Three New Species of the Genus Actinobispora of the Family Pseudonocardiaceae, Actinobispora Alaniniphila Sp

Three New Species of the Genus Actinobispora of the Family Pseudonocardiaceae, Actinobispora Alaniniphila Sp

International Journal of Systematic Bacteriology (1 999),49,88 1-886 Printed in Great Britain Three new species of the genus Actinobispora of the family Pseudonocardiaceae, Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov. and Actinobispora xinjiangensis sp. nov. Li-Hua Xu,’ Xiang Jin12Pei-Hong Mae,' Zheng-Fu Lu,’ Xiao-Long Cuil and Cheng-Lin Jiangl Author for correspondence: Cheng-Lin Jiang. Tel: +86 871 5033790. Fax: +86 871 5173878. 1 Yunnan Institute of The genus Actinobispora Jiang et al. is characterized by the formation of Microbiology, Yunnan longitudinally paired spores on both the vegetative and the aerial mycelium, Un ive rsity, 65009 1 Kunming, Yunnan, China absence of mycolic acid, cell wall chemotype IV (containing meso- diaminopimelic acid as the diamino acid, galactose and arabinose), PVI and 2 Institute of Microbiology, Xinjiang Academy of MK-g(H2). Comparative studies of morphology, chemical classification and Agricultural Sciences, phylogenetic analysis based on the 165 rRNA sequences among the four type 83000 Wulumuqi, Xinjiang, strains of the genus Actinobispora and type strains of related genera were China carried out. The results indicated that the genus Actinobispora is different from these other genera and should be placed in the family Pseudonocardiaceae Embley et a/. 1988 with the genera Amycolatopsis, Pseudonocardia, Saccharomonospora, Saccharopolyspora and A ctinopolyspora. On the bases of these results, three new species under the names of Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov. and Actinobispora xinjiangensis sp. nov. are proposed; the type strains are CCTCC AA970OlT, CCTCC AA97002l and CCTCC AA97020T. Keywords: Actinobispora alaniniphila sp. nov., Actinobispora aurantiaca sp. nov., Actinobispora xinjiangensis sp. nov., 16s rRNA INTRODUCTION with Kibdelosporangium, Amycolatopsis, Pseudono- cardia, Saccharomonospora, Saccharopolyspora, The description of the genus Actinobispora has been Micropolyspora and Actinopolyspora (Jiang et al., published previously by Jiang et al. (1991). It is 1995; Miyadoh, 1997). The results of chemotaxonomic characterized by the formation of longitudinally paired and phylogenetic analysis of some related genera with spores on both the vegetative and the aerial mycelium, wall chemotype IV and absence of mycolic acid, such absence of mycolic acid and having cell wall chemotype as Saccharothrix, Amycolata, Kibdelosporangium, IV. More recently, many other members of the genus Actinokineospora, Pseudonocardia, Saccharomono- have been isolated (Hu et al., 1994; Suzuki et al., 1998) spora and Amycolatopsis have been reported (Bowen et from soil samples collected from 2 1 Provinces of China al., 1989; Embley et al., 1988a, b; Henssen et al., 1987; and other countries such as India, Japan, Austria, Kothe et al., 1989; Takeuchi et al., 1992; Warwick et France, USA, thus indicating that members of this al., 1994; Yassin et al., 1993). Ochi (1995) reported the genus are widely distributed. The genus Actinobispora results of amino acid sequence analysis of ribosomal was included in the group of Micropolyspora together protein AT-L30 of members of the family Pseudono- cardiaceae. Warwick et al. (1994) reported the phylo- genetic analysis of the family Pseudonocardiaceae and Abbreviations: DPG, diphosphatidylglycerol; GluNu, unknown glucos- the genera Actinokineospora and Saccharothrix. These amine-containing phospholipid; PC, phosphatidylcholine; PE, phospha- tidylethanolamine; PG, phosphatidylglycerol; PI, phosphatidylinositol; authors indicated that Amycolatopsis, Saccharomono- PME, phosphatidylmethylethanolamine. spora, Pseudonocardia, Amycolata, Saccharopolyspora The GenBank accession numbers for the sequences reported in this paper and Kibdelosporangium should be placed in the family are AF056706, AF056707, AF056708 and AF056709. Pseudonocardiaceae. In the present study, the phylo- 0079201999 IUMS 881 L.-H. Xu and others genetic relationships among the genus Actinobispora samples collected from more than ten areas of Yunnan and and related genera are analysed, and three new species Xinjiang, People's Republic of China. Plates were incubated of the genus Actinobispora are described based on at 28 "C for 21-28 d. The strains used in this study are listed phenetic markers, chemotaxonomy and 16s rDNA in Table 1. sequences. Morphology. The media used for micromorphological studies were yeast extract-malt extract agar (ISP 2) and oatmeal agar (ISP 3) (Shirling & Gottlieb, 1966). The time of METHODS incubation was 14-21 d at 28 "C. Morphological obser- Actinomycete strains. Many strains of the genus Actino- vations of spores were made with a light microscope and a bispora were isolated with AV agar (Ochi, 1995; Nonomura model EPMA-8705 electron microscope. & Ohara, 1971) and HV agar (Hayakawa, 1990) from soil Cultural, physiological and biochemical tests. The media and Table 1. List of strains used in this study Species Strain GenBank no. Actinobispora yunnanensis Y-11981T(= CCTCC M90959T) AFO 56706 Actinobispora yunnanensis Y-7105 Actinobispora yunnanensis Y-7126 Actinobispora yunnanensis Y- 16279 Actinobispora yunnanensis Y-15151 Actinobispora yunnanensis Y - 16227 Actinobispora sp. Y-14385 Act in0bispora alaniniphila Y-16303T(= CCTCC AA97001T) AF056708 Actinobispora aurantiuca Y- 14860T (= CCTCC AA97002T) AF056707 Act in0bispo ra xinjiangensis XJ-45T (= CCTCC AA97020T) AF056709 Strep tomy ces gr iseus KCTC 9080 X6 1478 Streptomyces lavendulae ISP 5069 X53 173 Streptomyces olivoreticuli DPDU 0278 X53 166 Streptomyces hygroscopicus ATCC 14607 U72 167 Streptomyces albus DSM 403 13 X53 163 Streptomyces coelicolor ATCC null M35377 Streptomyces thermoviolaceus DSM 40443 268096 Streptomyces thermocarboxydovorans DSM 44296 U94489 Streptomyces thermocarboxydus DSM 44293 U94490 Strep to verticillium ladakanum DSM 40587 X53 167 Nocardioides albus DSM 43 109 X53211 Act inoplanes p h ilippinensis IF0 13878 D85474 Micromonospora chalcea DSM 43026 X92594 Dactylosporangium aurantiacum IF0 12592 D85480 Actinomadura madurae JCM 7436 D50668 Microbispora amethystogenes JCM 3021 U48988 Micro b ispora ch r omogenes IF0 14876 U48989 Microbispora thermorosea ATCC 27099 U48987 Microtetraspora glauca IF0 14761 D85490 Saccharothrix australiensis ATCC 31947 X53 193 Ku tzner ia vir idogrisea JCM 3282 U58530 Nocardia asteroides DSM 43005 X53205 Nocardia seriolae ATCC 43993T X80592 Nocardia otitidiscaviarum ATCC 14629 M59056 Tsukamurella inchonensis IMMIB D-771 X85955 Pseudonocardia thermophila ATCC 19285 X53 195 Saccharomonosporu viridis ATCC 15386 X54286 . Saccharomonospora caesia ' INMI 19125 X76960 Saccharopolyspora hirsuta ATCC 27875 X53 196 Promicromonospora enterophila DSM 43852 X83807 Thermoactinomyces candidus NCIMB 11249 M77490 Thermoactinomyces vulgaris NCIMB 11364 M7749 1 Thermoactinomyces dichotomicus NCIMB 10211T L 16902 Escherichia coli 501859 882 International Journal of Systematic Bacteriology 49 Three new Actinobispora species procedures used for the study of the cultural and physio- strains contained phosphatidylmethylethanolamine logical characteristics of the strains were those described by (PME). Strain Y-1198 lT contained diphosphatidyl- Shirling & Gottlieb (1966) and Locci (1989). Colour deter- glycerol (DPG). Strain XJ-45T contained phospha- minations were made by comparing the cultures with colour tidylinositol (PI). The major menaquinones are MK- chips from the ISCC-NBS colour charts Standard Samples No. 2106 (Kelly, 1964). 9(H2)and MK-7(H2).Some strains contained traces of MK-9(H4) and MK-7(H4) (Table 3). Chemical analyses. The test strains were grown in yeast extract-malt extract broth at 28 “C to the late exponential growth phase. The cells were harvested by centrifugation at Sequence comparisons and phylogenetic analysis 4000 g for 10 min and were washed with distilled water. Cell walls were purified and analysed by the method of Almost the complete 16s rRNA sequences [ 1460-1468 Lechevalier & Lechevalier (1 980). The procedures of Becker nucleotides between Escherichia coli positions 37 and et al. (1964) and Lechevalier & Lechevalier (1980) were used 1516 (Brosius et al., 1978)] for the four strains of the for whole-cell analysis. The phospholipid analysis was genus Actinobispora were determined. These sequences carried out using the method of Lechevalier et al. (1981). were compared with the corresponding sequences from Mycolic acids were determined by the methods of the representative reference strains with cell wall type Lechevalier & Lechevalier (1 980). Menaquinones were I-IV of the other genera of the order Actinomycetales. determined using the procedures of Collins (1985). The results showed that Actinobispora yunnanensis and 165 rDNA gene sequencing. The 16s rRNA gene was the other three strains were clearly clustered into a amplified by PCR (Saiki et al., 1988) using Taq DNA group. The evolutionary distances among the four polymerase (Sino-American Biotechnology), primer A 7-26 strains were 0.025-0.045. Fig. 1 shows a neighbour- (5’ CCGTCGACGAGCTCAGAGTTTGATC- joining phylogenetic tree constructed on the basis of CTGGCTCAG 3’)? and primer B 1523-1504r (5’ CCCGG- GTACCAAGCTTAAGGAGGTGATCCAGCCGCA 3’). the evolutionary distances calculated by using the 15 16 The 1.5 kb amplified 16s rDNA fragment was purified by positions that could be aligned. agarose gel electrophoresis. The purified fragments were According to Embley et al. (1988b), the family Pseudo- directly sequenced by using a FS-DNA sequencing kit nocardiaceae

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us