Thesis
Regulation of major histocompatibility class II (MHCII) genes
LEIMGRUBER, Elisa
Abstract
Les molécules CMHII sont spécialisées dans la présentation d'antigènes extracellulaires aux cellules T qui déclenchent une réponse immunitaire spécifique à l'antigène. L'élément du promoteur le plus important pour l'expression des gènes CMHII est le module S-Y, qui est reconnu par le transactivateur CIITA et les facteurs de transcription qui composent l'enhanceosome. La première partie de cette thèse porte sur l'étude du remodelage de la chromatine qui est induit aux promoteurs des gènes CMHII. La deuxième partie de cette thèse démontre l'existence d'un module S-Y en amont du gène BTN2A2. CIITA et l'enhanceosome se lient de façon efficace à ce module et régulent l'expression du gène BTN2A2. Par conséquent, l'expression du gène BTN2A2 est étroitement co-régulée avec les gènes CMHII.
Reference
LEIMGRUBER, Elisa. Regulation of major histocompatibility class II (MHCII) genes. Thèse de doctorat : Univ. Genève, 2009, no. Sc. 4133
URN : urn:nbn:ch:unige-45661 DOI : 10.13097/archive-ouverte/unige:4566
Available at: http://archive-ouverte.unige.ch/unige:4566
Disclaimer: layout of this document may differ from the published version.
1 / 1 UNIVERSITE DE GENEVE
Département de biologie moléculaire FACULTE DES SCIENCES Professeur David Shore
Département de pathologie et immunologie FACULTE DE MEDECINE Professeur Walter Reith
______
Regulation of major histocompatibility class II (MHCII) genes – role of nucleosome eviction in MHCII gene activation and identification of BTN2A2, a relative of the B7 family of immunomodulatory molecules, as a novel target gene of the MHCII-specific regulatory machinery
THESE présentée à la Faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologie
par
Elisa LEIMGRUBER de Fribourg (FR)
Thèse n° 4133 Atelier d’impression ReproMail Genève 2009
Remerciements
Je suis profondément reconnaissante envers le Prof. Walter Reith de m’avoir accueillie dans son laboratoire et d’avoir dirigé mon travail de thèse. Je le remercie également d’avoir été toujours disponible pour discuter de mon travail et de m’avoir transmis son intérêt et sa grande connaissance du domaine de la régulation des gènes. Je remercie également le Prof. David Shore d’avoir accepté d’être mon co-directeur de thèse et de l’intérêt qu’il a porté à mon travail. Un grand Merci aussi aux personnes qui se trouvaient dans le laboratoire à mon arrivée, en particulier Michal et Queralt, qui m’ont fait partager leur motivation et leur passion de la science. Je les remercie aussi pour leur amitié et pour avoir donné tant de leur temps pour m’aider au jour le jour dans le laboratoire. Je remercie beaucoup Queralt qui m’a accompagnée durant toutes ces années et qui s’est intéressée de près et avec grand intérêt à mes sujets de recherche. Je remercie tout particulièrement Isabelle qui, malgré son arrivée plus tardive dans le laboratoire, a rejoint très vite le groupe des personnes qui ont grandement contribué à la réussite de mon travail de thèse. Je la remercie également pour son amitié et pour les bons moments passés à côté d’elle à la paillasse. Merci à Antoine, qui a contribué à ce travail de thèse en me proposant toujours très généreusement son aide pour la réussite de mes expériences mais aussi pour entretenir le bien commun du laboratoire. Je suis reconnaissante également envers toutes les personnes du laboratoire, les personnes du département de pathologie et immunologie, et les collaborateurs externes qui ont participé à ce travail et qui ont contribué à sa publication dans des journaux scientifiques. Finalement, je suis très reconnaissante envers ma famille, mes amis et surtout mon Nicolas, qui m’ont apporté leur précieux soutient durant toutes ces années de thèse.
2 Résumé
Les molécules du complexe majeur d’histocompatibilité (CMH) jouent un rôle crucial dans la défense du corps contre les micro-organismes pathogènes. Il existe deux classes de molécules CMH : CMH de classe I (CMHI) et CMH de classe II (CMHII). Les molécules CMHII sont spécialisées dans la présentation d’antigènes d’origine extracellulaire aux cellules T CD4 +. La reconnaissance des complexes antigène-CMHII par les cellules T CD4 + déclenche la prolifération et l’activation des cellules T et induit les réponses immunes spécifiques à l’antigène. Les molécules CMHII jouent également un rôle important dans les processus de sélection positive et négative qui dirigent le développement des cellules T CD4 + dans le thymus. Les molécules CMHII sont exprimées de façon constitutive à la surface des cellules présentatrices d’antigènes (les cellules dendritiques, les cellules B et les macrophages) et les cellules épithéliales du thymus. L’expression des gènes CMHII peut également être induite par l’interféron gamma (IFN γ) dans des cellules qui n’expriment normalement pas les molécules CMHII. Des défauts dans l’expression des gènes CMHII conduisent au développement d’un déficit immunitaire appelé “le syndrome des lymphocytes nus ”. L’expression des molécules CMHII est coordonnée et régulée principalement au niveau transcriptionnel. L’élément régulateur le plus important est le module S-Y qui est localisé en amont de chaque promoteur CMHII . Ce module est composé de quatre séquences d’ADN conservées, les boîtes S, X, X2 et Y, qui sont reconnues par les facteurs de transcription qui régulent l’expression des gènes CMHII . Les facteurs qui se lient au module S-Y sont RFX, CREB et NF-Y. Ces facteurs forment un complexe multi-protéique appelé «l’enhanceosome ». Le trans-activateur CIITA se lie ensuite à l’enhanceosome pour activer l’expression des gènes CMHII . La chromatine joue un rôle important dans le contrôle de l’accès de facteurs de transcription aux promoteurs. La chromatine est organisée sous forme de nucléosomes, qui sont composés des histones H2A, H2B, H3 et H4. Les histones peuvent subir des modifications, principalement l’acétylation et la méthylation, que peuvent affecter l’état de condensation de la chromatine et influencer le recrutement de co-facteurs requis pour l’activation de la transcription. Ces co-facteurs sont impliqués dans le déplacement des nucleosomes et dans l’établissement de modifications des histones. Ces processus permettent
3 finalement le recrutement de la polymérase II et de la machinerie générale de la transcription au site d’initiation de la transcription. La première partie des résultats présentés dans cette thèse porte sur l’étude du remodelage de la chromatine qui est induit aux promoteurs des gènes CMHII lors de l’activation de leur expression. Ce travail décrit les modifications des histones qui sont introduites aux promoteurs des gènes CMHII lors de leur activation et documente le déplacement des nucléosomes aux promoteurs CMHII, permettant au module S-Y et au site d’initiation de la transcription d’être accessibles aux facteurs de transcription . Les résultats montrent que l’enhanceosome médie l’éviction des nucléosomes et que le repositionnement des nucléosomes dans la région promotrice détermine la position du site d’initiation pour la transcription des gènes CMHII . CIITA a longtemps été décrit comme un activateur hautement spécifique de l’expression des gènes CMHII . Cependant, plusieurs études récentes ont montré que ce facteur pouvait aussi contrôler l’expression de gènes n’appartenant pas à la famille des gènes CMHII . La deuxième partie de cette thèse démontre l’existence d’un module S-Y en amont du gène BTN2A2 , qui code pour une protéine appartenant à la famille des molécules de costimulation B7. La machinerie de transcription des gènes CMHII , composée de CIITA et RFX, se lie de façon efficace à ce module et régule l’expression du gène BTN2A2 . Par conséquent, l’expression du gène BTN2A2 est étroitement co-régulée avec les gènes CMHII dans les cellules B et les cellules induites par l’IFN γ.
4 Summary
The molecules of the major histocompatibility complex (MHC) play a crucial role in defending the body against micro-organisms. There are two classes of MHC molecules: MHC class I (MHCI) and MHC class II (MHCII). MHCII molecules are specialised for the presentation of antigens of extracellular origin to CD4 + T cells. Recognition of antigen- MHCII complexes by CD4 + T cells triggers T cell proliferation and activation, and thus induces antigen-specific immune responses. MHCII molecules also play an important role in the positive and negative selection processes that drive the development of CD4 + T cells in the thymus. MHCII molecules are expressed constitutively at the surface of antigen presenting cells (dendritic cells, B cells, macrophages) and thymic epithelial cells. The expression of MHCII genes can also be induced by interferon gamma (IFNγ) in cells that do normally not express MHCII molecules. Defects in the expression of MHCII genes lead to a severe immunodeficiency disease called “the bare lymphocyte syndrome”. MHCII gene expression is coordinated and regulated mainly at the transcriptional level. The most important regulatory element is the S-Y module, which is located upstream of each MHCII promoter. This module is composed of four conserved DNA sequences, the S, X, X2 and Y boxes, which are recognised by transcription factors that regulate MHCII gene expression. The factors that bind to the S-Y module are RFX, CREB and NF-Y. These factors form a multi-protein complex called the "enhanceosome". The trans-activator CIITA is recruited to the enhanceosome and activates MHCII gene expression. Chromatin plays an important role in controlling the access of transcription factors to promoters. Chromatin is organised into nucleosomes, which are composed of histones H2A, H2B, H3 and H4. Histones can undergo modifications, such as acetylation and methylation, which can affect chromatin accessibility and influence the recruitment of co-factors required for transcription activation. These co-factors are involved in the displacement of nucleosomes and the establishment of histone modifications. These mechanisms ultimately allow the recruitment of polymerase II and the general transcription machinery at the transcription start site (TSS). The first part of the results presented in this thesis addresses the chromatin remodeling events that are induced during the activation of MHCII genes. This work describes the histone
5 modifications that are introduced at MHCII promoters upon activation, and documents a nucleosome positioning process that renders the S-Y module and TSS of MHCII promoters accessible to transcription factors. The results show that the enhanceosome mediates nucleosome eviction, and that nucleosome repositioning in the promoter region determines the position of the TSS for MHCII gene transcription. For many years, CIITA was believed to be a highly specific activator of MHCII gene expression. However, several recent studies have shown that this factor could also control the expression of non-MHCII genes. The second part of this thesis describes the identification of an S-Y regulatory module upstream of the BTN2A2 gene, which encodes a relative of the B7 family of immunomodulatory molecules. The MHCII-specific regulatory machinery, including the enhanceosome complex and CIITA, binds efficiently to this module and regulates BTN2A2 expression. Expression of the BTN2A2 gene is consequently tightly co- regulated with MHCII genes in B cells and cells induced with IFN γ.
6 Table of contents
I INTRODUCTION...... 9 I.1 Structure and function of MHC molecules ...... 10 I.1.1 MHCI molecules ...... 10 I.1.2 MHCII molecules...... 12 I.2 Regulation of MHCII genes ...... 23 I.2.2 Trans-acting factors...... 26 I.2.3 Specificity of the MHCII transcription machinery ...... 34 I.2.4 Mechanisms mediating transcriptional activation by CIITA and the enhanceosome ...... 37 II RESULTS...... 50 II.1 Transcription-coupled deposition of histone modifications during MHCII gene activation ...... 51 II.1.1 Introduction ...... 51 II.1.2 Article...... 52 II.2 Nucleosome eviction from MHCII promoters controls positioning of the transcription start site ...... 66 II.2.1 Introduction ...... 66 II.2.2 Article...... 67 II.3 The gene encoding BTN2A2, a relative of the B7 family of costimulatory molecules, is regulated by the MHCII-specific regulatory machinery...... 94 II.3.1 Introduction ...... 94 II.3.2 Article...... 95 Abstract ...... 97 Materials and Methods...... 100 Results ...... 103 Discussion ...... 108 Figure legends ...... 110 Figures...... 113 II.4 Generation of a knock-out mouse to study the function of Btn2a2 ...... 123
7 III CONCLUSIONS AND PERSPECTIVES...... 128 III.1 Role of histone modifications deposited during MHCII gene activation...... 129 III.2 Role of nucleosome eviction in MHCII gene activation...... 130 III.3 Btn2a2 potential function...... 134 Abbreviations...... 137 References ...... 141
8 I INTRODUCTION
9 I.1 Structure and function of MHC molecules
In response to continuous exposure of the host to pathogens, evolution has developed a complex immune system composed of cells and molecules that can trigger defensive responses against infections. Molecules of the major histocompatibility complex (MHC) play a central role in host defence against microorganisms. MHC molecules were originally identified thanks to research on graft acceptance or rejection (Gorer 1938; Snell 1953). Their involvement in the elaboration of immunological responses against pathogens was defined later (Benacerraf 1981; Schwartz 1985). MHC genes, also called HLA (for Human Leukocyte Antigen ) genes in humans and H2 or Ia in mice, are expressed in all vertebrates. MHC molecules are divided into two classes: class I (MHCI) and class II (MHCII). MHCI and MHCII molecules are transmembrane glycoproteins that belong to the immunoglobulin superfamily. Although MHCI and MHCII molecules have a similar overall structure, they differ in their function and expression (Bjorkman et al. 1987; Madden et al. 1992; Brown et al. 1993; Cresswell 1994; Stern et al. 1994; Jones 1997; Natarajan et al. 1999; Rudolph et al. 2006). The main function of classical MHCI molecules is the presentation of peptides derived from intracellular proteins to CD8 + T lymphocytes, whereas classical MHCII molecules present peptides derived from internalised extracellular proteins to CD4 + T lymphocytes. In addition, there are several non-classical MHC molecules and MHC-like molecules, some of which play pivotal roles in the immune response (Braud et al. 1999; Alfonso and Karlsson 2000).
I.1.1 MHCI molecules
MHCI molecules are present at the surface of all nucleated cell types. Classical MHCI molecules are divided in three isotypes, HLA-A, HLA-B and HLA-C in humans and H2-K, H2-D and H2-L in mice. In addition, a large number of non-classical MHCI molecules have been identified. The latter include HLA-E, HLA-F and HLA-G.
I.1.1.1 Structure of MHCI molecules MHCI molecules are composed of two polypeptide chains, a transmembrane heavy chain (α chain) of 45 kDa and a β2-microglobulin ( β2m) chain of 12 kDa (Figure 1A). The 10 peptide-binding site is formed by the α1 and α2 domains of the heavy chain. The β2m subunit is associated with the α3 domain of the heavy chain. MHCI molecules generally bind peptides of a maximum length of 8–10 residues by means of specific binding pockets that differ in size and amino-acid composition from allele to allele. Only peptides of a limited length can be presented by MHCI molecules because the extremities of the peptide-binding cleft are closed. Classical MHCI molecules are highly polymorphic, particularly HLA-A and HLA-B. Polymorphic residues are located predominantly in the peptide binding region of the α1 and α2 domains (Parham and Ohta 1996).
A. B.
target cell α 2 peptide α 1
MHCI peptide peptide
CD8 TCR
CD8+ T cell
Figure 1. A. Structure of MHCI molecules (adapted from Birkbeck College textbook). Crystal structure of the peptide binding groove formed by the α1 and α2 chains of an MHCI molecule (top panel). Schematic representation of an MHCI molecule composed of α1, α2, α3 and β2m domains (bottom panel). B. Function of MHCI molecules (adapted from Birkbeck College textbook). The figure shows a cell presenting an endogenous peptide loaded on an MHCI molecule to a CD8 + T cell.
11 I.1.1.2 Function of MHCI molecules Classical MHCI molecules are specialised for antigen presentation. They present peptides derived from intracellular proteins to the T cell receptor (TCR) of CD8 + T lymphocytes (Figure 1B). Recognition of self-peptides by the TCR of CD8 + T cells is implicated in the maintenance of periferal self-tolerance. Conversely, recognition of non-self peptides by CD8 + T cells leads to the destruction of infected cells. MHCI molecules also play an important role in the protection of healthy cells against natural killer (NK) cell responses as well as in the destruction of infected cells by NK cells (Lehner and Cresswell 1996; Natarajan et al. 1999; Natarajan et al. 2002). Finally, MHCI molecules are essential for the development of CD8 + T cells in the thymus. Non-classical MHCI molecules play more diverse roles within and outside the immune system. HLA-E molecules are present at the surface of all cells, HLA-F molecules are restricted to lymphoid cells and HLA-G molecules are present at the surface of foetal trophoblast cells and thymic epithelial cells (TECs). The functions of these non-classical MHCI molecules are less known than those of classical MHCI molecules. They are involved mainly in the control of NK cell responses (Braud et al. 1999).
I.1.2 MHCII molecules
Molecules encoded by MHCII genes are expressed mainly at the surface of specialised cells of the immune system, including B lymphocytes, dendritic cells (DCs), macrophages and thymic epithelial cells (TECs) (Benoist and Mathis 1990; Glimcher and Kara 1992; Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003). In addition, MHCII expression can be induced in non bone marrow-derived cells by a variety of stimuli, such as interferon-γ (IFN γ) (Benoist and Mathis 1990; Glimcher and Kara 1992; Muhlethaler-Mottet et al. 1998; Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003). Classical MHCII molecules are divided into three isotypes, HLA-DR, HLA-DQ and HLA-DP in humans, H2-E and H2-A in mice. In addition, there are two non-classical MHCII molecules: HLA-DM and HLA-DO.
12 I.1.2.1 Structure of MHCII molecules MHCII molecules are heterodimers composed of two transmembrane polypeptide chains, an α chain of 33 kDa and a β chain of 29 kDa (Figure 2). The α α 1 and β chains are composed of two extracellular peptide domains, a transmembrane domain and a cytoplasmic β 1 domain. The extracellular α1 and β1 domains form the peptide binding region of the MHCII molecule. In peptide contrast to MHCI, peptides from 13 to more than 25 amino acids can be loaded onto MHCII molecules by extending their extremities outside of the peptide- binding groove (Stern et al. 1994; Murthy and Stern 1997). Similarly to MHCI, MHCII molecules exhibit a high degree of polymorphism. For example, over 600 Figure 2. Structure of MHCII allelic variants have been described for the HLA-DRB1 molecules (adapted from Birkbeck College textbook). The crystal gene, the most polymorphic MHCII gene. structure the peptide binding pocket formed by the α1 and β1 domains of Polymorphic residues are located mainly in the peptide the MHCII molecule is shown at the top. A schematic representation of binding region and influence peptide binding MHCII molecules composed of α1, α2, β1 and β2 domains is shown at the specificity and recognition of the MHCII/peptide bottom. complex by the TCR (Engelhard 1994).
I.1.2.2 Organisation of the MHCII locus The genes encoding the classical HLA-DR, HLA-DQ and HLA-DP MHCII molecules and the non-classical HLA-DM and HLA-DO MHCII molecules are clustered together in the MHCII locus, spreading over an 800 kb region on the short arm of the chromosome 6 (The MHC sequencing consortium; Kumnovics et al. 2003; Horton et al. 2004) (Figure 3). The α and β chains of MHCII molecules are encoded by A and B genes (Trowsdale 1993). The number of functional HLA-DRB genes varies depending on the haplotype. In addition, the MHCII locus contains numerous MHCII pseudogenes that have resulted from gene duplications and rearrangements during evolution. Several other genes are also present in the
13 MHCII locus. Some of these, namely the TAP and LMP genes, play accessory roles in antigen presentation by MHCI molecules (Kumnovics et al. 2003). Orthologs of MHCII genes exist in all mammalian species. The number of functional α and β chain genes varies due to species-specific duplication and deletion events, but MHCII genes are conserved among different species, such as the mouse, rat, pig, cat, cow and chicken (Kumnovics et al. 2003).
I.1.2.3 Constitutive and inducible expression of MHCII genes The three classical MHCII isotypes, HLA-DR, HLA-DQ and HLA-DP , are generally expressed in a coordinated manner. The invariant chain (Ii) and the non-classical MHCII isotypes HLA-DM and HLA-DO are also co-regulated, as expected from their accessory roles in antigen presentation by MHCII molecules (Brown et al. 1991; Westerheide et al. 1997; Moore et al. 1998; Taxman et al. 2000; Nagarajan et al. 2002b). A Figure 3. Map of the human MHCII locus (adapted from The few examples of discoordinated MHCII expression have MHC sequencing consortium ). MHCII genes are located in a been reported, but these are generally rare and mainly cluster on the short arm of the chromosome 6. limited to non-physiological situations (Pesando and Graf 1986; Ono et al. 1991; De Lerma Barbaro et al. 1997; Douhan et al. 1997; Coiras et al. 2002). Two fundamental modes of MHCII expression exist: constitutive and inducible. Constitutive expression is restricted to antigen presenting cells (DCs, macrophages and B cells) and TECs in the medulla and cortex of the thymus (Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003). The expression level of MHCII molecules can vary depending on the developmental stage of these cells. For instance, cell surface MHCII expression is upregulated during the maturation of DCs (Pierre et al. 1997). Within the B cell lineage, only mature B cells express MHCII molecules (Latron et al. 1988; Dellabona et al.
14 1989). The level of constitutive expression can be modulated in response to a variety of stimuli. Cell surface MHCII expression is increased in DCs activated with GM-CSF, TNF-α and interleukin (IL)-1, while their expression is downregulated after IL-10 stimulation (Sallusto and Lanzavecchia 1994; Morel et al. 1997; Fiebiger et al. 2001). In macrophages, IFN γ, GM-CSF, IL-3, IL-6, IL-13 enhance MHCII expression, whereas IL-10 and CSF-1 have inhibitory effects (Figueiredo et al. 1989; Lee et al. 1993). MHCII expression can be increased in B cells by various cytokines, such as IL-4, IL-5, IL-10, IL-13 and GM-CSF, by Immunoglobulin-Antigen complexes, by CpG and LPS, or by engagement of the cell surface receptors CD40 and CD72 (Go et al. 1990; Burstein et al. 1991; Kamal et al. 1991; Guardiola and Maffei 1993; Defrance et al. 1994; Santos Argumedo et al. 1994; Barrachina et al. 1999; Hartmann and Krieg 2000). A decrease in MHCII expression is observed after stimulation with prostaglandins and glucocorticoids in B cells (Glimcher and Kara 1992; Mach et al. 1996). For most cell types, the most efficient stimulus for inducing MHCII gene expression is IFN γ (Collins et al. 1984; Benoist and Mathis 1990; Mach et al. 1996). Other cytokines can stimulate MHCII expression in specific cell types. For instance, epithelial cells, eosinophils and microglia can be stimulated by IL-2/TSH/ eostradiol, IL-4/GM-CSF and IL-3 respectively (Benoist and Mathis 1990; Mach et al. 1996). IFN γ-induced MHCII gene expression can itself be modulated by additional stimuli, including TGF β, IFN β and TNF α (Melhus et al. 1991; Ransohoff et al. 1991; Kato et al. 1992; Devajyothi et al. 1993; Loughlin et al. 1993; Reimold et al. 1993).
I.1.2.4 Function of MHCII molecules Macrophages, DCs and B cells are professional antigen presenting cells (APCs). APCs share the common function of presenting antigens to T cells and are specialised for antigen uptake (Figure 4A). DCs continuously sample their environment by uptaking antigens. Following activation by infections or inflammatory stimuli, DCs mature and become the most efficient APC for presenting antigens to naïve T cells. Macrophages internalise antigens mainly by phagocytosis. Their MHCII expression and antigen presentation capacity are induced by activation signals such as bacterial components (LPS) or cytokines. Macrophages play key roles in promoting inflammation at the sites of infection and in sustaining the effector phase of cellular immune responses. B cells express MHCII molecules constitutively
15 and uptake antigens via their antigen specific immunoglobulin receptors. The principal function of MHCII-mediated antigen presentation by B cells is to promote the B cell-T cell collaboration required for the production of high affinity antibodies (Jenkins et al. 2001; Itano and Jenkins 2003). The distribution of APCs differs among tissues. Macrophages are mainly present in lymphoid tissues, conjunctive tissues and body cavities. DCs are mainly present in lymphoid tissues, conjunctive tissues and epithelia. B cells are mainly present in lymphoid tissues and the blood (Figure 4B). All APCs are present in lymphoid tissues, such as lymph nodes, the spleen and Peyer’s patches, but are localised in distinct regions within these structures. In lymph nodes, macrophages are found in the subcapsular and medullary sinuses, DCs are mainly restricted to the T cell zone, whereas B cells are localised in the follicles. In the spleen, B cells are localised in the follicular and marginal zones, and DCs are found in the T cell zone (Picker 1993; Jenkins et al. 2001; Itano and Jenkins 2003).
16 A.
B.
Figure 4. Function and localisation of antigen presenting cells (APCs) (adapted from The immune System , P.Parham (A) and Jenkins, 2001 #5028 (B)). A. Macrophages, dendritic cells and B cells are antigen presenting cells with distinct functions in antigen uptake and presentation. B. Localisation of APCs in the lymph node and the spleen.
17 Mechanism of antigen presentation by MHCII molecules The association of antigenic peptides with MHCII molecules at the surface of APCs is possible thanks to the intersection between two intracellular processes: the process of antigen internalisation and degradation, and the synthesis and intracellular trafficking of MHCII molecules. These two processes combine to permit the export of peptide/MHCII complexes to the cell surface (Figure 5) (Germain and Margulies 1993; Wolf and Ploegh 1995; Villadangos 2001; Watts 2001; Watts 2004; Trombetta and Mellman 2005; Jensen 2007). The mechanisms implicated in these two processes are detailed below.
Figure 5. Mechanism of peptide processing and loading onto MHCII molecules in APC (from The immune System , P.Parham). Extracellular antigens are internalised and degraded into peptides in endolysosomes. MHCII molecules are synthesised in the ER and transported via the Golgi to endosomes, where they encounter the peptides. MHCII/peptide complexes are finally transported to the plasma membrane
Extracellular antigens are internalised by endocytosis (pinocytosis for soluble molecules or phagocytosis for larger complexes or pathogens). Following capture of extracellular antigens, endocytotic vesicles (also called endosomes or phagosomes) are 18 formed, migrate into the cell and become more acidic. These vesicles fuse with other vesicles, such as lysosomes, containing hydrolases that are activated by the acidic environment. The low endosomal pH also plays a role in regulating the activity of HLA-DM and HLA-DO, non- classical MHCII molecules involved in peptide loading onto MHCII molecules (Kropshofer et al. 1999). In the endolysosomes, extracellular antigens are degraded into peptides ready to be loaded onto MHCII molecules. MHCII α/β heterodimers are synthesised in the endoplasmic reticulum (ER) where they form a complex with the invariant chain protein (Ii). The invariant chain is a type II transmembrane chaperone protein that plays a role in MHCII molecule folding and assembly (Bikoff et al. 1993; Viville et al. 1993; Cresswell 1996). Part of the Ii chain, the CLIP region (for CLass II Invariant chain Peptide), interacts with the peptide binding groove of MHCII molecules, thereby preventing premature loadings of peptides present in the ER (Busch et al. 1996). The MHCII/Ii complexes are transported through the Golgi and trans-Golgi network to endolysosomes where they encounter peptides derived from degraded proteins. Before peptides can be loaded onto MHCII molecules, the Ii chain first has to be cleaved by cathepsins L and S, thus leaving only the CLIP peptides bound to the MHCII molecules (Riese and Chapman 2000). The HLA-DM protein, modulated by HLA-DO in B cells, then catalyses the exchange between CLIP and peptides. Once peptides are loaded onto MHCII molecules, the MHCII/peptide complexes are exported by vesicles to the plasma membrane, where the MHCII molecules can exert their functions by presenting the peptides to CD4 + T cells. Following expression at the cell surface, MHCII molecules can be turned over by the classical endocytic pathway and either eliminated or recycled back to the surface with or without peptide exchange.
The role of MHCII molecules in T cell activation MHCII molecules play a fundamental role in the initiation and development of immune responses directed against pathogens. The main role of MHCII molecules expressed at the surface of APCs is to present peptides derived from exogenous proteins to CD4 + T lymphocytes (Figure 6). The recognition of peptides loaded on MHCII molecules by the TCR of CD4 + T cells represents a key event in the development, activation and regulation of the adaptive immune system (Cresswell 1994; Reith and Mach 2001).
19 In addition to antigen presentation to mature CD4 + T cells in the periphery, MHCII molecules play a central role in the generation of mature CD4 + T lymphocytes in the thymus (Viret and Janeway 1999). Maturation of CD4 + T cells in the thymus is associated with two processes, positive and negative selection. Positive selection is mediated by cortical thymic epithelial cells (cTEC), which direct the survival of thymocytes that carry a TCR capable of recognising self MHCII molecules (von Boehmer 1994; Fowlkes and Schweighoffer 1995; Jameson et al. 1995). In contrast, negative selection mediated by thymic DCs and epithelial cells in the medulla (mTECs) leads to the elimination of auto-reactive T cells that recognise self antigens and could thus lead to the development of autoimmune diseases (Nossal 1994). In secondary lymphoid tissues, DCs present antigen-MHCII complexes to naïve CD4 + T lymphocytes. When the naïve CD4 + T cells interact with MHCII/peptide complexes via their TCR, they become APC activated, proliferate, differentiate into effector T helper cells and migrate to the sites where they will exert their functions. If the naïve T cells do not recognise antigen, MHCII they leave the lymphoid tissues and continue to circulate. peptide The processes of activation, proliferation, differentiation CD4 TCR and migration of CD4 + T cells can last several days. This reflects the delay observed between the time of infection CD4+ cell and the development of an effective adaptive immune response.
The recognition of MHCII/peptide complexes is on Figure 6. Function of + MHCII molecules (adapted its own not sufficient to activate naïve CD4 T cells. the from Birkbeck College textbook). APC presenting activation, clonal proliferation and differentiation of T cells an exogenous peptide loaded into effector cells is possible only if a second signal is on a MHCII molecule to a CD4 + T cell delivered by costimulatory molecules expressed at the surface of APCs in association with MHCII/peptide complexes (Mueller et al. 1989). DCs are the most potent APCs for the activation of naïve T cells and thus for the initiation of T cell-mediated immune responses (Steinman et al. 1997; Jenkins et al. 2001; Itano and Jenkins 2003). DCs are derived from monocytes or bone marrow precursors that have migrated from the blood into tissues and organs. In non-lymphoid tissues, these immature DCs actively internalise and present antigens but express only low levels of 20 costimulatory molecules. Activation of the DCs by infections or inflammatory signals induces their migration to secondary lymphoid tissues where they aquire a mature phenotype and express high levels of MHCII and costimulatory molecules (Banchereau and Steinman 1998; Hawiger et al. 2001). In addition, mature DCs secrete chemokines and cytokines that attract naïve T cells and regulate their activation and differentiation. In the absence of activation signals, macrophages do not express costimulatory molecules and express only low levels of MHCII molecules. These immature macrophages can not activate naïve T cells. However, macrophage activation enhances antigen presentation and the expression of costimulatory molecules (Askew et al. 1995). B cells internalise soluble extracellular antigens thanks to their surface immunoglobulins and present MHCII/peptide complexes to CD4 + T cells. Costimulatory molecules are not expressed constitutively at the surface of B cells, but are induced by microbial components such as bacterial lipopolysaccharide (LPS) or CpG (Cassell and Schwartz 1994). The costimulatory signals delivered by activated APC are mediated by the binding of B7 costimulatory molecules to the CD28 T cell receptor (Figure 7). B7 molecules belong to the immunoglobulin superfamily. There are two B7 molecules, B7.1 (CD80) and B7.2 (CD86), performing different functions (Carreno and Collins 2002; Greenwald et al. 2005). These B7 molecules belong to a larger family of costimulatory molecules implicated in the modulation of T cell activation.
Figure 7. T cell activation by costimulatory molecules (adapted from The immune System , P.Parham). TCR and CD4 + T cell co-receptor fixation to MHCII/peptide complexes expressed at the surface of APCs produces activation signal 1. B7 costimulatory molecules expressed by APCs and engaged by the CD28 T cell co-receptor deliver the second signal required for activating naïve CD4 + T cells.
21 Following activation, CD4 + T cells differentiate into different types of effector cells. The most well known effector CD4 + T cell subsets are T helper 1 (Th1) and T helper 2 (Th2) cells. These two sub-populations develop in response to specific signals of which the most important are the cytokines present during T cell activation. Th1 cells secrete cytokines (particularly INF γ) that activate macrophages and other effector cells, leading to inflammation and cell-mediated immune responses. In contrast, Th2 cells secrete cytokines (particularly IL- 4) that regulate B cell differentiation and antibody production. Another co-receptor, CTLA-4, is expressed at the surface of activated T cells. CTLA-4 antagonises the function of the CD28 co-receptor by fixing B7 molecules with 10-fold higher affinity. This signal is required to limit T cell activation and prevent massive and uncontrolled T cell proliferation.
22 I.2 Regulation of MHCII genes
Since MHCII molecules perform key functions in the immune system, it is not surprising that MHCII genes are highly regulated. The regulation of MHCII gene expression occurs mainly at the level of transcription (Benoist and Mathis 1990; Glimcher and Kara 1992; Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003). In addition, a small number of reports have indicated that post-transcriptional mechanisms may also play a minor role in the control of MHCII expression (Maffei et al. 1989; De Lerma Barbaro et al. 1994; Del Pozzo et al. 1994; Del Pozzo et al. 1999). The regulatory mechanisms controlling MHCII genes are not only responsible for the cell-type and tissue-specific expression of MHCII genes, but also for maintaining the correct level of expression and appropriate activation under defined physiological conditions. Failures in the control of MHCII gene activation lead to immunodeficiency. Altered MHCII expression has also been suggested to be implicated in the development of autoimmune diseases, such as insulin-dependent diabetes mellitus, multiple sclerosis, rheumatoid arthritis or autoimmune nephritis (Wraith et al. 1989; Acha Orbea and McDevitt 1990; Guardiola and Maffei 1993).
I.2.1.1 Cis-acting elements controlling MHCII gene transcription MHCII genes contain, in their promoter regions and introns, regulatory DNA sequences that direct their transcriptional activation. Thanks to extensive studies on the promoter regions of MHCII genes during the past 20 years, the essential regulatory elements required for transcriptional activation of MHCII genes have been precisely defined.
I.2.1.2 The S-Y regulatory module The most important cis-regulatory element is ~60 bp long and is located upstream of all MHCII genes. This crucial regulatory sequence is called the S-Y module, and is composed of four different sub-sequences, the S, X, X2 and Y boxes. The S-Y module is conserved not only in all classical MHCII genes, but also in the non-classical MHCII genes and the invariant chain gene (Benoist and Mathis 1990; Zhu and Jones 1990; Brown et al. 1991; Glimcher and Kara 1992; Ting and Baldwin 1993; Mach et al. 1996). The S, X, X2 and Y boxes are conserved at the level of their sequence, as well as with respect to their relative position, orientation and spacing, such that they present a common stereotypic alignment on the DNA 23 (Vilen et al. 1991; Vilen et al. 1992). A similar regulatory region is found in the promoter regions of MHCI genes and is recognized by the same transcription factors that bind to the S- Y modules of MHCII genes. However, the impact of this module on MHCI gene regulation is less important because MHCI promoters contain additional regulatory sequences that can activate expression in the absence of the transcription factors implicated in MHCII gene activation (Figure 8) (Gobin et al. 1997; Martin et al. 1997; Gobin et al. 1998; van den Elsen et al. 1998).
MHCII
HLA-DRA S X X2 Y Oct HLA-DRB, -DP, - DQ, -DO, -DMA S X X2 Y
HLA-DMB NF-1 κB S X X2 Y GC
Ii κB κB Y’ S X X2 Y ISRE GC
MHCI
HLA-A,-B, -C, -E, -F κ κ B B ISRE S X X2 Y HLA-G κB κB ISRE S X X2 Y b2m κ ISRE B S X X2 Y
Figure 8. Comparison between MHCII and MHCI promoter regions. The S-Y modules are represented in blue. Other regulatory elements are represented in gray. Additional putative binding sites are shown in white. The S-Y module of HLA-G is non-functional and is coloured in light blue.
The functional importance of the S-Y regulatory module has been defined by means of in vitro approaches and the generation of transgenic mice. Generally, all four boxes are required for optimal constitutive and inducible MHCII gene expression and none of them can function in an independent manner (Vilen et al. 1991; Vilen et al. 1992; Reith et al. 1994b). The function of the S-Y module is to recruit transcription factors that are required for MHCII genes expression. Each box is specifically recognised by different transcription factors. The transcription fators RFX5, RFXANK and RFXAP assemble into a complex (Regulatory Factor X) that binds to the X box. The X2 and the Y boxes are bound by the transcription factors CREB (cAMP Response Element Binding protein) and NF-Y (Nuclear Factor-Y) 24 respectively. The factor that binds to the S box remains to be identified. These factors assemble on the S-Y module to form a multiprotein complex called the “enhanceosome”. Occupation of the S-Y module by the enhanceosome is strongly stabilized by cooperative binding interactions (Durand et al. 1994; Reith et al. 1994a; Reith et al. 1994b; Moreno et al. 1995). The enhanceosome further recruits the non-DNA binding co-activator CIITA (Class II Trans-Activator), thus triggering MHCII transcription. The importance of the precise architecture of the S-Y module has been demonstrated by experiments showing that mutations in the individual sub-elements or changes in the distance between the sub-elements abolish enhanceosome assembly, the recruitment of CIITA and thus MHCII gene expression (Vilen et al. 1991; Vilen et al. 1992). In addition to the S-Y module, other regulatory elements have been described in the promoter regions of certain MHCII genes (Figure 8). The HLA-DRA promoter contains an octamer element, which is recognized by the Oct-2 transcription factor and is required for optimal expression in B cells (Tsang et al. 1990; Wright and Ting 1992; Zeleznik Le et al. 1992). In addition, an enhancer is present in the first intron of the HLA-DRA gene (Wang et al. 1987). Enhancer sequences have also been described in introns of the HLA-DQA , HLA- DQB and Ii genes (Sullivan and Peterlin 1987; Moore et al. 1998; Krawczyk et al. 2004). The Ii promoter contains additional regulatory sequences that are necessary for optimal induction of the Ii gene by IFN γ, including NF-κB sites, an ISRE element, a second Y box and a GC- rich region, (Barr and Saunders 1991; Brown et al. 1994; Wright et al. 1995).
I.2.1.3 MHCII locus control regions In addition to the S-Y modules associated with the promoter regions of MHCII genes, several regulatory sequences have been identified at positions situated far upstream of the transcription initiation sites of various MHCII genes (Krawczyk et al. 2004). The first evidence for such long-distance control sequences was provided by the study of the mouse H2-Eα gene. This gene has a locus control region (LCR) that is situated between -1.3kb and -20kb upstream of the core promoter and contains an inverted copy of the S-Y module (called the distal Y’-S’ module) (Dorn et al. 1988; Carson and Wiles 1993). This inverted S-Y module can function as an enhancer of transcription and is conserved in the orthologous human HLA-DRA gene at a position situated 2.3kb upstream the transcription start site (TSS) (Feriotto et al. 1995; Mischiati et al. 1999; Masternak et al. 2003).
25 Recent investigations using bioinformatic methods have allowed the identification of new enhancer sequences that are similar to the MHCII S-Y module and are located within the large MHCII locus (Krawczyk et al. 2004; Gomez et al. 2005). These distal S-Y enhancer modules are bound by the transcription factors RFX and CIITA, and are associated with changes in the chromatin structure similar to those observed at MHCII promoters. These distal enhancers are present at a high density in the region between the HLA-DRA and the HLA- DQA genes, suggesting a global regulation of the MHCII locus by RFX and CIITA (Gomez et al. 2005). More recently, the insulator factor CCCTC binding factor (CTCF) was found to interact with CIITA to form long-distance chromatin loops between one of the distal enhancers and the promoter regions of the HLA-DRB1 and HLA-DQA1 genes (Majumder et al. 2008). This example illustrates a novel regulatory mechanism implicating the three- dimensional structure of the MHCII locus.
I.2.2 Trans-acting factors
I.2.2.1 The BLS syndrome MHCII deficiency, also called the “bare lymphocyte syndrome” (BLS), is a severe hereditary immunodeficiency disease characterised by the absence of MHCII molecules. This rare disease was first described in the late 1970’s. Since then, approximately 70 patients coming from 50 unrelated families have been reported. The mode of inheritance is autosomal recessive and a high degree of consanguinity has been observed in the affected patients. BLS patients present a severely impaired immune system and they are highly susceptible to bacterial, viral, and fungal infections. The majority of the affected children dies before the age of 5 (Griscelli et al. 1989; Klein et al. 1993; Elhasid and Etzioni 1996; Mach et al. 1996; Reith and Mach 2001). All phenotypes observed in BLS patients can be explained by the absence of MHCII molecules and thus by a defect in antigen presentation to CD4 + T cells. The numbers of CD8 + T cell are increased whereas the numbers of CD4 + T cell are decreased. This is due to defective CD4 + T cell selection in the thymus, resulting from the absence of MHCII expression by thymic epithelial cells (Rieux Laucat et al. 1993).
26 Table 1. The bare lymphocyte syndrome.
The fact that BLS could be due to several different genetic defects emerged from fusion experiments performed with cells isolated from patients (Hume and Lee 1989; Benichou and Strominger 1991; Seidl et al. 1992; Lisowska-Grospierre et al. 1994). Four different complementation groups were identified by these experiments (Table 1). Elucidation of the genetic defects affecting patients in these four complementation groups led to isolation of the genes coding for four transcription factors that are essential for MHCII gene regulation. These regulatory factors are CIITA (defective in complementation group A), RFXANK (defective in complementation group B), RFX5 (defective in complementation group C), and RFXAP (defective in complementation group D) (Steimle et al. 1993; Steimle and Mach 1995; Durand et al. 1997; Masternak et al. 1998; Nagarajan et al. 1999). CIITA and RFX deficient cell lines derived from BLS patients, as well as a small number of in vitro generated mutant cell lines, have been very powerful tools for studying MHCII gene regulation (Table 1). In addition, the generation of CIITA and RFX knock-out mice has allowed researchers to explore the regulation of MHCII expression and the function of MHCII molecules in vivo (Chang et al. 1996; Clausen et al. 1998).
27 I.2.2.2 Assembly of the MHCII-specific regulatory machinery at MHCII promoters The MHCII-specific regulatory machinery assembles at MHCII promoters in two steps. First, the enhanceosome assembles at the S-Y regulatory module. The enhanceosome then recruits the co-activator CIITA, which activates transcription (Figure 9). In vivo footprint and chromatin immunoprecipitation (ChIP) experiments have confirmed the presence of the MHCII-specific regulatory machinery containing RFX and CIITA at MHCII promoters in cells expressing MHCII genes. Occupation of the S-Y module leads to a typical pattern of DNase I hypersensitive sites flanking the S-Y module (Reith et al. 1988; Gonczy et al. 1989).
APCs CIITA RFX Pol II Expression of MHCII genes Thymic epithelial cells ? CREB NF-Y IFN γ-induced cells S X X2 Y +1
CIITA
BLS complementation group A RFX CREB No expression ? NF-Y
S X X2 Y +1
RFX5 RFXANK CIITA
BLS complementation RFXAP ? CREB groups B, C, D NF-Y No expression
S X X2 Y +1
Figure 9. Transcriptional regulation of MHCII genes. In cells expressing MHCII genes, the enhanceosome complex composed of the RFX complex, CREB and NF-Y, assembles at the S-Y module located upstream of all MHCII genes. Binding of the enhanceosome to the S-Y module allows the recruitment of CIITA. CIITA then actives MHCII transcription by the general transcription machinery and Pol II (top panel). In B cells from BLS patients in complementation group A, CIITA is absent but the enhanceosome assembles correctly at the S-Y module. However, assembly of the enhanceosome alone does not suffice for transcription activation (middle panel). In B cells from BLS patients in complementation groups B, C or D, the absence of one of the RFX subunits abolishes assembly of the entire enhanceosome (bottom panel).
28 MHCII promoter occupancy in cells lacking CIITA (BLS complementation group A) differs from that observed in cells lacking one of the three subunits of the RFX complex (BLS complementation groups B, C and D) (Reith et al. 1995; Mach et al. 1996). In RFX-deficient cells, the DNase I hypersensitive sites are absent and the S-Y module remains unoccupied because of the absence of enhanceosome formation (Reith et al. 1988; Gonczy et al. 1989; Kara and Glimcher 1991; Kara and Glimcher 1993; Masternak and Reith 2002). In contrast, in CIITA-deficient cells, the DNase I hypersensitive sites are present and the enhanceosome assembles correctly at the S-Y module, although it is not sufficient to activate transcription. Thus, mutations in CIITA abolish transcription but not formation of the enhanceosome complex at MHCII promoters (Figure 9) (Reith et al. 1988; Kara and Glimcher 1991; Herrero Sanchez et al. 1992; Kara and Glimcher 1993; Durand et al. 1994; Masternak and Reith 2002).
The RFX complex The RFX complex consists of three different subunits: RFX5, RFXANK and RFXAP. These three factors assemble into a complex that binds to the X box of the S-Y module. All three subunits are required for binding of RFX (Steimle et al. 1995; Durand et al. 1997; Masternak et al. 1998; Nagarajan et al. 1999). The RFX complex does therefore not bind to MHCII promoters in BLS cells-exhibiting mutations in one of the three subunits (Reith et al. 1988; Gonczy et al. 1989; Kara and Glimcher 1991; Kara and Glimcher 1993). Biochemical studies have suggested that the RFX complex could be composed of one RFX5 dimer and one molecule each of RFANK and RFXAP. The three subunits of the complex can all interact with each others (DeSandro et al. 2000; Nekrep et al. 2000; Jabrane-Ferrat et al. 2002; Krawczyk et al. 2005; Garvie et al. 2007). RFX5 was first identified in 1995 as a key activator of MHCII gene expression. It was identified by complementation of a cell line (SJO) derived from a patient in BLS complementation group C (Steimle et al. 1995). Transfection of SJO cells with an RFX5 cDNA restored the expression of all classical and non-classical MHCII genes. RFX5 was the fifth member of the RFX protein family to be identified. RFX factors contain a characteristic DNA-binding domain (DBD) (Emery et al. 1996). RFX5 contains 616 amino acids and has an apparent molecular weight of 75 kDa. Biochemical studies have identified the domains that are necessary for the activity of RFX5 (Figure 10). Its DBD is sufficient for RFX assembly
29 and binding to the X box. It also contains a proline-rich domain (P) that may mediate the interaction with CIITA, and a nuclear localisation signal (NLS) (DeSandro et al. 2000; Villard et al. 2000; Nagarajan et al. 2004). RFXAP (for RFX Associated Protein) was identified as a subunit of the RFX complex by purification and sequencing by mass spectrometry (Durand et al. 1997). Mutations in the RFXAP gene are responsible for BLS complementation group D. The RFXAP protein is composed of 272 amino acids and has an apparent molecular weight of 36 kDa (Figure 10). RFXAP does not contain a DNA-binding domain and is not homologous to members of the RFX DNA-binding protein family. The C-terminal region of RFXAP contains a glutamine- rich domain (Q) that is essential for the activation of all MHCII genes (Peretti et al. 2001). This minimal Q-rich region is sufficient for the activation of HLA-DR genes. A larger region containing the Q domain and an NLS sequence is required for the activation of HLA-DP and HLA-DQ genes. To date, the only known function of RFXAP is the transcriptional activation of MHCII genes. The third subunit of the RFX complex, RFXANK, was identified thanks to purification and sequencing by mass spectrometry (Masternak et al. 1998; Nagarajan et al. 1999). The RFXANK protein contains 260 amino acids and has an apparent molecular weight of 33 kDa (Figure 10). The name of this subunit is derived from the presence of four ankyrin repeats in the C-terminal region of the protein (Masternak et al. 1998). RFXANK is also called RFX-B because it is mutated in patients belonging to BLS complementation group B (Nagarajan et al. 1999). In vitro studies have shown that RFXANK interacts with RFX5 and RFXAP via the ankyrin repeat domain (DeSandro et al. 2000; Nekrep et al. 2001; Krawczyk et al. 2005). A recent study using point mutations in distinct regions of RFXANK has demonstrated that ankyrin repeats 2 and 3 are responsible for the interaction with RFX5 and are thus essential for the in vivo binding of the enhanceosome to the X box (Krawczyk et al. 2005). Like the two other RFX genes, RFXANK shows great specificity for transcriptional activation of MHCII genes. One study has suggested that RFXANK could play a role in the regulation of another unrelated gene, the ephrin receptor-encoding gene ( EPHA3 ) (Das et al. 2002). This gene has been described to be involved in embryogenesis and cellular migration. Another study has reported that RFXANK could regulate activity of the serine/threonine kinase RAF-1, which is involved in growth factor signal transduction pathways (Lin et al. 1999).
30 NACHT
Figure 10. Schematic representations of protein domains in RFX5, RFXANK, RFXAP and CIITA. The regions implicated in specific functions are indicated below each protein. DE, acidic region; NLS, nuclear localisation signal; PST, proline-serine-threonine rich region; GDB, GTP-binding domain; NACHT, domain present in NAIP, CIITA, HET-E and TP1; LRR, leucine rich repeat; ARD, ankyrin repeat domain; L, leucine rich stretch; DBD, DNA binding domain; P, proline rich region; NES, nuclear export signal; Q, glutamine rich region.
The enhanceosome complex Assembly of the enhanceosome complex by binding of RFX, CREB and NF-Y to the X, X2 and Y boxes occurs in a coordinated and cooperative manner. Although the individual affinities of RFX, CREB and NF-Y for their cognate binding sites are low, multiple cooperative interactions between these factors allow the formation of a stable enhanceosome complex at MHCII promoters (Durand et al. 1994; Reith et al. 1994a; Reith et al. 1994b; Moreno et al. 1995; Mantovani 1999). This cooperation is illustrated by cells from BLS complementation group B, C or D, which carry mutations in one of the three RFX subunits. In 31 these cells, the entire MHCII promoter region encompassing the S, X, X2 and Y boxes is unoccupied (Reith et al. 1988; Gonczy et al. 1989; Kara and Glimcher 1991; Kara and Glimcher 1993) (Figure 9). The strict organisation of the S, X, X2 and Y boxes plays a fundamental role in enhancesome assembly and function. Changes in the DNA sequence of the individual binding sites as well as alteration in the distance separating the binding sites are known to impair MHCII transcription (Vilen et al. 1991; Vilen et al. 1992; Reith et al. 1994b; Zhu et al. 2000; Muhlethaler-Mottet et al. 2004). Formation of the enhanceosome at MHCII promoters is not sufficient on its own to activate transcription. This is well illustrated by the analysis of CIITA-deficient cells in BLS complementation group A. Although the enhanceosome is assembled correctly at MHCII promoters in these cells, gene activation is defective because it requires recruitment of the co- factor CIITA (Masternak et al. 2000).
CIITA CIITA was the first protein to be identified as an essential factor for MHCII gene expression. This was demonstrated by complementation of the RJ2.2.5 cell line, an in vitro generated mutant assigned to BLS complementation group A (Steimle et al. 1993). There are three isoforms of CIITA, of 1’207, 1’130 or 1’106 amino acids and with apparent molecular weights of 132, 124, or 121 kDa, respectively. The presence of the three isoforms depends on the cell type in which CIITA is expressed. CIITA is recruited to MHCII promoters by means of multiple protein-protein interactions between CIITA and various different components of the enhanceosome complex (Masternak et al. 2000; Muhlethaler-Mottet et al. 2004). In contrast to RFX and the other enhanceosome factors, which are expressed constitutively and ubiquitously, CIITA expression is tightly regulated and correlates with MHCII expression (Reith and Mach 2001; Ting and Trowsdale 2002; Landmann et al. 2003; LeibundGut-Landmann et al. 2004a). For this reason, CIITA is called the “master regulator” of MHCII gene expression. Numerous lines of experimental evidence have demonstrated the fundamental role of CIITA as a key regulator of MHCII gene expression. MHCII expression can be induced in almost all cell types by means of transfections with CIITA expression vectors (Chang et al. 1994; Silacci et al. 1994; Steimle et al. 1994; Sartoris et al. 1998). The inducible expression of MHCII genes by IFN γ is dependent on the activation of CIITA expression (Chang et al. 1994; Steimle et al. 1994). In addition, the levels of MHCII and
32 CIITA expression are tightly correlated in human and mouse tissues and cell lines (Otten et al. 1998). Finally, CIITA and MHCII expression are closely correlated during the development and differentiation of APCs. When B cells differentiate into plasma cells, the loss of MHCII expression is due to silencing of the CIITA-encoding gene (Silacci et al. 1994; Sartoris et al. 1998). In activated human T cells, the upregulation of MHCII expression is mediated by the induction of CIITA expression (Holling et al. 2002). Several stimuli, such as IL-4, TGF-β and IL-10, down-regulate MHCII expression by inhibiting the expression of CIITA (Lee et al. 1997; Nandan and Reiner 1997; O'Keefe et al. 1999; Rohn et al. 1999). Various essential protein domains have been identified in CIITA (Figure 10). The N- terminal region of CIITA contains an acidic domain (DE), three proline-serine-threonine rich domains (PST) and two NLS. The DE and PST regions function as transcription activation domains (Zhou and Glimcher 1995; Chin et al. 1997) The central region of the protein contains a GTP-binding domain (GBD) implicated in the formation of CIITA dimers and nuclear import (Kretsovali et al. 2001; Linhoff et al. 2001; Sisk et al. 2001). A leucine-rich repeat domain (LRR) and a third nuclear localisation signal are found in the C-terminal region of the protein (Hake et al. 2000). The identification of a NACHT (or NOD) domain situated before the LRR domain has classified CIITA in the family of the NACHT(NOD)-LRRs (NLRs), whose emerging function is to detect intracellular pathogens or danger signals (Martinon and Tschopp 2005). The regulation of CIITA itself has been the subject of intensive investigations. Expression of the human CIITA gene is regulated by four promoters (pI, pII, pIII, and pIV) (Muhlethaler-Mottet et al. 1997; LeibundGut-Landmann et al. 2004a). Promoters I, III and IV are highly conserved in mice. Each promoter precedes an alternative first exon that is spliced to the common downstream exons to generate three promoter-specific CIITA isoforms. The study of these promoters has revealed that their differential activation determines the tissue- and cell-type specificity of CIITA expression (Muhlethaler-Mottet et al. 1997; LeibundGut- Landmann et al. 2004a). Promoter I (pI) drives CIITA expression in conventional DCs and in microglia, monocytes and macrophages after stimulation with INF γ (Suter et al. 2000; Landmann et al. 2001; Waldburger et al. 2001; LeibundGut-Landmann et al. 2004a). The function of promoter II (pII) is unknown. Promoter III (pIII) directs CIITA expression in B cells, activated T cells and plasmacytoid DCs (Lennon et al. 1997; Holling et al. 2002; Wong et al. 2002; LeibundGut-Landmann et al. 2004b). Finally, promoter IV (pIV) is responsible for IFN γ-inducible CIITA expression in various cell types, including monocytes, 33 macrophages, fibroblasts, epithelial cells and endothelial cells (Muhlethaler-Mottet et al. 1998; Piskurich et al. 1998; Dong et al. 1999; Piskurich et al. 1999; Rohn et al. 1999). The activation of pIV by INF γ has recently been shown to require a three-dimensional chromatin structure established by long-distance interactions between pIV and a number of distal enhancers (Ni et al. 2008; Reith and Boss 2008). Promoter pIV is also used in cortical thymic epithelial cells (cTECs) (Waldburger et al. 2001; Waldburger et al. 2003; Irla et al. 2008). In contrast, medullary thymic epithelial cells (mTECs) use both pIII and pIV.
I.2.3 Specificity of the MHCII transcription machinery
For many years, the only target genes believed to be regulated by CIITA were the MHCII and MHCI genes. However, more recently, a number of reports have identified genes functioning within and outside of the immune system that are regulated directly by CIITA, or are affected by the presence of CIITA by unknown mechanisms (Table 2). Microarray experiments identified the Plexin-A1 gene and 40 other genes that could be regulated by CIITA in human B cells and IFN γ-induced cells (Nagarajan et al. 2002a; Wong et al. 2003). Plexin-A1 has been shown to be required for optimal T cell stimulation by DCs (Wong et al. 2003). Other studies suggested a role for CIITA in the repression of non- MHC genes, including IL-4 and FasL in mouse T cells (Gourley et al. 1999; Sisk et al. 2000; Gourley and Chang 2001; Gourley et al. 2002), IL-10 and cathepsin E in mouse B cells and/or DCs (Yee et al. 2004; Yee et al. 2005), and collagen type I α2 in IFN γ-induced cells (Zhu and Ting 2001; Xu et al. 2004). The expression of 16 other genes was found by microarray studies to be down-regulated in the presence of CIITA (Nagarajan et al. 2002a). The mechanisms via which CIITA regulates the expression of these non-MHC genes are either indirect or unknown. None of these genes contain typical S-Y regulatory modules in their promoter regions. Two complementary genome-wide methods have been used to identify target genes regulated directly by CIITA. The first approach consisted of a computer scan designed to identify genes containing the characteristic S-Y regulatory module of MHCII genes. The second approach used ChIP-on-chip technology to identify promoters that are bound by CIITA and RFX5. The combination of these two approaches led to identification of the gene encoding RAB4B as a direct target gene of the MHCII-specific regulatory machinery (Krawczyk et al. 2007; Krawczyk et al. 2008). Members of the RAB family of GTPases play 34 major roles in the regulation of intracellular vesicle traffic. RAB4B is believed to play a role in early endosome sorting and endosome recycling and could thus play a role in antigen or MHCII trafficking during MHCII-mediated antigen presentation. ChIP-on-chip analysis also allowed the identification of a small number of additional bona fide target genes of CIITA and RFX5 in B cells and DCs (Krawczyk et al. 2008). The latter study confirmed that CIITA is in fact highly dedicated for the regulation of genes implicated in antigen presentation by MHCII and MHCI molecules. Indeed, several of the new target genes identified in this study could contribute directly or indirectly to antigen presentation processes.
35 Table 2. CIITA target genes
36 I.2.4 Mechanisms mediating transcriptional activation by CIITA and the enhanceosome
The regulation of transcription is controlled by a variety of interconnected and dynamic processes, including the binding of specific transcription factors, recruitment of the general transcription machinery, the establishment of histone modifications and the recruitment of chromatin remodeling complexes (Mellor 2005; Saha et al. 2006a; Berger 2007; Li et al. 2007). To date, the best characterised step in the activation of MHCII gene transcription is binding of the transcription factors specialised for MHCII gene activation to the conserved regulatory elements located in the promoters of MHCII genes (Benoist and Mathis 1990; Glimcher and Kara 1992; Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003). However, the other processes have also been addressed by a growing number of studies.
I.2.4.1 Recruitment of the general transcription machinery An essential step in Pol II-mediated transcription is the assembly of a pre-initiation complex (PIC) containing the general transcription machinery (GTM) at the core promoter. The GTM consists of Pol II and a series of general transcription factors (GTFs). Key GTFs include TFIID, which is composed of the TATA-binding protein (TBP) and TBP associating factors (TAFs), TFIIA, TFIIB, TFIIE, TFIIF and TFIIH. These and other GTFs collaborate to promote several key events, including PIC assembly, Pol II recruitment, transcription initiation, promoter clearance, Pol II carboxy-terminal domain (CTD) phosphorylation, and transcription elongation (Hampsey and Reinberg 2003; Sims et al. 2004; Saunders et al. 2006). In the case of MHCII genes, both the enhanceosome complex and CIITA have been implicated in the recruitment of components of the GTM. CIITA has been shown to interact with TFIIB and TFIID, suggesting that it may mediate the recruitment of these GTFs to MHCII promoters (Fontes et al. 1997; Mahanta et al. 1997; Masternak and Reith 2002). A potential role of CIITA in promoter clearance and transcription elongation was suggested by the finding that it can interact with TFIIH and the general transcription factor p-TEFb (Mahanta et al. 1997; Kanazawa et al. 2000). A role of CIITA in promoter clearance was also proposed by another study showing that the recruitment of CIITA correlates with Ser-5 37 phosphorylation of the CTD of Pol II (Spilianakis et al. 2003). The latter study also proposed a role of the enhanceosome complex in recruitment of certain GTFs in the absence of CIITA. Indeed, in fibroblast cells, assembly of the enhanceosome at the HLA-DRA promoter in the absence of CIITA was found to be sufficient to promote the recruitment of TBP, TAFII 250, Pol II and TFIIF. Another study also demonstrated that the enhanceosome is sufficient to promote the recruitment of Pol II and GTFs at certain MHCII genes in CIITA-deficient cells (Masternak and Reith 2002).
I.2.4.2 Recruitment of chromatin remodeling and histone modifying factors It is well established that chromatin has a direct effect on gene expression and that the activation of genes in their native chromatin environment requires the action of chromatin modifying and remodeling factors. These factors play crucial roles in rendering the chromatin conformation in the vicinity of promoters permissive for recruitment of the GTM and transcriptional activation. The basic building block of chromatin is the nucleosome, which consists of 147 bp of DNA wrapped 1.65 times around an octameric complex containing four histones H2A, H2B, H3 and H4. This structure is very stable thanks to multiple interactions between the DNA molecule and the histones proteins (Luger and Richmond 1998). The association of a fifth histone, H1, leads to further compaction of the chromatin. The packaging of DNA into chromatin reduces accessibility of the DNA to transcription factors and the GTM (Kornberg and Klug 1981; Kornberg and Lorch 1999) (Figure 11). Chromatin modifying and remodeling enzymes are therefore recruited to enhance the accessibility of DNA and thus render the chromatin permissive for transcription.
38 A. B.
DNA
nucleosomes
chromosome
Figure 11. Chromatin and nucleosome structure (from (Jiang and Pugh 2009) and bio.kaist.ac.kr). A. Chromatin is formed by the packaging of DNA into nucleosomes. A nucleosome consists of DNA wrapped around a core particle composed of histones. Progressively increased degrees of chromatin condensation lead to the formation of chromosomes. B. A nucleosome core particule is composed of an octamer of the four canonical histones H2A, H2B, H3 and H4.
Histone modifications Histone modifications are introduced or removed by specific enzymes, such as histone acetyltransferases (HATs), histone deacetylases (HDACs), histone methyltransferases, histone demethylases and histone kinases. Of these enzymes, the methyltransferases and kinases are the most specific (Strahl and Allis 2000; Rice and Allis 2001; Nowak and Corces 2004; Allis et al. 2007; Kouzarides 2007). Histones are subjected to the introduction of complex patterns of covalent post- transcriptional modifications, particularly at amino-acids situated in their N-terminal tails. Over 60 modified residues on histones have been detected. To date, at least eight distinct modifications have been described: acetylation, methylation, phosphorylation, ubiquitylation, sumoylation, ADP ribosylation, deimination and proline isomerisation (Kouzarides 2007). In
39 addition, specific lysines or arginines can be mono-, di-, or trimethylated and mono- or dimethylated, respectively. The most well documented modifications in the field of transcriptional activation are acetylation and methylation (Kurdistani and Grunstein 2003; Martin and Zhang 2005; Wysocka et al. 2006). The large variety and combinations of possible histone modifications provides enormous potential for modulating and controlling gene activation or repression (Figure 12). Studying the spatial distribution and temporal changes in chromatin modification patterns is thus crucial for deciphering the functional responses associated with the incorporation of histone marks.
Figure 12. Positions of histone modifications in chromatin (from (Schones and Zhao 2008)). Variant histones and specific modifications are present in defined regions of the genome.
40 The functions of histone modifications can be divided into two general categories: the establishment of global chromatin environments and the modulation of precise DNA-based biological processes. Certain modifications are used to divide chromatin into global domains characterised by either “accessible” (euchromatin) or “inaccessible” (heterochromatin) states (Kouzarides 2007). Other modifications contribute to the elaboration of specific biological processes, such as transcription, DNA repair, DNA replication or chromosome condensation. Various models, including the “histone code” and the “signalling pathway” models have been proposed to underlie the role of histone modifications in transcription (Strahl and Allis 2000; Turner 2000; Jenuwein and Allis 2001). Our knowledge on the role of histone modifications has increased dramatically during the past few years thanks to techniques relying on chromatin immunoprecipitation (ChIP). The development of classical ChIP experiments and new genome-wide approaches combining ChIP with microarrays (ChIP-on-chip) or high-throughput sequencing (ChIP-Seq) have generated extensive information on the localisation and function of histone modifications (Bernstein et al. 2005; Pokholok et al. 2005; Albert et al. 2007; Barski et al. 2007; Heintzman et al. 2007; Kouzarides 2007; Li et al. 2007; Mikkelsen et al. 2007; Schones and Zhao 2008; Wang et al. 2008; Barski and Zhao 2009). These experiments have led to several general conclusions on the localisation of specific modifications. It is now well accepted that methylations of lysine 4 on H3 (H3K4me) and acetylation of H3 (H3ac) and H4 (H4ac), are widespread marks for active promoters in yeast as well as human cells (Figure 12) (Schones and Zhao 2008). Other marks are present mainly in silenced genes, and have been implicated in heterochromatin formation and transcriptional repression (Boyer et al. 2006; Squazzo et al. 2006). Distinct genomic regions, such as enhancers and the body of genes tend to display specific histone modification patterns (Heintzman et al. 2007; Roh et al. 2007). In contrast to the modifications present at most active promoters, marks associated with enhancers have a less clear and precise pattern and are detected at only a fraction (20-40%) of potential enhancers (Barski et al. 2007; Schones and Zhao 2008).
Acetylation of histones H3 and H4 Acetylation of histones at lysine residues was among the first modifications found to be tightly associated with active transcription (Wade et al. 1997; Kurdistani et al. 2004;
41 Kouzarides 2007; Wang et al. 2008). Histone acethylation is believed to destabilise chromatin either directly by affecting histone-DNA or nucleosome-nucleosome interactions, or indirectly by creating docking sites for chromatin modifying or remodelling factors. Genome- wide studies have indicated that acetylation at specific histone residues may target different regions of the gene (Wang et al. 2008). For example, H3K9ac and H3K27ac are located mainly in the region surrounding the TSS, whereas H3K4ac, H4K5ac and H4K8ac are elevated in promoter regions as well as in the transcribed region of active genes. In yeast, two hypoacetylated nucleosomes generally flank the transcription initiation start, whereas acetylation is enriched within the 5’ end of coding regions (Bernstein et al. 2002; Kurdistani and Grunstein 2003; Liu et al. 2005; Pokholok et al. 2005). In higher eukaryotes, hyperacetylation is observed at promoters and correlates with active transcription (Schubeler et al. 2004; Kouzarides 2007). The presence of H3K9/14ac is associated with enhancers (Roh et al. 2007).
Methylation of histone H3 Specific lysine and arginine residues in histones can be methylated with high specificity by methyltransferases. These methylation marks are associated with either gene activation or repression. Methylations of lysines 4, 36 and 79 of histone H3 have been associated with active transcription (Bernstein et al. 2005; Martin and Zhang 2005; Kouzarides 2007). In addition, monomethylation of histone H3K9, H3K27 and H4K20 are found in actively transcribed regions. The H3K36me3 modification accumulates at the 3’ ends of genes and is associated with elongation. In yeast, the H3K4me3 modification is generally enriched within the 5’ region of actively transcribed coding regions, while the H3K4me2 modification tends to span wider regions within the body of active genes (Liu et al. 2005; Pokholok et al. 2005). In humans, the H3K4me3 modification is mainly observed at active promoters (Schubeler et al. 2004; Bernstein et al. 2005; Kim et al. 2005; Roh et al. 2006; Heintzman et al. 2007). The H3K4me3 mark has also been detected at certain silent promoters or enhancers (Ng et al. 2003; Bernstein et al. 2006; Roh et al. 2006; Barski et al. 2007; Guenther et al. 2007; Heintzman et al. 2007). Finnaly, H3K4me1 has been reported to be a mark for enhancers (Heintzman et al. 2007; Roh et al. 2007). Three specific lysine methylation marks are associated with transcriptional repression and gene silencing: H3K9me, H3K27me, and H4K20me. The H3K9me and H4K20me
42 modifications play roles in heterochromatin formation (Schotta et al. 2004; Martens et al. 2005; Martin and Zhang 2005; Boyer et al. 2006; Squazzo et al. 2006; Kouzarides 2007). However, the dogma that H3K9me is restricted to silencing has been challenged in the last few years by the finding that H3K9me is also enriched in coding regions of certain active genes (Vakoc et al. 2005; Squazzo et al. 2006).
Variant histones Histones H2A and H3 exist in several variant isoforms (Redon et al. 2002; Henikoff and Ahmad 2005; Kamakaka and Biggins 2005; Sarma and Reinberg 2005; Boulard et al. 2007; Kusch and Workman 2007; Zlatanova and Thakar 2008). There are two major variants of histone H3: H3.3 and the centromere-specific protein CenH3. Several variants of histone H2A exist: H2A.Z, H2A.X, H2A-Bbd and macroH2A. These variants were all identified during the course of the last few years. The H2A and H3 variants are encoded by distinct genes and are distinguishable from canonical histones on the basis of their sequences (Malik and Henikoff 2003). Recent studies on these variant histones have revealed a highly dynamic picture of chromatin involving histone replacement processes. The incorporation of variant histones into chromatin has been implicated in key biological processes, including gene activation, chromosome segregation, heterochromatin silencing and cell cycle progression. Certain histone variants are incorporated at promoter regions during active transcription. At activated genes, or at genes that are poised for activation, histones H2A and H3 are replaced by H2A.Z and H3.3 respectively. H2A.Z incorporation has been observed during active transcription and has been described to protect against gene silencing (Santisteban et al. 2000; Meneghini et al. 2003; Farris et al. 2005; Li et al. 2005; Raisner et al. 2005; Zhang et al. 2005; Millar et al. 2006; Albert et al. 2007). Replacement of H2A/H2B with H2A.Z/H2B requires ATP and is mediated by a member of the SWI/SNF family of ATP- dependent chromatin remodelers. The same observation was made for the variant histone H3.3 at promoters of transcriptionally active genes (Chow et al. 2005; Henikoff and Ahmad 2005; Mito et al. 2005; Wirbelauer et al. 2005; Mito et al. 2007).
Chromatin remodeling factors Chromatin remodeling factors modify the structure of chromatin in an ATP-dependent manner. These factors alter the structure of chromatin by displacing or repositioning
43 nucleosomes. Remodeling complexes are grouped into different families: the INO80 (including INO80 and SWR1 subfamilies), ISWI (including ACF/CHRAC and NURF subfamilies), Mi2/CHD and SWI/SNF families (Lusser and Kadonaga 2003; Dirscherl and Krebs 2004; Saha et al. 2006a; Bao and Shen 2007b; Bao and Shen 2007a; Gangaraju and Bartholomew 2007). Changes in chromatin structure induced by chromatin remodelling factors are critical for DNA-templated processes, including transcription.
Histone modification and chromatin remodeling during MHCII gene activation CIITA has been implicated in the establishment of histone modifications and chromatin remodeling at MHCII promoters. Histones H3 and H4 are highly acetylated at MHCII promoters in wild type B cells and IFNγ-induced cells (Beresford and Boss 2001). The level of acetylation at MHCII promoters is reduced in CIITA-deficient cells, and increased acetylation coincides in time with the appearance of CIITA during IFNγ stimulation (Beresford and Boss 2001; Masternak and Reith 2002). Consistent with a potential role in mediating histone modifications, CIITA has been reported to interact with the histone acetyltransferases p300/CBP (for CREB Binding Protein) and p-CAF (for p300/CBP Associated Factor) (Kretsovali et al. 1998; Fontes et al. 1999; Spilianakis et al. 2000; Zika et al. 2005). ChIP experiments have also shown that the histone acetyltransferase GCN5 and CBP are recruited to MHCII promoter after IFN γ stimulation (Spilianakis et al. 2003). This recruitment is followed by an increase in H3 and H4 acetylation (Beresford and Boss 2001). Surprisingly, the contribution of CBP and p-CAF to MHCII gene activation was found to be independent of their HAT activity. CIITA itself has also been described to contain an intrinsic acetyltransferase activity that resides within its transactivation domain (Raval et al. 2001). Members of the SWI/SNF family, BRG1 and BRM1, are recruited to the HLA-DRA promoter after IFN γ stimulation. BRG1 is required for MHCII gene activation because transfection of CIITA into BRG1-deficient cells does not activate MHCII expression (Mudhasani and Fontes 2002). CIITA can interact with CARM1 at MHCII promoters, inducing the methylation of arginine 17 of histone H3 (H3R17Me2). This modification has been shown to stabilise CBP binding to promoters, and this mechanism was suggested to enhance MHCII gene expression (Chevillard-Briet et al. 2002; Zika and Ting 2005).
44 The role of the enhanceosome in the recruitment of chromatin modifying and remodeling factors is less well documented. However, BRG1 can interact with RFXAP, one of the subunits of the RFX complex (Mudhasani and Fontes 2005). This suggests a mechanism by which the chromatin at MHCII genes could be remodelled in the absence of CIITA.
I.2.4.3 The role of nucleosome positioning in transcription How nucleosomes are positioned in the genome and how their localisation influences transcription is a long-standing question. Numerous studies have focused on the organisation of nucleosomes in the genome, how nucleosomes are positioned, and how DNA sequences, transcription factors or chromatin remodeling complexes organise nucleosomes so that transcription can be activated. Recent genome-wide studies relying on ChIP-on-chip and ChIP-Seq techniques have allowed the elaboration of global nucleosome maps. Prior to these genome-wide studies, it was in most instances unclear whether the deposition of nucleosomes on DNA occurs at random positions or whether nucleosomes could play specific physiological functions depending on their location. However, the genome-wide nucleosome maps have revealed specific features of chromatin at promoters, enhancers and coding regions, particularly in yeast, where a constitutive nucleosome-free region (NFR) was detected at the 5’end of most genes. These studies have also described preferential positioning of nucleosomes, or nucleosome “phasing”, at certain loci (Saha et al. 2006b; Gangaraju and Bartholomew 2007; Jiang and Pugh 2009). Positioned nucleosomes tend to be spaced at a fixed distance from each other, with short stretches of linker DNA between them. The lengths of these linkers can vary between different species (Lee et al. 2007; Mavrich et al. 2008a; Mavrich et al. 2008b; Valouev et al. 2008). Nucleosome depletion at specific regions was reported many years ago. Indeed, DNase I hypersensitive sites (DHS) are nuclease sensitive regions corresponding to segments along the chromosome that are free of nucleosomes (Elgin 1981; Sabo et al. 2006; Workman 2006). DHS were found in regulatory elements such as promoters and enhancers and this has been used to map novel regulatory sequences such as locus control regions (LCRs). More recently, several mechanisms have been proposed to account for nucleosome depletion at specific sites (enhancers, promoters or TSS) such as sequence-dependent structural features of
45 DNA, assembly of the PIC, binding of transcription factors, or the recruitment of chromatin remodeling complexes. Several studies have reported a role of DNA sequence in nucleosome positioning. Original reports suggested the existence of sequence-directed nucleosome positioning (Drew and Travers 1985; Lowary and Widom 1998). More recently, computational techniques were developed to identify DNA sequence patterns associated with well positioned nucleosomes in yeast, Drosophila melanogaster , chicken and human (Satchwell et al. 1986; Ioshikhes et al. 2006; Segal et al. 2006; Ganapathi et al. 2007; Lee et al. 2007; Peckham et al. 2007; Field et al. 2008; Gupta et al. 2008; Miele et al. 2008; Yuan and Liu 2008). These studies demonstrated that DNA sequence is an important factor that favours or disfavours nucleosome binding. Nucleosomes have clear DNA composition preferences, particularly at promoter regions. Other studies correlating DNA sequence properties with nucleosome positioning have suggested that TSS tend to be free of nucleosomes because promoter sequences possess few if any methylated CGs (Henikoff 2007; Lin et al. 2007). However, other observations have suggested that, at regulatory elements, sequences influencing nucleosome stability have only a minor influence on nucleosome positionning compared to the role of transcription factors or remodeling complexes (Rando and Ahmad 2007; Henikoff 2008; Valouev et al. 2008). Another mechanism implicated in the generation of NFRs is the binding of transcription factors to specific sequence elements (Brown 1984; Workman 2006). These studies demonstrated that transcription factors can exclude or displace nucleosomes by binding to DNA. Transcription factors can compete with nucleosomes during DNA replication by forming stable complexes that exclude nucleosomes from the promoters of active genes. Pre-existing nucleosomes can also be displaced upon gene induction (Adams and Workman 1993). Biochemical studies have demonstrated the ability of transcription factors to exclude or remove nucleosomes from DNA (Steger and Workman 1996). The binding in a cooperative manner of multiple factors to regulatory elements can notably result in nucleosome destabilisation. However, there are only few examples of nucleosome eviction by transcription factors in vivo . Although activator-induced nucleosome disassembly is well documented at the yeast PHO5 promoter, the precise mechanism mediating nucleosome eviction has not been elucidated (Boeger et al. 2003, Reinke, 2003 #4971, Straka, 1991 #4973; Boeger et al. 2004). Chromatin remodeling complexes have been found to participate in nucleosome disassembly in cooperation with transcription factors and histone chaperones 46 (Taylor et al. 1991; Workman and Kingston 1992; Owen-Hughes and Workman 1996; Workman 2006). An alternative model implicates PIC assembly in nucleosome eviction. This model proposes that the recruitment of Pol II and GTFs trigger nucleosome eviction. However, to date, only few examples suggest a correlation between Pol II occupancy, nucleosome depletion and transcriptional activity (Mavrich et al. 2008b; Schones et al. 2008).
Nucleosome positioning in the yeast genome Recent genome-wide studies have shown that nucleosome positioning around the TSS of most yeast genes shares the same basic organisation. Almost all yeast promoters are devoid of nucleosomes (Bernstein et al. 2004; Lee et al. 2004; Schwabish and Struhl 2004; Sekinger et al. 2005; Yuan et al. 2005; Zanton and Pugh 2006). The NFR is flanked by two well- positioned nucleosomes: the -1 and the +1 nucleosome, which are the first nucleosomes located upstream and downstream the TSS, respectively (Figure 13). The -1 nucleosome generally covers a region from -300 to -150 bp relative to the TSS, and can thus regulate the accessibility to promoter regulatory elements. During a transcription cycle, the -1 nucleosome undergoes changes that affect its stability, such as variant histone exchange, methylation, acetylation, repositioning or even eviction. Downstream of the -1 nucleosome there is a NFR and the TSS, followed by the +1 nucleosome, which is the most precisely phased nucleosome (Mavrich et al. 2008a). This nucleosome can contain the H2A.Z or H3.3 variant histones and carry histone tail modifications such as methylation or acetylation (Malik and Henikoff 2003; Cosgrove 2007; Kouzarides 2007; Li et al. 2007). These epigenetic changes may contribute to histone instability required for +1 nucleosome eviction and recruitment of the preinitiation complex. In this context, a recent study by Mavrich et al . suggests that the +1 nucleosome forms a barrier against which nucleosome are packed, resulting in uniform positioning, which decays at larger distances from the barrier (Mavrich et al. 2008a). Following the clear phasing of the nucleosomes in promoter regions, the consensus spacing disappears and random nucleosome positioning is observed in the coding regions (Figure 13).
47
Figure 13. Nucleosomal landscape of yeast genes (from (Jiang and Pugh 2009), originally adapted from (Mavrich et al. 2008b)). Nucleosome positions are represented along genic and intergenic regions in yeast. Nucleosomes are represented by gray ovals. Peaks and valleys represent average nucleosome density The green circle marks the TSS and the red circle marks the transcription termination site. Green shading reflects regions with high levels of H2A.Z, H3K4Me and nucleosome phasing.
In yeast, NFRs occur at promoters even in the absence of active transcription. This suggests that the NFRs reflect transcriptional competence of nucleosome-devoid promoters rather than transcriptional activity. Indeed, even if nucleosome depletion is permissive for transcription, it is not sufficient to activate genes.
Nucleosome positioning in the human genome Whereas nucleosome positioning has been well documented in yeast (Yuan et al. 2005; Lee et al. 2007) and other metazoans (Johnson et al. 2006; Mavrich et al. 2008b), information is more limited for the human genome (Dennis et al. 2007; Ozsolak et al. 2007). Ozsolak et al. performed a ChIP-on-chip study on more than 3’600 promoters and demonstrated that nucleosome depletion is observed at the TSSs of activate genes but not silent genes. Other examples have also illustrated the appearance of NFR at active promoters (Gal-Yam et al. 2006; Heintzman et al. 2007). In the study of Gal-Yam et al., the analysis of nucleosome positioning in the stress inducible human GRP78 gene revealed that nucleosomes are depleted upon stress induction over a 350 base pair region situated upstream of the TSS. The first genome-wide map of nucleosomes in the entire human genome was performed by Schones et al. using high-throughput sequencing of MNase-treated chromatin (Schones et al. 2008). In this study, the authors mapped nucleosomes in resting and activated T cells and
48 demonstrated that nucleosomes close to the TSS of active genes are highly phased, whereas this phasing is absent when genes are silent. Moreover, promoters exhibiting a stalled Pol II at the TSS had a pattern of nucleosome phasing similar to that of the promoters of active genes, suggesting that the presence of Pol II correlates with nucleosome positioning. This study also showed that T cell activation is accompanied by nucleosome reorganisation. The position of the +1 nucleosome differed between unexpressed and active genes, and H2A.Z incorporation and H3K4Me3 modification were found to be associated with nucleosome eviction or displacement at promoter regions.
49 II RESULTS
50 II.1 Transcription-coupled deposition of histone modifications during MHCII gene activation
II.1.1 Introduction
Previous studies had shown that MHCII gene activation was associated with the incorporation of specific histone modifications at the promoter region. In particular, the H3Ac, H4Ac, H3K4Me3, H3K4Me2 and H3R17Me2 marks had been associated with active transcription of MHCII genes. However, only the promoter region and a limited number of modifications were investigated by these studies. Furthermore, little information was provided on the timing of the incorporation of these histone marks during activation, or on the order in which they are established. The aim of the work presented in this section was to define the spatial distribution, order and timing of the establishment of different H3 and H4 methylation and acetylation marks during IFN γ-induced activation of the HLA-DRA gene. The results demonstrated that there are two chromatin modification phases that are distinct in time and space. The first phase starts with a global acetylation of histone H4 throughout a large domain situated upstream of the 5’end of the HLA-DRA gene. The second phase is accompanied by the incorporation of all other modifications, and is restricted to a limited region surrounding the TSS. The modifications incorporated during the second phase are consequences of ongoing transcription, and their introduction is thus dependent on, rather than instructive for, MHCII gene activation.
51 II.1.2 Article
“Transcription-coupled deposition of histone modifications during MHCII gene activation”
This part of the results is presented in the form of a research article published in Nucleic Acids Research (Rybtsova et al. 2007). The work described in this publication was performed in collaboration with Natalia Rybtsova.
52 Published online 3 May 2007 Nucleic Acids Research, 2007, Vol. 35, No. 10 3431–3441 doi:10.1093/nar/gkm214 Transcription-coupled deposition of histone modifications during MHC class II gene activation Natalia Rybtsova, Elisa Leimgruber, Queralt Seguin-Este´ vez, Isabelle Dunand-Sauthier, Michal Krawczyk and Walter Reith*
Department of Pathology and Immunology, University of Geneva Medical School, 1 rue Michel-Servet, CH-1211, Geneva, Switzerland
Received November 3, 2006; Revised March 20, 2007; Accepted March 27, 2007
ABSTRACT chromatin-templated processes such as transcription. Dynamic structural rearrangements that render the Posttranslational histone modifications associated chromatin permissive for transcription are therefore with actively expressed genes are generally intimately associated with the regulation of gene expres- believed to be introduced primarily by histone- sion. These structural rearrangements are believed to be modifying enzymes that are recruited by transcrip- facilitated by various posttranslational modifications of tion factors or their associated co-activators. We nucleosomal histones that affect chromatin structure have performed a comprehensive spatial and tem- either directly or by creating docking sites for the poral analyses of the histone modifications that are recruitment of effector proteins [for recent reviews see deposited upon activation of the MHC class II gene (1–3)]. HLA-DRA by the co-activator CIITA. We find that Among the most well-documented modifications asso- transcription-associated histone modifications are ciated with actively transcribed genes are the acetylation introduced during two sequential phases. The first of various lysine residues in the N-terminal tails of H3 and phase precedes transcription initiation and is char- H4 (H3Ac and H4Ac) (1), the di- and tri-methylation of lysine 4 in the N-terminal tail of H3 (H3K4Me2 and acterized exclusively by a rapid increase in histone H3K4Me3) (2) and the methylation of arginine 17 in the H4 acetylation over a large upstream domain. All N-terminal tail of H3 (H3R17Me2) (3). More recently, it other modifications examined, including the acet- has been shown that the methylation of lysine 9 in the ylation and methylation of several residues in N-terminal tail of H3 (H3K9Me3)—a modification that histone H3, are restricted to short regions situated was until then thought to be a hallmark of silent at or within the 50 end of the gene and are heterochromatin (2)—is actually also found within the established during a second phase that is concom- 50 ends of several actively transcribed mammalian itant with ongoing transcription. This second phase genes (4). It is now well established from studies in is completely abrogated when elongation by RNA multiple model systems and species that there is a tight polymerase II is blocked. These results provide correlation between the presence of these histone mod- strong evidence that transcription elongation can ifications and active gene expression (1–3). A widespread play a decisive role in the deposition of histone view is that histone-modifying activities are recruited by modification patterns associated with inducible transcription factors and/or associated co-activators, gene activation. and that they impact primarily on assembly of the general transcription machinery and transcription initia- tion (1–3,5). However, there is also growing evidence suggesting that factors associated with elongating RNA INTRODUCTION polymerase can play a key role in establishing histone The basic building block of eukaryotic chromatin is the modifications associated with actively expressed genes nucleosome, which consists of 147 bp of DNA wrapped (2,6–11). around an octamer of the four core histone proteins H3, A full understanding of the mechanisms that mediate H4, H2A and H2B. The packaging of DNA into the deposition and functional consequences of specific nucleosomes creates a restrictive environment that reduces histone modification patterns requires the analysis and the accessibility of DNA to factors that mediate integration of at least three related parameters: where in
*To whom correspondence should be addressed. Tel: þ41 22 379 56 66; Fax: þ41 22 379 57 46; Email: [email protected]
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors
ß 2007 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 3432 Nucleic Acids Research, 2007, Vol. 35, No. 10
the gene the various different histone modifications are A IFN-γ HLA-DR made, in what temporal order they are introduced and what steps in the transcription process they are implicated in (12–16). Yet in the majority of higher eukaryotic systems these three parameters have not been integrated CIITA into a single comprehensive and dynamic description of B the spatial distribution and temporal order of chromatin HLA-DR modification events that occur during the activation of 0h CIITA 48h transcription. We have performed such an analysis in one 24h of the most well-defined human model systems, the RFX RFX activation of major histocompatibility complex class II HLA-DRA S′-Y′ S-Y 100 101 102 (MHC-II) genes (17–19). (−2.3 kb) (−0.1 kb) Two modes of MHC-II expression, constitutive and C inducible, are recognized (17–19). Constitutive expression 4h is restricted mainly to specialized cells of the immune 1.0 CIITA mRNA system (thymic epithelial cells, dendritic cells, macro- 0.8 phages and B cells). Most other cell types do not express 0.6 MHC-II genes unless they are exposed to interferon-g DRA mRNA (IFN-g). The molecular machinery that regulates MHC-II expression has been exceptionally well defined thanks to 0.4 the elucidation of the genetic defects that are responsible for the Bare Lymphocyte Syndrome, a rare hereditary 0.2 hours + IFN-γ immunodeficiency disease resulting from mutations in 0.0 genes encoding transcription factors that are essential for 0 6 12 18 24 30 36 42 48
MHC-II expression (17,20–24). One of these factors, the D class II transactivator (CIITA) (20), is a transcriptional occupation CIITA co-activator that is exquisitely specific for the activation of 1.0 MHC-II genes (Figure 1A). CIITA serves as the master 0.8 regulator of MHC-II genes and is expressed in a cell-type- 0.6 specific and IFN-g-inducible manner that dictates both the 0.4 constitutive and inducible patterns of MHC-II expression 0.2 0.0 (19). It is recruited to the regulatory regions of MHC-II 0h 2h 4h 6h 12h 0h 2h 4h 6h 12h genes by protein–protein interactions with a multi-protein ‘enhanceosome’ complex that assembles on a character- occupation RFX5 1.0 istic enhancer known as the MHC-II S-Y module 0.8 (Figure 1A) (17,18,25–29). A heterotrimeric DNA-binding 0.6 factor called regulatory factor X (RFX) is a central 0.4 component of the enhanceosome complex (Figure 1A) 0.2 (17,21–24). 0 The activation of MHC-II genes by CIITA is associated 0h 2h 4h 6h 12h 0h 2h 4h 6h 12h with an increase in many of the major histone modifica- tions known to correlate with active transcription, HLA-DRA distal S′-Y′ proximal S-Y including H3Ac, H4Ac, H3K4Me2, H3K4Me3 and (−2.3 kb) (−0.1 kb) H3R17Me2 (26–32). Most studies examining these mod- ifications have restricted themselves to the promoters of Figure 1. Precise timing of IFN-g-induced HLA-DRA expression. (A) Molecular mechanism mediating IFN-g-induced HLA-DRA expres- MHC-II genes (28,30–32), despite the fact that several sion. IFN-g induces rapid expression of the gene coding for the reports have shown that they may affect distal regions as transcriptional co-activator CIITA, which activates transcription of the well (26,27,29). Moreover, only limited information is HLA-DRA gene by associating with an enhanceosome complex that 0 0 available on when and in what order these modifications assembles at its proximal (S-Y) and distal (S -Y ) regulatory modules. RFX is a key component of the enhanceosome complex. (B) Cell are introduced during the activation process (28,29,32). surface HLA-DR expression was measured by FACS in Me67.8 cells We have therefore performed a comprehensive analysis of stimulated with IFN-g for 0, 24 and 48 h. (C) The accumulation of the spatial distribution, order and timing of the histone CIITA and HLA-DRA mRNAs were quantified by real-time RT-PCR modifications that are introduced during IFN-g-induced in IFN-g-stimulated Me67.8 cells over a 48-h time period. Shading activation of the prototypical MHC-II gene HLA-DRA. highlights a 4-h lag period between the induction of CIITA and HLA-DRA mRNA accumulation. Results are expressed relative to the We demonstrate that there are two spatially and values measured after 48 h. The mean and SD are shown for four temporally distinct chromatin-modification phases. experiments. (D) Occupation of the HLA-DRA S-Y and S0-Y0 modules The first phase precedes the initiation of transcription by CIITA and RFX was measured by quantitative chromatin and is characterized by a global increase in H4 acetylation immunoprecipitation (ChIP) at the indicated times following stimula- tion with IFN-g. Shaded bars highlight the occupation that is induced throughout a large upstream domain. All other modifica- during the lag period preceding HLA-DRA gene activation. Results are tions are restricted to short regions situated within or near expressed relative to the plateau values reached after 12 h. The mean the 50 end of the gene and are introduced in a second phase and SD are shown for two experiments. Nucleic Acids Research, 2007, Vol. 35, No. 10 3433 that coincides with, and is a consequence of, ongoing and a phosphatase inhibitor cocktail (Sigma). Lysates transcription. With the exception of H4Ac, most mod- were clarified by centrifugation and protein concentra- ifications observed at the HLA-DRA gene are thus tions were determined. Proteins were dissolved in 2 established by transcription-coupled mechanisms. sample buffer and equal amounts were fractionated by SDS-PAGE. Proteins were transferred to Immobilon-P MATERIALS AND METHODS membranes (Millipore), which were incubated with rabbit polyclonal CARM1 antibodies (Upstate 07-080, used at Cells 1/1000 dilution), rabbit polyclonal CBP antibodies Me67.8 cells were grown in RPMIþGlutamax medium (SantaCruz sc-369, used at 1/500 dilution), rabbit poly- (Invitrogen) supplemented with 10% fetal calf serum and clonal pCAF antibodies (Abcam ab12188, gift from antibiotics, and were induced with 200 U/ml of human W. Herr, used at 1/600 dilution), rabbit polyclonal Set1c IFN-g (Invitrogen) as described (33). Cell surface HLA- antibodies (gift from W. Herr, used at 1/500 dilution), DR expression was analyzed by FACS as described (34). rabbit polyclonal WDR5 antibodies (gift from W. Herr, DRB (Sigma) was added to culture medium at a used at 1/500 dilution) and mouse monoclonal concentration of 100 mM. S2-phosphorylated-Pol II antibodies (Covance, MMS- 129R). Detection was performed using peroxidase con- Chromatin immunoprecipitation (ChIP) jugated anti-mouse or anti-rabbit IgG antibodies Chromatin preparation and ChIP experiments were (Promega) and chemiluminescence visualization (ECL, performed as described using antibodies specific for Amersham) according to the manufacturer’s instructions. RFX, CIITA and modified histones (26,27,31). Results Blots were quantified using Quantity One software. for modified histones were normalized using the TATA- binding protein (TBP) promoter as internal control and RESULTS were compensated for fluctuations in nucleosome density by performing ChIP experiments in parallel with an Precise timing of IFN-g-induced HLA-DRA gene antibody against unmodified H3. Histone antibodies were transcription obtained from Abcam, Cambridge, UK (H3, Ab1791; Histone modifications introduced during IFN-g-induced H4K5Ac, Ab1758; H3K4Me3, Ab8580; H3K4Me2, activation of the HLA-DRA gene were studied in the Ab7766; H3K9Me3, Ab8898; H3K36me3, Ab9050) or melanoma cell line Me67.8, which was chosen because it Upstate, Lake Placid, NY (H4Ac, 06-866; H4K8Ac, 07- exhibits a robust and reproducible induction of CIITA 328; H4K12Ac, 07-595; H4K16Ac, 07-329; H3Ac, 06-599; and MHC-II expression in response to INF-g (Figure 1A) H3K9Ac, 07-352; H3K14Ac, 07-353; H3K23Ac, 07-355; (33). Me67.8 cells respond to IFN-g in a synchronized H3K27Ac, 07-360; H3R17Me3, 07-214). The RNA Pol II manner, such that the entire population exhibits a antibody was from Abcam (Ab817). Results were homogeneous shift over time in the level of cell surface generated by real-time PCR using the primers listed in MHC-II expression (Figure 1B). Supplementary Table 1. PCR was performed using the Time course experiments were performed to document iCycler iQ Real-Time PCR Detection System (BioRad) the activation of CIITA and HLA-DRA mRNA expres- and a SYBR-Green-based kit for quantitative PCR (iQ sion (Figure 1C), as well as occupation of the HLA-DRA Supermix—BioRad). Amplification specificity was con- S-Y modules by CIITA and RFX (Figure 1D). The time trolled by gel electrophoresis and dissociation curve courses obtained for these parameters are highly repro- analysis. Results were quantified using a standard curve ducible from one experiment to another (see error bars in generated with serial dilutions of input DNA. PCR Figure 1). CIITA mRNA accumulation starts 2 h after amplifications were performed in triplicate. Experiments induction, whereas the increase in HLA-DRA mRNA only were repeated between two and five times with different becomes evident after 6 h (Figure 1C). During this 4-h lag inductions. period, occupation of the S-Y modules by CIITA and RFX increases to reach a plateau by 6 h (Figure 1D). RNA quantification These results define a precise 4-h time window during CIITA and DRA mRNAs were quantified by real-time which key events implicated in CIITA-mediated transcrip- RT-PCR and normalized with respect to TBP mRNA as tional initiation of the HLA-DRA gene are most likely to described (31,34). Chromatin-bound nascent and inter- occur. genic transcripts were isolated and quantified by real-time RT-PCR as described (26). Primers used for nascent and Two distinct phases of histone acetylation intergenic transcripts are listed in Supplementary Table 1. We performed chromatin immunoprecipitation (ChIP) PCR measurements were made in triplicate. Experiments experiments to examine changes in the levels of H3Ac and were repeated between two and four times with different H4Ac that are induced over time within a 7-kb domain inductions. that spans 5 kb of the upstream regulatory region and 2 kb of the 50 end of the HLA-DRA gene. Two spatially and Immunoblotting temporally distinct histone acetylation phases were Cells were lysed for 1 h on ice in 50 mM Tris-HCl, pH 7.4, evident (Figure 2). During the first phase, there was a 150 mM NaCl, 10 mM EDTA, 1% NP40, 1 mM DTT strong increase in H4Ac over the entire region examined. containing 1 completeTM protease inhibitors (Roche) This global increase in H4Ac was first evident after 3 h of 3434 Nucleic Acids Research, 2007, Vol. 35, No. 10
A A 30 5 0h 6h 12h 25 4 H4Ac 20 3
15 2 12h 10 1 0 5 0h K5 K8 K12 K16 0 B H4Ac 20 8 15 H3Ac H4K5Ac 12h 6 10 4 12h 5 0h 2 0 −6 kb −4 kb −2 kb 0 +2 kb 0h 0
S′-Y′ S-Y exon 1 intron B 8 H4K8Ac 20 6 12h 15 4
2 10 0h
0 5 −6 kb −4 kb −2 kb 0 +2 kb
0 * − − − 3.5 kb 1.3 kb +0.6 kb 0.1 kb +0.3 kb +0.6 kb S′-Y′ S-Y ex 1 intron
H4Ac H3Ac Figure 3. Specificity of H4 acetylation induced at the HLA-DRA gene. 0h 3h 4h 5h 6h 12h (A) The levels of acetylation at lysines K5, K8, K12 and K16 of H4 were measured by quantitative ChIP at the HLA-DRA promoter after Figure 2. Spatial and temporal patterns of the induction of histone induction with IFN-g for the indicated times. Similar results were acetylation at the HLA-DRA gene. (A) The levels of H4 (top, H4Ac) obtained at the other positions in the region analyzed in (B) (data not and H3 (bottom, H3Ac) acetylation were measured by quantitative shown). (B) Acetylation at H4K5 and H4K8 was measured by ChIP at different positions within the HLA-DRA gene in non-induced quantitative ChIP at the indicated positions in the HLA-DRA gene cells and cells treated with IFN-g for 12 h. A schematic map of the after 0 and 12 h of induction. All results are expressed relative to the HLA-DRA gene is shown below. (B) The levels of H4 (left) and H3 value observed at the promoter in non-induced cells. The mean and SD (right) acetylation were measured by quantitative ChIP at the indicated are shown for two experiments. positions after induction with IFN-g for the indicated times. For H4Ac, similar time courses were also observed at the other positions examined in (A) (data not shown). Asterisk denotes not measured in all experiments. All results are expressed relative to the value observed the first phase, H4 was acetylated mainly at K5 and K8 at the promoter in non-induced cells. The mean and SD are shown for (Figure 3A). No obvious increases in the acetylation of four (H4Ac) and five (H3Ac) experiments. H4K12 and H4K16 were evident (Figure 3A). As observed for H4Ac, the increases in H4K5Ac and H4K8Ac were early events that were essentially complete induction and reached nearly maximal levels by 6 h. by 6 h of induction (Figure 3A) and concerned the entire During the second phase, there was an increase in H3Ac 7-kb region (Figure 3B). During the second phase, the that was restricted to a short 1-kb region situated within strongest increase in acetylation was observed at K9 of H3 the 50 end of the gene. This local increase in H3Ac (Figure 4A). There was a more modest increase for occurred mainly between 6 and 12 h after the start of acetylation at H3K14, whereas no obvious changes were induction. evident for acetylation at H3K23 and H3K27 (Figure 4A). To define the precise lysine (K) residues that are As for H3Ac, the increase in H3K9Ac was a late event implicated in the two phases, we performed ChIP occurring mainly after 6 h of induction (Figure 4A) and experiments with antibodies directed against specific was restricted to the 50 end of the gene (Figure 4B). acetylated K residues of histones H4 and H3. During The acetylation specificity that we observed is consistent Nucleic Acids Research, 2007, Vol. 35, No. 10 3435
A 0h 4h 6h 12h A
5 4.0 1.2 4 3.0 0.8 3
2.0 H4Ac 2 0.4 1.0 1 0.0 0 0.0 0h 1h 2h 3h 4h 5h 6h 12h 24h K9 K14 K23 K27 K9 1.0 H3Ac 0.8 B 0.6
5 0.4
H3K9Ac RNA pol II 0.2 4 0.0 0h 1h 2h 3h 4h 5h 6h 12h 24h 3 1.0 2 0.8 1 0.6
H3Ac 0.4 0 −3 kb −2 kb−1 kb 0 +1 kb +2 kb 0.2 0.0 0h 1h 2h 3h 4h 5h 6h 12h 24h S′-Y′ S-Y ex 1 intron 1.0 Figure 4. Specificity of H3 acetylation induced at the HLA-DRA gene. 0.8 (A) The levels of acetylation at lysines K9, K14, K23 and K27 of H3 0.6 were measured by quantitative ChIP at position þ300 of the HLA-DRA gene after induction with IFN-g for the indicated times. 0.4 Similar results were obtained at the promoter and at þ600 (data not shown). (B) H3 acetylation at K9 was measured by quantitative ChIP 0.2 at the indicated positions in the HLA-DRA gene after 0 and 12 h of nascent transcripts 0.0 * induction. All results are expressed relative to the value observed at the 0h 1h 2h 3h 4h 5h 6h 12h 24h promoter in non-induced cells. The mean and SD are shown for three experiments. B 1.0 1.0 with previous reports showing that H4K8 and H3K9 are 0.8 among the major residues that are acetylated at the HLA- 0.8 DRA promoter in B cells and IFN-g-induced cells (29,30). 0.6 To situate the two phases of histone acetylation with 0.6 respect to the initiation of transcription, we performed 0.4 H3Ac 0.4 ChIP experiments to determine the timing of Pol II 0.2 recruitment at the HLA-DRA promoter and the appear- nascent transcripts ance of nascent chromatin-bound HLA-DRA transcripts 0.0 0.2 (Figure 5A). Pol II recruitment coincided with the increase 0h 6h 7h 8h 10h 12h in H4 acetylation and reached nearly maximal levels by Figure 5. Temporal relationship between the induction of histone 6 h. In contrast, nascent transcripts appeared mainly after acetylation, the recruitment of Pol II and the initiation of transcription. 6 h, in parallel with the increase in H3 acetylation. (A) H4 acetylation, H3 acetylation, recruitment of Pol II and the The first phase of H4 acetylation is thus associated with appearance of nascent chromatin-bound transcripts were quantified after the indicated times in IFN-g-induced cells. For H4Ac, the results Pol II recruitment but precedes the initiation of transcrip- represent the mean and SD for measurements made in three to four tion. In contrast, the subsequent H3 acetylation phase experiments at four positions ( 1.3, 0.1, þ0.3 and þ0.6 kb) in the appeared to coincide with active transcription. To confirm HLA-DRA gene. For H3Ac, the results represent the mean and SD for the latter, we performed a finer time course between 6 and measurements made in three to five experiments at three positions ( 0.1, þ0.3 and þ0.6 kb) in the HLA-DRA gene. For nascent 12 h (Figure 5B). The results indicate that the increase in transcripts, the results represent the mean and SD for measurements H3 acetylation and the appearance of nascent transcripts made in two experiments at three positions (þ0.3, þ0.6 and þ1.7 kb) are simultaneous events. within the HLA-DRA gene. For Pol II, results represent the mean and SD for measurements made at the promoter ( 0.04 kb) in four experiments. Asterisk denotes not measured in all experiments. H4 acetylation is associated with intergenic transcription (B) Nascent chromatin-bound transcripts (open bars) and H3 acety- lation (gray bars) were quantified in IFN-g-induced cells after the Constitutive expression of the HLA-DRA gene in B cells is indicated times. Results represent the mean and SD from two associated with intergenic transcription of its upstream experiments. 3436 Nucleic Acids Research, 2007, Vol. 35, No. 10
1.0 A H3K4Me 3 0.8 intergenic transcripts 8 5 7 +300 0.6 6 4 12h 5 3 0.4 4 0.2 3 2 2 0h 1 0.0 * 1 0h 1h 2h 3h 4h 5h 6h 12h 24h 0 0
B H3K4Me 2 4 1.0 8 7 +300 12h intergenic transcripts 3 0.8 6 5 2 0.6 4 12h 3 0.4 1 0h 2 0h 1 0.2 * 0 0 0.0 − − − − − C H3R17Me2 5 kb 4 kb 3 kb 2 kb 1 kb 0 6 9 8 5 7 4 −100 S′-Y′ S-Y 6 12h 5 3 Figure 6. Intergenic transcription induced by IFN-g in the upstream 4 3 2 region of the HLA-DRA gene. Intergenic transcripts were quantified by 2 * 0h 1 real-time RT-PCR at the indicated times and positions in the upstream 1 region of the HLA-DRA gene. In the time course experiment (top), the 0 0 results represent the mean and SD of measurements made in three D H3K9Me 3 experiments at six positions ( 4.9, 3.5, 2.3, 1.8, 1.3 and 0.1 kb) in the upstream region. The spatial distribution (bottom) shows the 8 mean and SD derived from three experiments in cells induced for 0 and 7 5 12 h. Asterisk denotes not measured in all experiments. 6 4 +300 5 4 12h 3 3 2 regulatory region (26). We therefore determined 2 0h 1 whether these intergenic transcripts are also observed in 1 0 0 IFN-g-induced cells (Figure 6). Intergenic transcripts were −3 kb −2 kb−1 kb 0 +1 kb +2 kb 0h 4h 6h 12h induced during the early phase of H4 acetylation, prior to transcription of the HLA-DRA gene itself. The abundance S′-Y′ S-Y ex 1 intron of these intergenic transcripts is highest just upstream of the promoter and in regions that flank the distal S0-Y0 Figure 7. Temporal and spatial pattern of IFN-g-induced H3 methyla- module (Figure 6). This IFN-g-induced pattern of tion. The induction of (A) H3K4Me2, (B) H3K4Me3, (C) H3R17Me2 intergenic transcription is similar to the one observed and (D) H3K9Me3 modifications were assessed at the indicated times and positions in the HLA-DRA gene. In the left panels, results are previously in B cells (26). presented for cells induced with IFN-g for 0 and 12 h. In the right panels, time courses are shown for positions at which the modifications H3 acetylation coincides with increased H3 methylation attain a peak. The mean and SD are shown for two experiments. Asterisk denotes not measured in all experiments. To examine where and when changes in H3 methylation occur during IFN-g-induced expression of the HLA-DRA gene, we performed ChIP experiments with antibodies directed against H3K4Me3, H3K4Me2, H3R17Me2 and All H3 modifications are transcription dependent H3K9Me3 (Figure 7). Increases restricted to short regions situated near the 50 end of the HLA-DRA gene were With respect to both their timing and position, the observed for all four modifications. The increases in increases in H3 acetylation and methylation coincide H3K4Me3, H3K4Me2 and H3K9Me3 peaked at a with active transcription of the HLA-DRA gene, raising position situated after the transcription initiation site. the possibility that they might actually be a consequence The strongest increase in H3R17Me2 was situated at the of transcription. To address this possibility, we induced transcription initiation site. These methylation events cells with IFN-g for 6 h to permit the induction of CIITA occurred mainly after 6 h, although the increase in expression and completion of the early H4 acetylation H3K4Me2 appeared to precede the others somewhat. phase, and then continued the induction in the presence of Taken together, these results show that introduction of the the drug 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole H3 methylation marks overlaps temporally and spatially (DRB) (Figure 8A), which blocks transcription elongation with increased H3 acetylation. by inhibiting phosphorylation of the C-terminal domain Nucleic Acids Research, 2007, Vol. 35, No. 10 3437
A D IFN-γ + or -DRB CARM1
CBP 0h 6h 12h pCAF B Set1 phospho-Pol II CIITA RFX 1.0 100 10 WDR5 0.8 10 tubulin 0.6 1 0.4 0h 6h 12h DRB 1 0.2 0.0 −DRB +DRB 0h 6h DRB 0h 6h DRB
C DRA mRNA Pol II 7 H4Ac 1.0 1.0 6 0.8 0.8 5 4 0.6 0.6 3 0.4 0.4 2 0.2 0.2 1 0.0 0.0 0 6 H3Ac 4 K4Me3 4 K4Me2 5 3 3 4 3 2 2 2 1 1 1 0 0 0 7 R17Me2 K9Me3 3 K36Me3 6 16 5 2 4 12 3 8 2 1 4 1 0 0 0 0h 6h 12hDRB 0h 6h 12hDRB 0h 6h 12hDRB
Figure 8. Most IFN-g-induced histone modifications deposited at the HLA-DRA gene are a consequence of active transcription. (A) The diagram depicts the protocol used to document the effect of DRB on IFN-g-induced HLA-DRA gene activation. (B) The effect of DRB on the phosphorylation of Pol II was assessed by western blotting (left), whereas its effect on HLA-DRA promoter occupation by RFX (right) and CIITA (middle) was measured by ChIP. (C) HLA-DRA mRNA accumulation, the recruitment of Pol II at the promoter, and the levels of the indicated modifications were measured after 0, 6 and 12 h of induction with IFN-g, and after 12 h of induction in the presence of DRB for the last 6 h. Results are shown for measurements made at the promoter (Pol II and R17Me2), at þ300 (H4Ac, H3Ac, H3K4Me3, H3K4Me2 and H3K9Me3) and in exon 5 (H3K36Me3). Similar results were obtained at other positions in the modified regions (data not shown). The mean and SD are shown for two experiments. (D) Protein levels of the indicated histone modifying factors were measured by western blotting in cells treated as in panel C.
(CTD) of Pol II (Figure 8B) (35,36). This protocol in H3Ac, H3K4Me3, H3K4Me2, H3R17Me2 and completely blocked the induction of HLA-DRA mRNA H3K9Me3, which occur mainly after 6 h, were all accumulation (Figure 8C) and reduced Pol II density completely eliminated by DRB. The introduction of within the body of the gene (Supplementary Figure 1). these five modifications thus behaves in a manner similar As expected, DRB did not significantly affect HLA-DRA to that of the H3K36Me3 modification (Figure 8C), which promoter occupation by RFX and CIITA, the acetylation is known to be strictly dependent on active Pol II of H4 or recruitment of Pol II to the promoter (Figure 8B elongation (2). and C). Events that precede the initiation of HLA-DRA To ascertain that the DRB sensitivity of the H3Ac, transcription had thus been completed and were not H3K4Me3, H3K4Me2, H3R17Me2 and H3K9Me3 mod- reversed by the addition of DRB. In contrast, the increases ifications is not a non-specific consequence of a general 3438 Nucleic Acids Research, 2007, Vol. 35, No. 10 block in the transcription of genes encoding histone- Among the histone modifications we have examined, modifying factors, we examined the levels of several key only the rapid and long-range increase in H4 acetylation proteins by western blotting experiments. These included coincides temporally with the recruitment of CIITA and the histone acetyltransferase (HAT) factors [cyclic AMP occurs prior to and independently of active transcription responsive-element binding-protein (CBP) and p300/CBP- of the HLA-DRA gene. This suggests that only the early associated factor (pCAF)], the histone methyltransferase H4 acetylation phase is likely to be mediated by HATs (HMT) factors (Set1 and WDR5), and the H3R17-specific that are recruited directly by CIITA. HATs that are HMT CARM1 (Figure 8D). We also examined the HAT believed to be able to cooperate with CIITA include CBP, GCN5 (data not shown). No drop in the abundance of pCAF, GCN5 and steroid receptor co-activator (SRC)-1. any of these proteins was induced by the 6-h DRB These HATs have been reported to be recruited to MHC- treatment. II promoters in B cells and IFN-g-induced cells, can Taken together, these results are consistent with the interact with CIITA in vitro and upon over expression in model that the H3Ac, H3K4Me3, H3K4Me2, H3R17Me2 transfected cells, and can activate MHC-II reporter genes and H3K9Me3 modifications are introduced in a in synergy with CIITA in transient transfection experi- transcription-coupled manner during IFN-g-induced acti- ments (38–42). However, we have so far been unable to vation of the HLA-DRA gene. document a robust and reproducible recruitment of any of these HATs in a pattern that coincides temporally and spatially with the binding of CIITA and the early increase DISCUSSION in H4 acetylation. One explanation that could account for this discrepancy is that these HATs associate only Our results demonstrate that histone modifications transiently with the HLA-DRA upstream region. associated with IFN-g-induced HLA-DRA gene activation Alternatively, other HATs could be implicated. Since are introduced during two sequential phases that differ CIITA has been reported to have intrinsic HAT activity with respect to their timing, the regions of the gene that (43), one possibility is that CIITA itself might be are concerned, the precise modifications that are made and responsible for the increase in H4 acetylation. A second their dependence on ongoing transcription. The first phase intriguing possibility is suggested by the finding that precedes the initiation of transcription and is character- intergenic transcription is induced in the HLA-DRA ized by a rapid increase in H4K5 and H4K8 acetylation upstream region according to a pattern that is similar to over a large upstream domain. The second phase is that observed for H4 acetylation with respect to both concomitant with active transcription and is characterized timing and spatial distribution. Intergenic transcription by increases in H3K9Ac, H3K4Me2, H3K4Me3, has been attributed a regulatory function in the establish- H3K9Me3 and H3R17Me2 in short regions situated at ment of open chromatin domains in several systems 0 or within the 5 end of the gene. This second phase is (44–49). It has notably been suggested to contribute to the completely blocked by the transcription elongation function of locus control regions (LCRs) (44,45,49). inhibitor DRB, indicating that it is a consequence of Among other models, it has been postulated that the active elongation by Pol II. regulatory role of intergenic transcription could be due to The timing, localization and transcription-dependence chromatin remodeling activities—such as HATs—that of the increases in H3Ac, H3K4Me2, H3K4Me3, track along the chromatin with Pol II (50–55). Since the H3K9Me3 and H3R17Me2 suggest that these marks are HLA-DRA upstream regions exhibit properties typical of introduced by HATs and HMTs that are recruited by LCRs (26,56–58), it is tempting to speculate that such a actively transcribing Pol II, associated elongation factors tracking mechanism is operating during the early phase of and/or prior histone modifications that were introduced in H4 acetylation observed during HLA-DRA gene activa- a transcription-dependent manner. Moreover, they imply tion. We can however not exclude the possibility that the that most histone modifications introduced during HLA- intergenic transcription is a consequence rather than a DRA gene activation do not play a role in facilitating cause of increased H4 acetylation. assembly of the general transcription machinery and Our results highlight a dominant role of transcription transcription initiation, but are instead likely to be elongation in the recruitment of histone-modifying activ- implicated in subsequent processes such as promoter ities during the induction of MHC-II gene expression. clearance, transcription elongation and/or the establish- This is at odds with widespread models of gene regulation ment of transcriptional memory. These conclusions are postulating that HATs and HMTs are primarily recruited consistent with previous reports suggesting that phosphor- by DNA-bound transcription factors and their associated ylation of the CTD of Pol II by the CDK7 subunit of the co-activators (1–3,5). However, there is growing evidence general transcription factor TFIIH and the CDK9 subunit that a decisive role of transcription elongation in the of the transcription elongation factor pTEFb are key establishment of histone modifications is not just a events in CIITA-induced MHC-II gene expression (28,37). peculiarity of the MHC-II system. In contrast, our results challenge current models propos- There is strong evidence for a link between deposition of ing that CIITA serves as a scaffolding protein that recruits the H3K4Me3 mark and transcription elongation in and coordinates all key chromatin-modifying activities at Saccharomyces cerevisiae. Set1—the HMT responsible MHC-II promoters, and that the modifications introduced for methylating H3K4 in yeast—is recruited to the by these activities are primarily required for transcription elongating CTD-phosphorylated form of Pol II by its initiation at MHC-II genes (5). interaction with the elongation factor Paf1 (2,6–8). Nucleic Acids Research, 2007, Vol. 35, No. 10 3439
This mode of recruitment is consistent with the results of Taken together, the findings outlined above suggest that genome-wide mapping studies, which have shown that transcription elongation may play a critical role in the density of H3K4 methylation generally peaks within establishing histone-modification patterns associated the 50 transcribed portion of active yeast genes (59,60). with many actively expressed genes in species ranging The link between H3K4 methylation and transcription from yeast to humans. The results reported here for elongation is less well established in higher eukaryotes. activation of the HLA-DRA gene are thus likely to be of Set1 homolog in higher eukaryotes—of which there are widespread relevance to numerous gene regulatory sys- several—have in fact been reported to be recruited by tems in diverse species. interactions with specific transcription factors (61–65). However, large-scale mapping studies in Drosophila melanogaster and humans, as well as a more limited SUPPLEMENTARY DATA study in the chicken, have demonstrated that H3K4 Supplementary Data are available at NAR Online. methylation is, like in yeast, frequently concentrated within the 50 transcribed regions of active genes (66–70). Moreover, a protein fraction enriched in H3K4-specific ACKNOWLEDGEMENTS HMT activity was recently reported to introduce the We are grateful to Michel Strubin, Iannis Talianidis, and H3K4Me3 modification in a transcription-coupled current and past members of the laboratory for valuable manner in a reconstituted human in vitro transcription discussions and critical reading of the manuscript. This system (71). These findings suggest that a transcription- work was supported by the Swiss National Science dependent mode of recruitment of H3K4-specific HMTs is Foundation. Funding to pay the Open Access publication conserved in higher eukaryotes. charges for this article was provided by the Swiss National There are also indications that H3 acetylation may be Science Foundation. coupled to transcription elongation at numerous genes in diverse species. Large-scale mapping studies performed in Conflict of interest statement. None declared. S. cerevisiae, Schizosaccharomyces pombe, D. melanogaster and humans have established that the density of H3 REFERENCES acetylation tends to peak, as observed here at the HLA- DRA gene, within the 50 transcribed region of expressed 1. Kurdistani,S.K. and Grunstein,M. (2003) Histone acetylation and deacetylation in yeast. Nat. Rev. Mol. Cell Biol., 4, 276–284. genes (59,60,67,68,70,72,73). This intragenic localization 2. Martin,C. and Zhang,Y. (2005) The diverse functions of histone would be consistent with a widespread role of active lysine methylation. Nat. Rev. Mol. Cell Biol., 6, 838–849. transcription in increasing H3 acetylation. Transcription- 3. Wysocka,J., Allis,C.D. and Coonrod,S. (2006) Histone arginine dependent H3 acetylation could be mediated by HATs, methylation and its dynamic regulation. Front Biosci., 11, 344–355. 4. Vakoc,C.R., Mandat,S.A., Olenchock,B.A. and Blobel,G.A. (2005) such as the elongator complex, that travel along chroma- Histone H3 lysine 9 methylation and HP1gamma are associated tin in association with elongating Pol II (9,51–54). with transcription elongation through mammalian chromatin. Alternatively, several findings suggest that H3 acetylation Mol. Cell, 19, 381–391. could be coupled to H3K4 methylation. Large-scale 5. Wright,K.L. and Ting,J.P. (2006) Epigenetic regulation of MHC-II mapping studies have shown that the patterns of H3Ac and CIITA genes. Trends Immunol., 27, 405–412. 6. Krogan,N.J., Dover,J., Wood,A., Schneider,J., Heidt,J., and H3K4Me3 often coincide (59,60,67,68,70,72,73). Boateng,M.A., Dean,K., Ryan,O.W., Golshani,A. et al. (2003) Moreover, methylation at K4 makes H3 a preferential The Paf1 complex is required for histone H3 methylation by target for dynamic changes in acetylation (74). Finally, COMPASS and Dot1p: linking transcriptional elongation to histone histone-modifying complexes containing both HAT and methylation. Mol. Cell, 11, 721–729. 7. Ng,H.H., Robert,F., Young,R.A. and Struhl,K. (2003) Targeted H3K4-specific HMT subunits have been identified in recruitment of Set1 histone methylase by elongating Pol II provides yeast, D. melanogaster and humans (11,65,75). a localized mark and memory of recent transcriptional activity. The recruitment of CARM1, the HMT responsible for Mol. Cell, 11, 709–719. making the H3R17Me2 modification, is believed to be 8. Eissenberg,J.C. and Shilatifard,A. (2006) Leaving a mark: the many footprints of the elongating RNA polymerase II. Curr. Opin. mediated by interactions with specific transcription factors Genet. Dev., 16, 184–190. or co-activators (3,14,15,32,76). However, in two systems 9. Close,P., Hawkes,N., Cornez,I., Creppe,C., Lambert,C.A., CARM1 recruitment has been shown to be dependent on Rogister,B., Siebenlist,U., Merville,M.P., Slaugenhaupt,S.A. et al. the prior acetylation of H3 (14,15). Tethering of CARM1 (2006) Transcription impairment and cell migration defects in elongator-depleted cells: implication for familial dysautonomia. to chromatin modifications established during active Mol. Cell, 22, 521–531. transcription, such as H3 acetylation, might thus consti- 10. Saunders,A., Core,L.J. and Lis,J.T. (2006) Breaking barriers to tute an alternative pathway for CARM1 recruitment. transcription elongation. Nat. Rev. Mol. Cell Biol., 7, 557–567. Finally, our results extend the recent discovery that the 11. Smith,S.T., Petruk,S., Sedkov,Y., Cho,E., Tillib,S., Canaani,E. and 0 Mazo,A. (2004) Modulation of heat shock gene expression by the H3K9Me3 mark is introduced into the 5 transcribed TAC1 chromatin-modifying complex. Nat. Cell Biol., 6, 162–167. region of mouse and human genes by a transcription- 12. Metivier,R., Penot,G., Hubner,M.R., Reid,G., Brand,H., Kos,M. elongation-dependent process (4). As observed here at the and Gannon,F. (2003) Estrogen receptor-alpha directs ordered, HLA-DRA gene, this previous report also demonstrated cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell, 115, 751–763. co-localization between the H3K9Me3 and H3K4Me3 13. Kouskouti,A. and Talianidis,I. (2005) Histone modifications marks, suggesting that their introduction might be defining active genes persist after transcriptional and mitotic coupled (4). inactivation. EMBO J., 24, 347–357. 3440 Nucleic Acids Research, 2007, Vol. 35, No. 10
14. An,W., Kim,J. and Roeder,R.G. (2004) Ordered cooperative accompanied by rapid transcriptional silencing of class II functions of PRMT1, p300, and CARM1 in transcriptional transactivator (CIITA) expression. J. Exp. Med., 194, 379–391. activation by p53. Cell, 117, 735–748. 35. Chodosh,L.A., Fire,A., Samuels,M. and Sharp,P.A. (1989) 15. Daujat,S., Bauer,U.M., Shah,V., Turner,B., Berger,S. and 5,6-Dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits Kouzarides,T. (2002) Crosstalk between CARM1 methylation and transcription elongation by RNA polymerase II in vitro. CBP acetylation on histone H3. Curr. Biol., 12, 2090–2097. J. Biol. Chem., 264, 2250–2257. 16. Agalioti,T., Chen,G. and Thanos,D. (2002) Deciphering the 36. Yankulov,K., Yamashita,K., Roy,R., Egly,J.M. and Bentley,D.L. transcriptional histone acetylation code for a human gene. Cell, 111, (1995) The transcriptional elongation inhibitor 5,6-dichloro-1-beta- 381–392. D-ribofuranosylbenzimidazole inhibits transcription factor 17. Reith,W. and Mach,B. (2001) The bare lymphocyte syndrome and IIH-associated protein kinase. J. Biol. Chem., 270, 23922–23925. the regulation of MHC expression. Ann. Rev. Immunol., 19, 37. Kanazawa,S., Okamoto,T. and Peterlin,B.M. (2000) Tat competes 331–373. with CIITA for the binding to P-TEFb and blocks the expression of 18. Ting,J.P. and Trowsdale,J. (2002) Genetic control of MHC class II MHC class II genes in HIV infection. Immunity, 12, 61–70. expression. Cell, 109, S21–S33. 38. Kretsovali,A., Agalioti,T., Spilianakis,C., Tzortzakaki,E., 19. Reith,W., LeibundGut-Landmann,S. and Waldburger,J.M. (2005) Merika,M. and Papamatheakis,J. (1998) Involvement of CREB Regulation of MHC class II gene expression by the class II binding protein in expression of major histocompatibility complex transactivator. Nat. Rev. Immunol., 5, 793–806. class II genes via interaction with the class II transactivator. 20. Steimle,V., Otten,L.A., Zufferey,M. and Mach,B. (1993) Mol. Cell. Biol., 18, 6777–6783. Complementation cloning of an MHC class II transactivator 39. Fontes,J.D., Kanazawa,S., Jean,D. and Peterlin,B.M. (1999) mutated in hereditary MHC class II deficiency. Cell, 75, 135–146. Interactions between the class II transactivator and CREB binding 21. Steimle,V., Durand,B., Barras,E., Zufferey,M., Hadam,M.R., protein increase transcription of major histocompatibility complex Mach,B. and Reith,W. (1995) A novel DNA binding regulatory class II genes. Mol. Cell. Biol., 19, 941–947. factor is mutated in primary MHC class II deficiency (bare 40. Zhu,X.S. and Ting,J.P. (2001) A 36-amino-acid region of CIITA is lymphocyte syndrome). Genes Dev., 9, 1021–1032. an effective inhibitor of CBP: novel mechanism of gamma 22. Durand,B., Sperisen,P., Emery,P., Barras,E., Zufferey,M., Mach,B. interferon-mediated suppression of collagen alpha(2)(I) and other and Reith,W. (1997) RFXAP, a novel subunit of the RFX DNA promoters. Mol. Cell. Biol., 21, 7078–7088. binding complex is mutated in MHC class II deficiency. EMBO J., 41. Spilianakis,C., Papamatheakis,J. and Kretsovali,A. (2000) 16, 1045–1055. Acetylation by PCAF enhances CIITA nuclear accumulation and 23. Masternak,K., Barras,E., Zufferey,M., Conrad,B., Corthals,G., transactivation of major histocompatibility complex class II genes. Aebersold,R., Sanchez,J.C., Hochstrasser,D.F., Mach,B. et al. Mol. Cell. Biol., 20, 8489–8498. (1998) A gene encoding a novel RFX-associated transactivator is 42. Tzortzakaki,E., Spilianakis,C., Zika,E., Kretsovali,A. and mutated in the majority of MHC class II deficiency patients. Papamatheakis,J. (2003) Steroid receptor coactivator 1 links the Nat. Genet., 20, 273–277. steroid and interferon gamma response pathways. Mol. Endocrinol., 24. Nagarajan,U.M., Louis-Plence,P., DeSandro,A., Nilsen,R., 17, 2509–2518. Bushey,A. and Boss,J.M. (1999) RFX-B is the gene responsible for 43. Raval,A., Howcroft,T.K., Weissman,J.D., Kirshner,S., Zhu,X.S., the most common cause of the bare lymphocyte syndrome, an Yokoyama,K., Ting,J. and Singer,D.S. (2001) Transcriptional MHC class II immunodeficiency. Immunity, 10, 153–162. coactivator, CIITA, is an acetyltransferase that bypasses a promoter 25. Masternak,K., Muhlethaler-Mottet,A., Villard,J., Zufferey,M., requirement for TAF(II)250. Mol. Cell, 7, 105–115. Steimle,V. and Reith,W. (2000) CIITA is a transcriptional 44. Plant,K.E., Routledge,S.J. and Proudfoot,N.J. (2001) Intergenic coactivator that is recruited to MHC class II promoters by multiple transcription in the human beta-globin gene cluster. Mol. Cell. Biol., synergistic interactions with an enhanceosome complex. Genes Dev., 21, 6507–6514. 14, 1156–1166. 45. Routledge,S.J. and Proudfoot,N.J. (2002) Definition of 26. Masternak,K., Peyraud,N., Krawczyk,M., Barras,E. and Reith,W. transcriptional promoters in the human beta globin locus control (2003) Chromatin remodeling and extragenic transcription at the region. J. Mol. Biol., 323, 601–611. MHC class II locus control region. Nature Immunol., 4, 132–137. 46. Rogan,D.F., Cousins,D.J., Santangelo,S., Ioannou,P.A., 27. Krawczyk,M., Peyraud,N., Rybtsova,N., Masternak,K., Bucher,P., Barras,E. and Reith,W. (2004) Long distance control of Antoniou,M., Lee,T.H. and Staynov,D.Z. (2004) Analysis of MHC class II expression by multiple distal enhancers regulated intergenic transcription in the human IL-4/IL-13 gene cluster. by regulatory factor X complex and CIITA. J. Immunol., 173, Proc. Natl Acad. Sci. USA, 101, 2446–2451. 6200–6210. 47. Bolland,D.J., Wood,A.L., Johnston,C.M., Bunting,S.F., 28. Spilianakis,C., Kretsovali,A., Agalioti,T., Makatounakis,T., Morgan,G., Chakalova,L., Fraser,P.J. and Corcoran,A.E. (2004) Thanos,D. and Papamatheakis,J. (2003) CIITA regulates Antisense intergenic transcription in V(D)J recombination. transcription onset viaSer5-phosphorylation of RNA Pol II. Nat. Immunol., 5, 630–637. EMBO J., 22, 5125–5136. 48. Schmitt,S., Prestel,M. and Paro,R. (2005) Intergenic transcription 29. Gomez,J.A., Majumder,P., Nagarajan,U.M. and Boss,J.M. (2005) through a polycomb group response element counteracts silencing. X box-like sequences in the MHC class II region maintain Genes Dev., 19, 697–708. regulatory function. J. Immunol., 175, 1030–1040. 49. Gribnau,J., Diderich,K., Pruzina,S., Calzolari,R. and Fraser,P. 30. Beresford,G.W. and Boss,J.M. (2001) CIITA coordinates multiple (2000) Intergenic transcription and developmental remodeling of histone acetylation modifications at the HLA- DRA promoter. chromatin subdomains in the human beta-globin locus. Mol. Cell, 5, Nat. Immunol., 2, 652–657. 377–386. 31. Masternak,K. and Reith,W. (2002) Promoter-specific functions of 50. Engel,J.D. and Tanimoto,K. (2000) Looping, linking, and chro- CIITA and the MHC class II enhanceosome in transcriptional matin activity: new insights into beta-globin locus regulation. Cell, activation. EMBO J., 21, 1379–1388. 100, 499–502. 32. Zika,E., Fauquier,L., Vandel,L. and Ting,J.P. (2005) Interplay 51. Svejstrup,J.Q. (2004) The RNA polymerase II transcription cycle: among coactivator-associated arginine methyltransferase 1, CBP, cycling through chromatin. Biochim. Biophys. Acta, 1677, 64–73. and CIITA in IFN-gamma-inducible MHC-II gene expression. 52. Wittschieben,B.O., Otero,G., de Bizemont,T., Fellows,J., Proc. Natl Acad. Sci. USA, 102, 16321–16326. Erdjument-Bromage,H., Ohba,R., Li,Y., Allis,C.D., Tempst,P. et al. 33. Muhlethaler-Mottet,A., Di Berardino,W., Otten,L.A. and Mach,B. (1999) A novel histone acetyltransferase is an integral subunit (1998) Activation of the MHC class II transactivator CIITA by of elongating RNA polymerase II holoenzyme. Mol. Cell, 4, 123– interferon-g requires cooperative interaction between Stat1 and 128. USF-1. Immunity, 8, 157–166. 53. Hawkes,N.A., Otero,G., Winkler,G.S., Marshall,N., Dahmus,M.E., 34. Landmann,S., Muhlethaler-Mottet,A., Bernasconi,L., Suter,T., Krappmann,D., Scheidereit,C., Thomas,C.L., Schiavo,G. et al. Waldburger,J.M., Masternak,K., Arrighi,J.F., Hauser,C., (2002) Purification and characterization of the human elongator Fontana,A. et al. (2001) Maturation of dendritic cells is complex. J. Biol. Chem., 277, 3047–3052. Nucleic Acids Research, 2007, Vol. 35, No. 10 3441
54. Kim,J.H., Lane,W.S. and Reinberg,D. (2002) Human elongator association and coordinate function of the H3 K4 methyltransferase facilitates RNA polymerase II transcription through chromatin. MLL1 and the H4 K16 acetyltransferase MOF. Cell, 121, 873–885. Proc. Natl Acad. Sci. USA, 99, 1241–1246. 66. Miao,F. and Natarajan,R. (2005) Mapping global histone 55. Travers,A. (1999) Chromatin modification by DNA tracking. methylation patterns in the coding regions of human genes. Proc. Natl Acad. Sci. USA, 96, 13634–13637. Mol. Cell. Biol., 25, 4650–4661. 56. Carson,S. and Wiles,M.V. (1993) Far upstream regions of 67. Schubeler,D., MacAlpine,D.M., Scalzo,D., Wirbelauer,C., class II MHC Ea are necessary for position-independent, Kooperberg,C., van,L.F., Gottschling,D.E., O’Neill,L.P., copy-dependent expression of Ea transgene. Nucleic Acids Res., 21, Turner,B.M. et al. (2004) The histone modification pattern of active 2065–2072. genes revealed through genome-wide chromatin analysis of a higher 57. Carson,S. (1991) DNase I hypersensitive sites flank the mouse eukaryote. Genes Dev., 18, 1263–1271. class II major histocompatibility complex during B cell develop- 68. Liang,G., Lin,J.C., Wei,V., Yoo,C., Cheng,J.C., Nguyen,C.T., ment. Nucleic Acids Res., 19, 5007–5014. Weisenberger,D.J., Egger,G., Takai,D. et al. (2004) Distinct 58. Dorn,A., Fehling,H.J., Koch,W., Lemeur,M., Gerlinger,P., localization of histone H3 acetylation and H3-K4 methylation to Benoist,C. and Mathis,D. (1988) B cell control region at the 50 end the transcription start sites in the human genome. Proc. Natl Acad. of a major histocompatibility complex class II gene: sequences and Sci. USA, 101, 7357–7362. factors. Mol. Cell. Biol., 8, 3975–3987. 69. Schneider,R., Bannister,A.J., Myers,F.A., Thorne,A.W., 59. Pokholok,D.K., Harbison,C.T., Levine,S., Cole,M., Hannett,N.M., Crane-Robinson,C. and Kouzarides,T. (2004) Histone H3 lysine 4 Lee,T.I., Bell,G.W., Walker,K., Rolfe,P.A. et al. (2005) methylation patterns in higher eukaryotic genes. Nat. Cell Biol., 6, Genome-wide map of nucleosome acetylation and methylation in 73–77. yeast. Cell, 122, 517–527. 70. Bernstein,B.E., Kamal,M., Lindblad-Toh,K., Bekiranov,S., 60. Liu,C.L., Kaplan,T., Kim,M., Buratowski,S., Schreiber,S.L., Bailey,D.K., Huebert,D.J., McMahon,S., Karlsson,E.K., Friedman,N. and Rando,O.J. (2005) Single-nucleosome mapping of Kulbokas,E.J.III et al. (2005) Genomic maps and comparative Cell histone modifications in S. cerevisiae. PLoS Biol., 3, e328. analysis of histone modifications in human and mouse. , 120, 169–181. 61. Sedkov,Y., Cho,E., Petruk,S., Cherbas,L., Smith,S.T., Jones,R.S., 71. Pavri,R., Zhu,B., Li,G., Trojer,P., Mandal,S., Shilatifard,A. and Cherbas,P., Canaani,E., Jaynes,J.B. et al. (2003) Methylation at Reinberg,D. (2006) Histone H2B monoubiquitination functions lysine 4 of histone H3 in ecdysone-dependent development of cooperatively with FACT to regulate elongation by RNA Drosophila. Nature, 426, 78–83. polymerase II. Cell, 125, 703–717. 62. Milne,T.A., Briggs,S.D., Brock,H.W., Martin,M.E., Gibbs,D., 72. Sinha,I., Wiren,M. and Ekwall,K. (2006) Genome-wide patterns Allis,C.D. and Hess,J.L. (2002) MLL targets SET domain of histone modifications in fission yeast. Chromosome Res., 14, methyltransferase activity to Hox gene promoters. Mol. Cell, 10, 95–105. 1107–1117. 73. Roh,T.Y., Cuddapah,S. and Zhao,K. (2005) Active chromatin 63. Nakamura,T., Mori,T., Tada,S., Krajewski,W., Rozovskaia,T., domains are defined by acetylation islands revealed by genome-wide Wassell,R., Dubois,G., Mazo,A., Croce,C.M. et al. (2002) ALL-1 is mapping. Genes Dev., 19, 542–552. a histone methyltransferase that assembles a supercomplex of 74. Hazzalin,C.A. and Mahadevan,L.C. (2005) Dynamic acetylation of proteins involved in transcriptional regulation. Mol. Cell, 10, all lysine 4-methylated histone H3 in the mouse nucleus: analysis at 1119–1128. c-fos and c-jun. PLoS Biol., 3, e393. 64. Wysocka,J., Myers,M.P., Laherty,C.D., Eisenman,R.N. and 75. Pray-Grant,M.G., Daniel,J.A., Schieltz,D., Yates,J.R.III and Herr,W. (2003) Human Sin3 deacetylase and trithorax-related Set1/ Grant,P.A. (2005) Chd1 chromodomain links histone H3 Ash2 histone H3-K4 methyltransferase are tethered together methylation with. Nature, 433, 434–438. selectively by the cell-proliferation factor HCF-1. Genes Dev., 17, 76. Covic,M., Hassa,P.O., Saccani,S., Buerki,C., Meier,N.I., 896–911. Lombardi,C., Imhof,R., Bedford,M.T., Natoli,G. et al. (2005) 65. Dou,Y., Milne,T.A., Tackett,A.J., Smith,E.R., Fukuda,A., Arginine methyltransferase CARM1 is a promoter-specific regulator Wysocka,J., Allis,C.D., Chait,B.T., Hess,J.L. et al. (2005) Physical of NF-kappaB-dependent gene expression. EMBO J., 24, 85–96. Rybtsova_Supplementary_Figure 1
promoter intron 1 exon 3 exon 5 1.0
0.8
0.6
0.4
0.2 h + IFN-γ 0 12 0 6 12 12 0 6 12 12 0 6 12 12 DRB -- - - - + - - - + --- +
Supplementary Figure 1 . RNA Pol II densities in the promoter, intron 1, exon 3 and exon 5 were measured by ChIP in cells treated with IFN-γ for 0, 6 and 12 hours, and in cells treated with IFN-γ for 12 hours plus DRB for the last 6 hours. Results are represented relative to the value obtained at the promoter after 12 hours of induction. Rybtsova et al, supplementary Table 1, 15.09.2009
Supplementary Table 1 , primers used for real time PCR
Position in HLA-DRA orientation sequence (5’ to 3’)
- 4.9 kb (upstream) forward AACCTTGCACAAGAGAAAAGCTTTAC reverse GGAAGAGAAAAAGACCAGAAACGTC
- 3.5 kb (upstream) forward CTGCCCTAGCACATTTGTTAACG reverse GCTGGTCTGCTGGAATAGATCC
- 2.3 kb (S’Y’ enhancer) forward CAGAGAAAGGGAACTGAAAGTCATTT reverse TTATGACACTGTTTAGTCCTAGAACACTGA
- 1.9 kb (upstream) forward AAGCCCTTTGATGCGATCAG reverse ATGCAGCCGTTCTCACAAGTT
- 1.3 kb (upstream) forward TCTGTGGAAAGAACTTAACATTCTCCT reverse GATGTTCAACATAGACACTCCTGAAA
- 0.1 kb (S-Y enhancer) forward TTGCAAGAACCCTTCCCCT reverse AAATATTTTGAGATGACGCATC
- 0.04 kb (core promoter) forward ATTTTTCTGATTGGCCAAAGAGTAATT reverse AAAAGAAAAGAGAATGTGGGGTGTAA
+ 0.3 kb (intron 1) forward GGTCTCGACAGAAAGTATAAC reverse GGTGAGGGAAGAACTCCAC
+ 0.6 kb (intron 1) forward GCCCTGTTCTTATCTGAA reverse TATACCGACAGGATTTACACTC
+ 1.7 kb (intron 1) forward CAGACGAGAACCTTCTCATAGAGGTAA reverse AATTAAGACTGAGACCTTGTAGCGTCA
exon 3 forward AACAGCCCTGTGGAACTGAG reverse TTCGAAGCCACGTGACATTG
exon 5 forward TGGTTATGCCTCCTCGATTG reverse CAGAGACAGACTCCTGTATG
II.2 Nucleosome eviction from MHCII promoters controls positioning of the transcription start site
II.2.1 Introduction
The mechanisms involved in the recruitment of transcription factors that are essential for the regulation of MHCII gene expression had been well defined by previous studies. The role of these factors in the incorporation of histone modifications, and the recruitment of chromatin remodelling factors and GTFs to MHCII promoters had also been documented. However, the question of whether nucleosome eviction at MHCII promoters might play a role in transcriptional activation of MHCII genes had not been addressed. The work presented in this section describes the establishment of a strong nucleosome- free region at the TSSs of MHCII genes during activation. We show that nucleosome eviction at MHCII promoters is mediated by the enhanceosome complex and further consolidated by CIITA. Finally, we demonstrate that nucleosome eviction at MHCII promoters is a critical event in the determination of the correct position of the TSS in vivo.
66 II.2.2 Article
“Nucleosome eviction from MHCII promoters controls positioning of the transcription start site”
This part of the results is presented in the form of a research article published in Nucleic Acids Research (Leimgruber et al. 2009).
67 2514–2528 Nucleic Acids Research, 2009, Vol. 37, No. 8 Published online 5 March 2009 doi:10.1093/nar/gkp116
Nucleosome eviction from MHC class II promoters controls positioning of the transcription start site Elisa Leimgruber1, Queralt Seguı´n-Este´ vez1, Isabelle Dunand-Sauthier1, Natalia Rybtsova1, Christoph D. Schmid2,3, Giovanna Ambrosini2,3, Philipp Bucher2,3 and Walter Reith1,*
1Department of Pathology and Immunology, Faculty of Medicine, University of Geneva, 1 rue Michel-Servet, CH-1211, Geneva, 2Swiss Institute of Bioinformatics, EPFL, CH-1015, Lausanne and 3Swiss Institute for Experimental Cancer Research, CH-1066, Epalinges, Switzerland
Received December 3, 2008; Revised February 6, 2009; Accepted February 10, 2009
ABSTRACT as transcription. Dynamic structural rearrangements that render the chromatin permissive for transcription are Nucleosome depletion at transcription start sites therefore intimately associated with the regulation of (TSS) has been documented genome-wide in multi- gene expression. In agreement with the restrictive impact ple eukaryotic organisms. However, the mecha- of chromatin on transcription, large scale mapping studies nisms that mediate this nucleosome depletion and examining nucleosome occupancy in the genomes of its functional impact on transcription remain largely yeast, chicken, Drosophila melanogaster and human have unknown. We have studied these issues at human revealed that many genes in these organisms tend to MHC class II (MHCII) genes. Activation-induced exhibit a depletion of nucleosomes at their transcription nucleosome free regions (NFR) encompassing start site (TSS) and core promoter (1–6). Reduced nucleo- the TSS were observed at all MHCII genes. some occupancy has also been observed at distal Nucleosome depletion was exceptionally strong, enhancers controlled by specific transcription factors attaining over 250-fold, at the promoter of the pro- (7,8). The average nucleosome depletion revealed by totypical HLA-DRA gene. The NFR was induced these studies ranged from <1.5-fold to >4-fold depending primarily by the transcription factor complex that on the species, genes examined and methods used. Several mechanisms have been proposed to be respon- assembles on the conserved promoter-proximal sible for nucleosome depletion at the TSS/promoter, enhancer situated upstream of the TSS. Functional including sequence-dependent structural features of the analyses performed in the context of native chro- DNA (9–11), assembly of the preinitiation complex matin demonstrated that displacing the NFR without (PIC) containing general transcription factors and Pol II altering the sequence of the core promoter induced (2,6), the binding of sequence-specific transcription fac- a shift in the position of the TSS. The NFR thus tors (5,12,13), and the recruitment of chromatin modifying appears to play a critical role in transcription initia- and remodeling factors (14,15). However, for the majority tion because it directs correct TSS positioning of genes, particularly in higher eukaryotic organisms, in vivo. Our results provide support for a novel the critical parameters responsible for nucleosome eviction mechanism in transcription initiation whereby the from the TSS/promoter have not been characterized position of the TSS is controlled by nucleosome in vivo. Furthermore, in most cases the functional impact eviction rather than by promoter sequence. of nucleosome eviction on gene expression has not been defined. It is for instance not known whether nucleosome eviction from the TSS is generally a prerequisite for, or a consequence of, PIC assembly and transcription. We INTRODUCTION have therefore examined the mechanisms responsible The basic building block of eukaryotic chromatin is for nucleosome eviction, and the importance of this the nucleosome, which consists of 147 bp of DNA event for the activation of transcription, in a genetically wrapped around an octamer of histones H3, H4, H2A and biochemically well characterized human system, and H2B. Packaging of DNA into nucleosomes creates a namely expression of the family of genes encoding restrictive environment that reduces accessibility of DNA major histocompatibility complex class II (MHCII) mole- to factors mediating chromatin templated processes such cules (16–19).
*To whom correspondence should be addressed. Tel: +41 22 379 56 66; Fax: +41 22 379 57 46; Email: [email protected]
ß 2009 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2009, Vol. 37, No. 8 2515
MHCII molecules are heterodimeric cell-surface glyco- at MHCII promoters has not been addressed. We demon- proteins that play a pivotal role in the immune system strate here that all MHCII promoters exhibit an excep- because they present peptides to the antigen receptor tionally strong depletion of nucleosomes at their TSS (TCR) of CD4+ T cells. The recognition of MHCII- and adjacent S-Y modules in vivo. Nucleosome eviction peptide complexes by the TCR guides the development is induced mainly by assembly of the MHCII enhanceo- of CD4+ T cells in the thymus and the initiation, regula- some, although it is further consolidated by the recruit- tion and development of T cell-dependent immune ment of CIITA. Finally, we show that formation of the responses in the periphery. Humans have six to seven nucleosome free region (NFR) at MHCII promoters gene coding for the a and b chains of three ‘classical’ appears to be a critical event because it determines correct MHCII isotypes, HLA-DR, HLA-DP and HLA-DQ. positioning of the TSS in vivo. The latter finding suggests There are four additional genes coding for the a and b that eviction of nucleosomes from the promoter can chains of two ‘non-classical’ MHCII molecules, HLA- replace the requirement for core-promoter sequences in DO and HLA-DM, which are accessory molecules directing initiation at the correct TSS. required for loading peptides onto the classical MHCII molecules. All these MHCII genes are clustered together in the MHCII sub-region of the MHC locus on the short MATERIALS AND METHODS arm of chromosome 6. Classical and non-classical MHCII Cells genes are expressed in a tightly co-regulated manner (16–19). Constitutive expression is restricted to specialized The Me67.8 melanoma cell line, the wild-type B cell cells of the immune system, including thymic epithelial line Raji, the CIITA-deficient B cell mutant RJ2.2.5, cells, dendritic cells, macrophages and B cells. Other cell the RFXANK-deficient B cell mutant BLS1 and the types do not express MHCII genes unless they are RFX5-deficient B cell mutant SJO have been described stimulated with interferon-g (IFNg). previously (20,22,24), and were grown in RPMI+ The molecular machinery that regulates MHCII expres- Glutamax medium (Invitrogen) supplemented with 10% sion has been exceptionally well defined thanks to the fetal calf serum and antibiotics. Me67.8 cells were induced elucidation of the genetic defects responsible for the with 200 U/ml of human IFNg (Invitrogen). Bare Lymphocyte Syndrome (BLS), a hereditary immuno- deficiency disease resulting from mutations in genes qRT–PCR encoding transcription factors that are essential for Quantifications of HLA-DRA mRNA expression MHCII expression (16). One of these factors, the class II and nascent transcript abundance were performed by transactivator (CIITA), is a transcriptional coactivator qRT–PCR as described (33,34). that is exquisitely specific for the activation of MHCII genes (20,21). CIITA serves as the master regulator of Mononucleosome preparations MHCII genes and is expressed in a cell-type-specific and IFNg-inducible manner dictating the constitutive and Cells were treated with 1% formaldehyde for 8 min at inducible pattern of MHCII expression (16–19). CIITA room temperature. Crosslinking was stopped by addition is recruited to MHCII promoters by means of protein– of 0.2 M glycine. Cells were lysed for 10 min at 48C in cold protein interactions with a multi-protein ‘enhanceosome’ lysis buffer (50 mM HEPES–KOH pH 7.5, 140 mM NaCl, complex that assembles on a characteristic enhancer 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton known as the S-Y module, which consists of four X-100, 0.3 M sucrose, 2 mg/ml aprotinin and leupeptin). conserved sequence elements called the S, X, X2 and Nuclei were pelleted through lysis buffer containing Y boxes (16–19). This enhanceosome complex consists 0.9% sucrose and washed in TE (10 mM Tris–HCl pH of the X-box-binding-factor Regulatory Factor X (RFX), 8.0, 1 mM EDTA) containing 200 mM NaCl, 0.5 mM EGTA, 2 mg/ml aprotinin and leupeptin. Purified nuclei the X2-box-binding-factor cAMP Responsive Element- 6 binding protein (CREB), and the Y-box-binding-factor from 3 10 cells were resuspended in Micrococcal Nuclear Factor Y (NF-Y) (Figure 1A). Nuclease (MNAse) Buffer (MNB: 10 mM Tris–HCl pH RFX is a central component of the enhanceosome com- 7.4, 15 mM NaCl, 60 mM KCl, 3 mM CaCl2) and digested plex. It is composed of three subunits, RFX5, RFXAP with 6–10 U MNAse (Fermentas) for 40 min at 378C. and RFXANK (16). As for CIITA, mutations in each Digestions were stopped by adding 10 mM EDTA and of the three RFX subunits give rise to the BLS disease 10 mM EGTA. MNAse treated nuclei were then used (16,22–25). RFX is essential for MHCII expression for chromatin immunoprecipitation (ChIP) experiments because it nucleates assembly of the enhanceosome com- (see below). The extent of MNAse digestion was verified plex by binding cooperatively with CREB and NF-Y by extraction of the DNA and analysis by agarose gel (16–19,26,27). Thus, in the absence of a functional RFX electrophoresis (Supplementary Figure 2). complex, enhanceosome assembly, CIITA recruitment ChIP and MHCII gene activation are abolished. Mechanisms implicated in MHCII gene activation by MNase-treated nuclei from 3 106 cells were incubated in the enhanceosome and CIITA include the recruitment 300 ml of MNB containing 20 ml CL-4B beads (Amersham) of chromatin-remodeling factors, histone-modifying com- diluted two times in Dilution Incubation Buffer plexes, PIC components and transcription-elongation (DIB: 0.2 M HEPES pH 7.9, 2 M NaCl, 0.02 M EDTA, factors (28–32). However, the role of nucleosome eviction 200 mg/ml herring sperm DNA, 1 mg/ml BSA, 10 mM 2516 Nucleic Acids Research, 2009, Vol. 37, No. 8
EDTA, 10 mM EGTA) containing 1% Triton X-100, from MNAse-treated chromatin were used directly for 0.1% Na-DOC and 1 Complete Protease Inhibitor probe preparation without amplification. DNA labeling Cocktail (Roche) for 30 min at room temperature with (4 mg for each sample), hybridization and array scanning rotation. Samples were cleared by centrifugation for were performed by NimbleGen Systems. 10 min at maximum speed in a microfuge and superna- Nucleosome depletion profiles were generated by col- tants were incubated O/N at 48C with 700 ml of MNB lecting the log2-ratios for each Nimblegen oligonucleotide containing 10 mM EDTA, 10 mM EGTA and antibodies. probe into a grid of 30 bp windows relative to the Histone antibodies were obtained from Abcam (core H3, positions of the TSS. The log2-ratios within the same Ab1791; H3K4Me3, Ab8580) or Upstate (H3Ac, 06-599; window were averaged and the ‘fold change’ was com- H4Ac, 06-866). BRG1 antibodies were obtained from puted as 1 divided by the exponentiation of the averaged Upstate (07-478) or Santacruz (sc-10768). H2A.Z antibo- log-ratios. dies were from Abcam (Ab4174). Samples were incubated To generate a list of non-MHCII genes that are present with 15 ml of protein A FF sepharose beads (GE on the Nimblegen array and highly expressed in Raji B Healthcare) diluted two times in DIB for 90 min at room cells, mappings of Affymetrix U133-PLUS-2 probe sets temperature and washed twice with IP Buffer 1 (0.2 M were intersected with the genomic regions covered by the HEPES pH 7.9, 0.2 M NaCl, 0.02 M EDTA, 0.1% Nimblegen array using Galaxy (35). From the resulting Na-DOC, 0.1% SDS, 10 mM EDTA, 10 mM EGTA), 444 genes represented by probes on both the Affymetrix twice with IP Buffer 2 (0.5 M NaCl, 0.2 M HEPES pH and Nimblegen arrays, the 50 genes expressed most 7.9, 0.02 M EDTA, 0.1% Na-DOC, 0.1% SDS, 10 mM strongly in Raji cells (Supplementary Table 2) were EDTA, 10 mM EGTA) twice with IP Buffer 3 (20 mM defined on the basis of their average expression level in Tris–HCl pH 8.0, 0.25 M LiCl, 0.5% Na-DOC, 0.5% microarray datasets for Raji cells (GEO GDS596) (36). NP-40, 10 mM EDTA, 10 mM EGTA), and once with IP Buffer 4 (10 mM Tris–HCl pH 8.0, 0.1% NP-40, Luciferase constructs and reporter gene assays 10 mM EDTA, 10 mM EGTA). Immunoprecipitated The HLA-DRA promoter—Firefly Luciferase cassette chromatin fragments were eluted for 10 min at 658C with from the pDRAprox vector (34) was cloned into the 100 mM Tris–HCl pH 8.0, 1% SDS, 10 mM EDTA, 10 mM pRRLSIN lentiviral vector (http://tronolab.epfl.ch) by EGTA, and crosslinks were reversed O/N at 658C. DNA replacing the EcoRV-SalI fragment containing PGK- was extracted, precipitated and resupended in TE. GFP. The BglII site in the HLA-DRA promoter was used Classical ChIP experiments using sonicated chromatin to insert random sequences between the HLA-DRA S-Y and antibodies against CIITA, RFX5, NF-Y (Diagenode, module and the TSS. Inserted sequences corresponded to pAb-TFNYB), CREB (Santacruz, sc-186, sc-58), RNA NCBI Build 36.1 coordinates: chr6:26500854-26500892 Pol II (Abcam, Ab817), core H3, H4Ac, H3Ac, (DRA+40), chr6:26500854-26500934 (DRA+80), H3K4Me3, BRG1 and H2A.Z were performed as des- chr6:26500854-26501002 (DRA+150a) and cribed above except that samples were washed with IP chr6:26492247-26492395 (DRA+150b). Virus production Buffers 1 and 2 containing 1% Triton instead of SDS, and transductions were performed as described (http://tro with IP Buffer 3 containing 0.25% Na-DOC instead of nolab.epfl.ch). Transient transfections were performed NP-40, and without adding 10 mM EDTA and 10 mM using lipofectamin 2000 (Invitrogen). Luciferase activity EGTA to the buffers. was measured with a Dual luciferase reporter gene system Quantitative PCR (qPCR) (Promega). Results were normalized with respect to both total protein (quantified by Advance protein assay reagent qPCR was performed using the iCycler iQ Real-time PCR from Cytosqueleton) and the number of vector integrations Detection system (Biorad) and a SYBRGreen-based kit in the transduced cells (quantified by qPCR). for quantitative PCR (iQ Supermix Biorad). Primers are listed in Supplementary Table 1. Amplification specificity RNAse protection assays (RPA) was controlled by gel electophoresis and melting curve analysis. Results were quantified using a standard curve A fragment spanning the TSS of the DRA luciferase generated with serial dilutions of input DNA. All PCR constructs was subcloned into a Bluescript vector amplifications were performed in triplicate. (Stratagene). Probe preparation, hybridization, RNAse digestion and analysis by gel electrophoresis were done ChIP–chip experiments as previously described (20). Signals were detected using a Cyclone (Packard) phosphorimager and quantified using ChIP–chip experiments were performed with a custom the OptiQuant software (Packard). NimbleGen array of our own design. The latter carries all unique sequences from the entire extended human MHC (7.7 Mb on chromosome 6; genomic coordinates RESULTS 26.1 Mb to 33.8 Mb on hg17) as well as a number of Nucleosome eviction at the HLA-DRA gene in other selected control regions (total of 0.9 Mb). These IFNc-induced cells genomic regions were covered at high density with over- lapping Tm-matched oligonucleotides ( 50 bp long) To analyze chromatin structure at MHCII promoters spaced such that their 50 ends are situated 10 bp apart. we first studied IFNg-induced MHCII gene activation in Genomic input DNA and H3-ChIP samples prepared the Me67.8 melanoma cell line. These cells were chosen Nucleic Acids Research, 2009, Vol. 37, No. 8 2517 because they exhibit robust and reproducible IFNg- 200–300 bp in size were revealed in IFNg-induced induced MHCII gene activation (Figure 1A), and have Me67.8 cells (Figure 1C). One was centred on the distal been used extensively in previous studies on MHCII S0-Y0 module. The second spanned the proximal S-Y expression. Quantitative chromatin immunoprecipitation module and TSS. Relative to flanking regions, nucleosome 0 0 (qChIP) experiments demonstrated that the enhance- density was reduced up to 20-fold (log2 < 4) at the S -Y osome complex containing RFX, CREB and NF-Y enhancer and more than 250-fold (log2 < 8) at the S-Y/ assembles at the promoter-proximal S-Y enhancer of the TSS region. The difference in the extent of nucleosome prototypical MHCII gene HLA-DRA in non-induced depletion ( 10-fold) between the S0-Y0 and S-Y/TSS Me67.8 cells (Figure 1A). As documented previously regions (Figure 1C) correlated well with the relative level (33,37,38), treatment of these cells with IFNg induced of occupation of these two regions by RFX and CIITA the expression of CIITA, which was recruited to the (Figure 1B). HLA-DRA S-Y enhancer by binding to the enhanceosome Several lines of evidence indicated that the strong complex (Figure 1A). The recruitment of CIITA stabilized reduction in H3-qMNAse-ChIP signals observed within binding of the enhanceosome and induced the recruitment the S0-Y0 and S-Y/TSS regions reflects nucleosome deple- of Pol II (Figure 1A and B). Stabilization of the enhance- tion rather than an artefact resulting from preferential osome by CIITA was most evident when binding of RFX sensitivity of the DNA sequences within these regions to was assessed (Figure 1A and B). However, this stabiliza- digestion with MNAse. First, a strong reduction in tion concerns the entire enhanceosome complex, since nucleosome density at these regions was also revealed by in vivo footprint experiments have demonstrated that classical H3-ChIP experiments using sonicated chromatin occupation of the entire S-Y module is increased by treat- instead of MNAse treated chromatin (Supplementary ment of cells with IFNg (39,40). Figure 1A). Second, the chromatin structure in these The HLA-DRA gene contains a second S-Y enhancer regions was highly sensitive even to mild digestion with (denoted S0-Y0) situated 2.3-kb upstream of the TSS MNAse (Supplementary Figure 1B). Third, these regions (Figure 1B) (34). The pattern of binding of the enhance- were not degraded preferentially upon digestion of naked osome (as assessed by binding of RFX) and CIITA to this DNA with MNAse (data not shown). Finally, these distal S0-Y0 enhancer in uninduced and induced Me67.8 regions were not digested preferentially when the cells was very similar to that observed for the proximal H3-qMNAse-ChIP experiments were performed with S-Y enhancer (Figure 1B and data not shown) (34,41). chromatin from RFX-deficient cells, in which nucleosome However, the level of enhanceosome and CIITA occupa- eviction is abrogated because enhanceosome assembly 0 0 tion was lower at the upstream S -Y enhancer (Figure 1B). and CIITA recruitment are abolished (see below and IFNg-induced activation of the HLA-DRA gene has Figure 2C). been shown to lead to an increase in histone H4 acetyla- Nucleosome depletion was also evident, albeit less tion (H4Ac) over a large >5-kb upstream domain encom- strongly, at the S0-Y0 enhancer (2–4-fold reduction) and 0 0 passing both the S -Y and S-Y modules (33). We observed S-Y/TSS region (8-fold reduction) in uninduced Me67.8 that this increase in H4Ac was consistently lower at the cells (Figure 1C), despite the absence of CIITA expression 0 0 S-Y and S -Y modules (Supplementary Figure 1A). To and recruitment (Figure 1B). The pre-existence of these determine whether this lower level of H4Ac might reflect NFRs in uninduced cells suggested that enhanceosome a reduction in nucleosome density we performed qChIP assembly was sufficient to induce nucleosome eviction, experiments with antibodies directed against unmodified although maximal nucleosome depletion required IFNg histone H3. Nucleosome density in IFNg-induced Me67.8 induced CIITA recruitment and/or enhanceosome stabili- cells was indeed found to be significantly lower at the S-Y zation by CIITA. and S0-Y0 modules (Supplementary Figure 1A). We also analyzed micrococcal nuclease (MNAse) sensitivity of the Nucleosome eviction at the HLA-DRA gene in B cells chromatin at different positions within the HLA-DRA upstream region. Sensitivity to digestion with MNAse To extend our analysis of nucleosome eviction at the was greatest at the S-Y and S0-Y0 modules in IFNg-treated HLA-DRA gene to another cell type we turned to B Me67.8 cells (Supplementary Figure 1A). Taken together, cells, which express MHCII genes in a constitutive these findings suggested that nucleosomes are depleted at manner. qChIP experiments performed with the B cell the HLA-DRA S-Y and S0-Y0 modules in IFNg induced line Raji confirmed that the HLA-DRA-promoter region Me67.8 cells. This was consistent with earlier studies is occupied constitutively by Pol II, CIITA, and the three showing that IFNg-induced HLA-DRA gene expression enhanceosome components RFX, CREB and NF-Y is associated with the appearance of two DNAse I hyper- (Figure 2A). The distal S0-Y0 enhancer also exhibited sensitive sites at positions flanking the promoter-proximal constitutive occupation by the enhanceosome (assessed S-Y module (42). by binding of RFX) and CIITA (Figure 2B) (34). As To map nucleosome-depleted regions more precisely, we observed in IFNg-induced cells, binding of the enhance- performed qChIP experiments with H3 antibodies and osome and CIITA was stronger to the S-Y enhancer than MNAse-treated chromatin (qMNAse-ChIP). Digestion to the S0-Y0 enhancer (Figure 2B) (34). conditions were chosen such that conversion to mono- qChIP studies performed with B cells have shown that nucleosomes was almost complete (Supplementary the levels of H4Ac at the HLA-DRA gene is lowest Figure 2). Results were quantified by real time PCR at the S0-Y0 and S-Y modules (34). MNAse sensitivity of using a series of overlapping amplicons. Two NFRs of the chromatin was also enhanced at these regulatory 2518 Nucleic Acids Research, 2009, Vol. 37, No. 8
A enhanceosome TSS DRA RFX CREB NF-Y 500 –IFNγ MHCII 400 S-Y 300 CIITA 200
RFX CREB NF-Y fold induction 100 + IFNγ Pol II MHCII 0 –γ +γ
1.2 RFX 1.2 CREB 1.0 NF-Y 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 Relative occupancy Relative occupancy Relative occupancy 0.0 0.0 0.0 –γ +γ –γ +γ
1.0 CIITA 1.4 Pol II Control Promoter 1.2 0.8 1.0 0.6 0.8 0.4 0.6 0.4 0.2 0.2 Relative occupancy Relative occupancy 0.0 0.0 –γ +γ –γ +γ –γ +γ –γ +γ Control Promoter Control Promoter B S’-Y’ (-2.3 kb) S-Y (-0.1 kb) TSS HLA-DRA
3.5 1.2 3.0 RFX 1.0 CIITA 2.5 0.8 2.0 0.6 1.5 0.4 1.0 0.5 0.2 Relative occupancy 0.0 Relative occupancy 0.0 C –γ +γ –γ +γ C –γ +γ –γ +γ S’-Y’ S-Y S’-Y’ S-Y TSS S’-Y’ S-Y C (–2.3 kb) (–0.1 kb) )
2 0 0 –IFNγ –1 –1 –IFNγ –2 –2 –3 –3 –4 –4 + IFNγ –5 –5 + IFNγ –6 –6 –7 –7 –8 –8 –9 –9 –2.6 –2.5 –2.4 –2.3 –2.2 –2.1 –2.030 0
Relative nucleosome (log occupancy Distance relative to TSS (kb) Distance relative to TSS (bp)
Figure 1. Nucleosome eviction at the HLA-DRA gene in IFNg-induced cells. (A) HLA-DRA mRNA expression was measured by qRT–PCR in uninduced Me67.8 cells ( g) and in Me67.8 cells induced for 24 h with IFNg (+g). Occupation of the HLA-DRA promoter by RFX, CREB, NF-Y, CIITA and Pol II was analyzed by ChIP in uninduced Me67.8 cells ( g) and in Me67.8 cells induced for 24 h with IFNg (+g). An upstream region (control) was used to verify specificity. Occupancy is expressed relative to the value observed at the promoter in IFNg-induced cells. The means and Nucleic Acids Research, 2009, Vol. 37, No. 8 2519 sequences in B cells (Supplementary Figure 3). Finally, B IFNg-induced cells—enhance nucleosome eviction, since cells exhibited two constitutive DNAse I hypersensitive nucleosome depletion is slightly stronger ( 2–4-fold) in sites at positions flanking the S-Y module of the HLA- wild-type B cells than in CIITA-deficient cells DRA gene (Supplementary Figure 4) (42). Taken together (Figure 2C). These results also demonstrated that forma- these results indicated that B cells also exhibit nucleosome tion of the NFR spanning the TSS is on its own not depletion at the HLA-DRA S0-Y0 and S-Y/TSS regions. sufficient to promote PIC assembly and transcription, To map the nucleosome-depleted regions in B cells we because the latter processes do not occur in CIITA- performed qMNAse-ChIP experiments with H3 antibo- deficient cells (Figure 2A). This is consistent with pre- dies. This revealed the presence of 200–300 bp NFRs vious studies demonstrating that PIC assembly and at the S0-Y0 and S-Y/TSS regions of the HLA-DRA gene transcription of the HLA-DRA gene are strictly dependent (Figure 2C). Relative to flanking sequences, nucleosome on CIITA. 0 0 density was reduced over 50-fold (log2 < 6) at the S -Y enhancer and more than 100-fold (log2 < 7) at the S-Y/ Independence of nucleosome eviction on chromatin TSS region. The minor difference ( 2-fold) in the extent of modification and remodeling nucleosome depletion between the S0-Y0 and S-Y/TSS regions (Figure 2C) correlated well with the relative level It has been reported in other systems that nucleosome of occupation of these two regions by RFX and CIITA eviction from promoters may be dependent on the intro- (Figure 2B). duction of histone modifications, such as histone acetyla- tion (43). The activation of MHCII genes is well known to be associated with the acetylation of histones H3 and Dominant role of the enhanceosome in mediating H4 (H3Ac and H4Ac and the tri-methylation of lysine 4 nucleosome eviction of H3 (H3K4Me3) (29,33,34,41,44,45). To determine To distinguish between the roles of enhanceosome whether these modifications might be required for nucleo- binding, CIITA recruitment, PIC assembly and active some eviction we examined whether their introduction transcription in promoting nucleosome eviction at the correlates with establishment of the NFR at the promoter HLA-DRA gene we analyzed nucleosome occupancy of the HLA-DRA gene. Compared to wild-type B cells, the at the S0-Y0 and S-Y/TSS regions in CIITA-deficient and H3Ac, H4Ac and H3K4Me3 modifications were reduced RFX-deficient B cells. In the CIITA-deficient cells, as strongly in CIITA-deficient B cells as in RFX-deficient enhanceosome binding was normal but the absence of B cells (Figure 3), despite the fact that nucleosome CIITA completely abrogated PIC assembly and transcrip- eviction at the promoter is essentially complete in the tion (Figure 2A) (34). On the other hand, in RFX-deficient former but abolished in the latter (Figure 2C). cells the upstream regulatory region remained unoccupied BRG1—the ATPase subunit of human SWI/SNF because enhanceosome assembly and CIITA recruit- chromatin remodeling complexes—required for MHCII ment are strictly dependent on an intact RFX complex gene activation and is recruited to MHCII promoters by (Figure 2A) (34). qMNAse-ChIP experiments demon- interactions with CIITA and RFX (32). We therefore strated that strong nucleosome depletion was retained at assessed whether BRG1 recruitment might be required the S0-Y0 and S-Y/TSS regions in CIITA-deficient cells for establishment of the NFR at the HLA-DRA promoter. (Figure 2C) despite the absence of CIITA, PIC assembly There was no correlation between BRG1 recruitment and and transcription (Figure 2A and B). In contrast, no establishment of the NFR, since BRG1 association was significant nucleosome depletion was evident at the S0-Y0 eliminated to the same extent in CIITA-deficient and and S-Y/TSS regions in RFX-deficient cells (Figure 2C). RFX-deficient B cells (Figure 3). These results are consistent with the finding that the NFRs marking yeast promoters are flanked by nucleo- DNAse I hypersensitive sites flanking the HLA-DRA somes containing the histone variant H2A.Z (13,46,47). S-Y module were detected in CIITA-deficient cells but Nucleosomes containing H2A.Z are also enriched at the not in RFX-deficient cells (Supplementary Figure 4). 50 end of active genes in Drosophila and humans Taken together, these results indicated that nucleosome (2,6,46,48). H2A.Z incorporation has moreover been eviction at the HLA-DRA gene in B cells is mediated suggested to destabilize nucleosomes (46). We therefore mainly by assembly of the DNA-bound enhanceosome determined whether H2A.Z deposition might be required complex. CIITA recruitment, PIC assembly and/or for establishment of the NFR at the HLA-DRA promoter. ongoing transcription do not seem to play a major H2A.Z deposition at the promoter was indeed found to role. However, these processes may—as observed in be associated with HLA-DRA gene activation in B cells standard deviations derived from three independent experiments are shown. A schematic summary of MHCII-promoter occupation in uninduced and IFNg-induced cells is represented. (B) The HLA-DRA gene contains both a promoter-proximal S-Y enhancer (situated at 0.1 kb) and a distal S0-Y0 enhancer (situated at 2.3 kb). Occupation of the S0-Y0 and S-Y enhancers by RFX and CIITA was analyzed by ChIP in uninduced Me67.8 cells ( g) and in Me67.8 cells induced for 24 h with IFNg (+g). An upstream region (C) was used to control for specificity. Occupancy by RFX is expressed relative to the value observed at the S-Y enhancer in uninduced cells. Occupancy by CIITA is expressed relative to the value observed at the S-Y enhancer in induced cells. The means and standard deviations derived from three independent experiments are shown. (C) Nucleosome occupancy in the S0-Y0 (left) and S-Y/TSS (right) regions was measured by qMNAse-ChIP in uninduced Me67.8 cells ( IFNg) and in Me67.8 cells induced for 24 h with IFNg (+IFNg). Results were generated using overlapping amplicons of which the centres are represented by dots. Results were normalized with respect to MNAse-treated genomic DNA, are expressed on a log2 scale relative to the position at which maximum occupation was observed, and represent the mean of three independent experiments. Schematic representations of the NFRs and their flanking nucleosomes are provided. Distance in base pair relative to the TSS is indicated. Primer pairs are indicated in Supplementary Table 1. 2520 Nucleic Acids Research, 2009, Vol. 37, No. 8
A CIITA TSS DRA 1.0 RFX CREB NF-Y WT Pol II MHCII 0.8 S-Y 0.6 RFX CREB NF-Y 0.4 CIITA-/- MHCII 0.2 0.0 Relative expression –/– –/– WT RFX-/- MHCII RFX CIITA
RFX CREB NF-Y 1.0 1.2 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 Relative occupancy Relative occupancy Relative occupancy 0.0 0.0 0.0 C –/– –/– CIITA Pol II WT 1.4 1.2 RFX 1.2 1.0 CIITA 1.0 0.8 Promoter 0.8 0.6 0.6 0.4 0.4 0.2 0.2
Relative occupancy 0.0 Relative occupancy 0.0 C C –/– –/– –/– –/– WT WT RFX RFX CIITA CIITA Promoter Promoter B 1.2 1.2 RFX CIITA 1.0 1.0 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2
Relative occupancy 0.0 Relative occupancy 0.0 C S’-Y’ S-Y C S’-Y’ S-Y TSS S’-Y’ S-Y C (–2.3 kb) (–0.1 kb) 0 0 –1 -1 –2 -2 )
2 –3 -3 –4 -4 –5 WT -5 WT –6 -6 –7 -7 –8 -8
0 0 –/– RFX–/– RFX –1 -1 –2 -2 –3 -3 –4 -4 CIITA–/– –5 -5 Relative nucleosome (log occupancy CIITA–/– –6 -6 –7 -7 –8 -8 –2.6 –2.5 –2.4 –2.3 –2.2 –2.1 –2.0 –400 –300 –200 –100 0 100 200 300 Distance relative to TSS (kb) Distance relative to TSS (bp)
Figure 2. Nucleosome eviction at the HLA-DRA gene in B cells. (A) HLA-DRA mRNA expression was measured by qRT–PCR in WT, CIITA- deficient and RFX-deficient B cell lines. Occupation of the HLA-DRA promoter by RFX, CREB, NF-Y, CIITA and Pol II was analyzed by ChIP in Nucleic Acids Research, 2009, Vol. 37, No. 8 2521
(Figure 3) and IFNg-induced Me67.8 cells (data not We next performed ChIP-chip (ChIP-on-microarray) shown). There was however no correlation between experiments using a high density microarray carrying H2A.Z deposition and establishment of the NFR, since the entire human MHC as well as several control loci H2A.Z was lost to the same extent in CIITA-deficient (see Materials and methods section). ChIP samples were and RFX-deficient B cells (Figure 3). prepared using H3 antibodies and MNAse treated chro- Taken together, these findings imply that BRG1 recruit- matin from Raji B cells. Probes prepared from these ment, H2A.Z deposition and H3Ac, H4Ac or H2K4Me3 H3-ChIP samples were hybridized to the microarrays are not essential for nucleosome eviction at the HLA-DRA in conjunction with control probes prepared from promoter in B cells. The same conclusion was arrived either MNAse treated genomic DNA or H3-ChIP sam- at by studying the relationship between these processes ples derived from RFX-deficient B cells. The latter con- in IFNg-induced Me67.8 cells (data not shown). This trol was used to assess the dependence of nucleosome suggests that enhanceosome assembly may be sufficient depletion on assembly of the S-Y-specific regulatory by itself to induce nucleosome eviction. machinery. Strong nucleosome depletion at the S-Y/ TSS region was observed at all MHCII genes (Figure 4C and D), as well as at the MHCII-associated Nucleosome eviction occurs at all MHCII promoters invariant chain gene (CD74), which also contains a pro- All MHCII genes have an S-Y module situated at a very moter proximal S-Y module (Supplementary Figure 5). similar distance (50–100 bp) upstream of their TSS. NFRs Nucleosome depletion was evident when signals similar in position and size to the one observed at the obtained with the Raji H3-ChIP probes were compared HLA-DRA gene would therefore be expected to unmask with control signals obtained both with the H3-ChIP the TSS at all MHCII genes (Figure 4A). The generation probes derived from RFX-deficient cells (Figure 4C of a NFR encompassing the TSS might thus be a con- and D) and with input DNA (Figure 4D). In the served and functionally important role of the promoter- former comparison, a NFR spanning the TSS was evi- proximal S-Y module. To confirm this we quantified dent at all MHCII genes but not at non-MHCII genes nucleosome occupancy by qMNAse-ChIP at the pro- present on the array, indicating that it is induced by moters of several additional MHCII genes (HLA-DPA, assembly of the MHCII-specific regulatory machinery HLA-DPB, HLA-DQA, HLA-DQB and HLA-DRB1). on the S-Y module. In the latter comparison, nucleo- Suitable primers could not be designed for the other some depletion at the TSS was observed at both MHCII MHCII genes. At all genes tested, a strong (>20- to genes and non-MHCII genes exhibiting strong expres- 50-fold) degree of nucleosome depletion was evident at sion in B cells (Supplementary Table 2). However, their S-Y modules in Raji B cells (Figure 4B). the depletion was on the average significantly stronger
H3Ac H4Ac H3K4Me3 Brg1 H2A.Z
1.0 1.0 1.0 1.0 1.0 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.2 0.2 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0.0 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– WT WT WT WT WT RFX RFX RFX RFX RFX CIITA CIITA CIITA CIITA CIITA Prom. Prom. Prom. Prom. Prom.
Figure 3. Nucleosome eviction does not correlate with chromatin modification, BRG1 recruitment or H2A.Z deposition. The levels of H4Ac, H3Ac, H3K4Me3, BRG1 recruitment and H2A.Z deposition at the HLA-DRA promoter were analyzed by qChIP in wild-type Raji B cells (WT), CIITA- deficient B cells (CIITA / ) and RFX-deficient B cells (RFX / ). Results were corrected for nucleosome density using antibodies directed against unmodified histone H3, and were normalized relative to a control position at the TBP promoter. Results are expressed relative to the values observed in wild-type cells, and represent the means and standard deviations derived from three independent experiments. Primers used are indicated in Supplementary Table 1.
wild-type Raji B cells (WT), CIITA-deficient cells (CIITA / ) and RFX-deficient cells (RFX / ). An upstream region (C) was used to determine background binding. Occupancy is expressed relative to the value observed at the promoter in WT cells. The means and standard deviations derived from three independent experiments are shown. A schematic summary of MHCII-promoter occupation in WT, CIITA-deficient and RFX-deficient cells is shown. (B) Occupation of the HLA-DRA S0-Y0 and S-Y enhancers by RFX and CIITA was analyzed by ChIP in Raji B cells. An upstream region (C) was used to determine background binding. Occupancy is expressed relative to the value observed at the S-Y enhancer. The means and standard deviations derived from three independent experiments are shown. (C) Nucleosome occupancy in the S0-Y0 (left) and S-Y/TSS (right) regions was measured by qMNAse-ChIP in wild-type Raji B cells (WT, top panels), CIITA-deficient cells (CIITA / , bottom panels), and RFX- deficient cells (RFX / , bottom panels). Results were generated using overlapping amplicons of which the centres are represented by dots. Results were normalized with respect to MNAse treated genomic DNA, are expressed on a log2 scale relative to the position at which maximum occupation was observed, and represent the mean of three independent experiments. Schematic representations of the NFRs and their flanking nucleosomes are provided. Distance in base pair relative to the TSS is indicated. Primer pairs are indicated in Supplementary Table 1. 2522 Nucleic Acids Research, 2009, Vol. 37, No. 8
A C ChIP-chip DRA 0 0 DPA 1 1 DPB 2 2 3 DRB1 3 DRB3 DQA )) 4 4 –/– DQB 0 0 1 DRB1 1 2 3 DRB3 2 4 DQB1 DPA DOA 3 5 6 DOB 4 7 0 0 DMA (1/(2^(ratio ChIP WT / RFX (1/(2^(ratio 1 1 2 DMB 2 –0.4 –0.3 –0.2 –0.1 0.0 0.1 0.2 3 DPB DMA Distance relative to start site (kb) 4 3 5 4 B qMNase-ChIP 0 0 1.2 1.0 1 1 0.8 2 2 0.6 DMB DOA
0.4 Fold nucleosome depletion 3 3 0.2 4 4 0.0 U S-Y D U S-Y D U S-Y D 0 0 DRA DPA DPB 1.2 1 1 1.0 2 2 0.8 DOB GAPDH 0.6 3 3 0.4 4 4 Relative nucleosome occupancy 0.2 0.0 U S-Y D U S-Y D U S-Y D Distance relative to start site (kb) DQA DQB DRB1
D ChIP-chip 1/(2^(ratio ChIP WT / RFX–/–)) 1/(2^(ratio ChIP WT / input DNA)) 0 0 others 1 1
2 2 others
3 3 Fold depletion MHCII MHCII 4 4
Distance relative to start site (kb)
Figure 4. Nucleosome eviction from the S-Y/TSS region occurs at all MHCII genes. (A) MHCII promoters were aligned relative to their TSSs (arrows). Positions of the S-Y modules (white boxes), predicted NFRs (gray boxes) and amplicons (gray lines) used in panel B are indicated. The sizes and positions of the predicted NFRs were extrapolated from the NFR that was mapped at the DRA promoter. (B) Nucleosome occupancy in the vicinity of the S-Y/TSS regions of the HLA-DRA, HLA-DPA, HLA-DPB, HLA-DQA, HLA-DQB and HLA-DRB1 genes was measured by qMNAse-ChIP in Raji B cells. Primer pairs were situated upstream of (U), within (S-Y) and downstream of (D) the S-Y/TSS NFRs. Results were normalized with respect to MNAse treated genomic DNA, expressed relative to the value obtained at the downstream position, and show the means and standard deviations derived from three independent experiments. Amplicons used are depicted in panel A and indicated in Supplementary Table 1. (C) Nucleosome occupancy at the indicated MHCII genes was analyzed by ChIP–chip using antibodies directed against unmodified histone H3 and MNAse treated chromatin from wild-type Raji B cells (WT) and RFX-deficient B cells (RFX / ). The results are represented as the fold nucleosome depletion in WT relative to RFX / cells. The NFRs and TSSs are indicated by gray shading and arrows, respectively. (D) The average nucleosome density observed at the TSS of MHCII genes (thick lines) was compared with that found at 50 other genes present on the array and expressed most strongly in B cells (thin profiles). Results represent the average fold depletion observed in ChIP samples from wild-type Raji cells (WT) relative to ChIP samples from RFX-deficient (RFX / ) cells (left) or input DNA (right). The TSSs are indicated by arrows. and more focused on the TSS at MHCII genes non-MHCII genes resulted from considerable inter- than at non-MHCII genes (Figure 4D). Analysis of gene variability in the extent of nucleosome loss and individual genes indicated that the wider and more in the position and size of the NRFs (Supplementary mitigated pattern of nucleosome depletion observed at Figure 5). Nucleic Acids Research, 2009, Vol. 37, No. 8 2523
A DRA TSS B 1.0 CIITA RFX DRA+40 0.8
0.6
DRA+80 0.4
Relative occupancy 0.2 DRA+150a luciferase h IFNγ: 024024 024024 –400 control insert control insert insert TSS coding C
1.2 TSS coding coding 1.0 TSS 0.8
0.6
0.4 insert 0.2 Nucleosome occupancy
h IFNγ: 024024 02424 0 0 24 024 024 0 24 2424 24 DRA +40 +80 +150a DRA +40 +80 +150a +150a D
6
5
4
3
2
1 Fold induction (luciferase)
h IFNγ: 0 12 24 48 0 12 24 48 0 12 24 48 0 12 24 48 DRA DRA+40 DRA+80 DRA+150a
Figure 5. Nucleosome displacement from the TSS is required for IFNg-induced activation of the HLA-DRA gene. (A) Schematic representation of the wild type and mutated DRA promoter—luciferase constructs. Each construct was transduced into Me67.8 cells using lentiviral vectors. Maps show relative positions of the S-Y modules (open boxes), TSSs (arrows), inserted sequences (crosshatched boxes, +40, +80 and +150a), predicted NFRs, and amplicons used in (B and C). The amplicons were specific for the insert situated adjacent to the S-Y module, the TSS and the luciferase coding region of the constructs. The sizes and positions of the predicted NFRs were extrapolated from the NFR found at the endogenous DRA promoter. (B) Binding of RFX and CIITA to the S-Y module of the integrated DRA+150a construct (insert) and to a negative control region (control) were analyzed by qChIP in uninduced and IFNg-induced Me67.8 cells. Results were expressed relative to the level of binding observed at the S-Y module in IFNg-induced cells. (C) Nucleosome occupancy at the TSS, within the downstream luciferase coding region and near the S-Y module (insert) of the integrated constructs were analyzed by qMNAse-ChIP prior to and after induction for 24 h with IFNg. Results are expressed relative to uninduced cells and show the mean and standard deviations derived from three independent experiments. The amplicons used are indicated in panel A and in Supplementary Table 1. (D) Luciferase activity was measured in Me67.8 cells that had been transduced with each construct and induced with IFNg for the indicated times. Results are represented as fold induction relative to uninduced cells, and show the means and standard deviations derived from three independent experiments.
Nucleosome eviction controls TSS selection driven luciferase constructs in which the distance between A luciferase reporter gene assay was developed to study the S-Y module and the TSS was progressively increased the function of nucleosome eviction from the TSS of the by the insertion of unrelated sequences (Figure 5A). To HLA-DRA gene. We generated HLA-DRA-promoter study the function of these constructs in the context of 2524 Nucleic Acids Research, 2009, Vol. 37, No. 8 chromatin, they were integrated into the genome of Upstream displacement of the major TSS in the Me67.8 cells using lentiviral vectors. qCHIP experiments DRA+150a construct suggested that TSS selection was demonstrated that displacing the S-Y module away from determined either by the distance from the S-Y module the TSS did not affect the binding of RFX or CIITA or the position of the NFR. To distinguish between (Figure 5B). This suggested that nucleosome eviction at these two possibilities, we mapped by RPA the 50 ends the S-Y module was likely to be reproduced in the reporter of the transcripts that are derived from transiently-trans- gene constructs. fected DRA and DRA+150a constructs, at which a The sizes of the inserted sequences were chosen such normal chromatin structure is not expected to be estab- that the TSS would be expected to remain within the pre- lished. The major TSS observed for the stably-integrated dicted NFR (DRA+40 construct) or be masked by the wild-type DRA construct was not used at all in transiently first downstream nucleosome (DRA+80 and DRA+150a transfected cells (Figure 6D). Instead two of the minor constructs) (Figure 5A). To verify this prediction, nucleo- TSSs were used predominantly (Figure 6D and E, tran- some occupancy at the TSS of the integrated constructs scripts a and d). Furthermore, the abnormal pattern of was measured by qMNAse-ChIP prior to and after induc- TSS selection observed for the wild-type DRA construct tion with IFNg. The results confirmed that IFNg-induced was not altered by insertion of the 150-bp spacer in the eviction of nucleosomes from the TSS was reproduced in DRA+150a construct (Figure 6D and E). Taken the wild-type DRA construct, retained in the DRA+40 together, these results demonstrate that faithful TSS selec- mutant, but lost in the DRA+80 and DRA+150a tion requires the establishment of a normal chromatin mutants (Figure 5C, left panel). The nucleosome depletion environment and that selection of the major TSS is deter- observed in the DRA and DRA+40 constructs was spe- mined by the position of the NFR rather than simply by cific to their TSS regions, since no significant reduction in distance from the S-Y module. nucleosome occupancy was evident in the downstream luciferase coding region (Figure 5C, middle panel). We next confirmed that nucleosome eviction is actually DISCUSSION retained in the vicinity of the S-Y module of the reporter gene constructs. Compared to the TSS and coding regions, Our results demonstrate that an exceptionally strong a clear reduction in nucleosome occupation was observed depletion of nucleosomes from the promoter and TSS is near the S-Y module of the DRA+150a construct in a unique feature associated with transcriptional activation IFNg-induced cells (Figure 5C, right panel). Taken of all classical and non-classical MHCII genes. This together, these results confirmed that displacement of nucleosome eviction event is induced primarily by assem- the S-Y module away from the TSS led to displacement bly of the multiprotein enhanceosome complex on the of the TSS outside of the NFR. conserved S-Y regulatory modules of MHCII genes, and We next measured IFNg-induced luciferase activity in it leads to the formation of a 200–300 bp NFR that the transduced cells (Figure 5D). Luciferase activity was unmasks the TSS. The generation of this NFR appears induced with similar efficiencies in cells transduced with to be critical for transcription initiation at MHCII genes the wild type and DRA+40 constructs. In contrast, the in vivo because it controls correct positioning of the TSS. induction of luciferase activity was significantly reduced in Genome-wide studies have indicated that nucleosome cells transduced with the DRA+80 and DRA+150a con- depletion at the core promoter and TSS is a widespread structs. This reduction was independent of the inserted feature of many genes in all eukaryotic organisms ana- sequence as it was observed with two unrelated inserts lyzed. In yeast, nucleosome depletion at the core promoter (Supplementary Figure 6A and B). Similar results were and TSS is typically greater than 3–4-fold (4,5). However, obtained following transduction of the constructs into B in the chicken, Drosophila and human, nucleosome density cells (Supplementary Figure 6C). These results indicated at the promoter and TSS is on the average reduced by that displacement of the TSS outside of the NFR corre- 50% or less when examining large sets of genes (1,6,49). lated with impaired luciferase reporter gene activity. This low magnitude is likely to result from several param- To determine whether impaired luciferase reporter gene eters, including inter-gene variability in the precise posi- activity was a consequence of reduced transcription initi- tion and size of the NRFs, the fraction of the cells in ation we performed RNAse protection assays (RPA) with which a given gene exhibits the NFR and the stability of a probe that overlaps the 50 end of the luciferase gene and nucleosome loss over time. In this respect, MHCII genes the TSS derived from the HLA-DRA promoter (Figure 6). stand out in that the NFRs found at their promoters are In cells transduced with the wild-type construct, the 50 end remarkably homogeneous with respect to their size and of most IFNg-induced transcripts mapped to the expected position, and exhibit a particularly marked nucleosome TSS (Figure 6A–C, transcript c). Only a minor fraction of loss, attaining greater than 250-fold when quantified by the transcripts initiated at other positions (Figure 6A–C, qMNAse-ChIP. The latter implies that the NFRs transcripts a, b and d). IFNg-induced initiation at the observed at MHCII genes are maintained stably over major TSS was completely abolished in cells carrying the time and in the majority of cells. At least three mecha- DRA+150a construct (Figure 6A–C). Instead, a reduced nisms have been proposed to be implicated in the deple- but significant level of incorrectly initiated transcription tion of nucleosomes from gene regulatory regions. First, was induced. These transcripts were initiated within the DNA sequence itself can be an important parameter NFR now situated upstream of the normal TSS favoring nucleosome eviction because nucleosome stabil- (Figure 6A–C, transcript a). ity is strongly influenced by specific sequence-dependent Nucleic Acids Research, 2009, Vol. 37, No. 8 2525
A DRA DRA+150a B h IFNγ: 00612246 12 24 P M probe a 367 a b b c 242 c transcripts DRA d d 190 luciferase
147 probe 118 110 DRA+150a a transcripts GAPDH luciferase
C 1.0 DRA DRA+150a 0.8
0.6
0.4
0.2 Transcript abundance
h IFNγ: 0 6 12 24 0 6 12 24 0 6 12 24 0 6 12 24 0 6 12 24 0 6 12 24 0 6 12 24 0 6 12 24 acdb acdb D E DRA +150a IFNγ: + – + – + P DRA DRA+150a 0.7 a b 0.6 c 0.5 d 0.4 0.3 0.2
GAPDH Transcript abundance 0.1
IFNγ: - + - + - + - + Transiently ad ad Integrated transfected Transiently transfected
Figure 6. Nucleosome eviction is essential for faithful TSS selection. (A) Expression of the DRA and DRA+150a constructs was assessed by RPA in stably-transduced Me67.8 cells induced with IFNg for the indicated times. Transcripts corresponding to major (c) and minor (a, b, d) TSSs are indicated (left). GAPDH mRNA was used as control. P, non-digested probes. M, size marker (in bp). (B) Schematic representation of the results shown in panel A. Positions of the probe and IFNg-induced transcripts a–d are indicated above the maps of the two constructs. The maps show the S-Y modules (open boxes), the inserted sequence (crosshatched box) in DRA+150a, and the predicted positions of the NFR (gray boxes). (C) Quantification of the a, b, c and d transcripts levels derived from the DRA and DRA+150a constructs in stably-transduced cells induced with IFNg for 0, 6, 12 or 24 h. Transcript abundance is expressed relative to GAPDH mRNA. (D) Expressions of the DRA and DRA+150a constructs were assessed by RPA in transiently-transfected Me67.8 cells. Left panel shows the band pattern obtained with the integrated DRA construct in stably- transduced Me67.8 cells. Cells were uninduced ( ) or induced with IFNg for 24 h (+). P, non-digested probes. Bands are labeled a–d as in panel A. GAPDH mRNA was used as control. (E) Quantification of transcripts a and d levels derived from the DRA and DRA+150a constructs in transiently-transfected Me67.8 cells. Cells were uninduced ( ) or induced with IFNg for 24 h (+). Transcript abundance is expressed relative to GAPDH mRNA. structural features of DNA. Intrinsic nucleosome posi- although a subset of nucleosomes may be positioned by tioning signals embedded in the DNA have been proposed the underlying DNA sequence, the majority are not (10). to play a major role in determining nucleosome occupancy We found that an intrinsic nucleosome positioning code in vivo (9). However, other studies have concluded that, does not seem to play a dominant role in inducing 2526 Nucleic Acids Research, 2009, Vol. 37, No. 8 nucleosome depletion at MHCII promoters, since no Interestingly, an NF-Y-binding site (CCAAT box) is significant nucleosome depletion was evident in RFX- found in numerous genes at an upstream position (–60 deficient cells, where the MHCII-specific regulatory to –100 bp) very similar to that observed in MHCII machinery can not assemble. We can however not exclude genes (58). It is consequently tempting to speculate that the possibility that intrinsic destabilizing sequences situ- nucleosome eviction from the TSS may be a widespread ated within MHCII promoters may facilitate nucleosome function of NF-Y. displacement induced by binding of the MHCII-specific The functional importance of nucleosome eviction from regulatory machinery. A second parameter that has been promoters has been addressed for only very few genes implicated in nucleosome eviction from promoters is PIC in vivo. The most well documented example is activation assembly. The potential importance of this mechanism is of the yeast PHO5 promoter. At the PHO5 gene, activa- supported by genome wide studies demonstrating the exis- tor-induced disassembly of nucleosomes at the promoter is tence of a correlation between the extent of nucleosome required for transcriptional activation (59–61). However, depletion and either Pol II occupancy or transcriptional the precise activation step regulated by nucleosome deple- activity (2,6). This mechanism does again not appear to be tion has not been defined in this system. We show here critical at MHCII promoters, where nucleosome eviction that nucleosome eviction from MHCII promoters is crit- occurs normally in CIITA-deficient cells despite the ical for determining the position of the TSS. Our results absence of Pol II recruitment and transcription. Finally, demonstrate that the major TSS of the HLA-DRA gene is specific transcription factor-binding sites, have been found only used in the context of chromatin. Furthermore, this to correlate with nucleosome eviction in vivo (5,12,13), major TSS is no longer used when it is displaced down- suggesting that certain transcription factor complexes stream of the NFR, and is instead replaced by a cryptic may gain access to DNA by excluding nucleosomes. The upstream TSS situated within the NFR. The position of latter is consistent with in vitro studies illustrating that the NFR is thus more critical for TSS selection than the nucleosomes can be destabilized or excluded by coopera- underlying DNA sequence itself. This suggests that the tive binding of transcription factors (50–52). This third NFR induced at MHCII promoters actually replaces the mechanism is critical at MHCII promoters, where nucleo- requirement for core-promoter sequences by restricting some eviction requires assembly of the MHCII enhance- access to DNA to a precisely delimited region. These find- osome complex. ings provide an explanation for the previously puzzling The nucleosome eviction mechanism documented here observation that MHCII genes do not have typical core differs strikingly from the situation reported for the inter- promoters defined by a TATA box, an initiator element feron b (IFNb) gene (53). Assembly of the IFNb enhance- and/or other motifs implicated in PIC assembly, despite osome occurs within a pre-existing NFR that is flanked the fact that they have a precisely positioned TSS (62–64). by two nucleosomes positioned by their underlying DNA This had led to the speculation that MHCII genes might sequences. The nucleosome situated downstream of the rely on an alternative mechanism for proper positioning of NFR masks the promoter and is induced to slide further the TSS (64). Our results indeed provide direct evidence downstream by the bend introduced in the DNA by bind- for an alternative mechanism in which selection of the ing of TFIID. Nucleosome mobilization at the IFNb pro- major TSS is guided by the generation of a strong NFR moter is thus triggered by partial PIC assembly rather rather than simply by the sequence of the core promoter. than directly by binding of the enhanceosome complex. At MHCII genes on the other hand, nucleosome eviction is independent of PIC assembly and is instead induced by SUPPLEMENTARY DATA binding of the enhanceosome complex. Assembly of the MHCII enhanceosome complex Supplementary Data are available at NAR Online. requires cooperative binding between RFX, CREB and NF-Y. It remains to be established how these three factors contribute, respectively, to nucleosome eviction. Several ACKNOWLEDGEMENTS lines of evidence suggest that NF-Y may play a critical role in this process. NF-Y consists of three subunits, We are grateful to Michel Strubin, and to all members of NF-YA, NF-YB and NF-YC (27). NF-YB and NF-YC the laboratory, for constructive discussions. We thank contain histone-fold domains exhibiting striking homol- P. Salmon (Geneva, Switzerland) for providing lentiviral ogy to H2B and H2A, respectively (27). NF-YB-NF-YC vectors. dimers interact with DNA in a manner analogous to H2A- H2B dimers (54), suggesting that NF-Y might compete with nucleosomes for access to DNA. Furthermore, bind- FUNDING ing of NF-Y induces a 60–808 bend in the DNA (55,56), Swiss National Science Foundation [3100A0-105895]; the a structural deformation that could contribute to nucleo- Geneva Cancer League; the Swiss Multiple Sclerosis some destabilization. Finally, NF-Y can bind in vitro to Society and the National Center of Competence in the mouse MHCII Ea promoter in the context of nucleo- Research on Neural Plasticity and Repair (NCCR- somal DNA irrespectively of the position of its target NEURO). Funding for open access charge: Swiss site relative to the nucleosome (57). Taken together, National Science Foundation [3100A0-105895]. these features of NF-Y suggest that it might play a key role in displacing nucleosomes from MHCII promoters. Conflict of interest statement. None declared. Nucleic Acids Research, 2009, Vol. 37, No. 8 2527
REFERENCES 23. Durand,B., Sperisen,P., Emery,P., Barras,E., Zufferey,M., Mach,B. and Reith,W. (1997) RFXAP, a novel subunit of the RFX DNA 1. Ozsolak,F., Song,J.S., Liu,X.S. and Fisher,D.E. (2007) High- binding complex is mutated in MHC class II deficiency. EMBO J., throughput mapping of the chromatin structure of human pro- 16, 1045–1055. moters. Nat. Biotechnol., 25, 244–248. 24. Masternak,K., Barras,E., Zufferey,M., Conrad,B., Corthals,G., 2. Schones,D.E., Cui,K., Cuddapah,S., Roh,T.Y., Barski,A., Wang,Z., Aebersold,R., Sanchez,J.C., Hochstrasser,D.F., Mach,B. and Wei,G. and Zhao,K. (2008) Dynamic regulation of nucleosome Reith,W. (1998) A gene encoding a novel RFX-associated transac- positioning in the human genome. Cell, 132, 887–898. tivator is mutated in the majority of MHC class II deficiency 3. Schmid,C.D. and Bucher,P. (2007) ChIP-Seq data reveal nucleo- patients. Nat. Genet., 20, 273–277. some architecture of human promoters. Cell, 131, 831–832; author 25. Nagarajan,U.M., Louis-Plence,P., DeSandro,A., Nilsen,R., reply 832–833. Bushey,A. and Boss,J.M. (1999) RFX-B is the gene responsible for 4. Sekinger,E.A., Moqtaderi,Z. and Struhl,K. (2005) Intrinsic histone- the most common cause of the bare lymphocyte syndrome, an DNA interactions and low nucleosome density are important for MHC class II immunodeficiency. Immunity, 10, 153–162. preferential accessibility of promoter regions in yeast. Mol. Cell, 18, 26. Moreno,C.S., Beresford,G.W., Louis-Plence,P., Morris,A.C. and 735–748. Boss,J.M. (1999) CREB regulates MHC class II expression in a 5. Bernstein,B.E., Liu,C.L., Humphrey,E.L., Perlstein,E.O. and CIITA-dependent manner. Immunity, 10, 143–151. Schreiber,S.L. (2004) Global nucleosome occupancy in yeast. 27. Mantovani,R. (1999) The molecular biology of the CCAAT-binding Genome Biol., 5, R62. factor NF-Y. Gene, 239, 15–27. 6. Mavrich,T.N., Jiang,C., Ioshikhes,I.P., Li,X., Venters,B.J., 28. Mahanta,S.K., Scholl,T., Yang,F.C. and Strominger,J.L. (1997) Zanton,S.J., Tomsho,L.P., Qi,J., Glaser,R.L., Schuster,S.C. et al. Transactivation by CIITA, the type II bare lymphocyte syndrome- (2008) Nucleosome organization in the Drosophila genome. Nature, associated factor, requires participation of multiple regions of the 453, 358–362. TATA box binding protein. Proc. Natl Acad. Sci. USA, 94, 7. Zhao,H., Kim,A., Song,S.H. and Dean,A. (2006) Enhancer block- 6324–6329. ing by chicken beta-globin 5’-HS4: role of enhancer strength and 29. Spilianakis,C., Kretsovali,A., Agalioti,T., Makatounakis,T., insulator nucleosome depletion. J. Biol. Chem., 281, 30573–30580. Thanos,D. and Papamatheakis,J. (2003) CIITA regulates tran- 8. Heintzman,N.D., Stuart,R.K., Hon,G., Fu,Y., Ching,C.W., scription onset viaSer5-phosphorylation of RNA Pol II. EMBO J., Hawkins,R.D., Barrera,L.O., Van Calcar,S., Qu,C., Ching,K.A. 22, 5125–5136. et al. (2007) Distinct and predictive chromatin signatures of tran- 30. Kanazawa,S., Okamoto,T. and Peterlin,B.M. (2000) Tat competes scriptional promoters and enhancers in the human genome. Nat. with CIITA for the binding to P-TEFb and blocks the expression of Genet., 39, 311–318. MHC class II genes in HIV infection. Immunity, 12, 61–70. 9. Segal,E., Fondufe-Mittendorf,Y., Chen,L., Thastrom,A., Field,Y., 31. Mudhasani,R. and Fontes,J.D. (2002) The class II transactivator Moore,I.K., Wang,J.P. and Widom,J. (2006) A genomic code for requires brahma-related gene 1 to activate transcription of major nucleosome positioning. Nature, 442, 772–778. histocompatibility complex class II genes. Mol. Cell Biol., 22, 10. Peckham,H.E., Thurman,R.E., Fu,Y., Stamatoyannopoulos,J.A., 5019–5026. Noble,W.S., Struhl,K. and Weng,Z. (2007) Nucleosome positioning 32. Mudhasani,R. and Fontes,J.D. (2005) Multiple interactions between signals in genomic DNA. Genome Res., 17, 1170–1177. BRG1 and MHC class II promoter binding proteins. Mol. 11. Lee,W., Tillo,D., Bray,N., Morse,R.H., Davis,R.W., Hughes,T.R. Immunol., 42, 673–682. and Nislow,C. (2007) A high-resolution atlas of nucleosome occu- 33. Rybtsova,N., Leimgruber,E., Seguin-Estevez,Q., Dunand- pancy in yeast. Nat. Genet., 39, 1235–1244. Sauthier,I., Krawczyk,M. and Reith,W. (2007) Transcription- 12. Adkins,M.W., Howar,S.R. and Tyler,J.K. (2004) Chromatin disas- coupled deposition of histone modifications during MHC class II sembly mediated by the histone chaperone Asf1 is essential for gene activation. Nucleic Acids Res., 35, 3431–3441. transcriptional activation of the yeast PHO5 and PHO8 genes. Mol. 34. Masternak,K., Peyraud,N., Krawczyk,M., Barras,E. and Reith,W. Cell, 14, 657–666. (2003) Chromatin remodeling and extragenic transcription at the 13. Raisner,R.M., Hartley,P.D., Meneghini,M.D., Bao,M.Z., Liu,C.L., MHC class II locus control region. Nat. Immunol., 4, 132–137. Schreiber,S.L., Rando,O.J. and Madhani,H.D. (2005) Histone var- 35. Giardine,B., Riemer,C., Hardison,R.C., Burhans,R., Elnitski,L., iant H2A.Z marks the 5’ ends of both active and inactive genes in Shah,P., Zhang,Y., Blankenberg,D., Albert,I., Taylor,J. et al. (2005) euchromatin. Cell, 123, 233–248. Galaxy: a platform for interactive large-scale genome analysis. 14. Becker,P.B. and Horz,W. (2002) ATP-dependent nucleosome Genome Res., 15, 1451–1455. remodeling. Annu. Rev. Biochem., 71, 247–273. 36. Su,A.I., Wiltshire,T., Batalov,S., Lapp,H., Ching,K.A., Block,D., 15. Saha,A., Wittmeyer,J. and Cairns,B.R. (2006) Chromatin remodel- Zhang,J., Soden,R., Hayakawa,M., Kreiman,G. et al. (2004) A gene ling: the industrial revolution of DNA around histones. Nat. Rev. atlas of the mouse and human protein-encoding transcriptomes. Mol. Cell Biol., 7, 437–447. Proc. Natl Acad. Sci. USA, 101, 6062–6067. 16. Reith,W. and Mach,B. (2001) The bare lymphocyte syndrome 37. Muhlethaler-Mottet,A., Di Berardino,W., Otten,L.A. and Mach,B. and the regulation of mhc expression. Annu. Rev. Immunol., 19, (1998) Activation of the MHC class II transactivator CIITA by 331–373. interferon-g requires cooperative interaction between Stat1 and 17. Ting,J.P. and Trowsdale,J. (2002) Genetic control of MHC class II USF-1. Immunity, 8, 157–166. expression. Cell, 109(Suppl.), S21–S33. 38. Krawczyk,M., Leimgruber,E., Seguin-Estevez,Q., Dunand- 18. Reith,W., LeibundGut-Landmann,S. and Waldburger,J.M. (2005) Sauthier,I., Barras,E. and Reith,W. (2007) Expression of RAB4B, a Regulation of MHC class II gene expression by the class II trans- protein governing endocytic recycling, is co-regulated with MHC activator. Nat. Rev. Immunol., 5, 793–806. class II genes. Nucleic Acids Res., 35, 595–605. 19. Boss,J.M. and Jensen,P.E. (2003) Transcriptional regulation of the 39. Villard,J., Muhlethaler-Mottet,A., Bontron,S., Mach,B. and MHC class II antigen presentation pathway. Curr. Opin. Immunol., Reith,W. (1999) CIITA-induced occupation of MHC class II pro- 15, 105–111. moters is independent of the cooperative stabilization of the pro- 20. Steimle,V., Otten,L.A., Zufferey,M. and Mach,B. (1993) moter-bound multi-protein complexes. Int. Immunol., 11, 461–469. Complementation cloning of an MHC class II transactivator 40. Westerheide,S.D., Louis-Plence,P., Ping,D., He,X.F. and Boss,J.M. mutated in hereditary MHC class II deficiency. Cell, 75, 135–146. (1997) HLA-DMA and HLA-DMB gene expression functions 21. Krawczyk,M., Seguin-Estevez,Q., Leimgruber,E., Sperisen,P., through the conserved S-X- Y region. J. Immunol., 158, 4812–4821. Schmid,C., Bucher,P. and Reith,W. (2008) Identification of CIITA 41. Krawczyk,M., Peyraud,N., Rybtsova,N., Masternak,K., Bucher,P., regulated genetic module dedicated for antigen presentation. PLoS Barras,E. and Reith,W. (2004) Long distance control of MHC class Genet., 4, e1000058. II expression by multiple distal enhancers regulated by regulatory 22. Steimle,V., Durand,B., Barras,E., Zufferey,M., Hadam,M.R., factor X complex and CIITA. J. Immunol., 173, 6200–6210. Mach,B. and Reith,W. (1995) A novel DNA binding regulatory 42. Go¨nczy,P., Reith,W., Barras,E., Lisowska-Grospierre,B., factor is mutated in primary MHC class II deficiency (Bare Griscelli,C., Hadam,M.R. and Mach,B. (1989) Inherited Lymphocyte Syndrome). Genes Dev., 9, 1021–1032. Immunodeficiency with a defect in a Major Histocompatibility 2528 Nucleic Acids Research, 2009, Vol. 37, No. 8
Complex class II promoter-binding protein differs in the chromatin 54. Romier,C., Cocchiarella,F., Mantovani,R. and Moras,D. (2003) structure of the HLA-DRA gene. Mol. Cell Biol., 9, 296–302. The NF-YB/NF-YC structure gives insight into DNA binding and 43. Sharma,N. and Nyborg,J.K. (2008) The coactivators CBP/p300 and transcription regulation by CCAAT factor NF-Y. J. Biol. Chem., the histone chaperone NAP1 promote transcription-independent 278, 1336–1345. nucleosome eviction at the HTLV-1 promoter. Proc. Natl Acad. Sci. 55. Ronchi,A., Bellorini,M., Mongelli,N. and Mantovani,R. (1995) CC USA, 105, 7959–7963. AAT-box binding protein NF-Y (CBF, CP1) recognizes the minor 44. Beresford,G.W. and Boss,J.M. (2001) CIITA coordinates multiple groove and distorts DNA. Nucleic Acids Res., 23, 4565–4572. histone acetylation modifications at the HLA- DRA promoter. Nat. 56. Liberati,C., di Silvio,A., Ottolenghi,S. and Mantovani,R. (1999) Immunol., 2, 652–657. NF-Y binding to twin CCAAT boxes: role of Q-rich domains and 45. Zika,E. and Ting,J.P. (2005) Epigenetic control of MHC-II: inter- histone fold helices. J. Mol. Biol., 285, 1441–1455. play between CIITA and histone-modifying enzymes. Curr. Opin. 57. Motta,M.C., Caretti,G., Badaracco,G.F. and Mantovani,R. (1999) Immunol., 17, 58–64. Interactions of the CCAAT-binding trimer NF-Y with nucleosomes. 46. Zlatanova,J. and Thakar,A. (2008) H2A.Z: view from the top. J. Biol. Chem., 274, 1326–1333. Structure, 16, 166–179. 58. Bucher,P. (1990) Weight matrix descriptions of four eukaryotic 47. Liu,C.L., Kaplan,T., Kim,M., Buratowski,S., Schreiber,S.L., RNA polymerase II promoter elements derived from 502 unrelated Friedman,N. and Rando,O.J. (2005) Single-nucleosome mapping of promoter sequences. J. Mol. Biol., 212, 563–578. histone modifications in S. cerevisiae. PLoS Biol., 3, e328. 59. Boeger,H., Griesenbeck,J., Strattan,J.S. and Kornberg,R.D. (2004) 48. Barski,A., Cuddapah,S., Cui,K., Roh,T.Y., Schones,D.E., Wang,Z., Removal of promoter nucleosomes by disassembly rather than Wei,G., Chepelev,I. and Zhao,K. (2007) High-resolution sliding in vivo. Mol. Cell, 14, 667–673. profiling of histone methylations in the human genome. Cell, 129, 60. Reinke,H. and Horz,W. (2003) Histones are first hyperacetylated 823–837. and then lose contact with the activated PHO5 promoter. Mol. Cell, 49. Schones,D.E. and Zhao,K. (2008) Genome-wide approaches to 11, 1599–1607. studying chromatin modifications. Nat. Rev. Genet., 9, 179–191. 61. Straka,C. and Horz,W. (1991) A functional role for nucleosomes in 50. Morse,R.H. (1993) Nucleosome disruption by transcription factor the repression of a yeast promoter. EMBO J., 10, 361–368. binding in yeast. Science, 262, 1563–1566. 62. Mantovani,R., Tora,L., Moncollin,V., Egly,J.M., Benoist,C. and 51. Workman,J.L. and Kingston,R.E. (1992) Nucleosome core displa- Mathis,D. (1993) The major histocompatibility complex (MHC) Ea cement in vitro via a metastable transcription factor-nucleosome promoter: sequences and factors at the initiation site. Nucleic Acids complex. Science, 258, 1780–1784. Res., 21, 4873–4878. 52. Owen-Hughes,T. and Workman,J.L. (1996) Remodeling the 63. Viville,S., Jongeneel,V., Koch,W., Mantovani,R., Benoist,C. and chromatin structure of a nucleosome array by transcription fac- Mathis,D. (1991) The E alpha promoter: a linker-scanning analysis. tor-targeted trans-displacement of histones. EMBO J., 15, J. Immunol., 146, 3211–3217. 4702–4712. 64. Benoist,C. and Mathis,D. (1990) Regulation of major histocom- 53. Lomvardas,S. and Thanos,D. (2001) Nucleosome sliding via TBP patibility complex class-II genes: X, Y and other letters of the DNA binding in vivo. Cell, 106, 685–696. alphabet. Annu. Rev. Immunol., 8, 681–715. Leimgruber et al. Supplementary Figure 1
TSS A. S’-Y’ S-Y
3.0
2.0
B. 1.0 - IFN γ Relative H4Ac Relative
1 0.0
1.2
1.0 0.1
0.8
0.6 ResistanceMNAse to 0.01 units: 0 1 2 4 60 1 2 4 6 0 1 2 4 6 0.4
Relative H3 density H3 Relative -3.5 kbS’-Y’ S-Y/TSS 0.2 + IFN γ 0U 4U 6U 10U 1.4 1 1.2 1.0 0.8 0.1 0.6 0.4 0.2 ResistanceMNAse to 0.01 ResistanceMNAse to 0.0 -5 -4 -3 -2 -1 0 1 2 units: 0 1 2 4 60 1 2 4 6 0 1 2 4 6 Distance relative to start site (kb) -3.5 kbS’-Y’ S-Y/TSS
Supplementary Figure 1 . The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit lower levels of H4Ac, reduced nucleosome occupancy and enhanced MNAse sensitivity in IFN γ-induced Me67.8 cells. ( A) H4Ac (top) and nucleosome density (middle) were quantified by qChIP at the indicated positions, and are expressed relative to the -4.9kb upstream position. Resistance to MNAse digestion (bottom) was assessed at the indicated positions by performing qPCR on DNA extracted from chromatin digested with the indicated amounts of MNAse, and is expressed relative to the promoter in the absence of MNAse digestion. A schematic map of the HLA-DRA upstream region is shown. Primer pairs are indicated in Supplemental Table 1. ( B) Resistance to digestion with MNAse was assessed at the S’-Y’ enhancer, the S-Y/TSS region and a control upstream region (-3.5 kb) in chromatin from non-induced Me67.8 cells (-IFN γ) and in Me67.8 cells induced for 24 h with IFN γ (+IFN γ) treated with the indicated amounts of MNAse. Leimgruber et al. Supplementary Figure 2
MNAse units
0 1 2 6 10 0 1 3 6
tri
di 400 bp 300 bp mono 200 bp nucleosome ladder 100 bp marker Size
Nuclei DNA
Supplementary Figure 2 . DNA obtained by digestion with the indicated amounts of MNAse of nuclei (left) or purified genomic DNA (right) was analyzed by gel electrophoresis. The positions of mono-, di- and tri-nucleosomes (left), and the sizes in bp of marker fragments (right), are indicated. Block arrows indicate the digestion conditions used for experiments. Leimgruber et al. Supplementary Figure 3
TSS S’-Y’ S-Y
0U 4U 6U 10U 1.4
1.2 1.0 0.8 0.6
0.4
ResistanceMNAse to 0.2
-5 -4 -3 -2 -1 0 1 2 Distance relative to start site (kb)
Supplementary Figure 3 . The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit enhanced MNAse sensitivity in Raji B cells. Resistance to MNAse digestion was assessed at the indicated positions by performing qPCR on DNA extracted from chromatin digested with the indicated amounts of MNAse, and is expressed relative to the promoter in the absence of MNAse digestion. A schematic map of the HLA-DRA upstream region is shown. Primer pairs are indicated in Supplemental Table 1. Leimgruber et al. Supplementary Figure 4
RFX -/- CIITA -/- WT
*
b (2.7 kb)
a (2.5 kb)
DNAse I DNAse I DNAse I
a b Pst I Pst I
6.1 kb S-Y E1 E2 E3 2.5 kb 2.7 kb probe
Supplementary Figure 4 . Southern blot analysis of DNase I hypersensitive sites flanking the HLA-DRA S-Y module in wild type Raji B cells (WT), RFX-deficient B cells (RFX -/-) and CIITA- deficient B cells (CIITA -/-). The two hypersensitive sites flanking the S-Y module (right, arrows labelled a and b) are detected in WT and CIITA -/- cells but not in RFX -/- cells. A schematic map of the Southern blotting strategy is indicated below. *, contaminating band of unknown origin. Leimgruber et al. Supplementary Figure 5
0 1 2 3 CD74 4 (MHCII - Ii chain) 5 0 0 1 1 ut DNA))) ut 2 2 3 3 4 CUTA 4 BAT1 5 5 0 0 1 1 2 2 3 3 4 C6orf48 4 GAPDH 5 5 0 0 1 1 2 2 3 3 4 RGL2 4 TAPBP 5 5 0 0 Fold nucleosome depletion (1/2^(ratio ChIP WT (1/2^(ratioChIP nucleosome Fold inp / depletion 1 1 2 2 3 3 4 TUBB 4 LTB 5 5 -0.8 -0.4 0 0.4 0.8 -0.8 -0.4 0 0.4 0.8 Distance relative to start site (kb)
Supplementary Figure 5 . Nucleosome occupancy at the TSS of the MHCII-associate invariant chain (Ii) gene (CD74) and non-MHCII genes. Nucleosome occupancy at the indicated genes was analyzed by ChIP-chip. Results represent the fold depletion observed in ChIP samples from wild type Raji B cells (WT) relative to input DNA. TSSs are indicated by arrows. Leimgruber et al. Supplementary Figure 6
A. TSS C. DRA S-Y 1.0
0.8 DRA+150a 0.6
0.4 DRA+150b luciferase 0.2 -400 -300 -200 -100 100 200 300 Relative Relative luciferase activity B. DRA
6 vector
5 DRA+150a
4
3
2
1 Fold induction (luciferase) induction Fold
h IFN γ: 01224480 12 24 48 0122448 DRADRA+150a DRA+150b
Supplementary Figure 6 . Nucleosome displacement from the TSS is required for activation of the HLA- DRA gene. ( A) Schematic representation of the wild type (DRA) and mutated (DRA+150a, DRA+150b) constructs. Maps show the S-Y modules (open boxes), TSSs (arrows), the two different inserted 150 bp sequences (DRA+150a, crosshatched box; DRA+150b, stippled box) and the predicted position of the NFRs (gray boxes). ( B) Each construct was transduced into Me67.8 cells using lentiviral vectors, and luciferase activity was measured after induction of the transduced cells with IFN γ for the indicated times. Results are represented as fold induction relative to uninduced cells, and show the means and standard deviations derived from three independent experiments. ( C) Luciferase promoter activity was measured in Raji B cells transduced with the DRA and DRA+150a constructs, or with the empty lentiviral vector. Results are represented relative to the activity of the wild type DRA construct and show the means and standard deviations derived from three independent experiments. Leimgruber et al. Supplementary Table 1. Primers used for qPCR
A) qChIP experiments for CIITA, RFX, CREB, NF-Y, Pol II, H2A.Z and BRG1 (Figures 1A, 1B, 2A, 2B, 3 and 5B) gene, position forward primer reverse primer DRA +0.052kb CCGAGCTCTACTGACTCCC GGACTCCACTTATGGCCATT DRA -0.1kb TTGCAAGAACCCTTCCCCT AAATATTTTGAGATGACGCATC DRA -0.299 kb GGTCTCGACAGAAAGTATAAC GGTGAGGGAAGAACTCCAC DRA -8.3 kb GCTTCCAGAGTCCCCGTAAAG GGAAGAATATTTCATGAACCGTAACAA Insert GCAACAGATGCGTCATCTCG CTTCTACAACATGAGGGACAG
B) H4Ac-ChIP, H3-ChIP and MNAse sensitivity experiments (Supplemental Figures 1 and 3). gene, position forward primer reverse primer DRA -4.9 kb AACCTTGCACAAGAGAAAAGCTTTAC GGAAGAGAAAAAGACCAGAAACGTC DRA -3.5 kb CTGCCCTAGCACATTTGTTAACG GCTGGTCTGCTGGAATAGATCC DRA -2.3 kb CAGAGAAAGGGAACTGAAAGTCATTT TTATGACACTGTTTAGTCCTAGAACACTGA DRA -1.3 kb TCTGTGGAAAGAACTTAACATTCTCCT GATGTTCAACATAGACACTCCTGAAA DRA -0.04 kb ATTTTTCTGATTGGCCAAAGAGTAATT AAAAGAAAAGAGAATGTGGGGTGTAA DRA +1.7 kb CAGACGAGAACCTTCTCATAGAGGTAA AATTAAGACTGAGACCTTGTAGCGTCA
C) Mapping of nucleosome occupancy at the HLA-DRA S’-Y’ enhancer by qMNAse- ChIP (Figures 1C and 2C) gene, position forward primer reverse primer DRA -2.56 kb CTGCAGTGACTTCTGCTCC ATCAGTCTAAGCAGAACTGAA DRA -2.53 kb GGCTAATTCCCTGTAATATATTC CAGTCAAGAAATAGGAATCCCT DRA -2.5 kb CTTAGACTGATTACAGGGATTC ATGGTGACGAGCCACTATAGC DRA -2.45 kb CTATAGTGGCTCGTCACCAT GAGGGAATTTCCAAAGGCAC DRA -2.41 kb TCCTCATTCAGGTGCCTTTGG TGGACAGTGCTCATGGTTCTC DRA -2.38 kb CACACAGGAAATTAGAGTTTGA CTCTGTGATAGGAGAGAAGTT DRA -2.35 kb GAGAACCATGAGCACTGTC ATGACTTTCAGTTCCCTTTCT DRA -2.33 kb GAACTTCTCTCCTATCACAGA ACTAAATTTGGGAGACTTGAG DRA -2.29 kb AGTCATTTCTCAAGTCTCCCA GAACACTGATTGGTTCTTCTT DRA -2.25 kb ACCAATCAGTGTTCTAGGAC CAATCCAAGTTGTTGCTCAG DRA -2.19 kb GAGCAACAACTTGGATTGAAGATG CCTTGTTCTTAAATGGTGCTTGAG DRA -2.16 kb GTCTTTGAATTTACCATGTTTTTC GCCCTTTGCTGGCTGCCAT DRA -2.11 kb CAAGGCATTATGGCAGCCAG GTCATCTCCTCTTTTAGAGGC DRA -2.09 kb GCAGACATAGAAAATTATACATGG CCTATGATTTAAGCTTGTCATC DRA -2.05 kb GGAGATGACAAGCTTAAATCA CCAGATGAGAGCCTATGGT
1
D) Mapping of nucleosome occupancy at the HLA-DRA S-Y/TSS region by qMNAse- ChIP (Figures 1C and 2C) gene, position forward primer reverse primer DRA -0.357 kb GTCCCTTACGCAAACTCTCC GAGCTAAATACAGATCATATGTC DRA -0.326 kb GGCACAGACATATGATCTGT CCTGAAGCACATTAGTGAGA DRA -0.299 kb GCTCTCACTTTAGGTGTTTCC GACAGGGATATACCTGAAGCA DRA -0.249 kb GGTATATCCCTGTCTAGAACT GACTGTTGGTCAATGACGGA DRA -0.22 kb GGGTTAAAGAGTCTGTCCG GGACAACAACGACAACAAATC DRA -0.169 kb GATTTGTTGTCGTTGTTGTCC CCAGGACACAAGATACTCC DRA -0.138 kb CTTCTTTATCCAATGAACGGA GGAAGGGTTCTTGCAAAGG DRA -0.102 kb TTGCAAGAACCCTTCCCCT AAATATTTTGAGATGACGCATC DRA -0.04 kb ATTTTTCTGATTGGCCAAAGAGTAATT AAAAGAAAAGAGAATGTGGGGTGTAA DRA -0.031 kb GGTCAGACTCTATTACACCC GAGTGAGGCAGAACAGACAA DRA +0.03 kb CCCACATTCTCTTTTCTTTTATTC CGCTCTGTTGGGAGTCAGTA DRA +0.052 kb CCGAGCTCTACTGACTCCC GGACTCCACTTATGGCCATT DRA +0.093 kb GCCATAAGTGGAGTCCCTG CGCTCATCAGCACAGCTATG DRA +0.13 kb CATAGCTGTGCTGATGAGCG CCCTCAGCACCTACCTTTGA DRA +0.164 kb GCTATCAAAGGTAGGTGCTGA CCAATGCTTCGTAGTCTATCG DRA +0.202 kb GGACGATAGACTACGAAGCA CACTCCACACATTATCTTCCA DRA +0.233 kb AGACCTATGGACATTTGGAAGA CGAGACCACATAATACCTGTC DRA +0.259 kb GGAGTGAAAGAATAGTGTGAC CCACAATTTGTTATAGTTTCTGT
2
E) Mapping of nucleosome occupancy at MHCII genes by qMNAse-ChIP (Figure 4B) gene, position forward primer reverse primer DRA D GCTATCAAAGGTAGGTGCTGA CCAATGCTTCGTAGTCTATCG DRA S-Y TTGCAAGAACCCTTCCCCT AAATATTTTGAGATGACGCATC DRA U GCTCTCACTTTAGGTGTTTCC GACAGGGATATACCTGAAGCA DPA D GCGTCCTCCTGAGCACTCA TGATCTTGAGAGCCCTCTCC DPA S-Y ATCAGCATGGCTGGGATTCAC CACCTTCCAGCGTCCTCTTTAC DPA U CCATTATGTTCCTTCTCCCGA CATGATTTAAAATATAGTGACCA DPB D CTGACGGCGTTACTGATGG CCAAGAATGGCAGTTCGGCT DBP S-Y CTTTCCTCCGTCATCTTAAGTG TTCTGTGACCCTGGGATTG DPB U CAGACCATGTCCTGTGGG TGCTCTGAAGGAGATCTCAA DQA D CTACAATTTCTCTGCAAATCG GGGTGAGTGTATGAGTGAGG DQA S-Y ACTGAGGTGTCATCATAGGG GACCTCGAGACAAGGCAA DQA U GGTGACAGAGTGAGACTAC TCTGCCAGTGGCAAGAGG DQB D GCTCTGGAGAGCAGCTGCC CCTTGATGCTGTCGATGCTG DQB S-Y TGATGTACCTGGCAGAAAGAATAAAAA CTGCCCAGAGACAGCTGAGGT DQB U TGCGATTCAACAGTAAACATC CCCTATTGAAAGAATCCCAAG DRB1 D CCCACAATGTGCACTTACGT GCAGTTCTGACAGTGACACT DRB1 S-Y CAAGTTATAGGGAGTAAGTTAC GCTATTGAACTCAGATGCTGA DRB1 U CTGGTCAGTGATGTGTTCAC CTGCAAACAGTTCTCTTGTC
F) Luciferase qMNAse-ChIP (Figure 5C) gene, position forward primer reverse primer Insert GCAACAGATGCGTCATCTCG CTTCTACAACATGAGGGACAG Luci -10 bp GGATCTGCGATCTAAGTAAGC GAATGGCGCCGGGCCTTTC Luci + 195 bp CACTTACGCTGAGTACTTCG CACTGCATACGACGATTCTG
3 Leimgruber et al. Supplementary Table 2. Genes analysed by ChIP-on-chip
A) MHCII genes gene symbols genomic coordinates 1 HLA-DRB5 chr6: 32606022 – HLA-DRB1 chr6: 32665559 - HLA-DPB1 chr6: 33151727 + HLA-DOB chr6: 32892803 - HLA-DQA1 chr6: 32713112 + HLA-DQB1 chr6: 32742420 - HLA-DOA chr6: 33085367 - HLA-DMB chr6: 33016795 - HLA-DMA chr6: 33028831 - HLA-DPA chr6: 33149356 - HLA-DPB chr6: 33151738 +
B) Non-MHCII Genes highly expressed in B cells gene symbols genomic coordinates 1 mean expr 2 CD74 chr5:149761426-149772685 - 11625.35 RPS10 chr6:34493209-34501854 - 10351.25 GAPDH chr12:6513872-6517786 + 9110.4 KIFC1 chr6:33475814-33476311 - 7092.95 C6orf48 chr6:31910383-31915520 + 4675.45 LTB chr6:31656314-31658181 - 1338.8 TUBB chr6:30796113-30801182 + 1295.45 RGL2 chr6:33365057-33374156 + 1218.05 TAPBP chr6:33375449-33390114 - 1218.05 BAT1 chr6:31605975-31622338 - 1015.5 CUTA chr6:33492297-33494043 - 976.85 LY6G5B chr6:31740992-31749302 + 859.85 SKIV2L chr6:32034560-32045509 + 775.35 AGPAT1 chr6:32243967-32253851 - 680.25 PPT2 chr6:32229279-32244040 + 680.25 PSMB9 chr6:32919891-32955342 + 562.45 CLIC1 chr6:31806337-31815519 - 541.1 RING1 chr6:33284264-33288476 + 518.95 BAT3 chr6:31714784-31728426 - 514.8 HSPA1B chr6:31903667-31906010 + 479.8 STK19 chr6:32046931-32057202 + 466.85 HMGN4 chr6:26646551-26655139 + 455 GPSM3 chr6:32266521-32271278 - 445.25
4 PSMB8 chr6:32916472-32920690 - 441.1 ABCF1 chr6:30647149-30667286 + 432.25 CLEC16A chr16:10945943-11183527 + 417.75 COL11A2 chr6:33238436-33268254 - 415.05 TAP1 chr6:32920965-32929733 - 405.75 BRD2 chr6:33044415-33057260 + 401.05 LSM2 chr6:31873155-31882731 - 395.4 DDR1 chr6:30956784-30975912 + 379.85 C6orf125 chr6:33773324-33787482 - 364.55 ITPR3 chr6:33697322-33772317 + 364.55 PPP1R11 chr6:30142465-30146089 + 360.95 MAST2 chr1:46041872-46274383 + 306.9 RPP21 chr6:30420925-30422649 + 301.1 RXRB chr6:33269343-33276410 - 289.4 KPNA6 chr1:32346231-32414756 + 278.45 PBX2 chr6:32260488-32265941 - 275.55 PDXK chr21:43963403-44006616 + 271.45 APOM chr6:31728172-31733966 + 250.9 C6orf27 chr6:31841346-31853050 - 248.05 HIST1H2BD chr6:26266328-26279553 + 245.2 COL1A1 chr17:45616456-45633999 - 245 C6orf134 chr6:30702598-30722582 + 244.05 TRIM10 chr6:30227705-30236690 - 235.5 MDC1 chr6:30775563-30793645 - 232.55 HIST1H4C chr6:26212083-26212497 + 224.1
1 NCBI Build 36.2 (26-10-2006), the orientation is designated by + or -
2 Based on microarray datasets for Raji cells (GEO GDS596; (Su et al. 2004))
5
II.3 The gene encoding BTN2A2, a relative of the B7 family of costimulatory molecules, is regulated by the MHCII-specific regulatory machinery
II.3.1 Introduction
MHC genes were long considered to be the only targets of RFX and CIITA. However, several studies subsequently challenged this notion of absolute specificity and implicated CIITA in the regulation of non-MHC genes (Gourley et al. 1999; Sisk et al. 2000; Gourley and Chang 2001; Zhu and Ting 2001; Gourley et al. 2002; Nagarajan et al. 2002a; Wong et al. 2003; Xu et al. 2004; Yee et al. 2004; Yee et al. 2005). The mechanism by which CIITA regulates these new target genes is either not known or indirect. To overcome these difficulties in identifying new direct targets of RFX and CIITA, we have exploited a computational approach used by Kawczyk et al. to identified new S-Y modules in the human genome (Krawczyk et al. 2007). This computational study led to the identification of a MHCII-like S-Y regulatory module upstream the BTN2A2 gene, which encodes a relative of the B7 family of costimulatory molecules. The work presented in this section shows that BTN2A2 is regulated by the MHCII- specific regulatory machinery. BTN2A2 was found to be expressed in human B cells and IFNγ-induced cells. In these cells, BTN2A2 expression is coordinated with MHCII gene expression and is controlled by key components of the MHCII-specific transcription machinery, namely RFX and CIITA. Reporter gene assays demonstrated that the BTN2A2 S- Y module functions as a transcriptional enhancer and that this activity is dependent on RFX and CIITA. ChIP experiments furthermore confirmed that CIITA and RFX assemble at the BTN2A2 S-Y module. Finally, the orthologous mouse Btn2a2 gene is expressed most strongly in B cells, pDCs, thymic epithelial cells and endothelial cells. As for the human gene, the expression of Btn2a2 was found to be strictly dependent on RFX and CIITA in B cells.
94 II.3.2 Article
“The gene encoding BTN2A2, a relative of the B7 family of costimulatory molecules, is regulated by the MHCII-specific regulatory machinery”
This part of the results is presented in the form of a manuscript under preparation for publication.
95 The gene encoding BTN2A2, a relative of the B7 family of costimulatory molecules, is regulated by the MHCII-specific transcription machinery
Elisa Leimgruber1, Michal Krawczyk1,2, Isabelle Dunand-Sauthier1, Queralt Seguín-Estévez1, Marie-Laure Santiago-Raber1, Magali Irla1, Antoine Geinoz1, Emmanuèle Barras1, Shozo Izui1 and Walter Reith1*
1 Department of Pathology and Immunology, Faculty of Medicine, University of Geneva, 1 rue Michel-Servet, CH-1211, Geneva, Switzerland
2 Current address: Regulatory Biology Laboratory, Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA.
*Correspondence should be addressed to Walter Reith, Department of Pathology and Immunology, Faculty of Medicine, University of Geneva, CMU, 1 rue Michel-Servet, CH- 1211, Geneva, Switzerland, tel +41 22 379 56 66, fax +41 22 379 57 46, [email protected]
Running title: BTN2A2 is regulated by RFX and CIITA Key words: B7 molecules, Butyrophilin genes, MHCII gene regulation, Transcription, Class II transactivator (CIITA), Regulatory factor X (RFX)
96 Abstract
Butyrophilin (BTN) genes encode a family of transmembrane proteins belonging to the immunoglobulin domain superfamily. With the exception of BTN1, which encodes a major protein in milk fat globules, the function of the remaining BTN genes is largely unknown. However, they exhibit homology to the B7 family of immunomodulatory molecules and there is growing evidence that they play key roles in the immune system. We show here that the gene encoding BTN2A2 is coregulated with MHC class II (MHCII) genes. A conserved enhancer (S-Y enhancer) characteristic of MHCII genes was identified in the promoter of the BTN2A2 gene. This S-Y enhancer is bound by CIITA and the MHCII enhanceosome complex containing RFX, and functions as an RFX and CIITA dependent enhancer. BTN2A2 expression is strongly reduced in RFX and CIITA-deficient B cells. The mouse Btn2a2 gene is expressed mainly in B cells, plasmacytoid dendritic cells, thymic epithelial cells and endothelial cells. Taken together, these results suggest that BTN2A2 could function as an accessory molecule during MHCII-mediated antigen presentation by certain cell types.
97 Introduction
Butyrophilin molecules (BTN) are transmembrane proteins belonging to the immunoglobulin domain superfamily. They have been identified in humans, mice and other species (Henry et al. 1999; Rhodes et al. 2001). Human BTN genes are clustered in the extended MHCI region on chromosome 6 and are divided into three subfamilies, BTN1, BTN2 and BTN3. These three subfamilies comprise seven BTN genes, BTN1A1, BTN2A1, BTN2A2, BTN2A3, BTN3A1, BTN3A2 and BTN3A3. Only three BTN genes have been identified in mice: Btn1a1, Btn2a2 and Btn3a3. The mouse Btn genes are located on chromosome 13. The functions of BTN genes are largely unknown. The first member of the BTN family, BTN1A1, was originally purified from bovine milk and was identified as a major protein of the milk fat globule membrane (Franke et al. 1981; Jack and Mather 1990). The other members of the BTN family are widely expressed in numerous tissues (Ruddy et al. 1997; Rhodes et al. 2001). Several observations have suggested that BTN molecules could play roles in the immune system. The BTN3 genes are expressed specifically in lymphoid tissues and BTN3 expression is increased following stimulation of endothelial cells with interferon-γ (IFNγ). BTN3A1 was shown to bind to a ligand on T cells (Compte et al. 2004). The Butyrophilin-like 2 (BTNL-2) gene has been described to inhibit T cell activation and to be modulated during intestinal inflammation (Nguyen et al. 2006; Arnett et al. 2007). Another member of the BTN family, BTN2A1, has been reported recently to be a ligand of DC-SIGN (Malcherek et al. 2007). BTN molecules contain extracellular IgV and IgC domains exhibiting close homology to those of the B7 (CD80/CD86) family of costimulatory molecules (Carreno and Collins 2002; Greenwald et al. 2005). B7 costimulatory molecules play key roles in the activation of T cells during immune responses (Carreno and Collins 2002; Greenwald et al. 2005). They are co-expressed with MHCII molecules at the surface of antigen presenting cells (APCs). MHCII molecules are expressed constitutively in APCs, including thymic epithelial cells (TECs), dendritic cells (DCs), macrophages and B cells. Other cell types do not express MHCII genes unless they are stimulated with IFNγ. During immune responses, APCs present peptides loaded on MHC class II (MHCII) molecules to the antigen receptor (TCR) of CD4+ T cells (Reith and Mach 2001). In parallel, B7 molecules deliver costimulatory signals that
98 are essential for T cell activation (Carreno and Collins 2002; Greenwald et al. 2005). The molecular mechanisms that regulate MHCII expression have been well defined thanks to the elucidation of the genetic defects responsible for the bare lymphocyte syndrome (BLS), a hereditary immunodeficiency disease resulting from mutations in genes encoding two transcription factors, CIITA and RFX, that are essential for MHCII expression (Reith and Mach 2001). CIITA serves as the master regulator of MHCII genes and is expressed in a cell type-specific and IFNγ-inducible manner dictating the constitutive and inducible pattern of MHCII expression (Reith and Mach 2001; Reith et al. 2005). CIITA is recruited to MHCII promoters by means of protein-protein interactions with a multi-protein “enhanceosome” complex that assembles on a characteristic enhancer known as the S-Y module (Masternak et al. 2000; Muhlethaler-Mottet et al. 2004). This S-Y enhancer module consists of four conserved sequence elements called the S, X, X2 and Y boxes (Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003; Reith et al. 2005). These regulatory sequences are highly conserved with respect to their sequence, orientation, position and spacing (Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003; Reith et al. 2005). The enhanceosome complex that assembles on the S-Y module is composed of the X-box-binding- complex Regulatory Factor X (RFX), the X2-box binding factor CREB and the Y-box binding factor NF-Y (Reith and Mach 2001; Ting and Trowsdale 2002; Boss and Jensen 2003; Reith et al. 2005). Mutations in CIITA and each of the three subunits of RFX give rise to the BLS disease (Steimle et al. 1995; Durand et al. 1997; Masternak et al. 1998; Nagarajan et al. 1999). We demonstrate here that expression of the human BTN2A2 and mouse Btn2a2 genes is controlled by CIITA and RFX. We identified a sequence situated upstream of the BTN2A2 promoter that shows clear homology to the S-Y regulatory module present upstream of MHCII promoters. This BTN2A2 S-Y module was found to be functional and to be bound by the MHCII-specific regulatory machinery. In addition, we analysed the expression of Btn2a2 in different mouse cell types. We show that Btn2a2 is expressed in B cells, and that this expression is dependent on the MHCII-specific regulatory machinery, since no transcripts can be detected in CIITA- or RFX-deficient cells. Similarly to MHCII genes, Btn2a2 expression is also induced after stimulation with IFNγ in fibroblasts and endothelial cells.
99 Materials and Methods
Cells
The wild type B cell lines Raji, HHK and 6.1.6c, the CIITA-deficient B cell mutants RJ2.2.5, the RFXAP-deficient B cell mutants Da and 6.1.6, the RFX5-deficient B cell mutants Robert and SJO, the RFXANK-deficient B cell mutants Abduhla and BLS1, the CIITA- deficient fibroblast BLS3 and the Me67.8 melanoma cell line have been described previously (Steimle et al. 1993; Steimle et al. 1995; Villard et al. 1997; Masternak et al. 1998; Peretti et al. 2001; Krawczyk et al. 2005; Krawczyk et al. 2007) and were grown in RPMI+Glutamax medium (InVitrogen) supplemented with 10-15% fetal calf serum and antibiotics. Me67.8 and BLS3 cells were induced with 200U/ml of human IFNγ (InVitrogen). HUVEC cells were prepared as described previously (Johnson-Leger et al. 2002) and induced with 1000U/ml of human IFNγ (InVitrogen). The A20 mouse B cell line (ATCC) was cultured in RPMI+Glutamax medium (InVitrogen) supplemented with 10% fetal calf serum, 0.1% beta-mercaptoethanol and antibiotics. Primary splenic B cells were purified from wild type C57BL/6 mice, RFX5-/- mice (Clausen et al. 1998) or CIITApIII/IV-/- mice (LeibundGut-Landmann et al. 2004b) by sorting CD19+ cells with Miltenyi magnetic beads using AutoMacs or by sorting B220+ cells using FACS Vantage (Becton Dickinson, Mountain View, CA). Follicular splenic B cells (B220+/CD23+,CD21/35+) and marginal zone splenic B cells (B220+/CD23low,CD21/35+) were purified from the spleen of C57BL/6 mice using FACS Vantage. Primary mouse embryonic fibroblasts (MEFs) were isolated from mice at the 14th day of pregnancy, filtered through a cell strainer and plated into a tissue culture dish. MEFs and primary B cells were induced with 100U/ml of mouse IFNγ (InVitrogen). Plasmacytoid dendritic cells (pDCs) and bone marrow-derived dendritic cells (BMDCs) were derived from tibia and femur bone marrow suspensions of 8-week-old mice. Differentiation of BM-derived pDCs was performed by incubating 2-5x106/ml of BM-cells in DMEM medium supplemented with 100 ng/ml FLT3L and cultured in Petri dishes for 6 to 8 days. Purified pDCs were obtained by sorting CD11c+B220+ cells using FACS Vantage. Maturation and activation of pDCs were performed by adding the TLR7 ligand Imiquimod (3 μg/ml, Invivogen, San Diego, CA). Differentiation of BMDCs was performed by incubating 1x106/ml of BM-cells in DMEM medium 100 supplemented with GM-CSF (5% supernatant) and cultured in petri dishes for 6 to 8 days. Purified BMDCs were obtained by sorting CD11chigh cells using FACS Vantage. Maturation and activation of BMDCs were performed by adding the TLR4 ligand LPS (Alexis Biochemicals). To obtain splenic DCs, spleens were digested for 20 minutes at room temperature with 1 mg/ml DNase I (Sigma-Aldrich) and 1 mg/ml Liberase CI (Roche), then treated for 5 minutes with 0.1M EDTA to disrupt T cell-DC complexes. DCs were further purified by cell sorting (FACS Vantage) after labeling with anti-CD11c antibody (e- bioscience). Mouse T cells were purified from C57BL/6 mice or CIITA transgenic mice as described previously (Otten et al. 2006). Mouse macrophages CD11b+/CD11c- were purified from the bone-marrow of C57BL/6 mice. Mouse thymic epithelial cells (TECs) were prepared as described (Irla et al. 2008). The mouse thymus, myocardium and brain-derived PymT- transformed endothelial cell lines, t.End.1 (Aurrand-Lions et al. 2004), bEnd.1 and MyEnd.4, respectively, were provided by the laboratory of Prof. B. Imhof (CMU, Geneva) and were originally obtained from the laboratory of Prof. B. Engelhardt (Theodor Kocher Institute, University of Bern). Primary lung mouse endothelial cells were provided by the laboratory of Prof. B. Imhof (CMU, Geneva), and were isolated as described (Reynolds and Hodivala-Dilke 2006) excepted that the ICAM-2 marker used for positive selection was replaced by PECAM- 1/CD31.
Quantitative RT-PCR
RNA extraction, cDNA preparation and quantification of mRNA expression were performed as described (Krawczyk et al. 2007). The iCycler iQ Real-time PCR Detection system (Biorad) and the SYBRGreen-based kit (iQ Supermix Biorad) were used to perform quantitative PCRs. Amplification specificity was controlled by gel electophoresis and melting curve analysis. Results were quantified using a standard curve generated with serial dilutions of input DNA. All PCR amplifications were performed in triplicate. Expression levels were normalised using TBP mRNA or 18S rRNA. Primers are listed in supplementary Table 1.
Chromatin immunoprecipitation (ChIP)
ChIP experiments and ChIP-on-chip experiments using sonicated chromatin and antisera containing CIITA and RFX5 antibodies were performed as previously described (Krawczyk et al. 2007; Leimgruber et al. 2009). 101 Luciferase reporter gene assays The pDRAproximal (pDRAprox) vector used to measure HLA-DRA promoter activity has been described previously (Masternak et al. 2003). This vector contains an HLA-DRA promoter fragment (from -151 to +10) inserted upstream of the Firefly Luciferase reporter gene in the pGL3b vector (Promega). The vector containing the entire BTN2A2 promoter was generated by inserting a PCR-amplified sequence, spanning from the S-Y-like module up to the putative TSS of BTN2A2, between the MluI and BglII sites of the pGL3b vector. Vectors containing the BTN S-Y modules were generated by replacing the HLA-DRA S-Y module with the BTN S-Y fragments amplified by PCR from genomic DNA by using MluI-BglII sites in the pDRAprox vector. Mutations were introduced into the BTN2A2 S-Y module by site- directed mutagenesis as previously described (Krawczyk et al. 2007). Primers used for cloning are listed in supplementary Table 1. Cells were co-transfected with the Firefly Luciferase reporter vectors and a control Renilla Luciferase vector. Transfections were performed by electroporation (950μF, 0.21V). Luciferase reporter assays were performed according to the manufacturer’s instructions (Promega).
102 Results
Identification of a typical MHCII-like S-Y module upstream of the BTN2A2 gene
A characteristic S-Y regulatory module is conserved upstream of all MHCII genes and is recognised by the MHCII-specific regulatory machinery, composed of CIITA and the enhanceosome (Fig. 1A). The conserved architecture of the MHCII S-Y module has allowed the design of a stringent sequence profile that has been used for the identification of novel S- Y sequences (Krawczyk et al. 2004; Krawczyk et al. 2007). Using this approach, we identified putative new S-Y modules were localised within the extended MHCI region in the promoters of three members of the BTN2 subfamily (BTN2A1, BTN2A2 and BTN2A3), with the highest score for the BTN2A2 gene (Fig. 1B). Alignment of the S-Y-like sequences of BTN2A2 orthologs with the HLA-DRA S-Y module shows a high conservation of the BTN2A2 S-Y-like module among different species. The X and Y boxes of BTN2A2 are the most well conserved sequences of the S-Y module (Fig. 1C). The function of the BTN2A2 gene is unknown. The BTN2A2 protein is classified in the B7 superfamily of costimulatory molecules on the basis of its structure and sequence homology (Fig. 1D).
BTN2A2 expression is regulated by the MHCII-specific regulatory machinery
To study the importance of the MHCII-specific regulatory machinery for expression of the BTN2A2 gene we analysed the expression of BTN2A2, BTN2A1, BTN2A3 and HLA-DRA mRNAs by real-time qRT-PCR in the wild type B cell line Raji, in the isogenic CIITA- deficient B cell line RJ2.2.5 and in RJ2.2.5 cells complemented by transfection with a vector containing the three isoforms of CIITA (I, III or IV). The results demonstrated that BTN2A2 is expressed in B cells, absent in CIITA-deficient RJ2.2.5 cells, and restored by the complementation with vectors containing each of the three CIITA isoforms. BTN2A2 expression was also found to be strongly reduced in the RFX-deficient B cells BLS-1, Da, Robert, Abduhla and 6.1.6 (Fig. 2A). The pattern of BTN2A2 expression in these different cell lines closely parallels that of the control HLA-DRA gene. In contrast to BTN2A2, BTN2A1 expression was very low in all B cells tested. No transcripts were detected for BTN2A3, previously reported to be a likely pseudogene (data not shown) (Rhodes et al. 2001). 103 Previous studies have shown that the expression of MHCII genes is induced in a CIITA- dependant manner after treatment of various cell types with IFNγ. To determine whether the expression of BTN2A2 is also induced by IFNγ, we analysed BTN2A2 mRNA levels in a melanoma cell line (Me67.8), in primary umbilical vein endothelial cells (HUVECs) and in the CIITA-deficient fibroblast cell line BLS3 following stimulation with IFNγ (Fig. 2B). BTN2A2 expression was induced by IFNγ in Me67.8 and HUVEC cells, whereas no induction was observed in the CIITA-deficient BLS3 cells. IFNγ-induced BTN2A2 expression in Me67.8 and HUVEC cells was evident, albeit less strong than the induction observed for the control HLA-DRA gene. In contrast to BTN2A2, BTN2A1 expression was not induced. Collectively, these results demonstrate that BTN2A2 expression is regulated by CIITA and RFX in a coordinated fashion with MHCII genes in B cells and that expression of BTN2A2 is induced by IFNγ in a CIITA-dependent manner.
The BTN2A2 S-Y module functions as a CIITA- and RFX-dependent enhancer
To study the function of the BTN2A2 S-Y module, we used a Luciferase reporter gene assay to measure the activity of the BTN2A2 promoter in Raji B cells (WT), CIITA-deficient RJ2.2.5 cells (CIITA-/-) and RFX-deficient SJO cells (RFX5-/-). The pDRAprox Luciferase vector containing the HLA-DRA promoter was used as a positive control. To test the activity of the BTN2A2 promoter, the entire promoter region of HLA-DRA, extending from the S-Y module to the TSS, was replaced by the promoter of BTN2A2 (Fig. 3A). The results show that the BTN2A2 promoter is functional, although its activity is lower than that of the HLA-DRA promoter. The activity of the BTN2A2 promoter was abolished in CIITA-deficient and RFX- deficient cells (Fig. 3A), indicating that it is regulated by CIITA and RFX. To determine whether the S-Y module of BTN2A2 is functional, the S-Y module of HLA-DRA was replaced by the S-Y module of BTN2A2 (Fig. 3A). As controls we also replaced the HLA-DRA S-Y module with the S-Y-like sequence of the BTN2A1 and BTN2A3 genes. No significant activity could be detected for the BTN2A1 and BTN2A3 S-Y-like sequences, suggesting that they are not functional. In contrast, the BTN2A2 S-Y module activated reporter gene expression in an RFX and CIITA-dependent manner (Fig. 3A). To confirm that the BTN2A2 S-Y module functions as a typical S-Y enhancer, we performed reporter gene assays using constructs containing mutations in the S, X, X2 and Y boxes (Fig. 3B). Mutations were chosen on the basis of their ability to affect activity of the
104 HLA-DRA S-Y module (Tsang et al. 1990; Muhlethaler-Mottet et al. 2004). The results show that the X box mutation completely abrogated BTN2A2 S-Y activity, indicating a key role of the RFX binding site in the BTN2A2 promoter. The Y box mutation decreases BTN2A2 promoter activity by approximately 50%, indicating a contribution of the NF-Y binding site. No adverse effects were observed for mutations in the S and X2 boxes. The activities of all constructs were abolished in CIITA-deficient cells. These results are in full agreement with previous studies on MHCII promoters. Indeed, mutations in the X and Y boxes were previously shown to have the strongest effects on MHCII promoter activity, whereas the impacts of mutations in the S and X2 boxes were generally weaker (Tsang et al. 1990; Muhlethaler-Mottet et al. 2004; Krawczyk et al. 2007). Collectively, these results confirm that the BTN2A2 S-Y module functions as an RFX and CIITA-dependent enhancer.
CIITA and RFX assemble at the BTN2A2 S-Y module
To study the recruitment of CIITA and RFX to the BTN2A2 S-Y module, we performed ChIP experiments with Raji B cells (WT), CIITA-deficient RJ2.2.5 B cells (CIITA-/-) and RFX-deficient SJO B cells (RFX-/-). The results show that there is significant binding of RFX and CIITA to the BTN2A2 promoter relative to the HLA-DRA promoter in WT Raji B cells (Fig. 4A). Background binding was assessed using a region situated -8.3kb upstream the HLA- DRA gene. As expected, binding of CIITA and RFX to the BTN2A2 and HLA-DRA promoters was abolished in CIITA- and RFX-deficient cells (Fig. 4B and C). To determine whether CIITA and RFX assemble at the BTN2A2 promoter following IFNγ treatment, we analysed the binding of these factors to the BTN2A2 promoter in Me67.8 cells that had been induced or not with IFNγ. The results revealed that the BTN2A2 promoter is occupied by CIITA and RFX in Me67.8 cells. As observed for the control HLA-DRA and Ii promoters, RFX occupancy was increased by IFNγ treatment. This is likely to be due to the stabilising effect of CIITA recruitment (Fig. 4D and E). No binding was detected at a control position situated -3.5kb upstream the HLA-DRA gene . These results indicate that CIITA and RFX assemble at the BTN2A2 promoter in IFNγ-induced cells in a pattern identical to that previously described for MHCII genes.
The mouse Btn2a2 gene is regulated by the MHCII-specific regulatory machinery
Studies on human BTN expression have revealed that certain members of the BTN
105 family are expressed widely in different tissues whereas others, such as the BTN3 genes, are expressed in a more restricted pattern (Ruddy et al. 1997; Rhodes et al. 2001). Very little is known about the expression pattern of BTN genes in mice. We therefore performed a detailed analysis of Btn2a2 mRNA expression in different mouse cell types using quantitative RT- PCR. Btn2a2 expression was quantified in total, follicular and marginal zone splenic B cells, immature and mature splenic CD8+ and CD8- DCs, immature and mature BM-DCs, immature and mature BM-derived pDCs, BM-derived macrophages, splenic T cells and thymocytes. The expression level of Btn2a2 in these primary cells was compared to the level detected in the A20 B cell line (Fig 5A). The results show that Btn2a2 is preferentially expressed in B cells, particularly marginal zone B cells, and pDCs. Only low levels were observed in the other cell types. We next compared Btn2a2 expression in resting and activated B cells (Fig. 5B). Purified total, follicular and marginal zone splenic B cells were activated in vitro with CpG for 24 hours. Btn2a2 mRNA levels were strongly reduced in activated B cells. This strong reduction in Btn2a2 mRNA levels correlated closely with the reductions in IA-α and CIITA mRNA levels (Fig. 5B). To determine whether the Btn2a2 gene is, like the human gene, controlled by CIITA and RFX, the expression of Btn2a2 was measured in primary splenic B cells isolated from wild type (WT) C57BL/6 mice, CIITA-deficient mice and RFX-deficient mice (Fig 5C). The results indicated that Btn2a2 expression is strongly reduced in both CIITA- and RFX- deficient B cells. The decrease is as strong as that observed for the IA-α gene, demonstrating that Btn2a2 and MHCII genes are tighly co-regulated in mouse B cells by CIITA and RFX. To determine whether the Btn2a2 gene is also regulated by CIITA in cells expressing only low level of Btn2a2, we analysed Btn2a2 expression in WT and CIITA-deficient BM-DCs. The results show that Btn2a2 expression is also reduced strongly in BM-DCs, even though these cells express Btn2a2 only weakly (Fig. 5D). Btn2a2 expression can also be induced in T cells expressing a CIITA transgene (supplementary Fig. 1). Taken together, these results show that the mouse Btn2a2 gene is regulated by the MHCII-specific regulatory machinery in B cells. To determine whether the expression of Btn2a2 is induced by INFγ we analysed the mRNA level of Btn2a2 in WT mouse embryonic fibroblasts (MEFs), CIITA-deficient MEFs, the bEnd.1 brain endothelial cell line and the MyEnd.4 myocardic endothelial cell line following stimulation with INFγ (Fig. 6). Btn2a2 expression was induced in these cells by INFγ treatment. However, no induction was observed in CIITA-deficient MEFs. 106 We further extended our analysis of Btn2a2 expression to several non-hematopoietic cell types. Btn2a2 mRNA levels were measured by qRT-PCR in thymic epithelial cells (TECs) isolated from the cortex and medulla, the lung epithelial cell line MLE-12, the tEnd.1 thymic endothelial cell line, the bEnd.1 brain endothelial cell line, the MyEnd.4 myocardic endothelial cell line and primary endothelial cells isolated from the lung. Btn2a2 was expressed in cortical and mature medullary TECs. Btn2a2 expression levels correlated well with IA-α and CIITA mRNA levels in TECs, suggesting that Btn2a2 is regulated by the MHCII-specific regulatory machinery in these cells (Fig. 7A, B and C). Btn2a2 is also expressed at various levels in endothelial cells (supplementary Fig. 2). Endothelial cells do normally not express CIITA or MHCII genes. Expression of Btn2a2 in endothelial cells is therefore probably regulated by regulatory mechanisms different from those implicated in MHCII gene expression.
107 Discussion
In this study, we have demonstrated that the gene encoding BTN2A2 is regulated by the same regulatory machinery that controls the expression of MHCII genes. A typical MHCII-like S-Y regulatory module was identified upstream of the BTN2A2 gene by means of a computer scan previously developed to search for genomic sequences that resemble MHCII- like regulatory sequences (Krawczyk et al. 2004). BTN2A2 was found to be expressed in human B cells and IFNγ-induced cells. In these cells, BTN2A2 expression is coregulated with MHCII gene expression, and is controlled by key components of the MHCII-specific regulatory machinery, namely RFX and CIITA. Reporter gene assays demonstrated that the BTN2A2 S-Y module functions as a transcriptional enhancer in B cells and that this activity is dependent on RFX and CIITA. ChIP experiments furthermore confirmed that CIITA and RFX assemble at the BTN2A2 S-Y module in B cells and IFNγ-induced cells. Finally, the orthologous mouse Btn2a2 gene is expressed most strongly in B cells, pDCs, thymic epithelial cells and endothelial cells. As for the human gene, the expression of Btn2a2 in B cells and DCs was found to be strictly dependent on RFX and CIITA. CIITA was initially believed to be highly specific for MHCII genes and related genes involved in antigen presentation. However, subsequent reports suggested that CIITA could be more pleiotropic in its function. The genes encoding IL-4, FasL, cathepsin E, IL-10, collagen α2(I), and Plexin-A1 were been proposed to be regulated by CIITA (Sisk et al. 2000; Zhu and Ting 2001; Gourley et al. 2002; Wong et al. 2003; Yee et al. 2004). In addition, microarray experiments suggested that CIITA could regulate the expression of numerous genes (Nagarajan et al. 2002a). However, these studies did not provide evidence for a direct role of CIITA in the regulation of these genes. More recently, a small number of non-MHCII genes were identified and validated experimentally as novel direct targets of the MHCII-specific regulatory machinery by ChIP-on-chip experiments (Krawczyk et al. 2008). The BTN2A2 gene was among the potential targets identified in this study. However, it had not been pursued and validated as a CIITA target gene because it was assigned only a low score on the basis of the reproducibility of the ChIP-on-chip signals (Krawczyk et al. 2008). Certain members of the BTN family have been reported to be expressed in cells of the immune system. The BTN3 genes are expressed specifically in lymphoid tissues and experiments using a BTN3 fusion protein suggest that it interacts with a receptor present on T
108 cells (Compte et al. 2004). BTN2A1 has been described as a potential ligand for DC-SIGN (Malcherek et al. 2007). However, the functions and regulation of these BTN genes remain largely unknown. The regulation of BTN2A2 by the MHCII-specific regulatory machinery suggests that it could play an important role in the immune response. This would be consistant with the structure of the BTN2A2 molecule. BTN2A2 contains extracellular IgV-like and IgC-like domains sharing homology to the B7 family of immunomodulatory molecules. There is also a B30.2/SPRY domain in the intracellular portion of the protein (Rhodes et al. 2005). This domain is found in several protein families, including members of the BTN family, negative regulators of the JAK/STAT pathway and proteins encoded by TRIM genes. Proteins that contain B30.2/SPRY domains may play diverse roles in the immune response, including the regulation of cytokine production and immunity to retroviruses (Rhodes et al. 2005). Expression studies have shown that the mouse Btn2a2 gene is expressed in TECs and endothelial cells. In the thymus, Btn2a2 is expressed by TECs in the medulla and cortex. These cells also express CIITA and MHCII genes, which suggests that Btn2a2 is co-regulated with MHCII genes in TECs and could be implicated in T cell development. Endothelial cells do normally not express MHCII genes. The expression of Btn2a2 in primary lung endothelial cells and endothelial cell lines derived from the thymus, brain and myocard, suggests that Btn2a2 expression is also controlled by additional regulatory mechanisms different from those implicated in MHCII expression.
109 Figure legends
FIGURE 1. The upstream region of the human BTN2A2 gene contains a typical MHCII-like S-Y (S-X-X2-Y) module. A. Schematic representation of the MHCII-specific regulatory machinery bound to the S-Y module. Promoters of all MHCII genes contain an S-Y module upstream of the TSS. The MHCII-specific regulatory machinery is composed of the transactivator CIITA and the enhanceosome complex containing RFX, CREB and NF-Y. B. Identification of the BTN2A2 S-Y module. The 3kb upstream regions of all human genes were scanned for the presence of sequences resembling the MHCII S-Y motif. BTN2A2, BTN2A3, BTN2A1 and MHCII genes are represented by dots. The score represents a measure of the homology to the consensus S-Y motif. An indicative distance scale is shown below. C. Alignment of the S-Y modules identified in the BTN2A2 genes of the indicated species with the S-Y module of the HLA-DRA gene. The S, X, X2 and Y sequences of the S-Y module are boxed. Conserved residues relative to the HLA-DRA S-Y sequence are in bold. D. Schematic representation of human and mouse BTN2A2 proteins compared to the mouse CD80 (B7) protein. Key protein domains are depicted as boxes.
FIGURE 2. BTN2A2 expression is controlled by the MHCII-specific regulatory machinery. A. BTN2A2, BTN2A1 and HLA-DRA mRNA expression was measured by qRT-PCR in the wild type B cell line Raji, the CIITA-deficient B cell line RJ2.2.5 (RJ), the RFX-deficient B cell lines BLS-1, Da, Robert, Abduhla and 6.1.6, and RJ2.2.5 cells complemented with expression vectors encoding the three isoforms (I, III and IV) of CIITA (RJ+I, RJ+III, RJ+IV). B. BTN2A2, BTN2A1 and HLA-DRA mRNA expression was measured by qRT-PCR in HUVECs, Me67.8 cells and CIITA-deficient fibroblasts (BLS3) induced for 0 and 48h with IFNγ. Results are presented relative to the expression level measured in Raji and were normalised using TBP mRNA. The means and standard deviations derived from three independent experiments are shown.
FIGURE 3. The BTN2A2 S-Y module functions as a CIITA- and RFX-dependent enhancer. A. Activity of the BTN2A2 S-Y module was assessed by means of Luciferase reporter gene assays. Activity of the HLA-DRA (left) and BTN2A2 (middle) promoters was measured in Raji B cells (WT), CIITA-deficient cells (CIITA-/-) and RFX5-deficient cells (RFX5-/-). Activity
110 of the S-Y modules of the three members of the BTN2 subfamily (BTN2A1, BTN2A2 and BTN2A3) was assessed by inserting them in place of the S-Y module of the HLA-DRA S-Y module. The activity of these constructs was measured in Raji B cells (WT), CIITA-deficient cells (CIITA-/-) and RFX5-deficient cells (RFX5-/-) (right). The vector containing the HLA- DRA minimal promoter without an S-Y module (pGL3bmin) was used as a negative control. B. Mutations were introduced into the S, X, X2 and Y sequences of the vector containing the BTN2A2 S-Y promoter. Promoter activity was measured in Raji B cells (WT) and CIITA- deficient B cells (CIITA-/-). Results are expressed relative to the activity of the HLA-DRA construct. The means and standard deviations derived from three independent experiments are shown.
FIGURE 4. Occupancy of BTN2A2 promoter by the MHCII-specific regulatory machinery. A. Binding of RFX and CIITA to the BTN2A2 and HLA-DRA promoters were analyzed by ChIP experiments in Raji B cells (WT). An upstream region (-8.3kb) of the HLA-DRA promoter was used to determine background binding. Occupancy is expressed relative to the value observed at the HLA-DRA promoter. B. Binding of RFX and CIITA to the BTN2A2 promoter was analyzed by ChIP experiments in CIITA-deficient B cells (CIITA-/-) and RFX5-deficient B cells (RFX5-/-). Occupancy is expressed relative to the value observed in the Raji B cells. C. Binding of RFX and CIITA to the HLA-DRA promoter was analyzed by ChIP experiments in CIITA-deficient B cells (CIITA-/-) and in RFX5-deficient B cells (RFX5-/-). Occupancy is expressed relative to the value observed in Raji B cells. D. Occupancy of HLA-DRA, Ii and BTN2A2 promoters by RFX was analysed by ChIP in uninduced Me67.8 cells (-γ) and Me67.8 cells induced for 12 hours with IFNγ (+γ). An upstream region (-3.5kb) of HLA-DRA gene was used to determine background binding. E. Occupancy of HLA-DRA, Ii and BTN2A2 promoters by CIITA was analysed by ChIP in uninduced Me67.8 cells (-γ) and Me67.8 cells induced for 12h with IFNγ (+γ). An upstream region (-3.5kb) of HLA-DRA gene was used to determine background binding. The means and standard deviations derived from three independent experiments are shown.
FIGURE 5. Mouse Btn2a2 expression in hematopoietic cells. A. Mouse Btn2a2 expression was measured by qRT-PCR in the A20 B cell line, total (TOT), follicular (FO) and marginal zone (MZ) splenic B cells (spl-B cells), immature (im) and mature (mat) CD8+ or CD8- splenic DCs (spl-DCs), bone marrow-derived DCs (BM-DCs), bone marrow-derived
111 plasmacytoid DCs (BM-pDCs), T cells, thymocytes and macrophages (MФ). Results are expressed relative to the mRNA level found in total splenic B cells and were normalised using TBP mRNA. B. Mouse Btn2a2 expression in activated B cells. Mouse Btn2a2, IA-α and CIITA expression was measured by qRT-PCR in the A20 B cell line and total (TOT), follicular (FO) and marginal zone (MZ) splenic B cells (spl-B cells). B cells were treated in vitro with or without CpG for 24 hours. Results are expressed relative to the mRNA level in unactivated total splenic B cells. C. Mouse Btn2a2 and IA-α expression were measured by qRT-PCR in total splenic B cells from WT, CIITA-deficient (CIITA-/-) and RFX5-deficient (RFX-/-) mice. D. Mouse Btn2a2 and IA-α expression were measured by qRT-PCR in BMDCs from WT and CIITA-deficient (CIITA-/-) mice. Results are expressed relative to the mRNA level found in WT splenic B cells and were normalised using TBP mRNA. The means and standard deviations derived from three independent experiments are shown.
FIGURE 6. Mouse Btn2a2 expression in IFNγ-induced cells. Α. Mouse Btn2a2 expression was measured by qRT-PCR in mouse embryonic fibroblasts (MEFs) from WT and CIITA- deficient (CIITA-/-) mice, the bEnd.1 brain endothelial cell line and the MyEnd.4 myocardic endothelial cell line after treatment with (+) or without IFNγ (-). Β. IA-α expression was measured by qRT-PCR in mouse embryonic fibroblasts (MEFs) from WT and CIITA- deficient mice (CIITA-/-), the bEnd.1 brain endothelial cell line and the MyEnd.4 myocardic endothelial cell line after treatment with (+) or without IFNγ (-). Results are expressed relative to the mRNA level in the uninduced cells and were normalised using 18S rRNA. The means and standard deviations derived from three independent experiments are shown.
FIGURE 7. Mouse Btn2a2 expression in TECs. A. Mouse Btn2a2 expression was measured by qRT-PCR in splenic B cells, cortical TECs and immature (im) or mature (mat) medullary TECs. B. IA-α expression was measured by qRT-PCR in splenic B cells, cortical thymic epithelial cells (TECs) and immature (im) or mature (mat) medullary TECs. C. CIITA expression was measured by qRT-PCR in splenic B cells, cortical TECs and immature (im) or mature (mat) medullary TECs. Results are expressed relative to the mRNA level in the uninduced cells and were normalised using 18S rRNA. The means and standard deviations derived from three independent experiments are shown.
112 Figures
FIGURE 1
A
CIITA ? RFX CREB NF-Y MHCII genes S X X2 Y B MHC-II locus 20 BTN2A2 18
Score 14 BTN2A3 BTN2A1 10 0200kb 400kb 600kb 800kb 1Mb
C SXX2Y human HLA-DRA GGACCCT -16- CCTAGCAACAGATG.CGTCA -15- CTGATTGG human BTN2A2 GGGTTTT -15- CCTAGTAACTGCTGAGAAAT -12- ACCATTGG pan BTN2A2 GGGTTTT -15- CCTAGTAACAGCTGAGAAAT -12- ACCATTGG mouse Btn2a2 GGATTGT -14- CCTAGTAACAAGTGACTGCT -12- ACTATTGG rat Btn2a2 AATTCGT -18- CCTAGTAACAAGTGACAGCT -12- ACTATTGG
D
Human NH2 COOH Signal peptide BTN2A2 IgV-like
IgC-like Mouse NH2 COOH BTN2A2 Transmembrane domain
B30.2/SPRY
Mouse B7 NH2 COOH Cytoplasmic
113 FIGURE 2
A 3 BTN2A2 mRNA 2 1 0 2 BTN2A1 mRNA 1
0
Relative expression 2 HLA-DRA mRNA
1
0 RJ Da Raji RJ+I 6.1.6. RJ+III BLS-1 Robert RJ+IV Abdulha
B
BTN2A2 mRNA BTN2A1 mRNA HLA-DRA mRNA 1200 10 10 Huvec 1000 8 8 Me 67.8 800 6 6 BLS3 600 4 4 400 2 2 200
Relative expression Relative 0 0 0 hIFNγ: 048 048 048
114 FIGURE 3
A HLA-DRA S-Y BTN2A2 promoter BTNs S-Y DRA min luciferase luciferase luciferase
BTN2A1/ BTN2A2/ BTN2A3/ pGL3bmin HLA-DRA BTN2A2 1.4 10 DRA DRA DRA 1.2 1.2 8 1 1 6 0.8 0.8 4 0.6 0.6 0.4 0.4 2 0.2 0.2 0 0 Relative luciferaseRelative activity Relative luciferase activity 0 Relative luciferase activity WT WT WT WT WT WT RFX -/- RFX RFX -/- RFX -/- RFX -/- RFX RFX -/- RFX RFX -/- RFX CIITA -/- CIITA CIITA -/- CIITA CIITA -/- CIITA -/- CIITA CIITA -/- CIITA CIITA -/- CIITA
B
SXX2 Y luciferase
wt GGGTTTTTTGTGTGT WT * 1 S mut TACATAGCGTACGT CIITA-/- 0.8 * wt CCTAGTAATGCTG X mut AAGCTACCACTCGT 0.6 0.4 * wt TGACAAAT X2 mut GATCAAGT 0.2 wt ACCATTGG 0 * luciferaserelative activity Y mut GTGAGGTT HLA-DRA BTN2A2 Smut Xmut X2mut Ymut
115 FIGURE 4
A Promoter occupancy in WT B cells D Promoter occupancy by RFX5 in IFNγ-induced melanoma cells
RFX5 DRA Ii BTN2A2 DRA-3.5kb 1 1 CIITA 1 0.8 0.8 2 0.8 0.6 0.6 1.5 0.4 0.4 0.6 1 0.2 0.2 0.4 0 0 0.5 0.2 0 0 -γ +γ -γ +γ -γ +γ -γ +γ BTN2A2 BTN2A2 promoter -8.3kb DRA promoter BTN2A2 BTN2A2 promoter DRA DRA promoter -8.3kb DRA promoter DRA DRA promoter E B Promoter occupancy by CIITA in IFNγ-induced melanoma cells BTN2A2 promoter occupancy in deficient B cells DRA Ii BTN2A2 DRA-3.5kb 1 RFX5 CIITA 1.2 1 1 1 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.2 0.2 0.2 0.2 0 0 0 0 -γ +γ -γ +γ -γ +γ -γ +γ WT WT RFX5 -/- RFX5 RFX5 -/- RFX5 CIITA -/- CIITA CIITA -/- CIITA C Occupancy of DRA promoter in deficient B cells
RFX5 CIITA 1 1 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0 0 WT WT CIITA -/- CIITA RFX5 -/- RFX5 -/- RFX5 CIITA -/- CIITA
116 FIGURE 5
A Btn2a2 expression in wt cells
8
6
4
2
Relative expression Relative 0
A20 TOTFO MZ im mat im mat im mat im mat Ф
CD8- CD8- CD8+ CD8+ M T cells spl-B cells spl-DCs BMDCs BM-pDCs Thymocytes
B Btn2a2 expression in B cells IA-α expression in B cells CIITA expression in B cells 8 4 8 6 3 6 4 2 4 2 1 2 Relative expression Relative Relative expression Relative Relative expression 0 0 0 A20 A20 A20 -CpG -CpG -CpG -CpG -CpG -CpG -CpG -CpG +CpG +CpG -CpG +CpG +CpG +CpG +CpG +CpG +CpG +CpG TOT FO MZ TOTFO MZ TOTFO MZ
spl-B cells spl-B cells spl-B cells
C D Btn2a2 expression IA-α expression Btn2a2 expression IA-α expression in mutant B cells in mutant B cells in mutant BMDCs in mutant BMDCs
1 1 1.2 1.4 0.8 0.8 1 1.2 0.8 1 0.6 0.6 0.8 0.6 0.4 0.4 0.6 0.4 0.4 0.2 0.2 0.2 0.2 Relative expression Relative Relative expression Relative Relative expression 0 expression Relative 0 0 0 WT CIITA RFX5 WT CIITA RFX5 WT CIITA WT CIITA -/- -/- -/- -/- -/- -/-
117 FIGURE 6
A. Btn2a2 expression in IFNγ-induced cells
12 4 4 10 3 3 8 6 2 2 4 1 1 2 Relative expression Relative expression Relative Relative expression Relative 0 0 0 IFNγ: -+ -+ -+ -+
MEFs MEFs bEnd.1 MyEnd.4 WT CIITA-/- B. IA-α expression in IFNγ -induced cells
1000 6x105 300 800 4x105 600 200 400 100 2x105 200 Relative expression Relative Relative expression Relative 0 expression Relative 0 0 IFNγ: -+ -+ -+ -+
MEFs MEFs bEnd.1 MyEnd.4 WT CIITA-/-
118 FIGURE 7
A Btn2a2 expression in wt cells
3
2
1
Relative expression Relative 0 spl-B cells im mat cortex medulla
TECs B IA-α expression in wt cells
1 0.8 0.6 0.4 0.2
Relative expression Relative 0 spl-B cells im mat cortex medulla
TECs
C CIITA expression in wt cells 1.6 1.4 1.2 1 0.8 0.6 0.4
Relative expression Relative 0.2 0 spl-B cells im mat cortex medulla
TECs
119 SUPPLEMENTARY FIGURE 1
Btn2a2 IA-α
10 10 8 8 6 6 4 4 2 2 Relative expression 0 Relative expression 0 T cellsT T cellsT CIITA tg+ T cells T tg+ CIITA CIITA tg+ T cells T tg+ CIITA
Supplementary Figure 1. Mouse Btn2a2 expression in CIITA-transgenic T cells. Mouse Btn2a2 and IA-α mRNA expression were measured by qRT-PCR in WT T cells and T cells expressing a CIITA (isoform IV) transgene. Results are expressed relative to the mRNA level found in WT T cells and were normalised using 18S rRNA. Means and standard deviations derived from three independent experiments are shown.
120 SUPPLEMENTARY FIGURE 2
Btn2a2 8
4 3 2 1 Relative expression Relative 0 spl-B cells MLE-12 tEnd.1 bEnd.1 MyEnd.4 Lung
IA-α 1 0.8 0.6 0.4 0.2
Relative expression Relative 0 spl-B cells MLE-12 tEnd.1 bEnd.1 MyEnd.4 Lung
CIITA 1.0 0.8 0.6 0.4 0.2
Relative expression Relative 0.0 spl-B cells MLE-12 tEnd.1 bEnd.1 MyEnd.4 Lung
Supplementary Figure 2. Mouse Btn2a2 expression in endothelial cells. Mouse Btn2a2, IA-α and CIITA mRNA expression were measured by qRT- PCR in total splenic B cells, the MLE-12 lung endothelial cell line, the t.End.1 thymic endothelial cell line, the bEnd.1 brain endothelial cell line, the MyEnd.4 myocardic endothelial cell line and primary lung endothelial cells. Results are expressed relative to the mRNA level found in WT splenic B cells and were normalised using 18S rRNA. Means and standard deviations derived from three independent experiments are shown.
121
122 II.4 Generation of a knock-out mouse to study the function of Btn2a2
To study the function of the Btn2a2 gene in vivo, we decided to abolish its expression by developing a conditional knock-out mouse. The cloning experiments described below were performed by Emmanuèle Barras in our laboratory. To abolish the expression of Btn2a2 at both the transcriptional and translational level, we decided to delete a region containing the Btn2a2 promoter (including the S-Y-like module) and the first two exons (which contain the ATG and signal peptide sequence). The KS-LoxP- Frt-Neo-B5 vector was generated for this experiment. This vector contains a 5’upstream region of the Btn2a2 gene, the region to be deleted flanked by two loxP sites, a neomycin resistance marker flanked by Frt sites and a 3’downstream region of the Btn2a2 gene. This vector was introduced into embryonic stem (ES) cells, in which the wild type (WT) locus was replaced by the floxed locus by homologous recombination in the 5’upstream and 3’downstream regions of Btn2a2 (Figure 14). Clones containing the floxed locus were selected with neomycin.
SfiI 5’up XhoI 3’down NotI ApaI S-Y ex1 ex2 BamHI SalI
BamHI SalI SfiI NotIS-Y ex1 ex2 XhoI ApaI KS-loxP-frt-Neo-B5: Neo
S-Y ex1 ex2 WT locus:
Selection of neomicin-resistant ES clones
S-Y ex1 ex2 Floxed locus (Neo+): Neo
123 Figure 14. Generation of ES clones containing the floxed Btn2a2 locus. The 5’upstream region of Btn2a2 (~6.3 kb), the region to be deleted (~1.3 kb) and the 3’downstream region of Btn2a2 (~3.1 kb) were obtained by PCR amplification from the BAC RP23-16H24 and then inserted in the pKS-LoxP-frt-Neo-B5 vector using the indicated restriction sites. The WT locus was replaced by the floxed locus of the pKS- LoxP-frt-Neo-B5 vector by homologous recombination (crosses) in ES cells. Neomycin-resistant ES clones were selected. Light blue boxes, Frt sequences; dark blue box, neomycin marker; red triangles, LoxP sites.
Southern blots were performed to test whether the neomycin-resistant ES clones contained the floxed locus. DNA probes were designed upstream (5’) and downstream (3’) of the floxed locus. Genomic DNA of ES clones was prepared and digested with the restriction enzyme XhoI. DNA probes were labeled with 32P. The XhoI-digested DNA fragments of the WT (11.7kb) and floxed locus (6.6kb and 3.8kb) were detected in the Southern blot (Figure 15).
XhoI XhoI S-Y ex1 ex2 WT locus: 5’probe 3’probe
~11.8 kb
XhoI XhoI XhoI XhoI S-Y ex1 ex2 Floxed locus (Neo+): Neo 5’probe 3’probe
~6.6 kb ~3.8 kb
Figure 15. Strategy for testing ES clones by Southern bloting. DNA Probes were designed in the 5’ upstream region and the 3’downstream region of the Btn2a2 locus. The approximative lengths of the DNA fragments obtained after digestion with XhoI for the WT and floxed loci are shown below the map of the locus. Positions of the probes are represented by arrows. Red triangles, LoxP sites; light blue boxes, Frt sequences; dark blue box, neomycin marker.
An ES clone that tested positive for the floxed locus was then injected into WT mouse embryos to obtain chimeric mice. The neomycin marker was eliminated by crossing the chimeras with transgenic Flp mice. The resulting heterozygous mice (F/+) were then crossed with Cre transgenic mice to delete the sequence flanked by the two LoxP sites in the floxed locus (Figure 16).
124 S-Y ex1 ex2 Floxed locus (Neo+): Neo
Flp
S-Y ex1 ex2 Floxed locus (Neo-):
Cre
Deleted locus:
Figure 16. Generation of the Btn2a2-deleted locus. The neomycin marker present in the floxed locus was eliminated by crossing the chimeras with a transgenic Flp mouse. The deletion of the sequence flanked by the two loxP sites was obtained by crossing the floxed mice with transgenic Cre mice. Red triangles, loxP sites; light blue boxes, Frt sequences; dark blue box, neomycin marker.
Primer pairs were designed to identify F/+ heterozygous mice by genotyping. A forward primer (oligo 1) was designed in the sequence to be deleted and a reverse primer (oligo 2) was designed downstream of the second loxP site. Oligos 1 and 2 amplify a DNA fragment of 144 bp from the WT locus and of 271bp from the floxed locus (Figure 17).
A. B.
oligo 1+2 S-Y ex1 ex2 L(bp) +/+ F/+ WT locus (+): oligo 1 oligo 2 4000 3000 144 bp 2000 1600 S-Y ex1 ex2 Floxed locus (F): 1000 501 396 oligo 1 oligo 2 271 bp 220 201 144 bp 271 bp
Figure 17. Genotyping of F/+ heterozygous mice. A. Positions of the primers used for genotyping are indicated by arrows (oligos 1 and 2). The lengths of the expected PCR fragments are indicated below. B. PCR amplifications were visualised by using an agarose gel stained with ethidium bromide. The sizes of the PCR fragments are shown by arrows. L, DNA ladder; bp, base pairs.
125 Primer pairs were also designed to identify the genotypes of the progeny of the F/+ and Cre parental mice. The progeny can show four different genotypes: +/+, F/+, Cre +/+ or Cre -/+. To detect the deletion of the floxed locus, a third primer (oligo 3) was designed upstream of the first LoxP site. The length of the DNA fragments amplified by oligos 2 and 3 from the WT locus is approximatively 2.05 kb, and 469 bp after deletion by Cre (Figure 18).
A.S-Y ex1 ex2 B. WT locus (+): +/+ F/+ Cre +/+ Cre -/+ oligo 1 oligo 2 oligo 1+2 oligo 1+2 oligo 1+2 oligo 1+2 oligo Cre 144 bp L(bp) oligo Cre oligo Cre oligo Cre oligo 2+3 oligo 2+3 oligo 2+3 oligo 2+3 oligo 3 oligo 2
2049 bp 4000 2000 2200 bp (F) 2049 bp (WT) S-Y ex1 ex2 1000
Floxed allele (F): 501 469 bp (-) 271 bp (F) 220 oligo 1 oligo 2 144 bp (WT)
271 bp oligo 3 oligo 2
2200 bp
Deleted locus (-):
oligo 3 oligo 2
469 bp
Figure 18. Genotyping strategy for the WT, floxed (F) and deleted (-) loci. A. Positions of the primers used for genotyping are indicated by arrows (oligos 1, 2 and 3). The lengths of the expected PCR fragments are indicated below the scheme of the locus. B. PCR amplifications were visualised by using an agarose gel stained with ethidium bromide. The sizes of the PCR fragments are shown by arrows. L, DNA ladder; bp, base pairs.
The F/+ and -/+ heterozygous mice were crossed with the aim of generating F/F and - /- mice. To date, no homozygote F/F or -/- mice have been obtained in the offspring (Figure 19). These surprising results suggest two conclusions. First, it is likely that the Btn2a2 gene plays an essential role during development. Second, it is likely that introduction of the LoxP site in the Btn2a2 promoter has perturbed expression of the gene.
126 Offspring
+/+ F/+ or -/+ F/F or -/-
F/+ x F/+ 19 52 0
Parents -/+ x -/+ 17 25 0
Figure 19. Genotypes of the offspring of F/+ and -/+ mice. F/+ or -/+ heterozygous mice were crossed with F/+ or -/+ mice, respectively, and newborn mice of 4 weeks old were typed using the oligos described above. Numbers represent the number of pups having the indicated genotypes.
127 III CONCLUSIONS AND PERSPECTIVES
128 The work presented in this thesis examines different aspects of the regulation of MHCII gene expression. The first section of the results documents a dynamic incorporation of histone modifications occuring in two distinct phases during transcriptional activation of MHCII genes. H4 acetylations are deposited before transcription activation and are spread over a large region upstream of the HLA-DRA TSS. Specific H3 modifications localised in the vicinity of the HLA-DRA TSS are a consequence of transcription and are likely to be related to transcription elongation. In the second section, the analysis of nucleosome density at MHCII promoters reveals that a nucleosome-free region is created at the regulatory S-Y module and TSS of MHCII genes. The nucleosome eviction that occurs at MHCII promoters is mediated by the enhanceosome complex and is essential for determining the position of the TSS. Finally, the third section of the results describes the regulation of a novel direct target gene by the MHCII-specific regulatory machinery. The human BTN2A2 and mouse Btn2a2 genes are co-regulated with MHCII genes by CIITA and RFX in various key cell types of the immune system. The conclusions for these three parts are discussed at the end of each section of the results. The general discussion presented in this section therefore focuses on issues that have not been addressed in the results section.
III.1 Role of histone modifications deposited during MHCII gene activation
The study presented in the first part of the results section describes the highly dynamic chromatin modification status at MHCII promoters during transcriptional activation. Histone H3 and H4 modifications are deposited in two sequential phases. The first phase, which precedes transcription initiation, is characterised by an increase in H4K5 and H4K8 acetylation over a large upstream region of the HLA-DRA gene. Transcription-dependent histone modifications, including H3K9ac, H3K14ac, H3K4me3, H3K4me2, H3K9me3 and H3R17me2 are introduced in the vicinity of the TSS during the second phase. Several studies have been performed to identify chromatin modifying and remodeling factors that are involved in the deposition of histone marks or that require specific marks for their recruitment at MHCII promoters. ChIP experiments have demonstrated that GCN5, CBP, BRG1 and BRM1 are recruited to the HLA-DRA promoter following IFNγ stimulation in vivo and that their recruitment precedes an increase in H3 and H4 acetylation (Beresford
129 and Boss 2001; Spilianakis et al. 2003). It was also suggested that CIITA can interact specifically with CARM1 at MHCII promoters, mediating the methylation of arginine 17 of histone H3 (H3R17Me2). This modification was proposed to stabilise binding of CBP to the promoter, thereby enhancing MHCII gene expression (Chevillard-Briet et al. 2002; Zika and Ting 2005). These chromatin modifying and remodeling factors are likely to be involved in MHCII gene transcription. However, no functional studies have demonstrated convincingly that GCN5, CBP, BRG1, BRM1 or CARM1 are recruited by specific activators or through the deposition of specific modifications at MHCII promoters. It also remains unclear whether these factors interact together or with other activators, and by which mechanisms they are involved in the recruitment of PolII and the general transcription machinery to activate MHCII gene expression. Different histone modifications are deposited prior to and after transcription initiation at MHCII promoters. The major role of H4 acetylation may be to recruit chromatin remodelers and co-activators that are involved in transcription initiation. The transcription- dependent H3 modifications are instead likely to be involved in the recruitment of factors implicated in elongation. In summary, the spacial and temporal recruitment of chromatin modifying and remodeling activities required for MHCII gene transcription remains to be defined. The precise description of the histone modification pattern at MHCII promoters presented in the results section should be helpful for determining which co-activators or remodeling factors are involved in the establishment of an appropriate chromatin state for transcription initiation at MHCII promoters and elongation within the body of MHCII genes.
III.2 Role of nucleosome eviction in MHCII gene activation
The second part of the results describes the eviction of nucleosomes at MHCII promoters. This nucleosome eviction is mediated by the enhanceosome complex and is essential for determining the correct position of the TSS. Although the results demonstrate that nucleosomes are displaced from MHCII promoters by the enhanceosome, it is not clear whether a specific factor in the complex - RFX, NF-Y or CREB - is responsible for nucleosome eviction, or if it is the result of a coordinated effect of all enhanceosome factors. Indeed, the use of RFX-deficient cells does not allow us to distinguish between the different components of the enhanceosome complex, because none of the factors can assemble at the MHCII S-Y module in the absence of RFX. Several lines of evidence suggest that NF-Y could 130 play an important role in this process. NF-YB and NF-YC contain histone fold-domains that are homologous to histones H2A and H2B, respectively, and are necessary for heterodimerisation. Based on this homology, it was suggested that NF-YA/NF-YB dimers might compete with nucleosomes for binding to DNA. In addition, binding of NF-Y induces a bend of 60°-80° in the DNA, which could contribute to nucleosome destabilisation (Ronchi et al. 1995; Liberati et al. 1999; Mantovani 1999; Motta et al. 1999; Romier et al. 2003). The results presented in this thesis show that nucleosome eviction at MHCII promoters plays a role in positioning of the TSS. This mechanism may not be restricted to MHCII promoters, and could possibly explain how the TSS is defined in other genes. One of the characteristics of MHCII promoters is that they do not contain a well-defined TATA sequence or an initiator element involved in PIC assembly. Although TATA-like sequences are found in certain MHCII promoters, these sequences do not affect the position of transcription initiation (Benoist and Mathis 1990; Viville et al. 1991; Mantovani et al. 1993). Transcription factor-mediated nucleosome positioning could be a mechanism for determining the TSS position at other promoters lacking a TATA box. The determination of TSS location at TATA-less promoters by positioned nucleosomes has very recently been suggested (Jiang and Pugh 2009). In this review, the authors suggest that establishment of the TSS position at promoters lacking core promoter elements such as the TATA box could be explained by the position of nucleosomes. The involvement of histone modifications in promoting nucleosome eviction at promoters has been suggested by several studies (Workman 2006). One study reported that nucleosomes are first acetylated and then lost at the PHO5 promoter (Reinke and Horz 2003). Another study reported that histone acetylation by p300/CBP facilitates the destabilisation of H2A/H2B dimers in vitro (Ito et al. 2000). Involvement of the yeast H2A.Z histone variant in nucleosome displacement has also been proposed (Guillemette et al. 2005; Li et al. 2005; Raisner et al. 2005; Zhang et al. 2005). However, these studies were performed mainly in yeast and only documented a correlation between specific histones marks and the loss of nucleosomes. While histone modifications are likely to play an important role in nucleosome destabilisation at certain promoters, the functional role of these modifications has not been clearly demonstrated in vivo, and the presence of these marks does not explain the nucleosome eviction phenomenon in all systems. Computational studies have proposed that nucleosome positioning can also be determined by the underlying DNA sequence (Ioshikhes et al. 2006; Segal et al. 2006; Peckham et al. 2007; Field et al. 2008; Gupta et al. 2008; Miele 131 et al. 2008; Yuan and Liu 2008). However, such predictions have only been useful for determining nucleosome positioning for a limited number of promoters, and more experimental determinations of nucleosome positions need to be performed (Rando and Ahmad 2007; Henikoff 2008; Jiang and Pugh 2009). The nucleosome eviction observed at active MHCII promoters does not seem to be mediated by introduction of H3ac, H4ac or H3K4me3 modifications, the incorporation of H2A-Z or the underlying DNA sequence. The NFR located at MHCII promoters is instead likely to be induced by binding of the transcription factors that compose the enhanceosome complex. The control of nucleosome positioning by transcription factors has been described in other models (Brown 1984; Workman 2006). The most well documented example of activation-induced nucleosome eviction is the yeast PHO5 promoter. In this system, the PHO4 activator binds to its site within nucleosomes, suggesting that PHO4 can bind to the PHO5 promoter prior to nucleosome disassembly (Boeger et al. 2003; Adkins et al. 2004; Boeger et al. 2004; Korber et al. 2006). Nucleosome loss was also observed when the PHO5 promoter was placed in small chromosome circles, suggesting that nucleosomes are lost at the PHO5 promoter in trans rather than by sliding along the DNA in cis. Genome-wide experiments have revealed a role of transcription factors in NFR formation (Yu and Morse 1999; Bernstein et al. 2004; Raisner et al. 2005). These studies reported that DNA-binding sites for the transcription factor RAP1 are located in NFRs at promoters, and that this factor can remove nucleosomes. Moreover, removing this site from a test promoter induces nucleosome reassembly. The transcription factor REB1 has also been reported to be involved in the generation of NFRs. Indeed, REB1 binding is associated with NFRs flanked by two H2A.Z-containing nucleosomes. In vitro studies have described the role of cooperative binding of different transcription factors in nucleosome destabilisation (Workman and Kingston 1992; Morse 1993; Owen-Hughes and Workman 1996). This model is similar to the mechanism observed at MHCII promoters, where the enhanceosome complex mediates nucleosome eviction. A recent study suggested that the binding of transcription factors at human promoters could be involved in nucleosome positioning (Ozsolak et al. 2007). This genome-wide mapping study showed that nucleosome phasing is more variable at human promoters than at yeast promoters, and that the binding of regulatory factors can explain this variability. It has also been well documented that transcription factors recruit chromatin remodeling complexes which are involved in nucleosome disassembly at promoters (Owen- Hughes and Workman 1996; Lorch et al. 1999; Hassan et al. 2001). Although the 132 involvement of transcription factors in nucleosome eviction has been demonstrated at MHCII promoters in this thesis, the role of chromatin remodelers interacting with these factors remains to be defined. Nucleosome eviction at MHCII promoters is induced in cells treated with IFNγ. Histone displacement in response to inducers has been reported in several other studies. At the PHO5 gene, nucleosome eviction in response to activator induction is required for transcription activation (Straka and Horz 1991; Boeger et al. 2003; Adkins et al. 2004; Boeger et al. 2004; Korber et al. 2006). Other studies have reported that specific histones or entire nucleosomes can be displaced in response to inducers (Adams and Workman 1993; Workman 2006). In the study of Chen et al., T cell activation induces histones H3 and H4 depletion at the IL-2 promoter (Chen et al. 2005). Moreover, histones H2A and H2B are lost from the mouse mammary tumor virus promoter upon progesterone activation (Vicent et al. 2004). Transcription factor-mediated nucleosome eviction is also a characteristic of the GAL4 activator. The yeast transcriptional activator GAL4 mediates removal of promoter nucleosomes upon galactose induction through recruitment of the SWI/SNF complex (Taylor et al. 1991; Lohr and Lopez 1995; Bryant et al. 2008). Finally, nucleosomes are also lost at promoters of most heat-shock genes in yeast (Lee et al. 2004; Zhao et al. 2005). Recent studies have proposed new mechanisms via which nucleosomes are evicted from DNA. Santo-Rosa and colleagues identified a novel histone H3 endopeptidase activity in yeast that may regulate gene activation (Santos-Rosa et al. 2009). This endopeptidase is a serine protease that cleaves histone H3 after the alanine at position 21, generating a histone that lacks the first 21 residues. This “clipping” process precedes histone eviction at active promoters. Another example of H3 cleavage has been described during mouse embryonic stem cell differentiation (Duncan et al. 2008). In this study, the cathepsin L protease has been shown to be responsible for cleavage of the N-terminus tail of histone H3. These novel mechanisms remain to be documented in humans. However, they could potentially be involved in enhanceosome-mediated nucleosome eviction at MHCII promoters. The importance of the analysis of chromatin structure for understanding gene regulation is widely accepted. Indeed, deregulation of chromatin modifying processes can induce defects in development and cancer (Shilatifard 2006; Bu et al. 2007; Whittle et al. 2008). Our understanding of how nucleosome position can regulate gene expression has increased dramatically during recent years. The discovery of numerous histone modifications, variant histones and chromatin remodelling factors has led to the speculation that mechanisms 133 implicated in gene regulation are more complex than was initially thought. The development of sophisticated tools such as ChIP-chip and ChIP-Seq technologies has allowed the description of general and specific mechanisms involved in nucleosomal regulation at promoters but also at coding and non-coding regions. However, while nucleosome positioning and histone modification patterns can now be easily defined in all regions of the genome, the description of nucleosome positions and histone modifications has to be coupled with molecular and/or genetic studies to determine the functional role of these processes in specific systems.
III.3 Btn2a2 potential function
In the third section of the results, the BTN2A2 gene is identified as a novel direct target gene of the MHCII-specific regulatory machinery. Human BTN2A2 and mouse Btn2a2 expression are co-regulated with MHCII genes in various cells of the immune system, suggesting that this gene could play an important role in immune responses. The study of mouse Btn2a2 expression revealed that it is expressed most strongly in B cells and immature pDCs. In activated B cells, Btn2a2 expression is down-regulated. These results suggest that Btn2a2 may be involved in early stages of B cell activation. The Btn2a2 gene does not seem to be expressed at high levels in splenic or BM-derived DCs. However, Btn2a2 mRNA is detected in immature BM-derived pDCs. pDCs are distinct from the other subtypes of “conventional” DCs. These cells have the ability to secrete large amounts of IFNα in response to viral infections (Fitzgerald-Bocarsly et al. 2008). The low expression level of Btn2a2 mRNA in mature cells does not necessarily mean that the protein is not expressed at the surface of these cells. Indeed, although CIITA and MHCII gene expression is down- regulated during DC maturation (LeibundGut-Landmann et al. 2004b), the number of MHCII molecules increase at the cell surface. Btn2a2 is expressed in cortical TECs and mature medullary TECs. Cortical and medullary TECs are antigen presenting cells implicated in the development of T cells in the thymus. Cortical TECs regulate the expansion of T cell progenitors, development of CD4+CD8+ double-positive thymocytes, positive selection of double-positive thymocytes, and differentiation into single-positive CD4+ or CD8+ thymocytes. Medullary TECs are required for the deletion of autoreactive single-positive thymocytes and thus for establishing immunological tolerance to self-proteins (Takahama 2006). Characteristic features of mature 134 mTECs include high expression of MHCII and costimulatory molecules (CD80, CD86 and CD40) (Anderson et al. 2002; Gray et al. 2006). The co-expression of Btn2a2 with MHCII genes in cortical TECs and mature medullary TECs suggests that this gene may play a role in the regulation of T cell development. The presence of IgC and IgV domains exhibiting close similarity to the IgC and IgV domains of the B7 family members of costimulatory molecules suggests a role for the BTN2A2 molecule in modulation of the immune response. The presence of a B30.2/SPRY domain in the cytoplasmic region of the BTN2A2 protein may also indicate a specific function for BTN2A2. SPRY and B30.2 are homologous domains that have been identified in ~700 eukaryotic proteins. In humans, B30.2/SPRY domains are found in eleven protein families, including BTN molecules, members of the SS-B (SPRY domain-containing SOCS Box) family and TRIM molecules (Rhodes et al. 2005). Althrough B30.2 and SPRY domains are closely homologous, the B30.2 domain is found only in BTN and TRIM family molecules and is always located at the C-terminus. The B30.2 domain is encoded by a single exon and alternative spliced transcripts lacking this domain have been described for BTN and TRIM genes. Certain members of the BTN family have been suggested to play a role in the immune response, such as BTN2A1 and BTN3 molecules (Compte et al. 2004; Malcherek et al. 2007). The TRIM family contains members involved in innate immune resistance to retroviruses. TRIM5α is a retroviral restriction factor that blocks retroviruses, such as human immunodeficiency virus type 1 (HIV-1) or HIV-2, via its B30.2 domain (Stremlau et al. 2004; Nisole et al. 2005). TRIM21 is a major autoantigen involved in autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus (Ben-Chetrit et al. 1988; Ben-Chetrit et al. 1990). TRIM21 has been reported to bind normal serum IgG Fc through its PRY/SPRY domain (Rhodes and Trowsdale 2007). Members of the SS-B family contain a SOCS box which is a B50 amino-acid stretch, a feature of the suppressor of cytokine signaling (SOCS) protein family (Starr et al. 1997). The crystal structure of GUSTAVUS (an SS-B family protein) and of the SSB-2 protein reveal a β-sandwich fold as a core structure of their B30.2/SPRY domains that is essential for interactions between proteins (Woo et al. 2006a; Woo et al. 2006b; Kuang et al. 2009). Other studies suggest that the B30.2/SPRY domain functions as a protein-interaction module. Deletion of the B30.2/SPRY domain in TRIM11 abrogates interaction of the protein with its binding partner (Niikura et al. 2003). In addition, the Pyrin protein involved in the familial mediterranean fever autoinflammatory disease, interacts directly through its B30.2 domain with Caspase-1 to modulate IL-1β production 135 (Chae et al. 2006). The amino acid sequence is highly variable among B30.2/SPRY domains, suggesting that these domains are protein-interacting modules that recognise a specific individual partner protein rather than a consensus sequence motif (Woo et al. 2006a). The expression studies presented in this thesis show that the Btn2a2 gene is expressed in cell lines derived from endothelial cells of the thymus, brain and myocard, and in primary lung endothelial cells. In these cells, CIITA and MHCII genes are not expressed in the absence of IFNγ stimulation. This suggests that Btn2a2 expression is likely to be regulated by factors other than the MHCII-specific regulatory machinery in endothelial cells. The absence of Btn2a2-/- mice in the progeny of Btn2a2+/- intercrosses suggests that Btn2a2 plays an essential role during development. This phenotype could reflect a deregulation of endothelial cell development or function. The functions of human BTN2A2 and mouse Btn2a2 remain to be defined. Analyses of Btn2a2-/- embryos will be essential for studying the role of Btn2a2 in development. In addition, a new conditional Btn2a2 knock-out mouse will be generated to study the function of Btn2a2 in the immune system. To analyse interactions between the BTN2A2 protein and its ligands or receptors, we plan to generate a soluble BTN2A2-Fc fusion protein. This fusion protein will be very useful to perform ligand competition assays and to identify a potential receptor. Finally, the production of polyclonal or monoclonal antibodies specific for Btn2a2 will be essential for analysing the functions of this molecule. These antibodies will also be useful for localising Btn2a2 in mouse cells and tissues by immunofluorescence labelling, and for analysing its expression at the surface of cells by flow cytometry.
136 Abbreviations
APC antigen presenting cell ARD ankyrin repeat domain ATP adenosine 5’-triphosphate β2m β2 microglobulin BAC bacterial artificial chromosome BLS bare lymphocyte syndrome BRG1 Brahma-Related Gene 1 BMDC bone-marrow-derived dendritic cell Bp base pairs BTN butyrophilin BTNL butyrophilin-like BSA bovine serum albumin CIITA class II transactivator CARM1 co-activator-associated arginine-methyltransferase 1 CBP CREB binding protein CD cluster of differentiation cDNA complementary DNA ChIP chromatin immunoprecipitation CHRAC chromatin accessibitity complex CLIP class II invariant chain peptide CMHI complexe majeur d’histocompatibilité de classe I CMHII complexe majeur d’histocompatibilité de classe II CRE cAMP response element CREB CRE binding protein CTCF CCCTC binding factor cTEC cortical TEC CTD C-terminal domain DIB dilution incubation buffer DBD DNA-binding domain DC dendritic cell
137 DHS DNAse hypersensitive site DMEM Dulbecco modified eagle’s medium DNA deoxyribonucleic acid DNAse I deoxyribonuclease I DRB 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole DTT dithiothreitol EC endothelial cell ECL electrochemiluminescence EDTA ethylenediaminotetraacetic acid EGTA ethylene glycol-bis ER endoplasmic reticulum ES embryonic stem FACS fluorescence-activated cell sorting FITC fluorescein isothiocyanate FO follicule GDB GTP binding domain GFP green fluorescent protein GM-CSF granulocyte macrophage colony stimulating factor GTF general transcription factor GTM general transcription machinery GTP guanosine 5’-triphosphate HAT histone acetyltransferase HDAC histone deacetylase HEPES N-(2-hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid) HIV human immunodeficiency virus HLA human leukocyte antigen HUVEC human umbilical vein endothelial cell IFN interferon Ig immunoglobulin Ii invariant chain IL interleukin IP immunoprecipitation ISRE interferon-stimulated response element 138 JAK Janus kinase Kb kilo base pairs LCR locus control region LPS lipopolysaccharide LRR leucine rich repeat MEF mouse embryonic fibroblast MHC major histocompatibility complex MHCI major histocompatibility complex class I MHCII major histocompatibility complex class II MNAse microccocal nuclease MNB microccocal nuclease buffer mRNA messenger RNA mTEC medullary TEC MZ marginal zone NACHT domain present in NAIP, CIITA, HET-E and TP1 proteins Na-DOC deoxycholate sodium salt NES nuclear export signal NFR nucleosome free region NF-Y nuclear factor Y NK natural killer cell NLR NACHT-LRR or NOD-LRR NLS nuclear localisation signal NP-40 nonidet P-40 PBS phosphate buffered saline pCAF p300/CBP associated factor PCR polymerase chain reaction qPCR quantitative PCR pDC plasmacytoid dendritic cell PIC preinitiation complex Pol II polymerase II PST proline-serine-threonine RFX regulatory factor X RPA RNAse protection assay 139 RNA ribonucleic acid RPMI Roswell Park Memorial Institute cell culture medium RT reverse transcriptase SDS lauryl sulphate sodium salt SDS-PAGE SDS polyacrylamide gel electrophoresis siRNA small interfering RNA SOCS suppressor of cytokine signaling Spl-DC splenic dendritic cell SPRY domain in Spla and the Ryanodine receptor SSB SPRY domain-containing SOCS box protein SWI/SNF mating type switching/sucrose non-fermenting STAT signal transducer and activator of transcription TAF TBP-associated factor TAP transporter associated with antigen processing TBP TATA binding protein TCR T cell receptor TE Tris-EDTA buffer TEC thymic epithelial cell TF transcription factor TGF transforming growth factor Th T helper TLR toll-like receptor TNF tumor necrosis factor Tris tris(hydroximethyl)amoniomethane TSH thyroid stimulating hormone TSS transcription start site WT wild type
140 References
The MHC sequencing consortium. 1999. Complete sequence and gene map of a human major histocompatibility complex. Nature 401(6756): 921-923. Acha Orbea, H. and McDevitt, H.O. 1990. The role of class II molecules in development of insulin- dependent diabetes mellitus in mice, rats and humans. CurrTopMicrobiolImmunol 156: 103-119. Adams, C.C. and Workman, J.L. 1993. Nucleosome displacement in transcription. Cell 72(3): 305-308. Adkins, M.W., Howar, S.R., and Tyler, J.K. 2004. Chromatin disassembly mediated by the histone chaperone Asf1 is essential for transcriptional activation of the yeast PHO5 and PHO8 genes. Mol Cell 14(5): 657- 666. Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F. 2007. Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature 446(7135): 572-576. Alfonso, C. and Karlsson, L. 2000. Nonclassical MHC class II molecules. Annu Rev Immunol 18: 113-142. Allis, C.D., Berger, S.L., Cote, J., Dent, S., Jenuwien, T., Kouzarides, T., Pillus, L., Reinberg, D., Shi, Y., Shiekhattar, R., Shilatifard, A., Workman, J., and Zhang, Y. 2007. New nomenclature for chromatin- modifying enzymes. Cell 131(4): 633-636. Anderson, M.S., Venanzi, E.S., Klein, L., Chen, Z., Berzins, S.P., Turley, S.J., von Boehmer, H., Bronson, R., Dierich, A., Benoist, C., and Mathis, D. 2002. Projection of an immunological self shadow within the thymus by the aire protein. Science 298(5597): 1395-1401. Arnett, H.A., Escobar, S.S., Gonzalez-Suarez, E., Budelsky, A.L., Steffen, L.A., Boiani, N., Zhang, M., Siu, G., Brewer, A.W., and Viney, J.L. 2007. BTNL2, a butyrophilin/B7-like molecule, is a negative costimulatory molecule modulated in intestinal inflammation. J Immunol 178(3): 1523-1533. Askew, D., Gatewood, J., Olivas, E., Havenith, K., and Walker, W.S. 1995. A subset of splenic macrophages process and present native antigen to naive antigen-specific CD4+ T-cells from mice transgenic for an alpha beta T-cell receptor. Cell Immunol 166(1): 62-70. Aurrand-Lions, M., Johnson-Leger, C., Pepper, M.S., and Imhof, B.A. 2004. Haemangiomas are formed by cells expressing high levels of alphavbeta3 integrin and lacking acetylated LDL uptake. J Pathol 203(2): 700-709. Banchereau, J. and Steinman, R.M. 1998. Dendritic cells and the control of immunity. Nature 392(6673): 245- 252. Bao, Y. and Shen, X. 2007a. INO80 subfamily of chromatin remodeling complexes. Mutat Res 618(1-2): 18-29. Bao, Y. and Shen, X. 2007b. SnapShot: chromatin remodeling complexes. Cell 129(3): 632. Barr, C.L. and Saunders, G.F. 1991. Interferon-gamma-inducible regulation of the human invariant chain gene. J Biol Chem 266(6): 3475-3481. Barrachina, M., Gonalons, E., and Celada, A. 1999. LPS upregulates MHC class II I-A expression in B lymphocytes at transcriptional and at translational levels. Tissue Antigens 54(5): 461-470. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. 2007. High-resolution profiling of histone methylations in the human genome. Cell 129(4): 823-837. Barski, A. and Zhao, K. 2009. Genomic location analysis by ChIP-Seq. J Cell Biochem. Ben-Chetrit, E., Chan, E.K., Sullivan, K.F., and Tan, E.M. 1988. A 52-kD protein is a novel component of the SS-A/Ro antigenic particle. J Exp Med 167(5): 1560-1571. Ben-Chetrit, E., Fox, R.I., and Tan, E.M. 1990. Dissociation of immune responses to the SS-A (Ro) 52-kd and 60-kd polypeptides in systemic lupus erythematosus and Sjogren's syndrome. Arthritis Rheum 33(3): 349-355.
141 Benacerraf, B. 1981. Role of MHC gene products in immune regulation. Science 212: 1229-1238. Benichou, B. and Strominger, J.L. 1991. Class II-antigen-negative patient and mutant B-cell lines represent at least three, and probably four, distinct genetic defects defined by complementation analysis. ProcNatlAcadSciUSA 88: 4285-4288. Benoist, C. and Mathis, D. 1990. Regulation of major histocompatibility complex class-II genes: X, Y and other letters of the alphabet. Annu Rev Immunol 8: 681-715. Beresford, G.W. and Boss, J.M. 2001. CIITA coordinates multiple histone acetylation modifications at the HLA- DRA promoter. NatImmunol 2(7): 652-657. Berger, S.L. 2007. The complex language of chromatin regulation during transcription. Nature 447(7143): 407- 412. Bernstein, B.E., Humphrey, E.L., Erlich, R.L., Schneider, R., Bouman, P., Liu, J.S., Kouzarides, T., and Schreiber, S.L. 2002. Methylation of histone H3 Lys 4 in coding regions of active genes. Proc Natl Acad Sci U S A 99(13): 8695-8700. Bernstein, B.E., Kamal, M., Lindblad-Toh, K., Bekiranov, S., Bailey, D.K., Huebert, D.J., McMahon, S., Karlsson, E.K., Kulbokas, E.J., 3rd, Gingeras, T.R., Schreiber, S.L., and Lander, E.S. 2005. Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120(2): 169-181. Bernstein, B.E., Liu, C.L., Humphrey, E.L., Perlstein, E.O., and Schreiber, S.L. 2004. Global nucleosome occupancy in yeast. Genome Biol 5(9): R62. Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S.L., and Lander, E.S. 2006. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125(2): 315-326. Bikoff, E.K., Huang, L.Y., Episkopou, V., van Meerwijk, J., Germain, R.N., and Robertson, E.J. 1993. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4+ T cell selection in mice lacking invariant chain expression. J Exp Med 177(6): 1699-1712. Bjorkman, P.J., Saper, M.A., Samraoui, B., Bennett, W.S., Strominger, J.L., and Wiley, D.C. 1987. Structure of the human class I histocompatibility antigen, HLA-A2. Nature 329: 506-511. Boeger, H., Griesenbeck, J., Strattan, J.S., and Kornberg, R.D. 2003. Nucleosomes unfold completely at a transcriptionally active promoter. Mol Cell 11(6): 1587-1598. Boeger, H., Griesenbeck, J., Strattan, J.S., and Kornberg, R.D. 2004. Removal of promoter nucleosomes by disassembly rather than sliding in vivo. Mol Cell 14(5): 667-673. Boss, J.M. and Jensen, P.E. 2003. Transcriptional regulation of the MHC class II antigen presentation pathway. Curr Opin Immunol 15(1): 105-111. Boulard, M., Bouvet, P., Kundu, T.K., and Dimitrov, S. 2007. Histone variant nucleosomes: structure, function and implication in disease. Subcell Biochem 41: 71-89. Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., Bell, G.W., Otte, A.P., Vidal, M., Gifford, D.K., Young, R.A., and Jaenisch, R. 2006. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441(7091): 349-353. Braud, V.M., Allan, D.S., and McMichael, A.J. 1999. Functions of nonclassical MHC and non-MHC-encoded class I molecules. Curr Opin Immunol 11(1): 100-108. Brown, A.M., Barr, C.L., and Ting, J.P. 1991. Sequences homologous to class II MHC W, X, and Y elements mediate constitutive and IFN-gamma-induced expression of human class II-associated invariant chain gene. JImmunol 146: 3183-3189. Brown, A.M., Linhoff, M.W., Stein, B., Wright, K.L., Baldwin, A.S., Jr., Basta, P.V., and Ting, J.P. 1994. Function of NF-kappa B/Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell-specific binding of different NF-kappa B/Rel subunits. MolCell Biol 14: 2926-2935. Brown, D.D. 1984. The role of stable complexes that repress and activate eucaryotic genes. Cell 37(2): 359-365.
142 Brown, J.H., Jardetzky, T.S., Gorga, J.C., Stern, L.J., Urban, R.G., Strominger, J.L., and Wiley, D.C. 1993. Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 364: 33-39. Bryant, G.O., Prabhu, V., Floer, M., Wang, X., Spagna, D., Schreiber, D., and Ptashne, M. 2008. Activator control of nucleosome occupancy in activation and repression of transcription. PLoS Biol 6(12): 2928- 2939. Bu, P., Evrard, Y.A., Lozano, G., and Dent, S.Y. 2007. Loss of Gcn5 acetyltransferase activity leads to neural tube closure defects and exencephaly in mouse embryos. Mol Cell Biol 27(9): 3405-3416. Burstein, H.J., Tepper, R.I., Leder, P., and Abbas, A.K. 1991. Humoral immune functions in IL-4 transgenic mice. JImmunol 147: 2950-2956. Busch, R., Cloutier, I., Sekaly, R.P., and Hammerling, G.J. 1996. Invariant chain protects class II histocompatibility antigens from binding intact polypeptides in the endoplasmic reticulum. Embo J 15(2): 418-428. Carreno, B.M. and Collins, M. 2002. The B7 family of ligands and its receptors: new pathways for costimulation and inhibition of immune responses. Annu Rev Immunol 20: 29-53. Carson, S. and Wiles, M.V. 1993. Far upstream regions of class II MHC Ea are necessary for position- independent, copy-dependent expression of Ea transgene. NucleicAcidsRes 21: 2065-2072. Cassell, D.J. and Schwartz, R.H. 1994. A quantitative analysis of antigen-presenting cell function: activated B cells stimulate naive CD4 T cells but are inferior to dendritic cells in providing costimulation. J Exp Med 180(5): 1829-1840. Chae, J.J., Wood, G., Masters, S.L., Richard, K., Park, G., Smith, B.J., and Kastner, D.L. 2006. The B30.2 domain of pyrin, the familial Mediterranean fever protein, interacts directly with caspase-1 to modulate IL-1beta production. Proc Natl Acad Sci U S A 103(26): 9982-9987. Chang, C.H., Fontes, J.D., Peterlin, M., and Flavell, R.A. 1994. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. JExpMed 180: 1367-1374. Chang, C.H., Guerder, S., Hong, S.C., van Ewijk, W., and Flavell, R.A. 1996. Mice lacking the MHC class II transactivator (CIITA) show tissue- specific impairment of MHC class II expression. Immunity 4(2): 167-178. Chen, X., Wang, J., Woltring, D., Gerondakis, S., and Shannon, M.F. 2005. Histone dynamics on the interleukin- 2 gene in response to T-cell activation. Mol Cell Biol 25(8): 3209-3219. Chevillard-Briet, M., Trouche, D., and Vandel, L. 2002. Control of CBP co-activating activity by arginine methylation. EMBO J 21(20): 5457-5466. Chin, K.C., Li, G.G., and Ting, J.P. 1997. Importance of acidic, proline/serine/threonine-rich, and GTP- binding regions in the major histocompatibility complex class II transactivator: generation of transdominant- negative mutants. ProcNatlAcadSciUSA 94: 2501-2506. Chow, C.M., Georgiou, A., Szutorisz, H., Maia e Silva, A., Pombo, A., Barahona, I., Dargelos, E., Canzonetta, C., and Dillon, N. 2005. Variant histone H3.3 marks promoters of transcriptionally active genes during mammalian cell division. EMBO Rep 6(4): 354-360. Clausen, B.E., Waldburger, J.M., Schwenk, F., Barras, E., Mach, B., Rajewsky, K., Forster, I., and Reith, W. 1998. Residual MHC class II expression on mature dendritic cells and activated B cells in RFX5- deficient mice. Immunity 8(2): 143-155. Coiras, M.T., Alvarez-Barrientos, A.M., Diaz, G., Arroyo, J., and Sanchez-Perez, M. 2002. Evidence for discoordinate regulation of the HLA-DPB1 gene. Tissue Antigens 60(6): 505-514. Collins, T., Korman, A.J., Wake, C.T., Boss, J.M., Kappes, D.J., Fiers, W., Ault, K.A., Gimbrone, M.A.J., Strominger, J.L., and Pober, J.S. 1984. Immune interferon activates multiple class II major histocompatibility complex genes and the associated invariant chain gene in human endothelial cells and dermal fibroblasts. ProcNatlAcadSciUSA 81: 4917-4921. Compte, E., Pontarotti, P., Collette, Y., Lopez, M., and Olive, D. 2004. Frontline: Characterization of BT3 molecules belonging to the B7 family expressed on immune cells. Eur J Immunol 34(8): 2089-2099. 143 Cosgrove, M.S. 2007. Histone proteomics and the epigenetic regulation of nucleosome mobility. Expert Rev Proteomics 4(4): 465-478. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules. AnnuRevImmunol 12: 259- 293. Cresswell, P. 1996. Invariant Chain Structure and MHC Class II Function. Cell 84: 505-507. Das, S., Lin, J.H., Papamatheakis, J., Sykulev, Y., and Tsichlis, P.N. 2002. Differential splicing generates Tvl- 1/RFXANK isoforms with different functions. J Biol Chem 277(47): 45172-45180. De Lerma Barbaro, A., Sartoris, S., Tosi, G., Nicolis, M., and Accolla, R.S. 1994. Evidence for a specific post- transcriptional mechanism controlling the expression of HLA-DQ, but not -DR and -DP, molecules. JImmunol 153: 4530-4538. De Lerma Barbaro, A., Sartoris, S., Tosi, G., Nicolis, M., and Accolla, R.S. 1997. Evidence for a specific post- transcriptional mechanism controlling the expression of HLA-DQ, but not -DR and -DP, molecules. JImmunol1994Nov15 153: 4530-4538. Defrance, T., Carayon, P., Billian, G., Guillemot, J.C., Minty, A., Caput, D., and Ferrara, P. 1994. Interleukin 13 is a B cell stimulating factor. JExpMed 179: 135-143. Del Pozzo, G., Ciullo, M., Autiero, M., and Guardiola, J. 1994. Control of nucleo-cytoplasmic HLA-DRA mRNA partitioning by interaction of a retention signal with compartmentalized proteins. JMolBiol 240: 193-204. Del Pozzo, G., Ciullo, M., and Guardiola, J. 1999. Regulation of HLA class II gene expression: the case for posttranscriptional control levels. MicrobesInfect 1(11): 943-948. Dellabona, P., Latron, F., Maffei, A., Scarpellino, L., and Accolla, R.S. 1989. Transcriptional control of MHC class II gene expression during differentiation from B cells to plasma cells. JImmunol 142: 2902-2910. Dennis, J.H., Fan, H.Y., Reynolds, S.M., Yuan, G., Meldrim, J.C., Richter, D.J., Peterson, D.G., Rando, O.J., Noble, W.S., and Kingston, R.E. 2007. Independent and complementary methods for large-scale structural analysis of mammalian chromatin. Genome Res 17(6): 928-939. DeSandro, A.M., Nagarajan, U.M., and Boss, J.M. 2000. Associations and interactions between bare lymphocyte syndrome factors. MolCellBiol 20(17): 6587-6599. Devajyothi, C., Kalvakolanu, I., Babcock, G.T., Vasavada, H.A., Howe, P.H., and Ransohoff, R.M. 1993. Inhibition of interferon-gamma-induced major histocompatibility complex class II gene transcription by interferon-beta and type beta 1 transforming growth factor in human astrocytoma cells. Definition of cis-element. JBiolChem 268: 18794-18800. Dirscherl, S.S. and Krebs, J.E. 2004. Functional diversity of ISWI complexes. Biochem Cell Biol 82(4): 482-489. Dong, Y., Rohn, W.M., and Benveniste, E.N. 1999. IFN-gamma regulation of the type IV class II transactivator promoter in astrocytes. JImmunol 162(8): 4731-4739. Dorn, A., Fehling, H.J., Koch, W., Lemeur, M., Gerlinger, P., Benoist, C., and Mathis, D. 1988. B cell control region at the 5' end of a major histocompatibility complex class II gene: sequences and factors. MolCellBiol 8: 3975-3987. Douhan, J., Lieberson, R., Knoll, J.H.M., Zhou, H., and Glimcher, L.H. 1997. An isotype-specific activator of major histocompatibility complex (MHC) class II genes that is independent of class II transactivator. JExpMed 185: 1885-1895. Drew, H.R. and Travers, A.A. 1985. DNA bending and its relation to nucleosome positioning. J Mol Biol 186(4): 773-790. Duncan, E.M., Muratore-Schroeder, T.L., Cook, R.G., Garcia, B.A., Shabanowitz, J., Hunt, D.F., and Allis, C.D. 2008. Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation. Cell 135(2): 284-294. Durand, B., Kobr, M., Reith, W., and Mach, B. 1994. Functional complementation of MHC class II regulatory mutants by the purified X box binding protein RFX. MolCell Biol 14: 6839-6847.
144 Durand, B., Sperisen, P., Emery, P., Barras, E., Zufferey, M., Mach, B., and Reith, W. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J 16: 1045- 1055. Elgin, S.C. 1981. DNAase I-hypersensitive sites of chromatin. Cell 27(3 Pt 2): 413-415. Elhasid, R. and Etzioni, A. 1996. Major histocompatibility complex class II deficiency: a clinical review. Blood Rev 10(4): 242-248. Emery, P., Durand, B., Mach, B., and Reith, W. 1996. RFX proteins, a novel family of DNA binding proteins conserved in the eukaryotic kingdom. NuclAcids Res 24(5): 803-807. Engelhard, V.H. 1994. Structure of peptides associated with class I and class II MHC molecules. AnnuRevImmunol 12: 181-207. Farris, S.D., Rubio, E.D., Moon, J.J., Gombert, W.M., Nelson, B.H., and Krumm, A. 2005. Transcription- induced chromatin remodeling at the c-myc gene involves the local exchange of histone H2A.Z. J Biol Chem 280(26): 25298-25303. Feriotto, G., Mischiati, C., Bianchi, N., Rutigliano, C., Giacomini, P., and Gambari, R. 1995. Sequencing of an upstream region of the human HLA-DRA gene containing X' and Y' boxes. NucleicAcidsRes 23(10): 1671-1678. Fiebiger, E., Meraner, P., Weber, E., Fang, I.F., Stingl, G., Ploegh, H., and Maurer, D. 2001. Cytokines regulate proteolysis in major histocompatibility complex class II-dependent antigen presentation by dendritic cells. J Exp Med 193(8): 881-892. Field, Y., Kaplan, N., Fondufe-Mittendorf, Y., Moore, I.K., Sharon, E., Lubling, Y., Widom, J., and Segal, E. 2008. Distinct modes of regulation by chromatin encoded through nucleosome positioning signals. PLoS Comput Biol 4(11): e1000216. Figueiredo, F., Koerner, T.J., and Adams, D.O. 1989. Molecular mechanisms regulating the expression of class II histocompatibility molecules on macrophages. Effects of inductive and suppressive signals on gene transcription. JImmunol 143: 3781-3786. Fitzgerald-Bocarsly, P., Dai, J., and Singh, S. 2008. Plasmacytoid dendritic cells and type I IFN: 50 years of convergent history. Cytokine Growth Factor Rev 19(1): 3-19. Fontes, J.D., Jiang, B., and Peterlin, B.M. 1997. The class II trans- activator CIITA interacts with the TBP- associated factor TAF II 32. Nucleic Acids Res 25: 2522-2528. Fontes, J.D., Kanazawa, S., Jean, D., and Peterlin, B.M. 1999. Interactions between the class II transactivator and CREB binding protein increase transcription of major histocompatibility complex class II genes. MolCell Biol 19(1): 941-947. Fowlkes, B.J. and Schweighoffer, E. 1995. Positive Selection of T Cells. CurrOpImm 7: 188-195. Franke, W.W., Heid, H.W., Grund, C., Winter, S., Freudenstein, C., Schmid, E., Jarasch, E.D., and Keenan, T.W. 1981. Antibodies to the major insoluble milk fat globule membrane-associated protein: specific location in apical regions of lactating epithelial cells. J Cell Biol 89(3): 485-494. Gal-Yam, E.N., Jeong, S., Tanay, A., Egger, G., Lee, A.S., and Jones, P.A. 2006. Constitutive nucleosome depletion and ordered factor assembly at the GRP78 promoter revealed by single molecule footprinting. PLoS Genet 2(9): e160. Ganapathi, M., Singh, G.P., Sandhu, K.S., Brahmachari, S.K., and Brahmachari, V. 2007. A whole genome analysis of 5' regulatory regions of human genes for putative cis-acting modulators of nucleosome positioning. Gene 391(1-2): 242-251. Gangaraju, V.K. and Bartholomew, B. 2007. Mechanisms of ATP dependent chromatin remodeling. Mutat Res 618(1-2): 3-17. Garvie, C.W., Stagno, J.R., Reid, S., Singh, A., Harrington, E., and Boss, J.M. 2007. Characterization of the RFX complex and the RFX5(L66A) mutant: implications for the regulation of MHC class II gene expression. Biochemistry 46(6): 1597-1611. Germain, R.N. and Margulies, D.H. 1993. The biochemistry and cell biology of antigen processing and presentation. AnnuRevImmunol 11: 403-450. 145 Glimcher, L.H. and Kara, C.J. 1992. Sequences and factors: A guide to MHC class-II transcription. AnnuRevImmunol 10: 13-49. Go, N.F., Castle, B.E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T.R., Moore, K.W., and Howard, M. 1990. Interleukin 10, a novel B cell stimulatory factor: unresponsiveness of X chromosome-linked immunodeficiency B cells. JExpMed 172: 1625-1631. Gobin, S.J., Keijsers, V., van Zutphen, M., and van den Elsen, P.J. 1998. The role of enhancer A in the locus- specific transactivation of classical and nonclassical HLA class I genes by nuclear factor kappa B. JImmunol 161(5): 2276-2283. Gobin, S.J., Peijnenburg, A., Keijsers, V., and van den Elsen, P.J. 1997. Site alpha is crucial for two routes of IFN gamma-induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA. Immunity 6: 601-611. Gomez, J.A., Majumder, P., Nagarajan, U.M., and Boss, J.M. 2005. X box-like sequences in the MHC class II region maintain regulatory function. J Immunol 175(2): 1030-1040. Gonczy, P., Reith, W., Barras, E., Lisowska-Grospierre, B., Griscelli, C., Hadam, M.R., and Mach, B. 1989. Inherited immunodeficiency with a defect in a major histocompatibility complex class II promoter- binding protein differs in the chromatin structure of the HLA-DRA gene. Mol Cell Biol 9(1): 296-302. Gorer, P.A. 1938. The antigenic basis of tumor transplantation. JPathBac 47: 231. Gourley, T., Roys, S., Lukacs, N.W., Kunkel, S.L., Flavell, R.A., and Chang, C.H. 1999. A novel role for the major histocompatibility complex class II transactivator CIITA in the repression of IL-4 production. Immunity 10(3): 377-386. Gourley, T.S. and Chang, C.H. 2001. Cutting edge: the class II transactivator prevents activation-induced cell death by inhibiting Fas ligand gene expression. JImmunol 166(5): 2917-2921. Gourley, T.S., Patel, D.R., Nickerson, K., Hong, S.C., and Chang, C.H. 2002. Aberrant expression of Fas ligand in mice deficient for the MHC class II transactivator. J Immunol 168(9): 4414-4419. Gray, D.H., Seach, N., Ueno, T., Milton, M.K., Liston, A., Lew, A.M., Goodnow, C.C., and Boyd, R.L. 2006. Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood 108(12): 3777-3785. Greenwald, R.J., Freeman, G.J., and Sharpe, A.H. 2005. The B7 family revisited. Annu Rev Immunol 23: 515- 548. Griscelli, C., Lisowska-Grospierre, B., and Mach, B. 1989. Combined immunodeficiency with defective expression in MHC class II genes. ImmunodeficRev 1: 135-153. Guardiola, J. and Maffei, A. 1993. Control of MHC class II gene expression in autoimmune, infectious, and neoplastic diseases. CritRev Immunol 13: 247-268. Guenther, M.G., Levine, S.S., Boyer, L.A., Jaenisch, R., and Young, R.A. 2007. A chromatin landmark and transcription initiation at most promoters in human cells. Cell 130(1): 77-88. Guillemette, B., Bataille, A.R., Gevry, N., Adam, M., Blanchette, M., Robert, F., and Gaudreau, L. 2005. Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3(12): e384. Gupta, S., Dennis, J., Thurman, R.E., Kingston, R., Stamatoyannopoulos, J.A., and Noble, W.S. 2008. Predicting human nucleosome occupancy from primary sequence. PLoS Comput Biol 4(8): e1000134. Hake, S.B., Masternak, K., Kammerbauer, C., Janzen, C., Reith, W., and Steimle, V. 2000. CIITA leucine-rich repeats control nuclear localization, In vivo recruitment to the major histocompatibility complex (MHC) class II enhanceosome, and MHC class II gene transactivation. MolCell Biol 20(20): 7716-7725. Hampsey, M. and Reinberg, D. 2003. Tails of intrigue: phosphorylation of RNA polymerase II mediates histone methylation. Cell 113(4): 429-432. Hartmann, G. and Krieg, A.M. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J Immunol 164(2): 944-953.
146 Hassan, A.H., Neely, K.E., and Workman, J.L. 2001. Histone acetyltransferase complexes stabilize swi/snf binding to promoter nucleosomes. Cell 104(6): 817-827. Hawiger, D., Inaba, K., Dorsett, Y., Guo, M., Mahnke, K., Rivera, M., Ravetch, J.V., Steinman, R.M., and Nussenzweig, M.C. 2001. Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J Exp Med 194(6): 769-779. Heintzman, N.D., Stuart, R.K., Hon, G., Fu, Y., Ching, C.W., Hawkins, R.D., Barrera, L.O., Van Calcar, S., Qu, C., Ching, K.A., Wang, W., Weng, Z., Green, R.D., Crawford, G.E., and Ren, B. 2007. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet 39(3): 311-318. Henikoff, S. 2007. Nucleosomes at active promoters: unforgettable loss. Cancer Cell 12(5): 407-409. Henikoff, S. 2008. Nucleosome destabilization in the epigenetic regulation of gene expression. Nat Rev Genet 9(1): 15-26. Henikoff, S. and Ahmad, K. 2005. Assembly of variant histones into chromatin. Annu Rev Cell Dev Biol 21: 133-153. Henry, J., Miller, M.M., and Pontarotti, P. 1999. Structure and evolution of the extended B7 family. Immunol Today 20(6): 285-288. Herrero Sanchez, C., Reith, W., Silacci, P., and Mach, B. 1992. The DNA-binding defect observed in major histocompatibility complex class II regulatory mutants concerns only one member of a family of complexes binding to the X boxes of class II promoters. MolCell Biol 12: 4076-4083. Holling, T.M., van der Stoep, N., Quinten, E., and van den Elsen, P.J. 2002. Activated Human T Cells Accomplish MHC Class II Expression Through T Cell-Specific Occupation of Class II Transactivator Promoter III. JImmunol 168(2): 763-770. Horton, R., Wilming, L., Rand, V., Lovering, R.C., Bruford, E.A., Khodiyar, V.K., Lush, M.J., Povey, S., Talbot, C.C., Jr., Wright, M.W., Wain, H.M., Trowsdale, J., Ziegler, A., and Beck, S. 2004. Gene map of the extended human MHC. Nat Rev Genet 5(12): 889-899. Hume, C.R. and Lee, J.S. 1989. Congenital immunodeficiencies associated with absence of HLA class II antigens on lymphocytes result from distinct mutations in trans-acting factors. HumImmunol 26(4): 288- 309. Ioshikhes, I.P., Albert, I., Zanton, S.J., and Pugh, B.F. 2006. Nucleosome positions predicted through comparative genomics. Nat Genet 38(10): 1210-1215. Irla, M., Hugues, S., Gill, J., Nitta, T., Hikosaka, Y., Williams, I.R., Hubert, F.X., Scott, H.S., Takahama, Y., Hollander, G.A., and Reith, W. 2008. Autoantigen-specific interactions with CD4+ thymocytes control mature medullary thymic epithelial cell cellularity. Immunity 29(3): 451-463. Itano, A.A. and Jenkins, M.K. 2003. Antigen presentation to naive CD4 T cells in the lymph node. Nat Immunol 4(8): 733-739. Ito, T., Ikehara, T., Nakagawa, T., Kraus, W.L., and Muramatsu, M. 2000. p300-mediated acetylation facilitates the transfer of histone H2A-H2B dimers from nucleosomes to a histone chaperone. Genes Dev 14(15): 1899-1907. Jabrane-Ferrat, N., Nekrep, N., Tosi, G., Esserman, L.J., and Peterlin, B.M. 2002. Major histocompatibility complex class II transcriptional platform: assembly of nuclear factor Y and regulatory factor X (RFX) on DNA requires RFX5 dimers. Mol Cell Biol 22(15): 5616-5625. Jack, L.J. and Mather, I.H. 1990. Cloning and analysis of cDNA encoding bovine butyrophilin, an apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane during lactation. J Biol Chem 265(24): 14481-14486. Jameson, S.C., Hogquist, K.A., and Bevan, M.J. 1995. Positive Selection of Thymocytes. AnnRevImmunol 13: 93-126. Jenkins, M.K., Khoruts, A., Ingulli, E., Mueller, D.L., McSorley, S.J., Reinhardt, R.L., Itano, A., and Pape, K.A. 2001. In vivo activation of antigen-specific CD4 T cells. Annu Rev Immunol 19: 23-45. Jensen, P.E. 2007. Recent advances in antigen processing and presentation. Nat Immunol 8(10): 1041-1048. 147 Jenuwein, T. and Allis, C.D. 2001. Translating the histone code. Science 293(5532): 1074-1080. Jiang, C. and Pugh, B.F. 2009. Nucleosome positioning and gene regulation: advances through genomics. Nat Rev Genet 10(3): 161-172. Johnson-Leger, C.A., Aurrand-Lions, M., Beltraminelli, N., Fasel, N., and Imhof, B.A. 2002. Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood 100(7): 2479- 2486. Johnson, S.M., Tan, F.J., McCullough, H.L., Riordan, D.P., and Fire, A.Z. 2006. Flexibility and constraint in the nucleosome core landscape of Caenorhabditis elegans chromatin. Genome Res 16(12): 1505-1516. Jones, E.Y. 1997. MHC class I and class II structures. Curr Opin Immunol 9(1): 75-79. Kamakaka, R.T. and Biggins, S. 2005. Histone variants: deviants? Genes Dev 19(3): 295-310. Kamal, M., Katira, A., and Gordon, J. 1991. Stimulation of B lymphocytes via CD72 (human Lyb-2). EurJImmunol 21: 1419-1424. Kanazawa, S., Okamoto, T., and Peterlin, B.M. 2000. Tat competes with CIITA for the binding to P-TEFb and blocks the expression of MHC class II genes in HIV infection. Immunity 12(1): 61-70. Kara, C.J. and Glimcher, L.H. 1991. In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome. Science 252: 709-712. Kara, C.J. and Glimcher, L.H. 1993. Three in vivo promoter phenotypes in MHC class II deficient combined immunodeficiency. Immunogenetics 37: 227-230. Kato, T., Kitaura, M., Inaba, K., Watanabe, Y., Kawade, Y., and Muramatsu, S. 1992. Suppression of Macrophage Ia-Antigen Expression by Endogenous Interferon-Alpha/Beta. JInterferon Res special issue: 29-41. Kim, T.H., Barrera, L.O., Zheng, M., Qu, C., Singer, M.A., Richmond, T.A., Wu, Y., Green, R.D., and Ren, B. 2005. A high-resolution map of active promoters in the human genome. Nature 436(7052): 876-880. Klein, C., Lisowska Grospierre, B., LeDeist, F., Fischer, A., and Griscelli, C. 1993. Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, and outcome. JPediatr 123: 921-928. Korber, P., Barbaric, S., Luckenbach, T., Schmid, A., Schermer, U.J., Blaschke, D., and Horz, W. 2006. The histone chaperone Asf1 increases the rate of histone eviction at the yeast PHO5 and PHO8 promoters. J Biol Chem 281(9): 5539-5545. Kornberg, R.D. and Klug, A. 1981. The nucleosome. Sci Am 244(2): 52-64. Kornberg, R.D. and Lorch, Y. 1999. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98(3): 285-294. Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128(4): 693-705. Krawczyk, M., Leimgruber, E., Seguin-Estevez, Q., Dunand-Sauthier, I., Barras, E., and Reith, W. 2007. Expression of RAB4B, a protein governing endocytic recycling, is co-regulated with MHC class II genes. Nucl Acids Res 35(2): 595-605. Krawczyk, M., Masternak, K., Zufferey, M., Barras, E., and Reith, W. 2005. New functions of the major histocompatibility complex class II-specific transcription factor RFXANK revealed by a high-resolution mutagenesis study. Mol Cell Biol 25(19): 8607-8618. Krawczyk, M., Peyraud, N., Rybtsova, N., Masternak, K., Bucher, P., Barras, E., and Reith, W. 2004. Long distance control of MHC class II expression by multiple distal enhancers regulated by regulatory factor X complex and CIITA. J Immunol 173(10): 6200-6210. Krawczyk, M., Seguin-Estevez, Q., Leimgruber, E., Sperisen, P., Schmid, C., Bucher, P., and Reith, W. 2008. Identification of CIITA regulated genetic module dedicated for antigen presentation. PLoS Genet 4(4): e1000058. Kretsovali, A., Agalioti, T., Spilianakis, C., Tzortzakaki, E., Merika, M., and Papamatheakis, J. 1998. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. MolCell Biol 18(11): 6777-6783. 148 Kretsovali, A., Spilianakis, C., Dimakopoulos, A., Makatounakis, T., and Papamatheakis, J. 2001. Self- association of class II transactivator correlates with its intracellular localization and transactivation. JBiolChem 276(34): 32191-32197. Kropshofer, H., Hammerling, G.J., and Vogt, A.B. 1999. The impact of the non-classical MHC proteins HLA- DM and HLA-DO on loading of MHC class II molecules. Immunol Rev 172: 267-278. Kuang, Z., Yao, S., Xu, Y., Lewis, R.S., Low, A., Masters, S.L., Willson, T.A., Kolesnik, T.B., Nicholson, S.E., Garrett, T.J., and Norton, R.S. 2009. SPRY domain-containing SOCS box protein 2: crystal structure and residues critical for protein binding. J Mol Biol 386(3): 662-674. Kumnovics, A., Takada, T., and Lindahl, K.F. 2003. Genomic organization of the Mammalian MHC. Annu Rev Immunol 21: 629-657. Kurdistani, S.K. and Grunstein, M. 2003. Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Biol 4(4): 276-284. Kurdistani, S.K., Tavazoie, S., and Grunstein, M. 2004. Mapping global histone acetylation patterns to gene expression. Cell 117(6): 721-733. Kusch, T. and Workman, J.L. 2007. Histone variants and complexes involved in their exchange. Subcell Biochem 41: 91-109. Landmann, S., Muhlethaler-Mottet, A., Bernasconi, L., Suter, T., Waldburger, J.M., Masternak, K., Arrighi, J.F., Hauser, C., Fontana, A., and Reith, W. 2001. Maturation of dendritic cells is accompanied by rapid transcriptional silencing of class ii transactivator (ciita) expression. JExpMed 194(4): 379-392. Landmann, S., Waldburger, J.M., Masternak, K., Muhlethaler-Mottet, A., and Reith, W. 2003. CIITA and the MHCII enhanceosome in the regulation of MHCII expression. Current Genomics 4(4): 343-363. Latron, F., Jotterand Bellomo, M., Maffei, A., Scarpellino, L., Bernard, M., Strominger, J.L., and Accolla, R.S. 1988. Active suppression of major histocompatibility complex class II gene expression during differentiation from B cells to plasma cells. ProcNatlAcadSciUSA 85: 2229-2233. Lee, C.K., Shibata, Y., Rao, B., Strahl, B.D., and Lieb, J.D. 2004. Evidence for nucleosome depletion at active regulatory regions genome-wide. Nat Genet 36(8): 900-905. Lee, S.C., Liu, W., Roth, P., Dickson, D.W., Berman, J.W., and Brosnan, C.F. 1993. Macrophage colony- stimulating factor in human fetal astrocytes and microglia. Differential regulation by cytokines and lipopolysaccharide, and modulation of class II MHC on microglia. JImmunol 150: 594-604. Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C. 2007. A high-resolution atlas of nucleosome occupancy in yeast. Nat Genet 39(10): 1235-1244. Lee, Y.J., Han, Y., Lu, H.T., Nguyen, V., Qin, H., Howe, P.H., Hocevar, B.A., Boss, J.M., Ransohoff, R.M., and Benveniste, E.N. 1997. TGF-beta suppresses IFN-gamma induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. JImmunol 158: 2065-2075. Lehner, P.J. and Cresswell, P. 1996. Processing and delivery of peptides presented by MHC class I molecules. CurrOpinImmunol 8: 59-67. LeibundGut-Landmann, S., Waldburger, J.M., Krawczyk, M., Otten, L.A., Suter, T., Fontana, A., Acha-Orbea, H., and Reith, W. 2004a. Mini-review: Specificity and expression of CIITA, the master regulator of MHC class II genes. Eur J Immunol 34(6): 1513-1525. LeibundGut-Landmann, S., Waldburger, J.M., Reis e Sousa, C., Acha-Orbea, H., and Reith, W. 2004b. MHC class II expression is differentially regulated in plasmacytoid and conventional dendritic cells. Nat Immunol 5(9): 899-908. Leimgruber, E., Seguin-Estevez, Q., Dunand-Sauthier, I., Rybtsova, N., Schmid, C.D., Ambrosini, G., Bucher, P., and Reith, W. 2009. Nucleosome eviction from MHC class II promoters controls positioning of the transcription start site. Nucleic Acids Res. Lennon, A.M., Ottone, C., Rigaud, G., Deaven, L.L., Longmire, J., Fellous, M., Bono, R., and Alcaide-Loridan, C. 1997. Isolation of a B-cell-specific promoter for the human class II transactivator. Immunogenetics 45(4): 266-273. Li, B., Carey, M., and Workman, J.L. 2007. The role of chromatin during transcription. Cell 128(4): 707-719. 149 Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C., Gerton, J., and Workman, J.L. 2005. Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling. Proc Natl Acad Sci U S A 102(51): 18385-18390. Liberati, C., di Silvio, A., Ottolenghi, S., and Mantovani, R. 1999. NF-Y binding to twin CCAAT boxes: role of Q-rich domains and histone fold helices. JMolBiol 285(4): 1441-1455. Lin, J.C., Jeong, S., Liang, G., Takai, D., Fatemi, M., Tsai, Y.C., Egger, G., Gal-Yam, E.N., and Jones, P.A. 2007. Role of nucleosomal occupancy in the epigenetic silencing of the MLH1 CpG island. Cancer Cell 12(5): 432-444. Lin, J.H., Makris, A., McMahon, C., Bear, S.E., Patriotis, C., Prasad, V.R., Brent, R., Golemis, E.A., and Tsichlis, P.N. 1999. The ankyrin repeat-containing adaptor protein Tvl-1 is a novel substrate and regulator of Raf-1. J Biol Chem 274(21): 14706-14715. Linhoff, M.W., Harton, J.A., Cressman, D.E., Martin, B.K., and Ting, J.P. 2001. Two distinct domains within CIITA mediate self-association: involvement of the GTP-binding and leucine-rich repeat domains. MolCell Biol 21(9): 3001-3011. Lisowska-Grospierre, B., Fondaneche, M.C., Rols, M.P., Griscelli, C., and Fischer, A. 1994. Two complementation groups account for most cases of inherited MHC class II deficiency. HumMolGenet 3: 953-958. Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J. 2005. Single- nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol 3(10): e328. Lohr, D. and Lopez, J. 1995. GAL4/GAL80-dependent nucleosome disruption/deposition on the upstream regions of the yeast GAL1-10 and GAL80 genes. J Biol Chem 270(46): 27671-27678. Lorch, Y., Zhang, M., and Kornberg, R.D. 1999. Histone octamer transfer by a chromatin-remodeling complex. Cell 96(3): 389-392. Loughlin, A.J., Woodroofe, M.N., and Cuzner, M.L. 1993. Modulation of interferon-gamma-induced major histocompatibility complex class II and Fc receptor expression on isolated microglia by transforming growth factor-beta 1, interleukin-4, noradrenaline and glucocorticoids. Immunology 79: 125-130. Lowary, P.T. and Widom, J. 1998. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J Mol Biol 276(1): 19-42. Luger, K. and Richmond, T.J. 1998. DNA binding within the nucleosome core. Curr Opin Struct Biol 8(1): 33- 40. Lusser, A. and Kadonaga, J.T. 2003. Chromatin remodeling by ATP-dependent molecular machines. Bioessays 25(12): 1192-1200. Mach, B., Steimle, V., Martinez-Soria, E., and Reith, W. 1996. Regulation of MHC class II genes: Lessons from a disease. AnnuRevImmunol 14: 301-331. Madden, D.R., Gorga, J.C., Strominger, J.L., and Wiley, D.C. 1992. The three-dimensional structure of HLA- B27 at 2.1 A resolution suggests a general mechanism for tight peptide binding to MHC. Cell 70: 1035- 1048. Maffei, A., Perfetto, C., Ombra, N., Del Pozzo, G., and Guardiola, J. 1989. Transcriptional and post- transcriptional regulation of human MHC class II genes require the synthesis of short-lived proteins. JImmunol 142: 3657-3661. Mahanta, S.K., Scholl, T., Yang, F.C., and Strominger, J.L. 1997. Transactivation by CIITA, the type II bare lymphocyte syndrome- associated factor, requires participation of multiple regions of the TATA box binding protein. ProcNatlAcadSciUSA 94: 6324-6329. Majumder, P., Gomez, J.A., Chadwick, B.P., and Boss, J.M. 2008. The insulator factor CTCF controls MHC class II gene expression and is required for the formation of long-distance chromatin interactions. J Exp Med 205(4): 785-798. Malcherek, G., Mayr, L., Roda-Navarro, P., Rhodes, D., Miller, N., and Trowsdale, J. 2007. The B7 homolog butyrophilin BTN2A1 is a novel ligand for DC-SIGN. J Immunol 179(6): 3804-3811. Malik, H.S. and Henikoff, S. 2003. Phylogenomics of the nucleosome. Nat Struct Biol 10(11): 882-891. 150 Mantovani, R. 1999. The molecular biology of the CCAAT-binding factor NF-Y. Gene 239(1): 15-27. Mantovani, R., Tora, L., Moncollin, V., Egly, J.M., Benoist, C., and Mathis, D. 1993. The major histocompatibility complex (MHC) Ea promoter: sequences and factors at the initiation site. Nucleic Acids Res 21(21): 4873-4878. Martens, J.H., O'Sullivan, R.J., Braunschweig, U., Opravil, S., Radolf, M., Steinlein, P., and Jenuwein, T. 2005. The profile of repeat-associated histone lysine methylation states in the mouse epigenome. EMBO J 24(4): 800-812. Martin, B.K., Chin, K.C., Olsen, J.C., Skinner, C.A., Dey, A., Ozato, K., and Ting, J.P. 1997. Induction of MHC class I expression by the MHC class II transactivator CIITA. Immunity 6: 591-600. Martin, C. and Zhang, Y. 2005. The diverse functions of histone lysine methylation. Nat Rev Mol Cell Biol 6(11): 838-849. Martinon, F. and Tschopp, J. 2005. NLRs join TLRs as innate sensors of pathogens. Trends Immunol 26(8): 447- 454. Masternak, K., Barras, E., Zufferey, M., Conrad, B., Corthals, G., Aebersold, R., Sanchez, J.C., Hochstrasser, D.F., Mach, B., and Reith, W. 1998. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. NatGenet 20(3): 273-277. Masternak, K., Muhlethaler-Mottet, A., Villard, J., Zufferey, M., Steimle, V., and Reith, W. 2000. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev 14(9): 1156-1166. Masternak, K., Peyraud, N., Krawczyk, M., Barras, E., and Reith, W. 2003. Chromatin remodeling and extragenic transcription at the MHC class II locus control region. Nat Immunol 4(2): 132-137. Masternak, K. and Reith, W. 2002. Promoter-specific functions of CIITA and the MHC class II enhancesosome in transcriptional activation. EMBO J 21(6): 1379-1388. Mavrich, T.N., Ioshikhes, I.P., Venters, B.J., Jiang, C., Tomsho, L.P., Qi, J., Schuster, S.C., Albert, I., and Pugh, B.F. 2008a. A barrier nucleosome model for statistical positioning of nucleosomes throughout the yeast genome. Genome Res 18(7): 1073-1083. Mavrich, T.N., Jiang, C., Ioshikhes, I.P., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J., Glaser, R.L., Schuster, S.C., Gilmour, D.S., Albert, I., and Pugh, B.F. 2008b. Nucleosome organization in the Drosophila genome. Nature 453(7193): 358-362. Melhus, O., Koerner, T.J., and Adams, D.O. 1991. Effects of TNF alpha on the expression of class II MHC molecules in macrophages induced by IFN gamma: evidence for suppression at the level of transcription. JLeukocBiol 49: 21-28. Mellor, J. 2005. The dynamics of chromatin remodeling at promoters. Mol Cell 19(2): 147-157. Meneghini, M.D., Wu, M., and Madhani, H.D. 2003. Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112(5): 725-736. Miele, V., Vaillant, C., d'Aubenton-Carafa, Y., Thermes, C., and Grange, T. 2008. DNA physical properties determine nucleosome occupancy from yeast to fly. Nucleic Acids Res 36(11): 3746-3756. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., Lee, W., Mendenhall, E., O'Donovan, A., Presser, A., Russ, C., Xie, X., Meissner, A., Wernig, M., Jaenisch, R., Nusbaum, C., Lander, E.S., and Bernstein, B.E. 2007. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448(7153): 553-560. Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. 2006. Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes Dev 20(6): 711-722. Mischiati, C., Feriotto, G., Bianchi, N., Rutigliano, C., Giacomini, P., and Gambari, R. 1999. Analysis of the human HLA-DRA gene upstream region: evidence for a stem-loop array directed by nuclear factors. Biochimie 81(3): 219-228. Mito, Y., Henikoff, J.G., and Henikoff, S. 2005. Genome-scale profiling of histone H3.3 replacement patterns. Nat Genet 37(10): 1090-1097.
151 Mito, Y., Henikoff, J.G., and Henikoff, S. 2007. Histone replacement marks the boundaries of cis-regulatory domains. Science 315(5817): 1408-1411. Moore, B.B., Cao, Z.A., McRae, T.L., Woo, C.H., Conley, S., and Jones, P.P. 1998. The invariant chain gene intronic enhancer shows homology to class II promoter elements. J Immunol 161(4): 1844-1852. Morel, A.S., Quaratino, S., Douek, D.C., and Londei, M. 1997. Split activity of interleukin-10 on antigen capture and antigen presentation by human dendritic cells: definition of a maturative step. Eur J Immunol 27(1): 26-34. Moreno, C.S., Emery, P., West, J.E., Durand, B., Reith, W., Mach, B., and Boss, J.M. 1995. Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. JImmunol 155: 4313-4321. Morse, R.H. 1993. Nucleosome disruption by transcription factor binding in yeast. Science 262(5139): 1563- 1566. Motta, M.C., Caretti, G., Badaracco, G.F., and Mantovani, R. 1999. Interactions of the CCAAT-binding trimer NF-Y with nucleosomes. JBiolChem 274(3): 1326-1333. Mudhasani, R. and Fontes, J.D. 2002. The class II transactivator requires brahma-related gene 1 to activate transcription of major histocompatibility complex class II genes. Mol Cell Biol 22(14): 5019-5026. Mudhasani, R. and Fontes, J.D. 2005. Multiple interactions between BRG1 and MHC class II promoter binding proteins. Mol Immunol 42(6): 673-682. Mueller, D.L., Jenkins, M.K., and Schwartz, R.H. 1989. Clonal expansion versus functional clonal inactivation: a costimulatory signalling pathway determines the outcome of T cell antigen receptor occupancy. Annu Rev Immunol 7: 445-480. Muhlethaler-Mottet, A., Di Berardino, W., Otten, L.A., and Mach, B. 1998. Activation of the MHC class II transactivator CIITA by interferon-g requires cooperative interaction between Stat1 and USF-1. Immunity 8: 157-166. Muhlethaler-Mottet, A., Krawczyk, M., Masternak, K., Spilianakis, C., Kretsovali, A., Papamatheakis, J., and Reith, W. 2004. The S box of MHC class II promoters is a key determinant for recruitment of the transcriptional coactivator CIITA. J Biol Chem. Muhlethaler-Mottet, A., Otten, L.A., Steimle, V., and Mach, B. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J 16: 2851-2860. Murthy, V.L. and Stern, L.J. 1997. The class II MHC protein HLA-DR1 in complex with an endogenous peptide: implications for the structural basis of the specificity of peptide binding. Structure 5(10): 1385- 1396. Nagarajan, U.M., Bushey, A., and Boss, J.M. 2002a. Modulation of gene expression by the MHC class II transactivator. J Immunol 169(9): 5078-5088. Nagarajan, U.M., Lochamy, J., Chen, X., Beresford, G.W., Nilsen, R., Jensen, P.E., and Boss, J.M. 2002b. Class II transactivator is required for maximal expression of HLA-DOB in B cells. J Immunol 168(4): 1780- 1786. Nagarajan, U.M., Long, A.B., Harreman, M.T., Corbett, A.H., and Boss, J.M. 2004. A hierarchy of nuclear localization signals governs the import of the regulatory factor X complex subunits and MHC class II expression. J Immunol 173(1): 410-419. Nagarajan, U.M., Louis-Plence, P., DeSandro, A., Nilsen, R., Bushey, A., and Boss, J.M. 1999. RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10(2): 153-162. Nandan, D. and Reiner, N.E. 1997. TGF-beta attenuates the class II transactivator and reveals an accessory pathway of IFN-gamma action. JImmunol 158: 1095-1101. Natarajan, K., Dimasi, N., Wang, J., Mariuzza, R.A., and Margulies, D.H. 2002. Structure and function of natural killer cell receptors: multiple molecular solutions to self, nonself discrimination. Annu Rev Immunol 20: 853-885. 152 Natarajan, K., Li, H., Mariuzza, R.A., and Margulies, D.H. 1999. MHC class I molecules, structure and function. Rev Immunogenet 1(1): 32-46. Nekrep, N., Geyer, M., Jabrane-Ferrat, N., and Peterlin, B.M. 2001. Analysis of ankyrin repeats reveals how a single point mutation in RFXANK results in bare lymphocyte syndrome. MolCell Biol 21(16): 5566- 5576. Nekrep, N., Jabrane-Ferrat, N., and Peterlin, B.M. 2000. Mutations in the bare lymphocyte syndrome define critical steps in the assembly of the regulatory factor X complex. MolCell Biol 20(12): 4455-4461. Ng, H.H., Robert, F., Young, R.A., and Struhl, K. 2003. Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol Cell 11(3): 709-719. Nguyen, T., Liu, X.K., Zhang, Y., and Dong, C. 2006. BTNL2, a butyrophilin-like molecule that functions to inhibit T cell activation. J Immunol 176(12): 7354-7360. Ni, Z., Abou El Hassan, M., Xu, Z., Yu, T., and Bremner, R. 2008. The chromatin-remodeling enzyme BRG1 coordinates CIITA induction through many interdependent distal enhancers. Nat Immunol 9(7): 785- 793. Niikura, T., Hashimoto, Y., Tajima, H., Ishizaka, M., Yamagishi, Y., Kawasumi, M., Nawa, M., Terashita, K., Aiso, S., and Nishimoto, I. 2003. A tripartite motif protein TRIM11 binds and destabilizes Humanin, a neuroprotective peptide against Alzheimer's disease-relevant insults. Eur J Neurosci 17(6): 1150-1158. Nisole, S., Stoye, J.P., and Saib, A. 2005. TRIM family proteins: retroviral restriction and antiviral defence. Nat Rev Microbiol 3(10): 799-808. Nossal, G.J.V. 1994. Negative selection of lymphocytes. Cell 76: 229-239. Nowak, S.J. and Corces, V.G. 2004. Phosphorylation of histone H3: a balancing act between chromosome condensation and transcriptional activation. Trends Genet 20(4): 214-220. O'Keefe, G.M., Nguyen, V.T., and Benveniste, E.N. 1999. Class II transactivator and class II MHC gene expression in microglia: modulation by the cytokines TGF-beta, IL-4, IL-13 and IL-10. EurJImmunol 29(4): 1275-1285. Ono, S.J., Bazil, V., Sugawara, M., and Strominger, J.L. 1991. An isotype-specific trans-acting factor is defective in a mutant B cell line that expresses HLA-DQ, but not -DR or -DP. JExpMed 173: 629-637. Otten, L.A., Leibundgut-Landmann, S., Huarte, J., Kos-Braun, I.C., Lavanchy, C., Barras, E., Borisch, B., Steimle, V., Acha-Orbea, H., and Reith, W. 2006. Revisiting the specificity of the MHC class II transactivator CIITA in vivo. European Journal of Immunology 36(6): 1548-1558. Otten, L.A., Steimle, V., Bontron, S., and Mach, B. 1998. Quantitative control of MHC class II expression by the transactivator CIITA. EurJImmunol 28(2): 473-478. Owen-Hughes, T. and Workman, J.L. 1996. Remodeling the chromatin structure of a nucleosome array by transcription factor-targeted trans-displacement of histones. EMBO J 15(17): 4702-4712. Ozsolak, F., Song, J.S., Liu, X.S., and Fisher, D.E. 2007. High-throughput mapping of the chromatin structure of human promoters. Nat Biotechnol 25(2): 244-248. Parham, P. and Ohta, T. 1996. Population biology of antigen presentation by MHC class I molecules. Science 272(5258): 67-74. Peckham, H.E., Thurman, R.E., Fu, Y., Stamatoyannopoulos, J.A., Noble, W.S., Struhl, K., and Weng, Z. 2007. Nucleosome positioning signals in genomic DNA. Genome Res 17(8): 1170-1177. Peretti, M., Villard, J., Barras, E., Zufferey, M., and Reith, W. 2001. Expression of the three human major histocompatibility complex class II isotypes exhibits a differential dependence on the transcription factor RFXAP. MolCell Biol 21(17): 5699-5709. Pesando, J.M. and Graf, L. 1986. Differential expression of HLA-DR, -DQ, and -DP antigens on malignant B cells. J Immunol 136(11): 4311-4318.
153 Picker, L.J. 1993. Regulation of tissue-selective T-lymphocyte homing receptors during the virgin to memory/effector cell transition in human secondary lymphoid tissues. Am Rev Respir Dis 148(6 Pt 2): S47-54. Pierre, P., Turley, S.J., Gatti, E., Hull, M., Meltzer, J., Mirza, A., Inaba, K., Steinman, R.M., and Mellman, I. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells [see comments]. Nature 388(6644): 787-792. Piskurich, J.F., Linhoff, M.W., Wang, Y., and Ting, J.P. 1999. Two distinct gamma interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor beta. MolCell Biol 19(1): 431-440. Piskurich, J.F., Wang, Y., Linhoff, M.W., White, L.C., and Ting, J.P. 1998. Identification of distinct regions of 5' flanking DNA that mediate constitutive, IFN-gamma, STAT1, and TGF-beta-regulated expression of the class II transactivator gene. JImmunol 160(1): 233-240. Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D.K., and Young, R.A. 2005. Genome- wide map of nucleosome acetylation and methylation in yeast. Cell 122(4): 517-527. Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.J., and Madhani, H.D. 2005. Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123(2): 233-248. Rando, O.J. and Ahmad, K. 2007. Rules and regulation in the primary structure of chromatin. Curr Opin Cell Biol 19(3): 250-256. Ransohoff, R.M., Devajyothi, C., Estes, M.L., Babcock, G., Rudick, R.A., Frohman, E.M., and Barna, B.P. 1991. Interferon-beta specifically inhibits interferon-gamma-induced class II major histocompatibility complex gene transcription in a human astrocytoma cell line. JNeuroimmunol 33: 103-112. Raval, A., Howcroft, T.K., Weissman, J.D., Kirshner, S., Zhu, X.S., Yokoyama, K., Ting, J., and Singer, D.S. 2001. Transcriptional coactivator, CIITA, is an acetyltransferase that bypasses a promoter requirement for TAF(II)250. MolCell 7(1): 105-115. Redon, C., Pilch, D., Rogakou, E., Sedelnikova, O., Newrock, K., and Bonner, W. 2002. Histone H2A variants H2AX and H2AZ. Curr Opin Genet Dev 12(2): 162-169. Reimold, A.M., Kara, C.J., Rooney, J.W., and Glimcher, L.H. 1993. Transforming growth factor beta 1 repression of the HLA-DR alpha gene is mediated by conserved proximal promoter elements. JImmunol 151: 4173-4182. Reinke, H. and Horz, W. 2003. Histones are first hyperacetylated and then lose contact with the activated PHO5 promoter. Mol Cell 11(6): 1599-1607. Reith, W. and Boss, J.M. 2008. New dimensions of CIITA. Nat Immunol 9(7): 713-714. Reith, W., Kobr, M., Emery, P., Durand, B., Siegrist, C.A., and Mach, B. 1994a. Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters. JBiolChem 269(31): 20020- 20025. Reith, W., LeibundGut-Landmann, S., and Waldburger, J.M. 2005. Regulation of MHC class II gene expression by the class II transactivator. Nat Rev Immunol 5(10): 793-806. Reith, W. and Mach, B. 2001. The bare lymphocyte syndrome and the regulation of mhc expression. AnnuRevImmunol 19: 331-373. Reith, W., Satola, S., Herrero Sanchez, C., Amaldi, I., Lisowska-Grospierre, B., Griscelli, C., Hadam, M.R., and Mach, B. 1988. Congenital immunodeficiency with a regulatory defect in MHC class II gene expression lacks a specific HLA-DR promoter binding protein, RF-X. Cell 53: 897-906. Reith, W., Siegrist, C.A., Durand, B., Barras, E., and Mach, B. 1994b. Function of major histocompatibility complex class II promoters requires cooperative binding between factors RFX and NF-Y. ProcNatlAcadSciUSA 91(2): 554-558.
154 Reith, W., Steimle, V., and Mach, B. 1995. Molecular defects in the bare lymphocyte syndrome and regulation of MHC class II genes. ImmunolToday 16: 539-546. Reynolds, L.E. and Hodivala-Dilke, K.M. 2006. Primary mouse endothelial cell culture for assays of angiogenesis. Methods Mol Med 120: 503-509. Rhodes, D.A., de Bono, B., and Trowsdale, J. 2005. Relationship between SPRY and B30.2 protein domains. Evolution of a component of immune defence? Immunology 116(4): 411-417. Rhodes, D.A., Stammers, M., Malcherek, G., Beck, S., and Trowsdale, J. 2001. The cluster of BTN genes in the extended major histocompatibility complex. Genomics 71(3): 351-362. Rhodes, D.A. and Trowsdale, J. 2007. TRIM21 is a trimeric protein that binds IgG Fc via the B30.2 domain. Mol Immunol 44(9): 2406-2414. Rice, J.C. and Allis, C.D. 2001. Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr Opin Cell Biol 13(3): 263-273. Riese, R.J. and Chapman, H.A. 2000. Cathepsins and compartmentalization in antigen presentation. Curr Opin Immunol 12(1): 107-113. Rieux Laucat, F., Le Deist, F., Selz, F., Fischer, A., and de Villartay, J.P. 1993. Normal T cell receptor V beta usage in a primary immunodeficiency associated with HLA class II deficiency. EurJImmunol 23: 928- 934. Roh, T.Y., Cuddapah, S., Cui, K., and Zhao, K. 2006. The genomic landscape of histone modifications in human T cells. Proc Natl Acad Sci U S A 103(43): 15782-15787. Roh, T.Y., Wei, G., Farrell, C.M., and Zhao, K. 2007. Genome-wide prediction of conserved and nonconserved enhancers by histone acetylation patterns. Genome Res 17(1): 74-81. Rohn, W., Tang, L.P., Dong, Y., and Benveniste, E.N. 1999. IL-1 beta inhibits IFN-gamma-induced class II MHC expression by suppressing transcription of the class II transactivator gene. JImmunol 162(2): 886- 896. Romier, C., Cocchiarella, F., Mantovani, R., and Moras, D. 2003. The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y. J Biol Chem 278(2): 1336- 1345. Ronchi, A., Bellorini, M., Mongelli, N., and Mantovani, R. 1995. CCAAT-box binding protein NF-Y (CBF, CP1) recognizes the minor groove and distorts DNA. Nucleic Acids Res 23(22): 4565-4572. Ruddy, D.A., Kronmal, G.S., Lee, V.K., Mintier, G.A., Quintana, L., Domingo, R., Jr., Meyer, N.C., Irrinki, A., McClelland, E.E., Fullan, A., Mapa, F.A., Moore, T., Thomas, W., Loeb, D.B., Harmon, C., Tsuchihashi, Z., Wolff, R.K., Schatzman, R.C., and Feder, J.N. 1997. A 1.1-Mb transcript map of the hereditary hemochromatosis locus. Genome Res 7(5): 441-456. Rudolph, M.G., Stanfield, R.L., and Wilson, I.A. 2006. How TCRs bind MHCs, peptides, and coreceptors. Annu Rev Immunol 24: 419-466. Rybtsova, N., Leimgruber, E., Seguin-Estevez, Q., Dunand-Sauthier, I., Krawczyk, M., and Reith, W. 2007. Transcription-coupled deposition of histone modifications during MHC class II gene activation. Nucl Acids Res 35(10): 3431-3441. Sabo, P.J., Kuehn, M.S., Thurman, R., Johnson, B.E., Johnson, E.M., Cao, H., Yu, M., Rosenzweig, E., Goldy, J., Haydock, A., Weaver, M., Shafer, A., Lee, K., Neri, F., Humbert, R., Singer, M.A., Richmond, T.A., Dorschner, M.O., McArthur, M., Hawrylycz, M., Green, R.D., Navas, P.A., Noble, W.S., and Stamatoyannopoulos, J.A. 2006. Genome-scale mapping of DNase I sensitivity in vivo using tiling DNA microarrays. Nat Methods 3(7): 511-518. Saha, A., Wittmeyer, J., and Cairns, B.R. 2006a. Chromatin remodelling: the industrial revolution of DNA around histones. Nat Rev Mol Cell Biol 7(6): 437-447. Saha, A., Wittmeyer, J., and Cairns, B.R. 2006b. Mechanisms for nucleosome movement by ATP-dependent chromatin remodeling complexes. Results Probl Cell Differ 41: 127-148.
155 Sallusto, F. and Lanzavecchia, A. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony- stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. JExpMed 179: 1109-1118. Santisteban, M.S., Kalashnikova, T., and Smith, M.M. 2000. Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 103(3): 411-422. Santos-Rosa, H., Kirmizis, A., Nelson, C., Bartke, T., Saksouk, N., Cote, J., and Kouzarides, T. 2009. Histone H3 tail clipping regulates gene expression. Nat Struct Mol Biol 16(1): 17-22. Santos Argumedo, L., Gordon, J., Heath, A.W., and Howard, M. 1994. Antibodies to murine CD40 protect normal and malignant B cells from induced growth arrest. CellImmunol 156: 272-285. Sarma, K. and Reinberg, D. 2005. Histone variants meet their match. Nat Rev Mol Cell Biol 6(2): 139-149. Sartoris, S., Valle, M.T., Barbaro, A.L., Tosi, G., Cestari, T., D'Agostino, A., Megiovanni, A.M., Manca, F., and Accolla, R.S. 1998. HLA class II expression in uninducible hepatocarcinoma cells after transfection of AIR-1 gene product CIITA: acquisition of antigen processing and presentation capacity. JImmunol 161(2): 814-820. Satchwell, S.C., Drew, H.R., and Travers, A.A. 1986. Sequence periodicities in chicken nucleosome core DNA. J Mol Biol 191(4): 659-675. Saunders, A., Core, L.J., and Lis, J.T. 2006. Breaking barriers to transcription elongation. Nat Rev Mol Cell Biol 7(8): 557-567. Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and Zhao, K. 2008. Dynamic regulation of nucleosome positioning in the human genome. Cell 132(5): 887-898. Schones, D.E. and Zhao, K. 2008. Genome-wide approaches to studying chromatin modifications. Nat Rev Genet 9(3): 179-191. Schotta, G., Lachner, M., Sarma, K., Ebert, A., Sengupta, R., Reuter, G., Reinberg, D., and Jenuwein, T. 2004. A silencing pathway to induce H3-K9 and H4-K20 trimethylation at constitutive heterochromatin. Genes Dev 18(11): 1251-1262. Schubeler, D., MacAlpine, D.M., Scalzo, D., Wirbelauer, C., Kooperberg, C., van Leeuwen, F., Gottschling, D.E., O'Neill, L.P., Turner, B.M., Delrow, J., Bell, S.P., and Groudine, M. 2004. The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev 18(11): 1263-1271. Schwabish, M.A. and Struhl, K. 2004. Evidence for eviction and rapid deposition of histones upon transcriptional elongation by RNA polymerase II. Mol Cell Biol 24(23): 10111-10117. Schwartz, R. 1985. T-lymphocyte recognition of antigen in association with the gene products of the major histocompatibility complex. AnnuRevImmunol 3: 237-237. Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang, J.P., and Widom, J. 2006. A genomic code for nucleosome positioning. Nature 442(7104): 772-778. Seidl, C., Saraiya, C., Osterweil, Z., Fu, Y.P., and Lee, J.S. 1992. Genetic Complexity of Regulatory Mutants Defective for HLA Class- II Gene-Expression. JImmunol 148: 1576-1584. Sekinger, E.A., Moqtaderi, Z., and Struhl, K. 2005. Intrinsic histone-DNA interactions and low nucleosome density are important for preferential accessibility of promoter regions in yeast. Mol Cell 18(6): 735- 748. Shilatifard, A. 2006. Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression. Annu Rev Biochem 75: 243-269. Silacci, P., Mottet, A., Steimle, V., Reith, W., and Mach, B. 1994. Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the transactivator gene CIITA. JExpMed 180: 1329-1336. Sims, R.J., 3rd, Belotserkovskaya, R., and Reinberg, D. 2004. Elongation by RNA polymerase II: the short and long of it. Genes Dev 18(20): 2437-2468.
156 Sisk, T.J., Gourley, T., Roys, S., and Chang, C.H. 2000. MHC class II transactivator inhibits IL-4 gene transcription by competing with NF-AT to bind the coactivator CREB binding protein (CBP)/p300 [In Process Citation]. JImmunol 165(5): 2511-2517. Sisk, T.J., Roys, S., and Chang, C.H. 2001. Self-association of CIITA and its transactivation potential. MolCell Biol 21(15): 4919-4928. Snell, G.D. 1953. The genetics of transplantation. JNatlCancer Inst 14: 691-700. Spilianakis, C., Kretsovali, A., Agalioti, T., Makatounakis, T., Thanos, D., and Papamatheakis, J. 2003. CIITA regulates transcription onset viaSer5-phosphorylation of RNA Pol II. Embo J 22(19): 5125-5136. Spilianakis, C., Papamatheakis, J., and Kretsovali, A. 2000. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. MolCell Biol 20(22): 8489-8498. Squazzo, S.L., O'Geen, H., Komashko, V.M., Krig, S.R., Jin, V.X., Jang, S.W., Margueron, R., Reinberg, D., Green, R., and Farnham, P.J. 2006. Suz12 binds to silenced regions of the genome in a cell-type- specific manner. Genome Res 16(7): 890-900. Starr, R., Willson, T.A., Viney, E.M., Murray, L.J., Rayner, J.R., Jenkins, B.J., Gonda, T.J., Alexander, W.S., Metcalf, D., Nicola, N.A., and Hilton, D.J. 1997. A family of cytokine-inducible inhibitors of signalling. Nature 387(6636): 917-921. Steger, D.J. and Workman, J.L. 1996. Remodeling chromatin structures for transcription: what happens to the histones? Bioessays 18(11): 875-884. Steimle, V., Durand, B., Barras, E., Zufferey, M., Hadam, M.R., Mach, B., and Reith, W. 1995. A novel DNA binding regulatory factor is mutated in primary MHC class II deficiency (Bare Lymphocyte Syndrome). Genes & Dev 9: 1021-1032. Steimle, V. and Mach, B. 1995. Complementation cloning of mammalian transcriptional regulators: the example of MHC class II gene regulators. CurrOpinGenetDev 5(5): 646-651. Steimle, V., Otten, L.A., Zufferey, M., and Mach, B. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency. Cell 75: 135-146. Steimle, V., Siegrist, C.-A., Mottet, A., Lisowska-Grospierre, B., and Mach, B. 1994. Regulation of MHC class II expression by Interferon-gamma mediated by the transactivator gene CIITA. Science 265: 106-109. Steinman, R.M., Pack, M., and Inaba, K. 1997. Dendritic cells in the T-cell areas of lymphoid organs. Immunol Rev 156: 25-37. Stern, L.J., Brown, J.H., Jardetzky, T.S., Gorga, J.C., Urban, R.G., Strominger, J.L., and Wiley, D.C. 1994. Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus peptide. Nature 368: 215-221. Strahl, B.D. and Allis, C.D. 2000. The language of covalent histone modifications. Nature 403(6765): 41-45. Straka, C. and Horz, W. 1991. A functional role for nucleosomes in the repression of a yeast promoter. EMBO J 10(2): 361-368. Stremlau, M., Owens, C.M., Perron, M.J., Kiessling, M., Autissier, P., and Sodroski, J. 2004. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 427(6977): 848- 853. Sullivan, K.E. and Peterlin, B.M. 1987. Transcriptional enhancers in the HLA-DQ subregion. MolCellBiol 7: 3315-3319. Suter, T., Malipiero, U., Otten, L., Ludewig, B., Muelethaler-Mottet, A., Mach, B., Reith, W., and Fontana, A. 2000. Dendritic cells and differential usage of the MHC class II transactivator promoters in the central nervous system in experimental autoimmune encephalitis. EurJImmunol 30(3): 794-802. Takahama, Y. 2006. Journey through the thymus: stromal guides for T-cell development and selection. Nat Rev Immunol 6(2): 127-135.
157 Taxman, D.J., Cressman, D.E., and Ting, J.P. 2000. Identification of class II transcriptional activator-induced genes by representational difference analysis: discoordinate regulation of the DN alpha/DO beta heterodimer. JImmunol 165(3): 1410-1416. Taylor, I.C., Workman, J.L., Schuetz, T.J., and Kingston, R.E. 1991. Facilitated binding of GAL4 and heat shock factor to nucleosomal templates: differential function of DNA-binding domains. Genes Dev 5(7): 1285- 1298. Ting, J.P. and Baldwin, A.S. 1993. Regulation of MHC gene expression. CurrOpinImmunol 5: 8-16. Ting, J.P. and Trowsdale, J. 2002. Genetic control of MHC class II expression. Cell 109 Suppl: S21-33. Trombetta, E.S. and Mellman, I. 2005. Cell biology of antigen processing in vitro and in vivo. Annu Rev Immunol 23: 975-1028. Trowsdale, J. 1993. Genomic structure and function in the MHC. Trends Genet 9: 117-122. Tsang, S.Y., Nakanishi, M., and Peterlin, B.M. 1990. Mutational analysis of the DRA promoter: cis-acting sequences and trans-acting factors. MolCell Biol 10: 711-719. Turner, B.M. 2000. Histone acetylation and an epigenetic code. Bioessays 22(9): 836-845. Vakoc, C.R., Mandat, S.A., Olenchock, B.A., and Blobel, G.A. 2005. Histone H3 lysine 9 methylation and HP1gamma are associated with transcription elongation through mammalian chromatin. Mol Cell 19(3): 381-391. Valouev, A., Ichikawa, J., Tonthat, T., Stuart, J., Ranade, S., Peckham, H., Zeng, K., Malek, J.A., Costa, G., McKernan, K., Sidow, A., Fire, A., and Johnson, S.M. 2008. A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning. Genome Res 18(7): 1051- 1063. van den Elsen, P.J., Peijnenburg, A., van Eggermond, M.C., and Gobin, S.J. 1998. Shared regulatory elements in the promoters of MHC class I and class II genes. ImmunolToday 19(7): 308-312. Vicent, G.P., Nacht, A.S., Smith, C.L., Peterson, C.L., Dimitrov, S., and Beato, M. 2004. DNA instructed displacement of histones H2A and H2B at an inducible promoter. Mol Cell 16(3): 439-452. Vilen, B.J., Cogswell, J.P., and Ting, J.P. 1991. Stereospecific alignment of the X and Y elements is required for major histocompatibility complex class II DRA promoter function. Mol Cell Biol 11(5): 2406-2415. Vilen, B.J., Penta, J.F., and Ting, J.P. 1992. Structural constraints within a trimeric transcriptional regulatory region. Constitutive and interferon-gamma-inducible expression of the HLA-DRA gene. J Biol Chem 267(33): 23728-23734. Villadangos, J.A. 2001. Presentation of antigens by MHC class II molecules: getting the most out of them. Mol Immunol 38(5): 329-346. Villard, J., Lisowska-Grospierre, B., Van den Elsen, P., Fischer, A., Reith, W., and Mach, B. 1997. Mutation of RFXAP, a regulator of MHC class II genes, in primary MHC class II deficiency. NEnglJMed 337(11): 748-753. Villard, J., Peretti, M., Masternak, K., Barras, E., Caretti, G., Mantovani, R., and Reith, W. 2000. A functionally essential domain of RFX5 mediates activation of major histocompatibility complex class II promoters by promoting cooperative binding between RFX and NF-Y. MolCell Biol 20(10): 3364-3376. Viret, C. and Janeway, C.A.J. 1999. MHC and T cell development. Reviews in Immunogenetics 1: 91-104. Viville, S., Jongeneel, V., Koch, W., Mantovani, R., Benoist, C., and Mathis, D. 1991. The E alpha promoter: a linker-scanning analysis. JImmunol 146: 3211-3217. Viville, S., Neefjes, J., Lotteau, V., Dierich, A., Lemeur, M., Ploegh, H., Benoist, C., and Mathis, D. 1993. Mice lacking the MHC class II-associated invariant chain. Cell 72(4): 635-648. von Boehmer, H. 1994. Positive selection of lymphocytes. Cell 76: 219-228. Wade, P.A., Pruss, D., and Wolffe, A.P. 1997. Histone acetylation: chromatin in action. Trends Biochem Sci 22(4): 128-132.
158 Waldburger, J.M., Rossi, S., Hollander, G.A., Rodewald, H.R., Reith, W., and Acha-Orbea, H. 2003. Promoter IV of the class II transactivator gene is essential for positive selection of CD4+ T cells. Blood 101(9): 3550-3559. Waldburger, J.M., Suter, T., Fontana, A., Acha-Orbea, H., and Reith, W. 2001. Selective abrogation of major histocompatibility complex class II expression on extrahematopoietic cells in mice lacking promoter IV of the class II transactivator gene. JExpMed 194(4): 393-406. Wang, Y., Larsen, A.S., and Peterlin, B.M. 1987. A tissue-specific transcriptional enhancer is found in the body of the HLA-DR alpha gene. J ExpMed 166: 625-636. Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Peng, W., Zhang, M.Q., and Zhao, K. 2008. Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40(7): 897-903. Watts, C. 2001. Antigen processing in the endocytic compartment. Curr Opin Immunol 13(1): 26-31. -. 2004. The exogenous pathway for antigen presentation on major histocompatibility complex class II and CD1 molecules. Nat Immunol 5(7): 685-692. Westerheide, S.D., Louis-Plence, P., Ping, D., He, X.F., and Boss, J.M. 1997. HLA-DMA and HLA-DMB gene expression functions through the conserved S-X- Y region. JImmunol 158: 4812-4821. Whittle, C.M., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb, J.D. 2008. The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis. PLoS Genet 4(9): e1000187. Wirbelauer, C., Bell, O., and Schubeler, D. 2005. Variant histone H3.3 is deposited at sites of nucleosomal displacement throughout transcribed genes while active histone modifications show a promoter- proximal bias. Genes Dev 19(15): 1761-1766. Wolf, P.R. and Ploegh, H.L. 1995. How MHC class II molecules acquire peptide cargo: biosynthesis and trafficking through the endocytic pathway. AnnuRevCellDevBiol 11: 267-306. Wong, A.W., Brickey, W.J., Taxman, D.J., van Deventer, H.W., Reed, W., Gao, J.X., Zheng, P., Liu, Y., Li, P., Blum, J.S., McKinnon, K.P., and Ting, J.P. 2003. CIITA-regulated plexin-A1 affects T-cell-dendritic cell interactions. Nat Immunol 4(9): 891-898. Wong, A.W., Ghosh, N., McKinnon, K.P., Reed, W., Piskurich, J.F., Wright, K.L., and Ting, J.P. 2002. Regulation and specificity of MHC2TA promoter usage in human primary T lymphocytes and cell line. J Immunol 169(6): 3112-3119. Woo, J.S., Imm, J.H., Min, C.K., Kim, K.J., Cha, S.S., and Oh, B.H. 2006a. Structural and functional insights into the B30.2/SPRY domain. EMBO J 25(6): 1353-1363. Woo, J.S., Suh, H.Y., Park, S.Y., and Oh, B.H. 2006b. Structural basis for protein recognition by B30.2/SPRY domains. Mol Cell 24(6): 967-976. Workman, J.L. 2006. Nucleosome displacement in transcription. Genes Dev 20(15): 2009-2017. Workman, J.L. and Kingston, R.E. 1992. Nucleosome core displacement in vitro via a metastable transcription factor-nucleosome complex. Science 258(5089): 1780-1784. Wraith, D.C., McDevitt, H.O., Steinman, L., and Acha-Orbea, H. 1989. T cell recognition as the target for immune intervention in autoimmune disease. Cell 57: 709-715. Wright, K.L., Moore, T.L., Vilen, B.J., Brown, A.M., and Ting, J.P. 1995. Major histocompatibility complex class II-associated invariant chain gene expression is up-regulated by cooperative interactions of Sp1 and NF-Y. JBiolChem 270(36): 20978-20986. Wright, K.L. and Ting, J.P. 1992. In vivo footprint analysis of the HLA-DRA gene promoter: cell- specific interaction at the octamer site and up-regulation of X box binding by interferon gamma. ProcNatlAcadSciUSA 89: 7601-7605. Wysocka, J., Allis, C.D., and Coonrod, S. 2006. Histone arginine methylation and its dynamic regulation. Front Biosci 11: 344-355.
159 Xu, Y., Wang, L., Buttice, G., Sengupta, P.K., and Smith, B.D. 2004. Major histocompatibility class II transactivator (CIITA) mediates repression of collagen (COL1A2) transcription by interferon gamma (IFN-gamma). J Biol Chem 279(40): 41319-41332. Yee, C.S., Yao, Y., Li, P., Klemsz, M.J., Blum, J.S., and Chang, C.H. 2004. Cathepsin E: a novel target for regulation by class II transactivator. J Immunol 172(9): 5528-5534. Yee, C.S., Yao, Y., Xu, Q., McCarthy, B., Sun-Lin, D., Tone, M., Waldmann, H., and Chang, C.H. 2005. Enhanced production of IL-10 by dendritic cells deficient in CIITA. Journal of Immunology 174(3): 1222-1229. Yu, L. and Morse, R.H. 1999. Chromatin opening and transactivator potentiation by RAP1 in Saccharomyces cerevisiae. Mol Cell Biol 19(8): 5279-5288. Yuan, G.C. and Liu, J.S. 2008. Genomic sequence is highly predictive of local nucleosome depletion. PLoS Comput Biol 4(1): e13. Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando, O.J. 2005. Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309(5734): 626-630. Zanton, S.J. and Pugh, B.F. 2006. Full and partial genome-wide assembly and disassembly of the yeast transcription machinery in response to heat shock. Genes Dev 20(16): 2250-2265. Zeleznik Le, N.J., Itoh Lindstrom, Y., Clarke, J.B., Moore, T.L., and Ting, J.P. 1992. The B cell-specific nuclear factor OTF-2 positively regulates transcription of the human class II transplantation gene, DRA. JBiolChem 267: 7677-7682. Zhang, H., Roberts, D.N., and Cairns, B.R. 2005. Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123(2): 219-231. Zhao, J., Herrera-Diaz, J., and Gross, D.S. 2005. Domain-wide displacement of histones by activated heat shock factor occurs independently of Swi/Snf and is not correlated with RNA polymerase II density. Mol Cell Biol 25(20): 8985-8999. Zhou, H. and Glimcher, L.H. 1995. Human MHC class II gene transcription directed by the carboxyl terminus of CIITA, one of the defective genes in type II MHC combined immune deficiency. Immunity 2: 545-553. Zhu, L. and Jones, P.P. 1990. Transcriptional control of the invariant chain gene involves promoter and enhancer elements common to and distinct from major histocompatibility complex class II genes. MolCellBiol 10: 3906-3916. Zhu, X.S., Linhoff, M.W., Li, G., Chin, K.C., Maity, S.N., and Ting, J.P. 2000. Transcriptional scaffold: CIITA interacts with NF-Y, RFX, and CREB To cause stereospecific regulation of the class II major histocompatibility complex promoter. MolCellBiol 20(16): 6051-6061. Zhu, X.S. and Ting, J.P. 2001. A 36-Amino-Acid Region of CIITA Is an Effective Inhibitor of CBP: Novel Mechanism of Gamma Interferon-Mediated Suppression of Collagen alpha(2)(I) and Other Promoters. MolCell Biol 21(20): 7078-7088. Zika, E., Fauquier, L., Vandel, L., and Ting, J.P. 2005. Interplay among coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-gamma-inducible MHC-II gene expression. Proc Natl Acad Sci U S A 102(45): 16321-16326. Zika, E. and Ting, J.P. 2005. Epigenetic control of MHC-II: interplay between CIITA and histone-modifying enzymes. Curr Opin Immunol 17(1): 58-64. Zlatanova, J. and Thakar, A. 2008. H2A.Z: view from the top. Structure 16(2): 166-179.
160