DOCSLIB.ORG

Three New Species of the Genus Actinobispora of the Family Pseudonocardiaceae, Actinobispora Alaniniphila Sp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Three New Species of the Genus Actinobispora of the Family Pseudonocardiaceae, Actinobispora Alaniniphila Sp International Journal of Systematic Bacteriology (1 999),49,88 1-886 Printed in Great Britain Three new species of the genus Actinobispora of the family Pseudonocardiaceae, Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov. and Actinobispora xinjiangensis sp. nov. Li-Hua Xu,’ Xiang Jin12Pei-Hong Mae,' Zheng-Fu Lu,’ Xiao-Long Cuil and Cheng-Lin Jiangl Author for correspondence: Cheng-Lin Jiang. Tel: +86 871 5033790. Fax: +86 871 5173878. 1 Yunnan Institute of The genus Actinobispora Jiang et al. is characterized by the formation of Microbiology, Yunnan longitudinally paired spores on both the vegetative and the aerial mycelium, Un ive rsity, 65009 1 Kunming, Yunnan, China absence of mycolic acid, cell wall chemotype IV (containing meso- diaminopimelic acid as the diamino acid, galactose and arabinose), PVI and 2 Institute of Microbiology, Xinjiang Academy of MK-g(H2). Comparative studies of morphology, chemical classification and Agricultural Sciences, phylogenetic analysis based on the 165 rRNA sequences among the four type 83000 Wulumuqi, Xinjiang, strains of the genus Actinobispora and type strains of related genera were China carried out. The results indicated that the genus Actinobispora is different from these other genera and should be placed in the family Pseudonocardiaceae Embley et a/. 1988 with the genera Amycolatopsis, Pseudonocardia, Saccharomonospora, Saccharopolyspora and A ctinopolyspora. On the bases of these results, three new species under the names of Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov. and Actinobispora xinjiangensis sp. nov. are proposed; the type strains are CCTCC AA970OlT, CCTCC AA97002l and CCTCC AA97020T. Keywords: Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov., Actinobispora xinjiangensis sp. nov., 16s rRNA INTRODUCTION with Kibdelosporangium, Amycolatopsis, Pseudono- cardia, Saccharomonospora, Saccharopolyspora, The description of the genus Actinobispora has been Micropolyspora and Actinopolyspora (Jiang et al., published previously by Jiang et al. (1991). It is 1995; Miyadoh, 1997). The results of chemotaxonomic characterized by the formation of longitudinally paired and phylogenetic analysis of some related genera with spores on both the vegetative and the aerial mycelium, wall chemotype IV and absence of mycolic acid, such absence of mycolic acid and having cell wall chemotype as Saccharothrix, Amycolata, Kibdelosporangium, IV. More recently, many other members of the genus Actinokineospora, Pseudonocardia, Saccharomono- have been isolated (Hu et al., 1994; Suzuki et al., 1998) spora and Amycolatopsis have been reported (Bowen et from soil samples collected from 2 1 Provinces of China al., 1989; Embley et al., 1988a, b; Henssen et al., 1987; and other countries such as India, Japan, Austria, Kothe et al., 1989; Takeuchi et al., 1992; Warwick et France, USA, thus indicating that members of this al., 1994; Yassin et al., 1993). Ochi (1995) reported the genus are widely distributed. The genus Actinobispora results of amino acid sequence analysis of ribosomal was included in the group of Micropolyspora together protein AT-L30 of members of the family Pseudono- cardiaceae. Warwick et al. (1994) reported the phylo- genetic analysis of the family Pseudonocardiaceae and Abbreviations: DPG, diphosphatidylglycerol; GluNu, unknown glucos- the genera Actinokineospora and Saccharothrix. These amine-containing phospholipid; PC, phosphatidylcholine; PE, phospha- tidylethanolamine; PG, phosphatidylglycerol; PI, phosphatidylinositol; authors indicated that Amycolatopsis, Saccharomono- PME, phosphatidylmethylethanolamine. spora, Pseudonocardia, Amycolata, Saccharopolyspora The GenBank accession numbers for the sequences reported in this paper and Kibdelosporangium should be placed in the family are AF056706, AF056707, AF056708 and AF056709. Pseudonocardiaceae. In the present study, the phylo- 0079201999 IUMS 881 L.-H. Xu and others genetic relationships among the genus Actinobispora samples collected from more than ten areas of Yunnan and and related genera are analysed, and three new species Xinjiang, People's Republic of China. Plates were incubated of the genus Actinobispora are described based on at 28 "C for 21-28 d. The strains used in this study are listed phenetic markers, chemotaxonomy and 16s rDNA in Table 1. sequences. Morphology. The media used for micromorphological studies were yeast extract-malt extract agar (ISP 2) and oatmeal agar (ISP 3) (Shirling & Gottlieb, 1966). The time of METHODS incubation was 14-21 d at 28 "C. Morphological obser- Actinomycete strains. Many strains of the genus Actino- vations of spores were made with a light microscope and a bispora were isolated with AV agar (Ochi, 1995; Nonomura model EPMA-8705 electron microscope. & Ohara, 1971) and HV agar (Hayakawa, 1990) from soil Cultural, physiological and biochemical tests. The media and Table 1. List of strains used in this study Species Strain GenBank no. Actinobispora yunnanensis Y-11981T(= CCTCC M90959T) AFO 56706 Actinobispora yunnanensis Y-7105 Actinobispora yunnanensis Y-7126 Actinobispora yunnanensis Y- 16279 Actinobispora yunnanensis Y-15151 Actinobispora yunnanensis Y - 16227 Actinobispora sp. Y-14385 Act in0bispora alaniniphila Y-16303T(= CCTCC AA97001T) AF056708 Actinobispora aurantiuca Y- 14860T (= CCTCC AA97002T) AF056707 Act in0bispo ra xinjiangensis XJ-45T (= CCTCC AA97020T) AF056709 Strep tomy ces gr iseus KCTC 9080 X6 1478 Streptomyces lavendulae ISP 5069 X53 173 Streptomyces olivoreticuli DPDU 0278 X53 166 Streptomyces hygroscopicus ATCC 14607 U72 167 Streptomyces albus DSM 403 13 X53 163 Streptomyces coelicolor ATCC null M35377 Streptomyces thermoviolaceus DSM 40443 268096 Streptomyces thermocarboxydovorans DSM 44296 U94489 Streptomyces thermocarboxydus DSM 44293 U94490 Strep to verticillium ladakanum DSM 40587 X53 167 Nocardioides albus DSM 43 109 X53211 Act inoplanes p h ilippinensis IF0 13878 D85474 Micromonospora chalcea DSM 43026 X92594 Dactylosporangium aurantiacum IF0 12592 D85480 Actinomadura madurae JCM 7436 D50668 Microbispora amethystogenes JCM 3021 U48988 Micro b ispora ch r omogenes IF0 14876 U48989 Microbispora thermorosea ATCC 27099 U48987 Microtetraspora glauca IF0 14761 D85490 Saccharothrix australiensis ATCC 31947 X53 193 Ku tzner ia vir idogrisea JCM 3282 U58530 Nocardia asteroides DSM 43005 X53205 Nocardia seriolae ATCC 43993T X80592 Nocardia otitidiscaviarum ATCC 14629 M59056 Tsukamurella inchonensis IMMIB D-771 X85955 Pseudonocardia thermophila ATCC 19285 X53 195 Saccharomonosporu viridis ATCC 15386 X54286 . Saccharomonospora caesia ' INMI 19125 X76960 Saccharopolyspora hirsuta ATCC 27875 X53 196 Promicromonospora enterophila DSM 43852 X83807 Thermoactinomyces candidus NCIMB 11249 M77490 Thermoactinomyces vulgaris NCIMB 11364 M7749 1 Thermoactinomyces dichotomicus NCIMB 10211T L 16902 Escherichia coli 501859 882 International Journal of Systematic Bacteriology 49 Three new Actinobispora species procedures used for the study of the cultural and physio- strains contained phosphatidylmethylethanolamine logical characteristics of the strains were those described by (PME). Strain Y-1198 lT contained diphosphatidyl- Shirling & Gottlieb (1966) and Locci (1989). Colour deter- glycerol (DPG). Strain XJ-45T contained phospha- minations were made by comparing the cultures with colour tidylinositol (PI). The major menaquinones are MK- chips from the ISCC-NBS colour charts Standard Samples No. 2106 (Kelly, 1964). 9(H2)and MK-7(H2).Some strains contained traces of MK-9(H4) and MK-7(H4) (Table 3). Chemical analyses. The test strains were grown in yeast extract-malt extract broth at 28 “C to the late exponential growth phase. The cells were harvested by centrifugation at Sequence comparisons and phylogenetic analysis 4000 g for 10 min and were washed with distilled water. Cell walls were purified and analysed by the method of Almost the complete 16s rRNA sequences [ 1460-1468 Lechevalier & Lechevalier (1 980). The procedures of Becker nucleotides between Escherichia coli positions 37 and et al. (1964) and Lechevalier & Lechevalier (1980) were used 1516 (Brosius et al., 1978)] for the four strains of the for whole-cell analysis. The phospholipid analysis was genus Actinobispora were determined. These sequences carried out using the method of Lechevalier et al. (1981). were compared with the corresponding sequences from Mycolic acids were determined by the methods of the representative reference strains with cell wall type Lechevalier & Lechevalier (1 980). Menaquinones were I-IV of the other genera of the order Actinomycetales. determined using the procedures of Collins (1985). The results showed that Actinobispora yunnanensis and 165 rDNA gene sequencing. The 16s rRNA gene was the other three strains were clearly clustered into a amplified by PCR (Saiki et al., 1988) using Taq DNA group. The evolutionary distances among the four polymerase (Sino-American Biotechnology), primer A 7-26 strains were 0.025-0.045. Fig. 1 shows a neighbour- (5’ CCGTCGACGAGCTCAGAGTTTGATC- joining phylogenetic tree constructed on the basis of CTGGCTCAG 3’)? and primer B 1523-1504r (5’ CCCGG- GTACCAAGCTTAAGGAGGTGATCCAGCCGCA 3’). the evolutionary distances calculated by using the 15 16 The 1.5 kb amplified 16s rDNA fragment was purified by positions that could be aligned. agarose gel electrophoresis. The purified fragments were According to Embley et al. (1988b), the family Pseudo- directly sequenced by using a FS-DNA sequencing kit nocardiaceae
Load more

Recommended publications
  • Successful Drug Discovery Informed by Actinobacterial Systematics
    Successful Drug Discovery Informed by Actinobacterial Systematics Verrucosispora HPLC-DAD analysis of culture filtrate Structures of Abyssomicins Biological activity T DAD1, 7.382 (196 mAU,Up2) of 002-0101.D V. maris AB-18-032 mAU CH3 CH3 T extract H3C H3C Antibacterial activity (MIC): S. leeuwenhoekii C34 maris AB-18-032 175 mAU DAD1 A, Sig=210,10 150 C DAD1 B, Sig=230,10 O O DAD1 C, Sig=260,20 125 7 7 500 Rt 7.4 min DAD1 D, Sig=280,20 O O O O Growth inhibition of Gram-positive bacteria DAD1 , Sig=310,20 100 Abyssomicins DAD1 F, Sig=360,40 C 75 DAD1 G, Sig=435,40 Staphylococcus aureus (MRSA) 4 µg/ml DAD1 H, Sig=500,40 50 400 O O 25 O O Staphylococcus aureus (iVRSA) 13 µg/ml 0 CH CH3 300 400 500 nm 3 DAD1, 7.446 (300 mAU,Dn1) of 002-0101.D 300 mAU Mode of action: C HO atrop-C HO 250 atrop-C CH3 CH3 CH3 CH3 200 H C H C H C inhibitior of pABA biosynthesis 200 Rt 7.5 min H3C 3 3 3 Proximicin A Proximicin 150 HO O HO O O O O O O O O O A 100 O covalent binding to Cys263 of PabB 100 N 50 O O HO O O Sea of Japan B O O N O O (4-amino-4-deoxychorismate synthase) by 0 CH CH3 CH3 CH3 3 300 400 500 nm HO HO HO HO Michael addition -289 m 0 B D G H 2 4 6 8 10 12 14 16 min Newcastle Michael Goodfellow, School of Biology, University Newcastle University, Newcastle upon Tyne Atacama Desert In This Talk I will Consider: • Actinobacteria as a key group in the search for new therapeutic drugs.
    [Show full text]
  • Genomic and Phylogenomic Insights Into the Family Streptomycetaceae Lead
    1 Supplementary Material 2 Genomic and phylogenomic insights into the family Streptomycetaceae lead 3 to proposal of Charcoactinosporaceae fam. nov. and 8 novel genera with 4 emended descriptions of Streptomyces calvus 5 Munusamy Madhaiyan1, †, *, Venkatakrishnan Sivaraj Saravanan2, †, Wah-Seng See-Too3, † 6 1Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, 7 Singapore 117604; 2Department of Microbiology, Indira Gandhi College of Arts and Science, 8 Kathirkamam 605009, Pondicherry, India; 3Division of Genetics and Molecular Biology, 9 Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, 10 Malaysia 1 11 Table S3. List of the core genes in the genome used for phylogenomic analysis. NCBI Protein Accession Gene WP_074993204.1 NUDIX hydrolase WP_070028582.1 YggS family pyridoxal phosphate-dependent enzyme WP_074992763.1 ParB/RepB/Spo0J family partition protein WP_070022023.1 lipoyl(octanoyl) transferase LipB WP_070025151.1 FABP family protein WP_070027039.1 heat-inducible transcriptional repressor HrcA WP_074992865.1 folate-binding protein YgfZ WP_074992658.1 recombination protein RecR WP_074991826.1 HIT domain-containing protein WP_070024163.1 adenylosuccinate synthase WP_009190566.1 anti-sigma regulatory factor WP_071828679.1 preprotein translocase subunit SecG WP_070026304.1 50S ribosomal protein L13 WP_009190144.1 30S ribosomal protein S5 WP_014674378.1 30S ribosomal protein S8 WP_070026314.1 50S ribosomal protein L5 WP_009300593.1 30S ribosomal protein S13 WP_003998809.1
    [Show full text]
  • Pseudonocardia Parietis Sp. Nov., from the Indoor Environment
    This is an author manuscript that has been accepted for publication in International Journal of Systematic and Evolutionary Microbiology, copyright Society for General Microbiology, but has not been copy-edited, formatted or proofed. Cite this article as appearing in International Journal of Systematic and Evolutionary Microbiology. This version of the manuscript may not be duplicated or reproduced, other than for personal use or within the rule of ‘Fair Use of Copyrighted Materials’ (section 17, Title 17, US Code), without permission from the copyright owner, Society for General Microbiology. The Society for General Microbiology disclaims any responsibility or liability for errors or omissions in this version of the manuscript or in any version derived from it by any other parties. The final copy-edited, published article, which is the version of record, can be found at http://ijs.sgmjournals.org, and is freely available without a subscription 24 months after publication. First published in: Int J Syst Evol Microbiol, 2009. 59(10) 2449-52. doi:10.1099/ijs.0.009993-0 Pseudonocardia parietis sp. nov., from the indoor environment J. Scha¨fer,1 H.-J. Busse2 and P. Ka¨mpfer1 Correspondence 1Institut fu¨r Angewandte Mikrobiologie, Justus-Liebig-Universita¨t Giessen, D-35392 Giessen, P. Ka¨mpfer Germany [email protected] 2Institut fu¨r Bakteriologie, Mykologie und Hygiene, Veterina¨rmedizinische Universita¨t, A-1210 Wien, giessen.de Austria A Gram-positive, rod-shaped, non-endospore-forming, mycelium-forming actinobacterium (04- St-002T) was isolated from the wall of an indoor environment colonized with moulds. On the basis of 16S rRNA gene sequence similarity studies, strain 04-St-002T was shown to belong to the family Pseudonocardiaceae, and to be most closely related to Pseudonocardia antarctica (99.2 %) and Pseudonocardia alni (99.1 %).
    [Show full text]
  • Transition from Unclassified Ktedonobacterales to Actinobacteria During Amorphous Silica Precipitation in a Quartzite Cave Envir
    www.nature.com/scientificreports OPEN Transition from unclassifed Ktedonobacterales to Actinobacteria during amorphous silica precipitation in a quartzite cave environment D. Ghezzi1,2, F. Sauro3,4,5, A. Columbu3, C. Carbone6, P.‑Y. Hong7, F. Vergara4,5, J. De Waele3 & M. Cappelletti1* The orthoquartzite Imawarì Yeuta cave hosts exceptional silica speleothems and represents a unique model system to study the geomicrobiology associated to silica amorphization processes under aphotic and stable physical–chemical conditions. In this study, three consecutive evolution steps in the formation of a peculiar blackish coralloid silica speleothem were studied using a combination of morphological, mineralogical/elemental and microbiological analyses. Microbial communities were characterized using Illumina sequencing of 16S rRNA gene and clone library analysis of carbon monoxide dehydrogenase (coxL) and hydrogenase (hypD) genes involved in atmospheric trace gases utilization. The frst stage of the silica amorphization process was dominated by members of a still undescribed microbial lineage belonging to the Ktedonobacterales order, probably involved in the pioneering colonization of quartzitic environments. Actinobacteria of the Pseudonocardiaceae and Acidothermaceae families dominated the intermediate amorphous silica speleothem and the fnal coralloid silica speleothem, respectively. The atmospheric trace gases oxidizers mostly corresponded to the main bacterial taxa present in each speleothem stage. These results provide novel understanding of the microbial community structure accompanying amorphization processes and of coxL and hypD gene expression possibly driving atmospheric trace gases metabolism in dark oligotrophic caves. Silicon is one of the most abundant elements in the Earth’s crust and can be broadly found in the form of silicates, aluminosilicates and silicon dioxide (e.g., quartz, amorphous silica).
    [Show full text]
  • Marine Rare Actinomycetes: a Promising Source of Structurally Diverse and Unique Novel Natural Products
    Review Marine Rare Actinomycetes: A Promising Source of Structurally Diverse and Unique Novel Natural Products Ramesh Subramani 1 and Detmer Sipkema 2,* 1 School of Biological and Chemical Sciences, Faculty of Science, Technology & Environment, The University of the South Pacific, Laucala Campus, Private Mail Bag, Suva, Republic of Fiji; [email protected] 2 Laboratory of Microbiology, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen, The Netherlands * Correspondence: [email protected]; Tel.: +31-317-483113 Received: 7 March 2019; Accepted: 23 April 2019; Published: 26 April 2019 Abstract: Rare actinomycetes are prolific in the marine environment; however, knowledge about their diversity, distribution and biochemistry is limited. Marine rare actinomycetes represent a rather untapped source of chemically diverse secondary metabolites and novel bioactive compounds. In this review, we aim to summarize the present knowledge on the isolation, diversity, distribution and natural product discovery of marine rare actinomycetes reported from mid-2013 to 2017. A total of 97 new species, representing 9 novel genera and belonging to 27 families of marine rare actinomycetes have been reported, with the highest numbers of novel isolates from the families Pseudonocardiaceae, Demequinaceae, Micromonosporaceae and Nocardioidaceae. Additionally, this study reviewed 167 new bioactive compounds produced by 58 different rare actinomycete species representing 24 genera. Most of the compounds produced by the marine rare actinomycetes present antibacterial, antifungal, antiparasitic, anticancer or antimalarial activities. The highest numbers of natural products were derived from the genera Nocardiopsis, Micromonospora, Salinispora and Pseudonocardia. Members of the genus Micromonospora were revealed to be the richest source of chemically diverse and unique bioactive natural products.
    [Show full text]
  • 1 Supplementary Material a Major Clade of Prokaryotes with Ancient
    Supplementary Material A major clade of prokaryotes with ancient adaptations to life on land Fabia U. Battistuzzi and S. Blair Hedges Data assembly and phylogenetic analyses Protein data set: Amino acid sequences of 25 protein-coding genes (“proteins”) were concatenated in an alignment of 18,586 amino acid sites and 283 species. These proteins included: 15 ribosomal proteins (RPL1, 2, 3, 5, 6, 11, 13, 16; RPS2, 3, 4, 5, 7, 9, 11), four genes (RNA polymerase alpha, beta, and gamma subunits, Transcription antitermination factor NusG) from the functional category of Transcription, three proteins (Elongation factor G, Elongation factor Tu, Translation initiation factor IF2) of the Translation, Ribosomal Structure and Biogenesis functional category, one protein (DNA polymerase III, beta subunit) of the DNA Replication, Recombination and repair category, one protein (Preprotein translocase SecY) of the Cell Motility and Secretion category, and one protein (O-sialoglycoprotein endopeptidase) of the Posttranslational Modification, Protein Turnover, Chaperones category, as annotated in the Cluster of Orthologous Groups (COG) (Tatusov et al. 2001). After removal of multiple strains of the same species, GBlocks 0.91b (Castresana 2000) was applied to each protein in the concatenation to delete poorly aligned sites (i.e., sites with gaps in more than 50% of the species and conserved in less than 50% of the species) with the following parameters: minimum number of sequences for a conserved position: 110, minimum number of sequences for a flank position: 110, maximum number of contiguous non-conserved positions: 32000, allowed gap positions: with half. The signal-to-noise ratio was determined by altering the “minimum length of a block” parameter.
    [Show full text]
  • Complete Genome Sequence of Jiangella Gansuensis Strain YIM 002T (DSM 44835T), the Type Species of the Genus Jiangella and Source of New Antibiotic Compounds
    UC Davis UC Davis Previously Published Works Title Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds. Permalink https://escholarship.org/uc/item/34s6p01n Journal Standards in genomic sciences, 12(1) ISSN 1944-3277 Authors Jiao, Jian-Yu Carro, Lorena Liu, Lan et al. Publication Date 2017 DOI 10.1186/s40793-017-0226-6 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Jiao et al. Standards in Genomic Sciences (2017) 12:21 DOI 10.1186/s40793-017-0226-6 SHORTGENOMEREPORT Open Access Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds Jian-Yu Jiao1, Lorena Carro2, Lan Liu1, Xiao-Yang Gao3, Xiao-Tong Zhang1, Wael N. Hozzein4,12, Alla Lapidus5,6, Marcel Huntemann7, T. B. K. Reddy7, Neha Varghese7, Michalis Hadjithomas7, Natalia N. Ivanova7, Markus Göker8, Manoj Pillay9, Jonathan A. Eisen10, Tanja Woyke7, Hans-Peter Klenk2,8*, Nikos C. Kyrpides7,11 and Wen-Jun Li1,13* Abstract Jiangella gansuensis strain YIM 002T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon.
    [Show full text]
  • Pseudonocardia Asaccharolytica Sp. Nov. and Pseudonocardia Sulfidoxydans Sp
    International Journal of Systematic Bacteriology (1998), 48, 441-449 Printed in Great Britain Pseudonocardia asaccharolytica sp. nov. and Pseudonocardia sulfidoxydans sp. nov., two new dimethyl disulf ide-degrading actinomycetes and emended description of the genus Pseudonocardia Katrin Reichert,’ Andre Lipski,’ Silke Pradella,2 Erko Stackebrandt2 and Karlheinz Altendorf’ Author for correspondence: Andre Lipski. Fax: +49 541 969 2870. e-mail : Lipski@sfbbiol .biologie.uni-osnabrueck.de 1 Abteilung Mikrobiologie, Seven bacterial strains capable of oxidizing methyl sulfides were isolated from Universitat Osnabruck, experimental biofilters filled with tree-bark compost. The isolates could be Fachbereich BiologieKhemie, D-49069 divided into two groups according to their method of methyl sulfide Osnabruck, Germany degradation. Four isolates could use only dimethyl disulfide as the sole source * Deutsche Sammlung von of energy and three strains were able to use dimethyl sulfide and dimethyl Mikroorganismen und disulfide. Oxidation of the methyl sulfides by both groups led to the Zellkulturen GmbH, stoichiometric formation of sulfate. Chemotaxonomic, morphological, Mascheroder Weg 1b, D-38124 Braunschweig, physiological and phylogenetic properties identified all isolates as members of Germany the genus Pseudonocardia. The absence of phosphatidylcholine from the polar lipid pattern, as well as results of 16s rDNA analyses, led to the proposal of two new species, Pseudonocadia asaccharolytica sp. nov. and Pseudonocardia sulfidoxydans sp. nov.
    [Show full text]
  • Microbiome and Metagenome Analysis Reveals Huanglongbing Affects the Abundance of Citrus Rhizosphere Bacteria Associated with Resistance and Energy Metabolism
    horticulturae Article Microbiome and Metagenome Analysis Reveals Huanglongbing Affects the Abundance of Citrus Rhizosphere Bacteria Associated with Resistance and Energy Metabolism Hongfei Li 1, Fang Song 1 , Xiaoxiao Wu 2, Chongling Deng 2, Qiang Xu 1 , Shu’ang Peng 1 and Zhiyong Pan 1,* 1 Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, China; [email protected] (H.L.); [email protected] (F.S.); [email protected] (Q.X.); [email protected] (S.P.) 2 Guangxi Academy of Specialty Crops/Guangxi Citrus Breeding and Cultivation Research Center of Engineering Technology, Guilin 541004, China; [email protected] (X.W.); [email protected] (C.D.) * Correspondence: [email protected] Abstract: The plant rhizosphere microbiome is known to play a vital role in plant health by com- peting with pathogens or inducing plant resistance. This study aims to investigate rhizosphere microorganisms responsive to a devastating citrus disease caused by ‘Candidatus Liberibacter asiaticus’ (CLas) infection, by using 16S rRNA sequencing and metagenome technologies. The results show that 30 rhizosphere and 14 root bacterial genera were significantly affected by CLas infection, including 9 plant resistance-associated bacterial genera. Among these, Amycolatopsis, Sphingopyxis, Chryseobac- terium, Flavobacterium, Ralstonia, Stenotrophomonas, Duganella, and Streptacidiphilus were considerably Citation: Li, H.; Song, F.; Xu, Q.; enriched in CLas-infected roots, while Rhizobium was significantly decreased. Metagenome analysis Peng, S.; Pan, Z.; Wu, X.; Deng, C. revealed that the abundance of genes involved in carbohydrate metabolism, such as glycolysis, starch Microbiome and Metagenome and sucrose metabolism, amino sugar and nucleotide sugar metabolism, was significantly reduced Analysis Reveals Huanglongbing in the CLas-infected citrus rhizosphere microbial community.
    [Show full text]
  • Faenia Rectivirgula Kurup and Agre 1983 to the Genus Saccharopolyspora Lacey and Goodfellow 1975, Elevation of Saccharopolyspora Hirsuta Subsp
    INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY,OCt. 1989, p. 430441 Vol. 39, No. 4 0020-7713/89/04043 0- 12$02.00/0 Copyright 0 1989, International Union of Microbiological Societies Transfer of Faenia rectivirgula Kurup and Agre 1983 to the Genus Saccharopolyspora Lacey and Goodfellow 1975, Elevation of Saccharopolyspora hirsuta subsp. taberi Labeda 1987 to Species Level, and Emended Description of the Genus Saccharopolyspora F. KORN-WENDISCH,’” A. KEMPF,’ E. GRUND,’ R. M. KROPPENSTEDT,2 AND H. J. KUTZNER’ Institut fur Mikrobiologie der Technischen Hochschule Darmstadt, 0-6100 Darmstadt, ’ and Deutsche Sammlung von Mikroorganismen, 0-3300 Braunschweig,2 Federal Republic of Germany A thorough taxonomic study of the genera Succhuropolysporu and Fueniu showed that both of these taxa can be included in one genus. We propose that Fueniu rectivirgula be transferred to the genus Saccharopolysporu Lacey and Goodfellow 1975 as Sacchuropolyspora rectivirgula (Kurup and Agre 1983) comb. nov. A description of the new SucchuropoZysporu species is presented. The type strain is strain DSM 43 747 (= ATCC 33 515). In addition, we propose that Sacchuropolysporu hirsuta subsp. tuberi Labeda 1987 strain NRRL B-16 173T (T = type strain) be given species status as Succharopolysporu tuben sp. nov. In 1987 Labeda (30) transferred Streptomyces erythraeus MATERIALS AND METHODS to the genus Saccharopolyspora as Saccharopolyspora Organisms. The origins of the 24 strains used in this study, erythraea Labeda 1987 comb. nov. on the basis of its cell as well as three reference strains, are shown in Table 1. wall chemistry. Our studies of the genus Streptomyces also Cultural characteristics were observed on Trypticase soy indicated that Streptomyces erythraeus did not belong in the agar (TSA) (BBL Microbiology Systems, Cockeysville, Md.) genus Streptomyces, since the cell walls contained meso- and GYM agar (29), each prepared with and without 5% diaminopimelic acid (DAP) and because of phage typing NaCl, and on inorganic salts starch agar (48).
    [Show full text]
  • Systematic Research on Actinomycetes Selected According
    Systematic Research on Actinomycetes Selected according to Biological Activities Dissertation Submitted in fulfillment of the requirements for the award of the Doctor (Ph.D.) degree of the Math.-Nat. Fakultät of the Christian-Albrechts-Universität in Kiel By MSci. - Biol. Yi Jiang Leibniz-Institut für Meereswissenschaften, IFM-GEOMAR, Marine Mikrobiologie, Düsternbrooker Weg 20, D-24105 Kiel, Germany Supervised by Prof. Dr. Johannes F. Imhoff Kiel 2009 Referent: Prof. Dr. Johannes F. Imhoff Korreferent: ______________________ Tag der mündlichen Prüfung: Kiel, ____________ Zum Druck genehmigt: Kiel, _____________ Summary Content Chapter 1 Introduction 1 Chapter 2 Habitats, Isolation and Identification 24 Chapter 3 Streptomyces hainanensis sp. nov., a new member of the genus Streptomyces 38 Chapter 4 Actinomycetospora chiangmaiensis gen. nov., sp. nov., a new member of the family Pseudonocardiaceae 52 Chapter 5 A new member of the family Micromonosporaceae, Planosporangium flavogriseum gen nov., sp. nov. 67 Chapter 6 Promicromonospora flava sp. nov., isolated from sediment of the Baltic Sea 87 Chapter 7 Discussion 99 Appendix a Resume, Publication list and Patent 115 Appendix b Medium list 122 Appendix c Abbreviations 126 Appendix d Poster (2007 VAAM, Germany) 127 Appendix e List of research strains 128 Acknowledgements 134 Erklärung 136 Summary Actinomycetes (Actinobacteria) are the group of bacteria producing most of the bioactive metabolites. Approx. 100 out of 150 antibiotics used in human therapy and agriculture are produced by actinomycetes. Finding novel leader compounds from actinomycetes is still one of the promising approaches to develop new pharmaceuticals. The aim of this study was to find new species and genera of actinomycetes as the basis for the discovery of new leader compounds for pharmaceuticals.
    [Show full text]
  • A Bioinformatics Analysis Reveals a Group of Mocr Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins
    Hindawi Publishing Corporation Biochemistry Research International Volume 2016, Article ID 4360285, 13 pages http://dx.doi.org/10.1155/2016/4360285 Research Article A Bioinformatics Analysis Reveals a Group of MocR Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins Teresa Milano,1 Sebastiana Angelaccio,1 Angela Tramonti,1,2 Martino Luigi Di Salvo,1 Roberto Contestabile,1 and Stefano Pascarella1 1 Dipartimento di Scienze Biochimiche, Sapienza Universita` di Roma, 00185 Roma, Italy 2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche, 00185 Roma, Italy Correspondence should be addressed to Stefano Pascarella; [email protected] Received 27 November 2015; Accepted 26 May 2016 Academic Editor: Gary A. Lorigan Copyright © 2016 Teresa Milano et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH) architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average) that is homologous to fold type-I pyridoxal 5 -phosphate (PLP) dependent enzymes like aspartate aminotransferase (AAT). These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function.
    [Show full text]