler, R. (1973). The occurrence of beta- hydroxy-n-valeric acid in a patient with propionic and methylmalonic acidemia. Clin Chim Acta, 45(4), 391-401.

106

Stucki, M., Coelho, D., Suormala, T., Burda, P., Fowler, B., & Baumgartner, M. R. (2012). Molecular mechanisms leading to three different phenotypes in the cblD defect of intracellular cobalamin metabolism. Hum Mol Genet, 21(6), 1410-1418. doi: 10.1093/hmg/ddr579 Takahashi-Iniguez, T., Garcia-Arellano, H., Trujillo-Roldan, M. A., & Flores, M. E. (2011). Protection and reactivation of human methylmalonyl-CoA mutase by MMAA protein. Biochem Biophys Res Commun, 404(1), 443-447. doi: 10.1016/j.bbrc.2010.11.141 Vockley, J., P, R., Bennett, M., Matern, D., & Vladutiu, G. (2000). Synergisitic Heterozygosity: disease resulting from multiple partial defects in one or more metabolic pathways. Molecular Genetic Metabolism, 71(1-2), 10-18. Watkins, D., & Rosenblatt, D. S. (2011a). Inborn errors of cobalamin absorption and metabolism. Am J Med Genet C Semin Med Genet, 157(1), 33-44. doi: 10.1002/ajmg.c.30288 Watkins, D., & Rosenblatt, D. S. (2011b). Inherited Disorders of Folate and Cobalamin Transport and MetabolismScrivers Online Metabolic and Molecular Bases of Inheritated Disease. In D. Valle, A. L. Beaudet, B. Vogelstein & K. W. Kinzler (Series Eds.): The McGraw-Hill Companies, Inc. Retrieved from http://www.ommbid.com/. doi: http://dx.doi.org/10.1036/ommbid.172 Worgan, L., Niles, K., Tirone, J., Hofmann, A., Verner, A., Sammak, A., . . . Rosenblatt, D. S. (2006). Spectrum of mutations in mut methylmalonic acidemia and identification of a common Hispanic mutation and heplotye. Human Mutation, 27(1), 31-43. Yamanishi, M., Vlasie, M., & Banerjee, R. (2005). Adenosyltransferase: an enzyme and an escort for coenzyme B12? Trends Biochem Sci, 30(6), 304-308. doi: 10.1016/j.tibs.2005.04.008 Zhang, J., Dobson, C. M., Wu, X., Lerner-Ellis, J., Rosenblatt, D. S., & Gravel, R. A. (2006). Impact of cblB mutations on the function of ATP:cob(I)alamin adenosyltransferase in disorders of vitamin B12 metabolism. Mol Genet Metab, 87(4), 315-322. doi: 10.1016/j.ymgme.2005.12.003 Zhou, L., Errigo, R. J., Lu, H., Poritz, M. A., Seipp, M. T., & Wittwer, C. T. (2008). Snapback primer genotyping with saturating DNA dye and melting analysis. [Research Support, N.I.H., Extramural

107

APPENDIX V: Presentations

12th International Congress of Human Genetics 11 – 15 October 2011 Montreal, Quebec Published abstract and Poster

Mutation screening of two genes involved in intracellular Vitamin B12 metabolism genes by high resolution melting analysis (HRMA)

Margaret L. Illson, Qiuying Huang, Laura Dempsey Nunez, Alison Brebner, Brian M. Gilfix, David Watkins, David S. Rosenblatt, Carl T. Wittwer

Intracellular vitamin B12 (cobalamin) transport and metabolism require the products of at least 10 genes. Some of the inherited diseases involving the cobalamin pathway cannot be distinguished through simple biochemical assays. Time consuming and expensive testing methods such as somatic cell studies and sequencing have traditionally been used for precise diagnosis.

HRMA was tested as an alternative screen to identify variants in the cobalamin pathway: MMACHC, responsible for the cblC disorder and MUT, responsible for classic methylmalonic aciduria. A total of 16 coding exons and flanking introns were amplified by PCR (fragments sizes 145-359 bps) and melted in the presence of a saturating dye. Screening of 96 normal DNA samples revealed 6 common polymorphisms, and confirmed that melting curves (max. 4 melting domains) were accurately predicted by uMeltSM and uViewSM, (http://www.dna.utah.edu/). A blinded study of 197 whole genome amplified (WGA) patient samples compared HRMA results to sequencing. Melting after PCR identified all heterozygous variants. While homozygotes could be detected in exons containing multiple domains, single domain exons required mixing with known PCR products before re-melting.

241 heterozygous (114 different) and 69 homozygous (48 different) mutations were found. The sensitivity and specificity of variant detection by melting were both >99%. Errors were either clerical or resulted from allele bias secondary to WGA. Unlabeled probes and snapback primers were used to genotype common variants. Batch analysis (many samples, one exon) was easier to interpret than patient-centric analysis (fewer samples, many exons), although both were successful. Having demonstrated the efficacy of HRMA for the recessively inherited genes of the B12 pathway, 16 additional coding exons and flanking introns have been optimized for two genes implicated in vitamin B12- responsive methylmalonic aciduria- MMAA and MMAB (fragments sizes 145-357 bps). Screening of 96 normal DNA samples confirmed melting curve predictions and revealed 5 common polymorphisms. HRMA provides a cost effective, simple and rapid screening method facilitating clinical diagnosis of overlapping phenotypes for genes in the vitamin B12 pathway.

108

Federation of American Sciences for Experimental Biology Science Research Conferences 22 - 27 July 2012 Crete, Greece

Oral Presentation Monday July 23, 1012 Poster

Screening of the MMAB gene by high resolution melting analysis (HRMA)

Margaret Illson, 1, Laura Dempsy Nunez,1, Jana Kent, 2, Luming Zhou, 2, David Watkins, 1, Brian Gilfix, 3, Carl Wittwer, 2, David Rosenblatt, 1. 1) Department of Human Genetics, McGill University, Montreal, Quebec; 2) Department of Pathology, University of Utah Medical Center, Salt Lake City, Utah USA; 3) Division of Medical Biochemistry, Department of Medicine, McGill University, Montreal, Quebec,

Background: Intracellular vitamin B12 metabolism requires the products of five genes for the synthesis and transport of adenosylcobalamin (AdoCbl), an essential coenzyme for the mitochondrial enzyme, methylmalonyl Co-A mutase (MCM). Mutations in MMAA, MMAB, MMAD, MUT, or MCEE can result in isolated methylmalonylic aciduria (MMA). High Resolution Melting Analysis (HRMA) was utilized as a fast and inexpensive method to scan for mutations in MMAB.

Methods: DNA from 96 reference, 42 cblB and 91 patients with undiagnosed MMA were scanned by HRMA. gDNA was extracted from fibroblast cell lines and PCR amplified in the presence of LCGreen Plus fluorescent dye (Idaho Technology, Utah, USA). The PCR product was denatured on the Light Scanner 96 (Idaho Technology) and sequence variations were detected by changes in the melting profiles compared to reference samples.

Results: A blinded study of gDNA from 42 cblB patients, diagnosed by complementation analysis, validated the efficacy of the assay by detecting the presence of all 73 previously known mutations. Variants in 7 of the 11 unresolved alleles, from patients who had not had complete gene sequencing, were detected. Sanger sequencing confirmed their identity as mutations including one novel nonsense mutation, c.12 C>A, (p.C4X). Sensitivity of the HRM assay was 98.9% and specificity  99%.

109

 of Mutations Previously  of Mutations Identified by 42 cblB Known HRMA patients 1st 2nd 1st 2nd 34 34 34 34 34 5* 5 0 5 3 3* 0 0 3 1 *Tested for only 3 common mutations (c.556C>T, c.700C>T and 571 ins5)

HRMA was then used to scan the fibroblast cells from 91 patients with isolated methylmalonic aciduria of unknown etiology for variants in MMAB. The propionate incorporation of these lines was within the reference range, making complementation analysis infeasible. HRMA scanning identified 8 variants in 6 patients. Two patients (P1 and P2) have 2 sequence variants in the MMAB gene, while 4 contain only a single variant. Five of the 8 variants have been previously characterized as mutations. Of the remaining 3, one variant, c.398 C >T (S133F), is novel, affects a highly conserved residue and is predicted to be possibly damaging by Polyphen (http://genetics.bwh.harvard.edu/pph/). Two variants, c.185 C >T (T62M), and c.394 T >C (C132R) are predicted to be probably (T62M) or possibly (C132R) damaging. T62 is conserved across species but the conservation of C132 is variable.

st nd 1 Mutation 2 Mutation SNPs Clinical Phenotype Seizures at 2 months c. 398 C > T c.572 T > C Persistent isolated MMA P1 p.S133F p.R191Q none Non–responsive to vitamin

B12 Seizures at 3 months c.394 T > C c.572 T > C p.M239K Persistent isolated MMA P2 p.C132R p.R191Q (rs9593) No information on B Homozygous 12 responsiveness

Conclusion: The identification of 2 compound heterozygous patients for mutations in the MMAB gene suggests the existence of an unrecognized mild MMA phenotype that cannot be identified through complementation studies, and demonstrates the efficacy of HRMA to screen clinical samples.

110

APPENDIX VI : CERTIFICATES

111