Burkholderia Pseudomallei in Northern Vietnam

Burkholderia pseudomallei in Northern Vietnam:

Environmental Detection and Molecular

Characterization of Strains

I n a u g u r a l d i s s e r t a t i o n

zur

Erlangung des akademischen Grades

doctor rerum naturalium (Dr. rer. nat.)

an der Mathematisch-Naturwissenschaftlichen Fakultät

der

Ernst-Moritz-Arndt-Universität Greifswald

2012

vorgelegt von

Trinh, Thanh Trung

geboren am 17.11.1980

in Ninh Binh, Vietnam

Dekan: Prof. Dr. Klaus Fesser

1. Gutachter : Prof. Dr. Ivo Steinmetz

2. Gutachter : Prof. Dr. Leo Eberl

Tag der Promotion: 12.09.2012

Contents

Chapter 1 Background 4

Chapter 2 Clinical and microbiological features of melioidosis in 22 Northern Vietnam

Chapter 3 Improved culture- based detection and quantification of 31 Burkholderia pseudomallei from soil

Chapter 4 Highly sensitive detection and quantification of Burkholderia 38 pseudomallei in environmental soil samples using real-time PCR

References 48

Declaration 57

Curriculum Vitae, Publications, Contributions to articles 58

Acknowledgements 61

Appendix 63

Chapter 1

Background

Trinh Thanh Trung

1. Introduction ...... 5

1.1. Melioidosis ...... 5

1.1.1. From origins to global distribution ...... 5

1.1.2. Clinical features of melioidosis ...... 6

1.1.3. Diagnosis and management of melioidosis ...... 7

1.2. Characteristics of Burkholderia pseudomallei ...... 9

1.2.1. Taxonomy of Burkholderia pseudomallei and closely related species ...... 9

1.2.2. Modes of acquisition and bioweapon potential ...... 11

1.2.3. Bacterial genome and its plasticity ...... 12

1.2.4. Bacterial genotype and population structure ...... 15

1.3. B. pseudomallei in the environment ...... 17

1.3.1. Natural ecological niches and bacterial survival ...... 17

1.3.2. Methods for detection of B. pseudomallei from the environment ...... 19

1.4. What do we know about melioidosis in Vietnam? ...... 20

2. Aims of the study ...... 21

Chapter 1

1. Introduction 1.1. Melioidosis 1.1.1. From origins to global distribution Melioidosis, a term derived from the Greek “ melis ” (meaning donkey distemper) and “ eidos ” (meaning resemblance), is a serious infectious disease caused by a soil- dwelling Gram-negative bacterium Burkholderia pseudomallei (White, 2003; Cheng and Currie, 2005). A century ago, the first cases of the disease were described by the pathologist Alfred Whitmore in Myanmar (White, 2003). Several years later, a large number of human and animal melioidosis cases had been also detected Myanmar and Malaysia, respectively (Dance, 1991; White, 2003). During and after World War II, many sporadic cases of disease were recorded among the French and American soldiers who were stationed in Southeast Asia (Dance, 1991; Cheng and Currie, 2005). Subsequently, a large number of cases, including many epidemiologically linked clusters, were reported for indigenous populations in Thailand and Australia, where the first cases had been recognized in 1949 and 1956, respectively (Cheng and Currie, 2005). By the second half of the 20 th century, melioidosis had emerged as an important public health problem in certain areas of the tropics. In Ubon Ratchathani, Thailand, melioidosis accounts for up to 20% of community-acquired septicemic infection (Chaowagul et al., 1989) with an average annual incidence of 4.4 cases per 100,000 population. The mortality rate reaches approximately 40% in septic shock cases (Suputtamongkol et al., 1999). A study in Northern Australia also revealed a considerable percentage of melioidosis in community-acquired septicemic patients admitted to the Royal Darwin Hospital (Douglas et al., 2004). The average annual incidence of melioidosis in this region is 19.6 cases per 100,000 population and the overall mortality rate amounts to 16.2% among the infected cases (Currie et al., 2004). During the last 20 years, many attempts have been made to increase the awareness of melioidosis in routine diagnostic settings. Not only in Southeast Asia and Northern Australia, but also in different geographical areas of the world, many more cases of infection have been detected, resulting in the expansion of the global map of the disease (Figure 1-1). Sporadic and outbreak cases of melioidosis in Southern Taiwan as well as mainland China have been described (Yang, 2000; Shih et al. , 2009). Multiple cases have been reported from different regions of the Indian subcontinent (John et al., 1996). The occurrence of melioidosis patients as well as the presence of B. pseudomallei in the environment have been noted in Brazil (Rolim et al., 2005).

Chapter 1

Figure 1-1. Worldwide distribution of melioidosis (from Currie et al., 2008)

1.1.2. Clinical features of melioidosis Melioidosis has a wide variety of clinical presentations, ranging from an asymptomatic carrier state to a chronic debilitating localized infection or acute fulminant septicemia (White, 2003). Multiple organs or even only single sites of the body may be involved during the febrile episodes of infection (Leelarasamee, 2004). Therefore, clinical signs and symptoms at the onset of the disease vary, depending on the affected organs (White, 2003), leading to unpredictable clinical manifestations and resulting in the misdiagnosis of melioidosis as other infectious diseases, such as tuberculosis or typhoid fever in clinical settings (Stone, 2007; Vidyalakshmi et al. , 2008). In all of the hospitalized cases, septicemia is the most common presentation of melioidosis, and the most commonly affected organ is the lung (White, 2003). Skin and soft-tissue abscesses are also common sites and may be the source of systemic infection or the result of hematogenous spread (Cheng and Currie, 2005). In a few cases, melioidosis presents as uncomplicated localized infections of the skin, subcutaneous tissues, or eyes (White, 2003; Gal et al. , 2004). Additionally, abscess formation can occur in any internal organ, such as liver, spleen, lymph nodes, prostate, and skeletal muscles. In renal abscesses, melioidosis is often associated with genitourinary infection (White, 2003). Moreover, clinical presentations of endocarditis, peritonitis, osteomyelitis or septic arthritis, encephalitis or meningitis, and

Chapter 1 mycotic aneurysm have been recently seen in many melioidosis patients (Hsueh et al., 2001; Malczewski et al., 2005; Vidyalakshmi et al., 2008). A number of common risk factors for developing melioidosis have been defined. They include diabetes mellitus, chronic renal disease, chronic lung disease, excess alcohol uptake, and thalassemia (Suputtamongkol et al., 1999; Currie et al., 2004). Of thes, diabetes mellitus has the highest incidence rate for melioidosis; the estimated rate for meliodosis infection is 260.4 cases per 100,000 diabetic patients (Currie et al., 2004) and the underlying diabetes disease in melioidosis patients ranges from 37 to 64% (Malczewski et al., 2005). Moreover, other independent risk factors, such as malignant tumors and steroid therapy for immunosuppression, are also reported for melioidosis (Suputtamongkol et al. , 1999). Age above 45 years and occupation of farmer or construction worker – who are directly exposed to contaminated soil and water – are predisposing factors for developing melioidosis (Suputtamongkol et al., 1999; Currie et al., 2004). Recently, tsunami natural disaster in December 2004 has been associated with large numbers of detected cases, suggesting tsunamis as a new risk factor for melioidosis (Peacock, 2006). In different regions, the overall mortality rates of melioidosis are approximately 20 to 50%. Death occurs within 48 h after admission in most of the cases with disseminated bacteremia and septic shock (Simpson et al., 1999; Currie et al., 2000; Limmathurotsakul et al., 2006). Recurrent melioidosis has been reported in 13.1% of recovered patients. Of these, 75% develop the disease by relapse. The others manifest the disease by reinfection (Limmathurotsakul et al., 2006). Besides humans, melioidosis can affect a wide range of animals. Sporadic and outbreak cases have been reported in pets, such as dogs and cats, in farm animals, such as horses, mules and donkeys, goats, sheep, cattle, and buffalo, in zoo animals such as seals, dolphins, crocodiles, and also in human primates and non-human primates (Sprague and Neubauer, 2004).

1.1.3. Diagnosis and management of melioidosis Because of a wide range of clinical presentations, diagnostic confirmation of a melioidosis case has to depend heavily on clinical microbiological examination (Inglis et al., 2006). Although many antigen or antibody detection assays and molecular techniques have been developed for diagnosis of melioidosis, culture-based methods for isolation of B. pseudomallei still remain the “gold standard” in routine diagnostic settings (Cheng and Currie, 2005; Peacock, 2006). Observation of only a single B. pseudomallei colony on agar

Chapter 1 examined from any clinical specimen is an indication of the infection of melioidosis in the corresponding patients. To increase the sensitivity of culture detection methods, the isolation of the bacterium from nonsterile fluids such as urine, pus, sputum and throat swabs should be performed with either selective broths or Ashdown agar to reduce the overwhelminging effect of other commensal bacteria (Cheng et al., 2006; Inglis et al., 2006). Until bacterial colonies appear on the agar plate, presumptive identification of B. pseudomallei is based on typical wrinkled colony morphology, the appearance of bipolar “safety-pins” in Gram-negative staining, oxidase positivity, and gentamicin and polymyxin (colistin) resistance (White, 2003). Further confirmation can be done with the latex agglutination test to detect specific B. pseudomallei exopolysaccharide (Steinmetz et al., 1999) or a 200-kDa surface protein (Samosornsuk et al., 1999). Non-assimilation of L- arabinose sugar in a biochemical panel can distinguish B. pseudomallei from a closely related species, B. thailandensis, which metabolizes the sugar (Brett et al., 1998). Largely due to the delayed treatment with appropriate antibiotics and the high number of deaths occurring within 48 h of admission (White et al., 1989), many modern techniques are being developed for rapid diagnosis of melioidosis in clinical diagnostic settings. Serological tests such as the indirect hemagglutination assay are well established, but these tests cannot be generally used, because most of the population in endemic areas is seropositive (White, 2003). Direct immunofluorescence of clinical specimens such as pus, sputum, wound swabs and urine demonstrates the most promising way to reduce the time required for diagnosis. However, this method can only be used in microbiological laboratories equipped with special microscopy facilities (Walsh et al., 1994). Recently, real-time PCR assays targeting the type three secretion system 1 (TTSS1) gene and hypothetical protein-coding genes (BPSS1187 and BPSS2089) have been established for diagnosis of melioidosis from clinical specimens in Northern Australia and Northeast Thailand, respectively. Despite the high specificity and sensitivity of these assays, further evaluations are still required in other endemic locations (Meumann et al., 2006; Supaprom et al., 2007). B. pseudomallei obtained from various endemic regions demonstrates resistance to many antibiotics, such as penicillins, rifamycins and aminoglycosides. Additionally, the bacterium is also relatively resistant to quinolones and macrolides (Thibault et al. , 2004; Cheng and Currie, 2005; Karunakaran and Puthucheary, 2007), resulting in limited therapeutic options for the treatment of melioidosis and contributing to the high mortality rate of the disease. In order to establish a successful therapeutic treatment, many

Chapter 1 randomized controlled trials have been examined using two separate antibiotic treatment phases (Cheng and Currie, 2005). The first phase is called intensive-phase intravenous regimen with ceftazidime or imipenem or amoxicillin-clavulanate for at least 10 days until clear improvement is observed. In the second phase or eradication-phase an oral antibiotic regimen of trimethoprim-sulfamethoxazole should be conducted in the patients for 20 weeks (White, 2003; Cheng and Currie, 2005). Although there are many differences in the intensive and eradication antibiotic regimens between Australia and Thailand, all of the above-mentioned antibiotics are currently recommended drugs for treatment of melioidosis (Cheng and Currie, 2005).

1.2. Characteristics of Burkholderia pseudomallei 1.2.1. Taxonomy of Burkholderia pseudomallei and closely related species According to the Bergey’s Manual of Systematic Bacteriology, Burkholderia pseudomallei is an aerobic, motile, non-spore forming and Gram-negative rod bacterium. The bacterial cells are small (0.8 × 1.5 µm). Gram staining shows bipolar characteristics because of intracellular deposits of polyhydroxybutyrate (PHB). Formerly, Burkholderia pseudomallei belonged to rRNA homology group II of the Pseudomonas genus and was named Pseudomonas pseudomallei . In 1992, Yabuuchi et al . proposed transferring this species together with other six species into a new Burkholderia genus with the type species Burkholderia cepacia (Yabuuchi et al., 1992). The number of species within the genus is gradually increasing. To date, the Burkholderia genus consists of more than 60 validly described species (Yang et al. , 2006; Vanlaere et al. , 2008; Suarez-Moreno et al. , 2012). The genus is known to be a group of metabolically versatile bacteria that occupy remarkably diverse ecological niches of both natural environments and the human respiratory tract (Coenye and Vandamme, 2003; Mahenthiralingam et al. , 2008; Suarez- Moreno et al. , 2012). The human pathogenic species, B. pseudomallei and B. mallei are known to be causative agents of melioidosis and glander in humans and animals, respectively. Additionally, the genus contains a B. cepacia complex of at least 14 phenotypically and genetically related species (Vanlaere et al., 2008) which are known to be opportunistic pathogens in vulnerable individuals, especially in cystic fibrosis patients (Mahenthiralingam et al., 2008). The plant pathogenic species, B. glumae and B. plantarii are the most important bacterial pathogens of rice (Coenye and Vandamme, 2003). Although the genus contains a considerable number of pathogenic species, many other Burkholderia species are beneficial to humans because of their ability to fix nitrogen,

Chapter 1 degrade pollutants such as toluene and trichloroethylene, and produce plant-growth promoters or pesticides against phytopathogenic fungi (Coenye and Vandamme, 2003; Chiarini et al. , 2006). The identification of species within the Burkholderia genus requires a combination of multiple techniques (Vermis et al., 2002). Based on the assimilation of different carbon sources or the production of specific enzymes using the biochemical test kit API 20 NE, B. pseudomallei can be misidentified as Burkholderia cepacia , Chromobacterium violaceum or Pseudomonas aeruginosa (Amornchai et al., 2007); the avirulent species B. thailandensis occurring together with B. pseudomallei in the environment might also show an identical reaction panel to that of B. pseudomallei (Brett et al., 1998; Inglis et al., 2005). Additionally, 16S rRNA gene sequences cannot be used to accurately distinguish all of the Burkholderia species, especially B. cepacia complex species. A more recent development, recA gene sequence analysis offers a simple and accurate method for identifying species within the Burkholderia genus (Payne et al., 2005; Vanlaere et al., 2008). Topology of the Burkholderia genus recA phylogenetic tree forms separate branches for each taxonomically classified species and is congruent with the 16S rRNA gene-based phylogenetic tree (Figure 1-2) (Coenye and Vandamme, 2003; Payne et al. , 2005). In the phylogenetic tree, the pathogenic species B. pseudomallei , B. mallei and the avirulent species B. thailandensis form a cluster which is more closely related to the human opportunistic B. cepacia complex (Figure 1-2) (Payne et al., 2005).

Chapter 1

Figure 1-2. Phylogenetic tree based on the Burkholderia recA sequences (from Payne et al., 2005).

1.2.2. Modes of acquisition and bioweapon potential As B. pseudomallei naturally occupies soil and surface water in the endemic areas and most melioidosis cases occur in rice farmers or construction workers, whose daily activities directly expose them to contaminated soil or water, percutaneous inoculation is considered to be the major route for acquisition of melioidosis (Cheng and Currie, 2005). Via minor cuts or abrasions caused by injury, the bacteria enter through the skin, multiply

Chapter 1 in the body and manifest the symptoms of infection. Currie et al. (2000) estimated the incubation period to range from 1 to 21 days (mean 9 days), but many factors, such as bacterial load and host risk factors, probably affect this period. For instance, a long incubation time of up to 29 years has been observed in ex-servicemen after returning from Papua New Guinea and Vietnam (Cheng and Currie, 2005). Inhalation is also known to be an important route of infection with B. pseudomallei . The evidence comes from a high incidence of melioidosis in US-military helicopter crews in Vietnam (Cheng and Currie, 2005). This may be explained by the crews having inhaled contaminated dust raised by helicopter rotor blades during landing or taking off (Cheng and Currie, 2005). Moreover, recent investigations also found that some outbreaks or severe melioidosis cases are related to extreme weather events, such as heavy monsoonal rainfalls, destructive winds, cyclones, or typhoons (Currie and Jacups, 2003; Cheng et al. , 2006; Shih et al. , 2009). Under such conditions, the bacteria in the contaminated surface soil and water are probably aerosolized, resulting in the potential for inhalation of B. pseudomallei . Therefore, a shift toward inhalation of B. pseudomallei as the mode of acquisition rather than inoculation has also been proposed (Currie and Jacups, 2003). Nosocomial infections were also reported from disinfection solutions contaminated with B. pseudomallei (Cheng and Currie, 2005). Moreover, ingestion, person to person transmission, animal to human transmission, and sexual transmission have been suggested as a mode of acquisition; however, more evidence is required to substantiate these routes of infection (Cheng and Currie, 2005). Due to the high mortality rate, the intrinsic antibiotic resistance, the wide range of hosts, and the ability to infect via inhalation, B. pseudomallei is considered a potential biothreat agent and is listed as a category B agent by the Centers for Disease Control and Prevention (CDC) ( http://www.cdc.gov/ ).

1.2.3. Bacterial genome and its plasticity The genomic GC content of B. pseudomallei is 68%. The bacterial genome consists of two chromosomes, which are designated as chromosomes 1 and 2 of approximately 4.0 Mb and 3.1 Mb, respectively (Figure 1-3). The large chromosome contains 3,460 coding sequences (CDSs), which are mostly responsible for the many core functions of the cells, such as macromolecule biosynthesis, amino acid metabolism, cofactor and carrier synthesis, nucleotide and protein biosynthesis, and mobility. In contrast, the small chromosome contains 2,395 CDSs, which mainly involve in accessory functions, such as adaptation to

Chapter 1 stress conditions, osmotic protection, iron acquisition, secondary metabolism, regulation, and horizontally acquired DNA (Holden et al., 2004; Tuanyok et al., 2008).

Figure 1-3. Schematic circular diagrams of the large and small chromosomes of B. pseudomallei K96243 . Both chromosomes are centered around the origin of replication (O). From outside to inside: red color shows 12 genomic islands on the large chromosome and 4 on the small chromosome; variable and conserved genes are indicated in blue and yellow, respectively; red peaks indicate high variability in that genomic regions; black arrows indicate examples of novel indels (from Sim et al., 2008).

A bipartite genome structure of B. pseudomallei is similar to that of the closely related species B. mallei and B. thailandensis, but different from many distant species such as Pseudomonas aeruginosa , Pseudomonas putida or Xanthomonas campestris, the genomes of which have only a single chromosome (Holden et al., 2004). A comparative genome analysis reveals that the chromosomes of B. pseudomallei are slightly larger than those of B. mallei and B thailandensis . The predicted orthologs among those species show that the mean values of identity and length match are high between proteins of B. pseudomallei and B. mallei and low between proteins of B. mallei and B. thailandensis . The findings suggest that the three species have diverged very recently. This divergence is most likely to have occurred between B. thailandensis and the B. pseudomallei -B. mallei common ancestor and subsequently split between B. pseudomallei and B. mallei (Kim et al., 2005).

Chapter 1

The B. pseudomallei genome contains many abnormal DNA regions in which the GC content is higher or lower than 68% of bacterial genome. These regions are termed genomic islands (GIs), which were acquired very recently through horizontal gene transfer (HGT) (Holden et al., 2004). The sizes of genomic islands range from 7.4 to 107.9 kb and the genes within genomic islands are expected to be involved in different roles played by the cells, such as that of prophage, and in metabolism or pathogenicity (Holden et al., 2004; Tuanyok et al., 2008; Tumapa et al., 2008). A study by Tuanyok et al. (2008) shows that each completely sequenced genome possesses a distinct set of genomic islands and a certain number of genomic islands (from 16 to 21 genomic islands per genome). To date, 71 genomic islands from five different reference genomes have been identified and classified into a nomenclatural system based on the original 16 GIs identified in B. pseudomallei K96243 (Figure 1-4). Many of these genomic islands are commonly located next to a tRNA gene in the B. pseudomallei genome, suggesting the term “tRNA-mediated site-specific recombination” for the integration of foreign DNA into the bacterial genome via horizontal gene transfer. The specific recombination sites mean that many different genomic islands could be found across multiple strains at the same genomic locations (Figure 1-4) (Tuanyok et al., 2008). Moreover, many small genomic indels ranging in size from 1.3 to 7.5 kb have also been identified across both chromosomes of B. pseudomallei . Both GIs and indels are a part of the “accessory genome” and might contribute to phenotypic diversity of the bacterium (Sim et al., 2008).

Chapter 1

Figure 1-4. Genomic locations of 71 GIs on the large and the small chromosomes of five B. pseudomallei isolates. 16 GIs of B. pseudomallei K96243 are displayed outside of the lines. 55 novel GIs displayed inside the lines have been identified from four strains: 1710b, 1106a, MSHR668, and MSHR305. These novel GIs are classified based on the original locations of 16 GIs of strain K96243 (from Tuanyok et al., 2008).

Application of the whole-genome microarray to a large collection of clinical, environmental, and animal isolates shows that B. pseudomallei genomes are highly variable among individual strains. The proportion of the variable regions is approximately 14% of the whole B. pseudomallei genome and is broadly similar to that of other "- proteobacteria genera, such as Escherichia or Pseudomonas (Sim et al., 2008). Approximately one-third of these variable regions or “accessory genome” consists of a unique set of 16 genomic islands of B. pseudomallei K96243, supporting the hypothesis that recent acquisition of genomic islands by lateral gene transfer plays an important role in B. pseudomallei genome plasticity (Holden et al., 2004; Tuanyok et al., 2008; Tumapa et al., 2008).

1.2.4. Bacterial genotype and population structure For typing B. pseudomallei , a number of DNA-based methods have been developed, such as random amplified polymorphic DNA analysis (RAPD), ribotyping, restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP)

Chapter 1 and pulsed-field gel electrophoresis (PFGE). Of these methods, pulsed-field gel electrophoresis with the use of Xba I or Spe I restriction enzyme has been demonstrated as a powerful typing method for the bacterium (Inglis et al., 2002; Cheng et al., 2005). In terms of understanding the global epidemiology of meliodosis, the results produced by this method, however, are not well suited to interlaboratory comparisons, due to the lack of both standardization of electrophoresis conditions and standardized criteria for the analyzing PFGE pattern (Maiden et al., 1998). More recently, multilocus sequence typing (MLST) has been developed to infer the genetic relationship among B. pseudomallei isolates (Godoy et al., 2003). The method is based on nucleotide variations within fragments of seven housekeeping genes ace , gltB , gmh D, lep A, lip A, narK , and ndh . The different sequences obtained for each of the seven loci are assigned to different allele numbers, and the series of seven integers that corresponds to the allele numbers at the seven loci define the allelic profile of a strain. Each allelic profile is assigned a sequence type (ST) number which can be shared between laboratories via the internet. Therefore, MLST provides an unambiguous scheme of DNA sequences which can be used to compare the genetic relationship among B. pseudomallei isolates within or between laboratories (Godoy et al., 2003; Cheng et al., 2004). Various computational methods, such as unweighted-pair group with arithmetic averages (UPGMA), neighbor-joining dendrograms, minimum-evolution trees, or methods based upon related sequence type (eBURST) have been employed to analyze the genetic relationship among B. pseudomallei sequence types (Godoy et al. , 2003; Cheng et al. , 2004). Of these methods, the eBURST program is commonly used because the program is only designed for this special analysis (McCombie et al., 2006). The eBURST program is available at the MLST website ( http://www.mlst.net/ ). The principle of the method is based on the model of bacterial evolution, in which a single ancestral founding sequence type undergoes diversification to produce a subset of closely related sequence types. The descendants of the founding sequence type probably differ from each other by the accumulation of point mutation or the occurrence of genetic recombination which promotes the diversity among the MLST housekeeping-allele sequences (Godoy et al., 2003). In the eBURST algorithms, the founding sequence type is defined as the sequence type with the highest number of single locus variants (McCombie et al., 2006; Vesaratchavest et al., 2006). The sequence types which differ in their allele profiles by 1 of 7 housekeeping allele sequences of the founding sequence type are called single locus variants (SLVs). Similarly, the single locus variants diversify further into double locus

Chapter 1 variants (DLVs) that differ by 2 of 7 housekeeping allele sequences from the founding sequence type. In the eBURST diagram, the single locus variants are joined to the founding sequence type and the double locus variants are joined to the SLVs and so on until a bacterial population is represented as a series of clonal complexes with the founding sequence type located centrally (McCombie et al., 2006; Vesaratchavest et al., 2006). A single spot on the eBURST diagram represents each individual sequence type and the size of the spot is proportional to the number of isolates in the population that share the same sequence type centrally (McCombie et al., 2006; Vesaratchavest et al., 2006). In recent eBURST analyses of the B. pseudomallei MLST database, most of the Thai isolates join together in a large clonal complex at the center of the diagram, whereas the majority of the Australian isolates displays individual outliers surrounding the main complex (McCombie et al., 2006; Vesaratchavest et al., 2006). Although the findings show distinct populations between the bacterial isolates originating from two highly endemic regions, these analyses provide only limited statistical support and also produce unreliable eBURST diagrams due to a high rate of recombination relative to mutation in the B. pseudomallei population (Turner et al. , 2007; Pearson et al. , 2009). To overcome the limitations, Dale et al. (2011) have carried out a comparative analysis to assess the robustness of the B. pseudomallei population using many specialized programs, such as Structure , BAPS, Genetic Analysis in Excel and Minimum SNP (Dale et al. , 2011). Based on the geographical origin of the sequence types and the epidemiological data, the combination of both Structure and BAPS with Bayesian-based clustering algorithm provides the most highly robust tools to assess the population structure and dynamics of B. pseudomallei using the MLST database. In the Structure program, the B. pseudomallei sequence type database is divided into Population 1 (containing 95% Australian sequence type) and Population 2 (containing 89% Southeast Asian sequence types) with 1 95% probability of assignment. In the BAPS program, the Structure Population 2 is divided into BAPS Population 2a and 2b, although there are no geographic or epidemiological correlations between these sub-population sequence types (Dale et al. , 2011).

1.3. B. pseudomallei in the environment 1.3.1. Natural ecological niches and bacterial survival As a saprophytic bacterium, B. pseudomallei can be ready isolated from environmental samples. In the endemic areas, the bacterium is distributed in a wide variety of moist soil types of both undisturbed and agricultural lands (Vuddhakul et al. , 1999;

Chapter 1

Kaestli et al. , 2007; Kaestli et al. , 2009). Moreover, the bacterium can also be found in pooled surface water or in contaminated water supplies, resulting in the outbreak of disease (Currie et al., 2001). In the soil habitat, the bacterium chiefly occupies a soil depth of 30 cm and is significantly associated with certain physicochemical parameters, such as less acidic pH, moisture content above 10%, and higher chemical oxygen demand, or nutrient- rich soil (Palasatien et al. , 2008). However, a recent study using a grid-like sampling approach and spatial autocorrelation analysis showed that the B. pseudomallei cell count is not uniformly distributed in areas adjacent to a certain sampling point in both fallow land and rice fields (Limmathurotsakul et al. , 2010), showing the uncertainty of the specific factors necessary for the occurrence of B. pseudomallei in the soil habitat. Rice paddies or farmlands are the most common areas used for field studies of B. pseudomallei in endemic areas (Vuddhakul et al. , 1999; Wuthiekanun et al. , 2005). Therefore, little is known about the presence of the bacterium in other habitats. Information regarding the number of melioidosis cases associated with the 2004 Indian Ocean tsunami (Peacock, 2006) may provide epidemiological clues for further study on the occurrence of the bacterium in coastal or seawater habitats (Inglis and Sagripanti, 2006). Recently, an environmental study in Northern Australia has demonstrated that the occurrence of B. pseudomallei is significantly associated with undisturbed lands rich in grasses (Kaestli et al. , 2009). Further investigation showed that B. pseudomallei also occupies the rhizosphere of many grasses studied, as do many other Burkholderia spp. (Kaestli et al. , 2011; Suarez-Moreno et al. , 2012). Interestingly, the bacterium also infects and colonizes many grass tissues, such as root, xylem and leaf, providing knowledge on an as yet little-known habitat of B. pseudomallei (Kaestli et al. , 2011). Moreover, B. pseudomallei has also been found in the cells of many amoebic species of Acanthamoeba and the dinoflagellate Alexandrium minutum, and even in spores of the mycorrhizal fungus Gigaspora decipiens . This symbiotic property might contribute to an increased ability of the bacterium to survive under environmental stress (Sprague and Neubauer, 2004; Inglis and Sagripanti, 2006). B. pseudomallei can survive in double distilled water for long periods of up to 17 years, whereas the cells of other pathogenic species, such as S. aureus and E. coli or the closely related B. mallei, decrease significantly within a month (Moore et al., 2008). In soil habitats, water is also an important requirement for bacterial survival. The bacterium can survive for two years in soils with a water content of more than 40%, whereas death occurs within 70 days in soils with a water content of less than 10% (Tong et al., 1996). The

Chapter 1 prolonged persistence of the bacterium in water has yet to be explained. The accumulation of polyhydroxybutyrate (PHB) in B. pseudomallei cells is thought to be a carbon source which could provide energy for bacterial survival under nutrient-poor conditions. (Inglis and Sagripanti, 2006). However, a constructed mutant strain unable to produce PHB is still persistently viable for prolonged periods of time (Moore et al., 2008). Under stress conditions, such as low pH or high osmolarity, B. pseudomallei cells can be detected by flow cytometry and supravital stains, but they are unable to grow on the culture media (Colwell, 2000; Yamamoto, 2000; Inglis and Sagripanti, 2006). These findings led to the term “viable but nonculturable cells” (VBNC) for B. pseudomallei . This phenomenon is also observed in many non-spore-forming bacteria (Colwell, 2000; Yamamoto, 2000; Inglis and Sagripanti, 2006).

1.3.2. Methods for detection of B. pseudomallei in the environment Besides clinical screening for melioidosis patients in the endemic areas, the environmental surveillance of B. pseudomallei has also received considerable attention, in order to fully understand the ecological niches and the global distribution of the bacterium (Vuddhakul et al. , 1999; Currie, 2008; Palasatien et al. , 2008). Current techniques for the detection of B. pseudomallei in soil samples mostly rely on culture-based methods. Such methods require the dispersion of soil samples in distilled water prior to inoculating the detached bacteria in either Galimand’s broth or Ashdown’s selective enrichment broth (Wuthiekanun et al., 1995; Brook et al., 1997). The pre-enriched broths are subsequently cultured on selective Ashdown’s agar, and the detection of B. pseudomallei is based on the observation of colony morphology and microscopic examination (White, 2003). However, Brook et al. (1997) performed comparative experiments and noted that neither enrichment broth nor plating-out medium yields maximum sensitivity for detecting B. pseudomallei in environmental samples. Moreover, it is possible that the culture-based method could not detect viable but nonculturable cells of the bacterium (Brook et al. , 1997; Sprague and Neubauer, 2004; Inglis and Sagripanti, 2006; Currie, 2008). To overcome the limitations of the culture-based method, the currently most commonly used molecular techniques of PCR or real-time PCR assays have been developed to detect B. pseudomallei in both clinical and environmental samples. Many target genes of B. pseudomallei have been used for primer designation and PCR performance. Using DNA templates extracted from pure cultures of different species, the PCR assays targeting the ribosomal protein subunit (rpsU) and flagellin (fliC) genes are

Chapter 1 unable to distinguish B. pseudomallei , B. mallei and B. thailandensis (Hagen et al. , 2002). 16S rDNA PCR assays have been used for detection of B. pseudomallei in the enriched cultures of environmental samples (Brook et al. , 1997; Kao et al. , 2003), but those assays still show less sensitivity and specificity in clinical specimens (Kunakorn et al. , 2000). Recently, the real-time PCR assays targeting the type three secretion system 1 (TTSS 1) gene and the BPSS 1187 coding region have been developed (Brook et al. , 1997; Kao et al. , 2003; Novak et al. , 2006; Kaestli et al. , 2007; Supaprom et al. , 2007). For clinical diagnosis, both assays provide highly sensitive tools for rapid detection of B. pseudomallei in blood specimens of melioidosis cases with septic shock (Brook et al. , 1997; Kao et al. , 2003; Novak et al. , 2006; Kaestli et al. , 2007; Supaprom et al. , 2007). For environmental surveillance, the TTSS 1 real-time PCR assay has been successfully used for the detection of B. pseudomallei in soil samples from Northern Australia, although quantification results are limited (Kaestli et al, 2007; Kaestli et al, 2009). Further evaluations on both reliable detection and accurate quantification of these assays are still required.

1.4. What do we know about melioidosis in Vietnam? In Vietnam, the first case of melioidosis was detected at the Pasteur Institute, Ho Chi Minh City, in 1925 (Dance, 1991). After several further cases were reported, the first evidence of the existence of saprophytic B. pseudomallei was also obtained by Vaucel in Hanoi. Afterward, the bacterium was also found in the environment of Saigon by Chambon (Dance, 1991). During the Vietnam wars, a large number of Western soldiers were intimately exposed to environmental B. pseudomallei through contaminated wounds and burns or by inhalation. At that time, the infected soldiers were examined at clinical and laboratory facilities, making possible the laboratory confirmation of a diagnosis of melioidosis ((Dance, 1991; White, 2003; Cheng and Currie, 2005). As a result, at least 100 cases of melioidosis were recognized among French colonials in Indochina from 1948 through 1954. By 1973, 343 cases had also been reported in American soldiers fighting in Vietnam. Moreover, many cases have continued to be reported in returning veterans from the Vietnam wars for up to 29 years after exposure. The long incubation period of melioidosis inspired the sobriquet “the Vietnamese time bomb” for this disease (Cheng and Currie, 2005). Since Independence Day on the 30 th of April 1975, limited information on melioidosis has been reported from this country. In Northern Vietnam, a pilot study showed that antibodies against B. pseudomallei antigens can be detected among the

Chapter 1 population in suburban areas of Hanoi (Van Phung et al., 1993). Clinical evidence of the disease has been found only in six patients, from whom B. pseudomallei isolates were used for analyzing cellular lipid and fatty acid compositions (Phung et al., 1995). In Southern Vietnam, a recent study in a large referral hospital reported a low incidence of B. pseudomallei -positive blood cultures that correlated with a restricted distribution of B. pseudomallei in the environment around Ho Chi Minh City (Parry et al., 1999). However, patchy distribution of virulent B. pseudomallei in the environment has been shown in other endemic countries, such as Thailand (Vuddhakul et al. , 1999; White, 2003; Cheng and Currie, 2005). Therefore, the prevalence of the disease as well as the distribution of B. pseudomallei in the environment in Northern Vietnam still remains to be elucidated.

2. Aims of the study This thesis focused on the following aspects of meliodosis and its etiologic agent B. pseudomallei : First, the distribution of melioidosis currently affecting the indigenous population in Northern Vietnam was investigated. New findings on the epidemiology of the disease in this part of the country are presented in chapter 2. Second, knowledge was gained on bacterial characteristics of clinical B. pseudomallei isolates collected from Northern Vietnam. Phenotypic and genotypic information of the isolates are also presented in chapter 2. Based on pilot environmental studies in parts of Northern Vietnam (see Appendix), the final aim was to improve the currently available methodology for studying the environmental presence of B. pseudomallei . A new culture-based method for the quantification of viable B. pseudomallei from soil samples is presented in chapter 3 and a new, highly sensitive DNA-based method for the quantification of B. pseudomallei from soil samples is presented in chapter 4.

Chapter 2

Clinical and microbiological features of melioidosis in Northern Vietnam

Doan Mai Phuong, Trinh Thanh Trung, Katrin Breitbach, Nguyen Quang Tuan, Ulrich Nübel, Gisela Flunker, Dinh Duy Khang, Nguyen Xuan Quang, and Ivo Steinmetz.

Transactions of The Royal Society of Tropical Medicine and Hygiene. 2008. 102 Suppl 1: S30-36.

22 Transactions of the Royal Society of Tropical Medicine and Hygiene (2008) 102/S1, S30 S36

available at www.sciencedirect.com

journal homepage: www.elsevierhealth.com/journals/trs t

Clinical and microbiological features of melioidosis in northern Vietnam

Doan Mai Phuong a, Trinh Thanh Trung b, Katrin Breitbach b, Nguyen Quang Tuan c, Ulrich N¨ubel d, Gisela Flunker b, Dinh Duy Khang e, Nguyen Xuan Quang a, Ivo Steinmetz b, * Department of Microbiology, Bach Mai Hospital, 78 Giai Phong Road, Hanoi, Vietnam bFriedrich Loefﬂer Institute of Medical Microbiology, Ernst Moritz Arndt University Greifswald, Martin-Luther-Str. 6, 17489 Greifswald, Germany cDepartment of Infectious Diseases, Bach Mai Hospital, 78 Giai Phong Road, Hanoi, Vietnam d Robert Koch Institute, Burgstr. 37, 38855 Wernigerode, Germany eVietnamese Academy of Science and Technology, Institute of Biotechnology, 18 Hoang Quoc Viet, Hanoi, Vietnam

KEYWORDS Summary Sporadic cases of melioidosis have been reported from Vietnam for decades, but Melioidosis clinical and epidemiological data for the indigenous population are still scarce. In this study, we Burkholderia reviewed clinical and demographic data of patients with culture-proven melioidosis diagnosed pseudomallei at a single large referral hospital in Hanoi between November 1997 and December 2005. Genetic diversity We found that the clinical manifestations of melioidosis (with fatal septicaemia as the most Epidemiology common presentation), a high rate of underlying diseases, and a peak of cases admitted Sepsis during the wet season, were similar to studies from other endemic areas. The geographical Vietnam origin of patients with melioidosis showed that melioidosis existed in at least 18 northern provinces. The characterization of clinical Burkholderia pseudomallei strains by multilocus sequence typing identiﬁed 17 different sequence types (STs), 11 of which have (as yet) not been found outside Vietnam. Several of these STs presumably were generated through recent evolutionary events in this rapidly diversifying bacterial species, and thus, restricted geographic distribution may be a consequence of limited time passed since emergence. To our knowledge, this is the ﬁrst report on a series of cases describing clinical and epidemiological features of melioidosis and corresponding B. pseudomallei strains from northern Vietnam. © 2008 Published by Elsevier Ltd on behalf of Royal Society of Tropical Medicine and Hygiene.

1. Introduction with a restricted distribution of B. pseudomallei in the environment around Ho Chi Minh City. 1 However, surveys in The worldwide burden of melioidosis, an infectious disease other countries have shown that virulent B. pseudomallei of the tropics and subtropics caused by the soil bacterium might show a patchy distribution in the environment. 2,3 Burkholderia pseudomallei , is still unknown. In Vietnam, In a pilot study from northern Vietnam, Van Phung only very limited data on melioidosis are available for et al. 4 reported that antibodies against B. pseudomallei the indigenous population, although the disease received antigens can be detected among the population in suburban considerable attention amongst French colonials and areas of Hanoi. As a ﬁrst step towards an analysis of American soldiers. A recent study from a large referral epidemiological and clinical features of melioidosis in hospital in southern Vietnam reported a low incidence northern Vietnam, we reviewed clinical and demographic of B. pseudomallei -positive blood cultures that correlated data of patients with culture-proven melioidosis diagnosed * Corresponding author. at Bach Mai Hospital in Hanoi between November 1997 Tel.: +49 3834 86 5587; fax: +49 3834 86 5561. and December 2005. Moreover, we characterized clinical E-mail address: [email protected] B. pseudomallei strains isolated between June 2002 and (I. Steinmetz). December 2005.

2. Materials and methods submitted to the MLST database for B. pseudomallei and sequence types (STs) assigned. The complete set of allelic 2.1. Clinical and microbiological data analysis profiles available from this database as of 7 November 2007 We reviewed clinical and demographic data of 54 patients was downloaded and used for calculation of a minimum with culture-proven melioidosis admitted to Bach Mai spanning tree by applying Bionumerics software version 5.10 Hospital in Hanoi between November 1997 and December (Applied Maths, Sint-Martens-Latem, Belgium), with priority 2005. Bach Mai Hospital in Hanoi is a 1,450-bed government rules causing STs with the maximum number of single locus hospital with 60,000 to 65,000 in-patients and 400,000 variants and double locus variants to be linked first and no to 450,000 out-patients per year. Patients come from cross-linking allowed. Hanoi and the surrounding provinces in northern Vietnam. Melioidosis patients were either referred on clinical grounds from local hospitals in the various provinces or were directly 3. Results admitted to Bach Mai Hospital. Additionally, we reviewed 3.1. Characteristics of melioidosis patients admitted data from 21 patients who were admitted to other hospitals to Bach Mai Hospital between November 1997 and during the same period, but where B. pseudomallei was December 2005 isolated from their specimens at the Department of Medical Microbiology, Bach Mai Hospital. Five Bach Mai patients and Our analysis included 49 patients from whom B. pseu- 15 non-Bach Mai patients were excluded from the study domallei was isolated from one or more specimens. The because data were incomplete (see below). mean age of all patients with melioidosis was 45.8 years ± During the study period, blood cultures were routinely (SD 16.8). The male female ratio was 1.9:1 (32:17) examined using BACTEC Plus Aerobic/F medium bottles and and 69.4% of patients were rice farmers. There was a the BACTEC 9050 automated blood culture system (Becton striking seasonal accumulation of cases with 28 (57.1%) Dickinson, Sparks, MD, USA). Subcultures and direct isola- patients admitted during the wet season between June and tion of B. pseudomallei from sputum, pus, or fluids were September (Fisher’s exact test: P < 0.05, odds ratio = 2.75). obtained on blood agar. Identification of B. pseudomallei In 40 (81.6%) melioidosis patients, the primary diagnosis was based on Gram staining (rod-shape and lsquo;safety- was septicaemia and B. pseudomallei was isolated from pin’ bipolarity), a positive oxidase test, wrinkled colony the blood. In 23 (57.5%) of these septicaemic patients, morphology, characteristic earthy odour, and gentamicin clinical evidence for the potential source of infection resistance using disk susceptibility tests. The API 20NE was obtained. Eighteen (45%) septicaemic patients had identification system (bioMérieux,Marcy-l’Etoile, France) clinical signs of respiratory tract infection, including was used to confirm B. pseudomallei isolates. Five Bach Mai pneumonia, pleuritis and lung abscesses. In five of these patients and nine non-Bach Mai patients were excluded patients, B. pseudomallei could be isolated from sputum. from the data analysis because the use of API 20NE was In one septicaemic patient, B. pseudomallei was isolated not documented in the laboratory notes. Six non-Bach Mai from urine. In three septicaemic patients, the additional patients were excluded because neither their clinical data diagnosis of hepatic abscesses was made by ultrasound. One nor the residential addresses were available. septicaemic 12-year-old boy presented with a suppurative parotitis from which B. pseudomallei was grown. Skin 2.2. Characterization of clinical Burkholderia abscesses were found in one patient. The median duration pseudomallei strains of signs and symptoms of patients with septicaemia such as fever, jaundice, dyspnoea, or pain before admission was From June 2002 to December 2005, 25 B. pseudomallei 14.5 d (range 1 120). The mean ( ±SD) white blood cell isolates were stored for further characterization. The iden- count on admission was 11,510 ±7,458 cells/mm 3. Seven- tification of all 25 isolates was confirmed at the Department teen (42.5%) patients had known risk factors for melioidosis; of Medical Microbiology at the University of Greifswald, 10 (25%) with diabetes mellitus and three (7.5%) with Germany, using the methods described above. In addition, renal disease. Four (10%) patients had other risk factors: all isolates proved to be polymyxin B resistant and were alcoholism (2), history of tuberculosis (1) and lymphoma (1). tested positive with a B. pseudomallei -specific monoclonal Thirty-one (77.5%) septicaemic patients were treated with antibody-based latex agglutination test. 5 recA gene at least one drug that was tested to be active against the sequence analysis was performed after PCR using chromo- isolated strain. Twenty-three (57.5%) received ceftazidime somal DNA as the template and Burkholderia genus-specific or imipenem (one patient), which proved to be effective for primers BUR1 and BUR2. 6 Sequencing was carried out with the treatment of severe melioidosis. 3 Another four (10%) the same primers and results were compared to the recA patients received cefoperazone or cefotaxime, which was sequence of B. pseudomallei reference strain K96243T. 7 not tested against the isolated strain. Seventeen (42.5%) Minimal inhibitory concentrations (MICs) of antibiotics were patients with a positive blood culture died, nine (52.9%) determined by using the BD Phoenix Automated Microbiol- deaths occurred 48 h after admission. ogy System (Becton Dickinson). MICs for chloramphenicol Of the nine non-septicaemic patients, three presented were determined by E-Test (AB Biodisk, Solna, Sweden). with the primary diagnosis of pneumonia with B. pseudoma- Multilocus sequence typing (MLST) was performed llei culture-positive sputa. In one of these patients, a liver according to the method of Godoy et al. 8 The primers used abscess was evident by ultrasound and, in two patients, for amplification and sequencing of the seven housekeeping pus from a splenic abscess grew B. pseudomallei . One gene fragments are found at the B. pseudomallei MLST patient had a pericarditis with culture-positive pericardial website (http://www.mlst.net). Novel allelic profiles were fluid. Two patients had genitourinary infections, one of S32 D.M. Phuong et al.

Fig. 1. Geographical distribution of the homes of 55 culture-confirmed melioidosis patients diagnosed at the Department of Medical Microbiology at Bach Mai Hospital, Hanoi, Vietnam, between November 1997 and December 2005. Included are also six patients who were not admitted to Bach Mai Hospital, but where Burkholderia pseudomallei was isolated from their specimens at the Department of Medical Microbiology, Bach Mai Hospital. Dots and squares represent the homes of melioidosis patients diagnosed between November 1997 and December 2005. Squares represent the homes of patients that are presented in Table 1. The asterisk represents the city of Hanoi where five patients originated from. The map was constructed by using MapInfo professional software version 7.8 (MapInfo Corp., Troy, NY, USA). them with prostatitis with positive urine cultures. In one distribution data show that melioidosis exists in at least 18 patient with a septic arthritis, B. pseudomallei could be provinces, covering an area of approximately 90,000 km 2 grown from synovial fluid. The mean ( ±SD) duration of signs with a population of more than 30 million. and symptoms such as fever, jaundice, dyspnoea and pain before admission was 55 ±61.4 d. The mean ( ±SD) white 3.3. Characteristics of clinical Burkholderia pseudomallei blood cell count on admission was 9,878 ±4,274 cells/mm 3. strains Seven of the non-septicaemic patients had known risk Twenty-five strains of B. pseudomallei from patients who factors for melioidosis; four patients with diabetes mellitus, were diagnosed between June 2002 and December 2005 two patients with renal disease, and one patient with both were available for further characterization. The com- diabetes and renal disease. Six patients were treated with plete recA gene sequence analysis, recently shown to a drug (ceftazidime or ampicillin/sulbactam) shown to be identify Burkholderia spp. with high accuracy, 6 revealed effective against the isolated strain. All patients recovered 100% identity for all 25 strains compared to the reference and were discharged. B. pseudomallei recA sequence. Table 1 summarizes the characteristics of these strains and the corresponding pa- 3.2. Geographical origin of melioidosis patients diagnosed tients. Determination of the MIC of the strains from Table 1 at Bach Mai Hospital between November 1997 and confirmed the high level of resistance to many antibiotics December 2005 (data not shown). However, the MICs for drugs currently The widespread distribution of the homes of 55 melioidosis recommended for the treatment of melioidosis revealed patients from this study is shown in Figure 1. With the that all strains were sensitive to ceftazidime (MIC ¶ 4 assumption that the residential address of the patients is for all strains), imipenem (MIC range ¶2), meropenem the most likely place where the infection occurred, the (MIC range ¶2), ampicillin/sulbactam (MIC range ¶8/4), Clinical and microbiological features of melioidosis in northern Vietnam S33 Monoclonal antibody agglutination recA gene identity c profile 1 156 577 100% + API 20NE a Source of B. pseudomallei isolate pus Outcome (days after admission) b ) 3 1,900 Recovered Urine 1 556 577 100% + 7,100 Died (10 d) Blood 1 556 577 100% + History of falling into a pool of muddy water. (cells/ mm 14,400 Recovered Urine 1 556 577 100% + f Diabetes 4,700 Died (2 d) Blood, sputum 1 556 577 100% + glomerulonephritis syndrome None 27,800 Recovered Blood, sputum, None 9,900 Died (11 d) Blood 1 156 577 100% + None 12,200 Died (1 d) Blood 1 156 577 100% + urolithiasis strains diagnosed between June 2002 and December 2005 f e lung abscess Primary diagnosis Underlying disease WBC pleuritis abscess All profiles are considered to be an excellent identification result according to the current version of the API interpretation software. Burkholderia pseudomallei c 3 Septicaemia, pneumonia None 7,800 Recovered Blood 1 556 577 100% + 7 Pneumonia Diabetes 7,700 NA Blood 1 156 576 100% + 10 Septicaemia, pneumonia None 7,100 Died (2 d) Blood, sputum 1 156 577 100% + 60 Septicaemia, pneumonia Alcoholism 12,600 Recovered Blood 1 556 577 100% + 30 Septicaemia Nephropathy, Duration of symptoms (d) 180 NA Nephritic White blood cell count. b This patient underwent an appendectomy in another hospital 3 d prior to admission. dyspnoea dyspnoea, cough cough admission anorexia dysuria weight loss e Admission Signs and symptoms on (yrs), sex 60, M Jul 2003 Fever, chills, dyspnoea 3 Septicaemia, skin Characteristics of melioidosis patients and corresponding d NA: data not available; +:Previous positive. occupation unknown. Rice farmer 64, MRice farmer 41, Apr M 2004 Jul 2004 Fever, dyspnoea Chest pain, dyspnoea, 20 Septicaemia, pneumonia None 8,700 Recovered Blood, sputum 1 556 577 100% + NA 52, M Sep 2004 Fever, chills, dysuria 3 Prostatitis Diabetes, Rice farmer 39, F Aug 2004 Fever, chest pain, Rice farmer 78, M Jul 2004 Fever, chest pain, Table 1 Occupation Age Bach Mai hospital patients Rice farmer 43, MRetired Jun 2002 Fever, chills 15 Septicaemia Diabetes NA Recovered Blood 1 556 577 100% + a d NARetiredNA 61, M 50, M Nov 2003 Aug 2003 53, M Fever, dyspnoea Fever, chills Apr 2004 Fever, chills 10 15 Pneumonia, peripleuritis 14 None Septicaemia Septicaemia, pneumonia, 13,300 Lymphoma Recovered Sputum 7,000 Died (3 d)Rice 1 farmer 556 577 37, M Blood 100%Rice farmer 78, M SepRice 2005 farmer + 53, F Sep 2005 Fever Nov 2005 Fever, cough, dyspnoea 1 556 577 Fever, fatigue, 100% cough 20 + 30 Septicaemia, pneumonia 1 None Pneumonia Septicaemia, pneumonia Diabetes 20,800 Diabetes Died (9 d) Blood 9,300 Died (1 8,800 d) Recovered Blood 1 556 537 Sputum 100% + 1 156 1 577 556 574 100% 100% + + Rice farmer 18, F Nov 2004 Fatigue, oedema, Rice farmer 48, M Jan 2005 Fever, chills, dyspnoea 5 Septicaemia, pneumonia, Non-Bach Mai hospital patients Rice farmer 35, M May 2005 Fever, chest pain 8 Septicaemia Diabetes 5,100 NA Blood 1 156 577 100% + Rice farmer 71, MRice farmer 58, M Jan 2005 Feb 2005 Fever, dyspnoea, cough Oedema, dyspnoea, 30 Pericarditis Nephritis 9,200 Recovered Pericardial fluid 1 556 577 100% + Rice farmer 42, M Apr 2005 Fatigue, fever, chills 20 Septicaemia, pneumonia Diabetes 4,400 Recovered Blood 1 156 577 100% + Retired 69, M Jul 2005 Fever, cough, dysuria 14 Septicaemia Diabetes 9,700 Recovered Blood 1 556 577 100% + Rice farmer 74, MPupil Jun 2005 Fever 12, M Aug 2005 Fever, headache, nausea 3 7 Septicaemia, parotitis None Spleen abscess 24,900 None Recovered Blood, pus 6,900 1 556 577 Recovered 100% Pus + 1 556 577 100% + NA 45, M Oct 2005 Fever, fatigue, Rice farmer 49, M Dec 2005 Fever, chills 7 Septicaemia None 15,500 NA Blood 1 556 577 100% + Rice farmer 17, F Aug 2005 Fever, dyspnoea 1 Septicaemia S34 D.M. Phuong et al.

Fig. 2. Minimum spanning tree based on allelic profiles from 583 Burkholderia pseudomallei sequence types (STs) currently available from the database at http://www.mlst.net. Each node in the dendrogram represents a unique ST. Enlarged circles represent STs of isolates from Vietnam that are reported in this study. Squares represent STs of isolates from Vietnam that were reported previously. Black symbols (circles and squares) indicate STs found exclusively in Vietnam, halved symbols indicate STs that were found in Vietnam and elsewhere. Solid lines connect single-locus variants, dotted lines connect STs that differ at more than one locus, and lengths of dotted lines are proportional to the number of differing loci. Founders of clonal complexes and major clades previously identified through eBURST analyses are indicated (ST 48, ST 70, ST 76). co-trimoxazole (MIC range ¶2/38) and chloramphenicol determined through previous analyses applying the eBURST (MIC range ¶8). With tetracycline, 21 (84%) strains of algorithm (Figure 2). 9,10 B. pseudomallei were sensitive (MIC range ¶4), with one resistant strain (MIC > 8) and three intermediate resistant strains (MIC = 8). 4. Discussion Studies from Thailand have shown that virulent B. pseu- 3.4. Diversity and genetic relatedness of clinical domallei is not evenly distributed in the environment, but Burkholderia pseudomallei strains can be found in high numbers in some provinces, whereas Characterization of the 25 clinical B. pseudomallei strains other parts of the country are not affected. 2 The results from Vietnam by MLST identified 17 different STs. Among of our study support a similar phenomenon in Vietnam. In them were 11 STs not previously described, including three contrast to recent studies from southern Vietnam, we found new alleles at two loci ( gmhD and ndh ). In addition to a wide distribution of melioidosis cases in northern Vietnam. previous studies by other researchers, a total of 26 different The seasonal periodicity of the cases, with a peak occurring STs have now been documented for B. pseudomallei during the time of the year when rainfall is heaviest, has from Vietnam. These STs are affiliated with multiple also been observed in other endemic areas, 11 and might phylogenetic lineages that encompass other isolates from be explained by an increased occupational exposure of rice different geographic regions, notably from other countries farmers and/or a higher concentration of B. pseudomallei in Southeast Asia (Figure 2). Among 16 STs that are (as yet) in the environment during the wet season. In this context, specific to Vietnam, nine are positioned at the very tips of inhalation is increasingly being suggested as a mode of various branches in the minimum-spanning tree (Figure 2), acquisition of melioidosis. 12 Organ involvement and the high and hence, may have arisen through recent evolutionary rate of underlying diseases in melioidosis patients from this events. However, the other seven STs appear ancestral study were similar to those reported from other studies, to strains from Thailand and other places; for example, with severe pneumonia and septicaemia being the most ST 541 and ST 551 interconnect ST 48 and ST 70, which common clinical presentations. 13 The high mortality rate of are the presumed founders of clonal complexes that were septicaemic melioidosis in our study is in agreement with Clinical and microbiological features of melioidosis in northern Vietnam S35 data from northern Australia and northeast Thailand. 11,13 Authors’ contributions: DMP, DDK, NXQ and IS contributed The suppurative parotitis in the 12-year-old septicaemic to the design of the study; DMP and NQT collected clinical boy (Table 1) represents a unique syndrome that has data; DMP, TTT, KB and GF conducted the microbiological been described among paediatric melioidosis patients in characterization of strains; DMP,TTT, KB, NQT, GF, UN and IS northeast Thailand. 14 carried out the analysis and interpretation of clinical and/or A large proportion of contemporary B. pseudomallei laboratory data; IS drafted the paper. All authors critically isolates from Vietnam are positioned at the very tips of the read and approved the final manuscript. DMP and IS are minimum-spanning tree (Figure 2). In contrast, STs derived guarantors of the paper. from a historical collection from the 1960s are positioned mostly at more ancestral positions. 9 This finding may be Acknowledgements: We thank the entire staff of the Bac- explained by a very rapid evolution of B. pseudomallei terial Section in the Department of Medical Microbiology, that produces numerous novel STs within decades, similar Bach Mai Hospital, for their contribution in laboratory and 15 16 to Neisseria meningitidis or Helicobacter pylori . The clinical data retrieval from patients’ records; Nguyen Ngoc mechanism driving this diversification is likely to be a high Minh for his help in constructing the map of patients’ homes, rate of homologous recombination, which was previously and Helga Schalimow for excellent technical assistance. proposed as the reason for the remarkably large number of B. pseudomallei STs resolved by MLST despite a very low Funding : None. sequence diversity at the loci investigated. 8,10 Young STs are more likely to have a country-specific Conflicts of interest : None declared. distribution, since they may not yet have had sufficient time to disperse. Accordingly, STs that have a documented Ethics approval : Not required. widespread occurrence in several countries, including Vietnam, are known to have persisted in the environment for decades, since they were present in the recently References investigated historical collection (e.g. ST 46, ST 169, ST 211, ST 411). Hence, dispersal of B. pseudomallei 1. Parry CM, Wuthiekanun V, Hoa NT, Diep TS, Thao LT, between different countries within Southeast Asia may Loc PV, et al. Melioidosis in Southern Vietnam: clinical occur within years. However, we did not detect any STs surveillance and environmental sampling. Clin Infect Dis that had previously been found in northern Australia, 1999; 29 :1323 6. consistent with previous studies and presumably indicating 2. Cheng AC, Currie BJ. Melioidosis: epidemiology, pathophys- that intercontinental spread may be more strongly iology, and management. Clin Microbiol Rev 2005; 18 :383 416. hampered. 10,17 3. White NJ. Melioidosis. Lancet 2003; 361 :1715 22. The number of B. pseudomallei isolates analysed in 4. Van Phung L, Quynh HT, Yabuuchi E, Dance DA. Pilot study the present study is rather limited. More comprehensive of exposure to Pseudomonas pseudomallei in northern investigations of the genetic population structure and its Vietnam. Trans R Soc Trop Med Hyg 1993; 87 :416. relationship to disease epidemiology in Vietnam will require 5. Steinmetz I, Reganzerowski A, Brenneke B, Haussler S, additional isolates. Simpson A, White NJ. Rapid identification of Burkholde- The melioidosis patients seen at our hospital most ria pseudomallei by latex agglutination based on an likely represent the very tip of the iceberg of cases in exopolysaccharide-specific monoclonal antibody. J Clin northern Vietnam. As a large referral clinic, Bach Mai Microbiol 1999; 37 :225 8. Hospital belongs to the very few institutions in Vietnam 6. Payne GW, Vandamme P, Morgan SH, Lipuma JJ, Coenye T, where a biochemical identification of Gram-negative, non- Weightman AJ, et al. Development of a recA gene-based fermenting rods isolated from blood cultures has been identification approach for the entire Burkholderia genus. routinely performed to the species level. However, it Appl Environ Microbiol 2005; 71 :3917 27. seems possible that B. pseudomallei was still under- 7. Holden MT, Titball RW, Peacock SJ, Cerdeno-Tarraga AM, diagnosed from blood cultures because the API 20NE Atkins T, Crossman LC, et al. Genomic plasticity of the may not be entirely reliable for identification of the causative agent of melioidosis, Burkholderia pseudomallei . organism. 18 Moreover, B. pseudomallei was likely missed Proc Natl Acad Sci USA 2004; 101 :14240 5. from specimens from non-sterile sites such as sputum 8. Godoy D, Randle G, Simpson AJ, Aanensen DM, Pitt TL, because a selective medium (e.g. Ashdown agar) for Kinoshita R, et al. Multilocus sequence typing and B. pseudomallei screening was not used during the study evolutionary relationships among the causative agents of melioidosis and glanders, Burkholderia pseudomallei and period. Most patients from the northern provinces only Burkholderia mallei . J Clin Microbiol 2003; 41 :2068 79. have access to smaller hospitals where microbiological 9. McCombie RL, Finkelstein RA, Woods DE. Multilocus facilities are either not available or under-resourced and, sequence typing of historical Burkholderia pseudomallei consequently, melioidosis cannot be diagnosed. Prospective isolates collected in Southeast Asia from 1964 to 1967 studies, an increased awareness in hospitals, and the provides insight into the epidemiology of melioidosis. J Clin implementation of screening methods for B. pseudomallei Microbiol 2006; 44 :2951 62. in clinical laboratories are needed to unravel the true 10. Vesaratchavest M, Tumapa S, Day NP, Wuthiekanun V, prevalence of melioidosis and its clinical presentations in Chierakul W, Holden MT, et al. Nonrandom distribution Vietnam. Environmental surveys of B. pseudomallei will of Burkholderia pseudomallei clones in relation to provide further insights into the distribution and population geographical location and virulence. J Clin Microbiol biology of this bacterium in this part of the world. 2006; 44 :2553 7. S36 D.M. Phuong et al.

11. Currie BJ, Fisher DA, Howard DM, Burrow JN, Lo D, Selva- et al. Fit genotypes and escape variants of subgroup III Nayagam S, et al. Endemic melioidosis in tropical northern Neisseria meningitidis during three pandemics of epidemic Australia: a 10-year prospective study and review of the meningitis. Proc Natl Acad Sci USA 2001; 98 :5234 9. literature. Clin Infect Dis 2000; 31 :981 6. 16. Linz B, Balloux F, Moodley Y, Manica A, Liu H, Roumagnac P, 12. Currie BJ, Jacups SP. Intensity of rainfall and severity of et al. An African origin for the intimate association between melioidosis, Australia. Emerg Infect Dis 2003; 9:1538 42. humans and Helicobacter pylori . Nature 2007; 445 :915 8. 13. Chaowagul W, White NJ, Dance DA, Wattanagoon Y, 17. Currie BJ, Thomas AD, Godoy D, Dance DA, Cheng AC, Naigowit P, Davis TM, et al. Melioidosis: a major cause of Ward L, et al. Australian and Thai isolates of Burkholderia community-acquired septicemia in northeastern Thailand. pseudomallei are distinct by multilocus sequence typing: J Infect Dis 1989; 159 :890 9. revision of a case of mistaken identity. J Clin Microbiol 14. Dance DA, Davis TM, Wattanagoon Y, Chaowagul W, 2007; 45 :3828 9. Saiphan P, Looareesuwan S, et al. Acute suppurative 18. Inglis TJ, Merritt A, Chidlow G, Aravena-Roman M, parotitis caused by Pseudomonas pseudomallei in children. Harnett G. Comparison of diagnostic laboratory methods J Infect Dis 1989; 159 :654 60. for identiﬁcation of Burkholderia pseudomallei . J Clin 15. Zhu P,van der Ende A, Falush D, Brieske N, Morelli G, Linz B, Microbiol 2005; 43 :2201 6. Chapter 3

Chapter 3

Improved culture-based detection and quantification of Burkholderia pseudomallei from soil

Trinh Thanh Trung, Adrian Hetzer, Eylin Topfstedt, Andre Göhler, Direk Limmathurotsakul, Vanaporn Wuthiekanun, Sharon J. Peacock, and Ivo Steinmetz.

Transactions of The Royal Society of Tropical Medicine and Hygiene . 2011. 105(6): 346-51.

31 Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351

Contents lists available at ScienceDirect Transactions of the Royal Society of Tropical Medicine and Hygiene journal homepage: http://www.elsevier.com/locate/trstmh

Improved culture•based detection and quantiﬁcation of Burkholderia pseudomallei from soil

Trinh Thanh Trung a, Adrian Hetzer a, Eylin Topfstedt a, Andre Göhler a, Direk Limmathurotsakul b,c, Vanaporn Wuthiekanun b, Sharon J. Peacock b,d,e, Ivo Steinmetz a,∗ a Friedrich Loefﬂer Institute of Medical Microbiology, Ernst Moritz Arndt University of Greifswald, Greifswald, Germany b Mahidol•Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand c Department of Tropical Hygiene, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand d Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand e Department of Medicine, Cambridge University, Addenbrooke’s Hospital, Cambridge, UK article info abstract

Article history: Environmental surveillance of the Gram•negative soil bacterium Burkholderia pseudomallei , Received 7 August 2010 the aetiological agent of melioidosis, is important in order to define human popula• Received in revised form 7 March 2011 tions and livestock at risk of acquiring the infection. This study aimed to develop a Accepted 7 March 2011 more sensitive method for the detection of B. pseudomallei from soil samples in endemic Available online 4 May 2011 areas compared with the currently used culture method based on soil dispersion in water. We report the development of a new protocol that involves soil dispersion in Keywords: a polyethylene glycol (PEG) and sodium deoxycholate (DOC) solution to increase the Burkholderia pseudomallei Melioidosis yield of viable B. pseudomallei from soil samples. Comparative testing of soil samples Soil from Northeast Thailand covering a wide range of B. pseudomallei concentrations demon• Culturing strated a significantly higher recovery ( P < 0.0001) of B. pseudomallei colony•forming Polyethylene glycol units by the new method compared with the conventional method. The data indi• Sodium deoxycholate cate that using the detergents PEG and DOC not only results in a higher recovery of viable B. pseudomallei but also results in a shift in the bacterial species recovered from soil samples. Future studies on the geographical distribution and population struc• ture of B. pseudomallei in soil are likely to benefit from the new protocol described here. © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

1. Introduction still unknown. Studies from Thailand have shown that virulent B. pseudomallei is not evenly distributed in the The Gram•negative ␤•proteobacterium Burkholderia environment 2 but can be found in high numbers in pseudomallei has a dual lifestyle, primarily residing in soil some provinces whereas other parts of the country are and surface water of subtropical and tropical regions but not affected. 3 Since the occurrence of disease correlates also exhibiting an intracellular life cycle in mammalian with the presence of B. pseudomallei in the environment, and non•mammalian hosts causing the infectious disease deﬁning the presence and geographic distribution of melioidosis. 1 The worldwide burden of melioidosis is this pathogen is a useful tool to assess the risk of infec• tion for a given population. Culture•based methods are also needed to analyse phenotypic characteristics of individual environmental B. pseudomallei strains and to ∗ Corresponding author. Tel.: +49 3834 865 587; fax: +49 3834 865 561. deﬁne the variety of genotypes present in individual soil 4–7 E•mail address: steinmetz.ivo@uni•greifswald.de (I. Steinmetz). samples.

0035•9203/$ – see front matter © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved. doi: 10.1016/j.trstmh.2011.03.004 T.T. Trung et al. / Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351 347

In a number of environmental studies, B. pseudomallei 2.2. Culture•based methods to enumerate Burkholderia was successfully isolated and quantified from soil sam• pseudomallei in soil samples ples in Thailand, 3,8,9 Southern Vietnam 10 and Laos 11 by a protocol introduced by Wuthiekanun et al. in 1995 9 Soil was mechanically homogenised prior to the that was then adapted to larger sample sizes by Smith experiments to achieve a more uniform distribution of et al. 8 in the same year. The protocol is based on microorganisms within the samples and to ensure that homogenisation of the soil sample in distilled water by 25 g subsamples taken from the original 200 g sample were physical means followed by an overnight sedimentation representative of the sample. Viable B. pseudomallei cells phase and subsequent culturing of the upper aqueous present in homogenised soil samples were then enumer• phase on selective Ashdown’s agar. Generally, distilled ated in three individual experiments performed on three water has been widely used for soil dispersion prior to different days within a week using 25 g subsamples by the quantitative or non•quantitative culturing of B. pseudo• two following methods. mallei in other endemic areas such as Brazil, 12 China, 13 Taiwan 14 and Australia. 15–17 Distilled water has also 2.2.1. PEG•DOC method been used for soil dispersal for other environmental In a sterile 250 ml Erlenmeyer flask, 25 g of microorganisms, 18,19 but there have also been attempts homogenised soil was combined with 50 ml of a PEG• to improve the dissociation of microorganisms from the DOC solution containing 2.5% (w/v) polyethylene glycol soil matrix by using physical or chemical soil dispersion 6000 (SERVA Electrophoresis, Heidelberg, Germany) and methods. 20 0.1% (w/v) sodium deoxycholate (Merck KGaA, Darmstadt, We hypothesised that the culture•dependent detec• Germany) and was shaken vigorously on an orbital shaker tion of B. pseudomallei in environmental samples is at 200 rpm for 2 h. After leaving for 5 min, the upper layer potentially biased by inefficient detachment of bacte• of the PEG•DOC solution was decanted and centrifuged at × rial cells from soil particles prior to direct culturing 1400 g for 10 min to sediment large soil particles. Then, on solid media, resulting in an underestimate of the 100 ␮l aliquots of the supernatant containing the bacteria −1 true bacterial numbers. In this study, we describe a detached from soil and two serial ten•fold dilutions (10 −2 culture protocol using a detergent solution of polyethy• and 10 ) were spread onto Ashdown’s agar plates (per lene glycol (PEG) and sodium deoxycholate (DOC) for litre, 10 g of trypticase soy broth, 40 ml of glycerol, 5 ml of soil dispersion that leads to a higher recovery of 0.1% crystal violet, 5 ml of 1% neutral red and 15 g of agar) B. pseudomallei than the current distilled water•based containing 5 mg/l gentamicin in duplicate (for Day 8 of the protocol. first 10 samples) or in triplicate (the remaining samples). For liquid culture enrichment of B. pseudomallei from soil samples, 1 ml aliquots of the same supernatants were 2. Materials and methods inoculated into 9 ml of selective Galimand broth (TBSS• C50) 9 supplemented with 1 g/l polymyxin B. Following ◦ 2.1. Soil sampling incubation at 40 C for 4 days, the enriched culture was plated on Ashdown’s agar. All agar plates were incubated ◦ Forty sandy loam soil samples were randomly selected at 40 C and were inspected daily for 4 days. The number from rice fields in Amphoe Lao Sua Kok, Ubon Ratchathani of B. pseudomallei colony•forming units (CFU) per gram of Province, Northeast Thailand, from which culture•positive soil was calculated using the following formula: B. pseudo• B. pseudomallei have been obtained in the past. Ten soil mallei CFU/g = number of B. pseudomallei colonies observed × × × samples were collected on 19 January 2010 and another on the agar plate 10 2 dilution factor. The original set of 30 soil samples were collected on 15 March 2010. 200 g sample was considered to be culture•positive if at A standard soil sampling technique was applied 2 by dig• least one 25 g subsample was positive. ging a hole with a spade to a depth of approximately 30 cm 2.2.2. Traditional method and taking 200 g of soil from the base of the hole. The spade The method was applied according to Smith et al. 8 with was cleaned with alcohol before and after sampling at each a minor change in the amount of soil analysed. Briefly, point. 25 ml of sterile water was added to 25 g of homogenised Soil samples sealed in plastic bags and plastic contain• soil. Soil bacteria were dispersed by vigorously shak• ers were shipped by air freight at ambient temperature to ing the emulsion for approximately 1 min. After leaving 21 the laboratory in Greifswald (Germany). A recent report overnight to sediment, 100 ␮l aliquots of the upper water indicated that survival of cultivable B. pseudomallei cells layer were collected for culture on Ashdown’s agar or sharply decreases in liquid media such as rain water when ◦ enrichment culture as described in Section 2.2.1 for the incubated at 2 C for a period of 4 weeks, whereas cell num• PEG•DOC method. The number of B. pseudomallei CFU per bers increased only moderately during this time when kept ◦ gram of soil was calculated as follows: B. pseudomallei at 20 C (V. Wuthiekanun, personal observation). Therefore, CFU/g = number of B. pseudomallei colonies observed on the samples were stored at room temperature until they were agar plate × 10 × dilution factor. analysed. Owing to different transport times, the first set of 10 samples was processed in the laboratory on Days 8, 2.3. Identification of bacterial colonies 12 and 14 after collection and the second set of 30 samples was processed on Days 4, 8 and 11 after soil sampling in Ashdown’s agar plates were initially screened for Northeast Thailand. characteristic B. pseudomallei colony morphology 348 T.T. Trung et al. / Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351

(purple•to•violet, highly wrinkled, flat and dry) and Since we aimed to develop an improved protocol that by taking the appearance of additional morphotypes 22 had to be compared with the current method with respect into account. Colonies suspected to be B. pseudomallei were to B. pseudomallei recovery, we had to deal with the fact that tested by oxidase test and positive colonies were tested fur• any soil sample in the range of grams has to be considered ther using a highly specific latex agglutination test in which as heterogeneous with regard to the distribution of any B. pseudomallei is positive but B. thailandensis is negative. 23 microorganisms and other soil components. This fact ham• Representatives of colonies growing on Ashdown’s agar pers any direct comparisons of analytical methods that are but not displaying the typical B. pseudomallei morphology applied to native soil samples, since strictly identical sam• were identified by gene sequence similarities. As the 16S ples cannot be tested by several methods. To compensate rRNA gene shows only limited sequence variations among for this unavoidable limitation, the original 200 g samples Burkholderia strains, 24 species were first distinguished by from Northeast Thailand were mechanically homogenised their partial recA gene sequence using the primers BUR1 and subsamples of 25 g were used for validation of the new and BUR2. 25 Those isolated colonies remaining negative method. by recA gene PCR (all non• Burkholderia strains) were The impact of the PEG•DOC solution on recovery of B. then further characterised by 16S rRNA gene sequence pseudomallei was further investigated on 25 g subsamples analysis by applying the 27F and 1522R primer set. 26 Gene of three different soil samples (RFT01, RFT02 and RFT08) sequence similarity searches were performed using the by direct comparison using the newly developed proto• BLAST program implemented in the sequence database of col either with PEG•DOC solution or with distilled water the National Center for Biotechnology Information (NCBI) as a detergent substitute. When the PEG•DOC solution (http://www.ncbi.nlm.nih.gov ). was applied, total bacterial cell numbers and B. pseu• domallei were significantly higher in all three samples 2.4. Statistical analyses (Figure 1 ). Moreover, inspection of non• B. pseudomallei bacterial colonies showed significant differences in the The quantitative bacterial count was based on CFU composition of colony phenotypes between both soil obtained by direct plating on Ashdown’s agar and was dispersion methods. To verify this observation experimen• compared using Wilcoxon signed•rank test. Qualitative tally, 16S rRNA and recA gene sequence analyses of selected bacterial culture results were compared by McNemar’s test. colonies that were representative of the different colony Quantitative and qualitative sensitivities of both protocols morphotypes grown on Ashdown’s agar were conducted and all P•values were calculated from 10 000 permutations, after either using the PEG•DOC solution or distilled water. in each of which repeated results on three different days The data in Figure 2 demonstrate a shift towards a higher of each independent soil sample were randomly selected. rate of Burkholderia spp. using the PEG•DOC solution com• The 95% CI of the sensitivity was calculated by permutation pared with distilled water. test. Sensitivity analysis was performed in which positive The newly developed PEG•DOC protocol was further of repeated measures is considered positive, and mean of validated by parallel testing of three 25 g subsamples on repeated measures after log transformation is considered three different days from 40 soil samples each consisting the quantitative count of each specimen. This quantitative originally of 200 g of soil from Northeast Thailand with value was used as summary statistics in Table 1 . the traditional culture method using distilled water and overnight sedimentation. The new method proved to be 3. Results significantly more sensitive as demonstrated by overall higher CFU values for the 40 samples tested ( P < 0.0001). In this study, we reasoned that the traditional soil cul• Nine samples were culture•negative by both methods on ture protocol for the detection of B. pseudomallei from any day including enrichment culture. The results of 31 the environment might underestimate the true number of culture•positive samples are shown in Table 1 . Consid• viable organisms because the bacterial cells are not effi• ering only samples that showed growth on agar plates ciently dissociated from soil particles prior to the culture by both methods ( n = 23), this revealed on average 8.8 steps. times higher CFU value (range 1–219 times) for the To examine the impact of various substances on the PEG•DOC protocol. release of bacteria from soil particles, pilot experiments Interestingly, both methods showed that although the were first performed with B. pseudomallei •spiked soil sam• original samples were mechanically homogenised, the dis• ples that were incubated with double the amount of various tribution of B. pseudomallei within single 200 g samples was solutions for soil dispersion (data not shown). These exper• still heterogeneous as demonstrated by significant differ• iments revealed that addition of a PEG and DOC solution led ences in CFU counts between the three 25 g subsamples to significantly enhanced recovery of viable B. pseudomallei tested (data not shown). In four of the 23 soil samples that cells, whereas use of cetyltrimethylammonium bromide were positive by both culture methods ( Table 1 ) this het• (CTAB) or PBS resulted in lower cell numbers. In addition to erogeneity was reflected by variable positivity of the three the use of a PEG•DOC solution for soil dispersal, a centrifu• subsamples directly on Ashdown’s agar using the tradi• gation step to separate bacteria from soil particles in order tional method, whereas all subsamples of each of these four to obtain a supernatant for subsequent culture was also samples were positive by the PEG•DOC culture protocol. introduced (see Materials and methods section for details) A difference in variability between both culture methods and thereby replaced the overnight sedimentation phase was also documented by determining the coefficients of of the traditional method. variation (CV) for single samples, which were significantly T.T. Trung et al. / Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351 349

Table 1 Comparison of the recovery of viable Burkholderia pseudomallei cells from soil samples ( N = 40) from Northeast Thailand using either the traditional protocol based on soil dispersion in distilled water including an overnight sedimentation phase or the polyethylene glycol–sodium deoxycholate (PEG•DOC) protocol

No. of specimens Traditional protocol PEG•DOC protocol

Agar (mean and range) (CFU/g soil) a Enrichment broth Agar (mean and range) (CFU/g soil) a Enrichment broth

23 (57.5%) 1.8 × 10 2 (0.7 to 4.0 × 10 4) Positive b 1.6 × 10 3 (1.1 to 7.9 × 10 4) Positive b 3 (7.5%) Negative Positive 1.6 × 10 1 (1.9 to 3.9 × 10 1) Positive 4 (10%) Negative Positive Negative Positive 1 (2.5%) Negative Negative Negative Positive 9 (22.5%) Negative Negative Negative Negative

CFU: colony•forming units. a Quantitative result was log transformed, and mean of repeated measures was used as summary statistics for each single specimen. b For eight specimens with highly quantitative count on agar, enrichment broth was not performed but was considered positive.

Figure 1. Comparison of the quantitative recovery of Burkholderia pseudomallei and non• B. pseudomallei colonies grown on Ashdown’s agar after performing soil dispersion using either distilled water (W) or polyethylene glycol and sodium deoxycholate solution (P•D) on three soil samples (RFT01, RFT02 and RFT08). The dispersions were incubated for 2 h followed by a centrifugation step and subsequent incubation of the supernatants on agar as described in the Materials and methods section. Data are mean ± SD of six•fold determinations and are shown as colony•forming units (CFU) per gram of soil (log scale). Signiﬁcant differences between groups (horizontal brackets) calculated with Wilcoxon signed•rank test are shown with an asterisk (* P < 0.05). ND: not detectable; 1: one•tailed t•test.

Figure 2. Comparison of the number of different morphotypes belonging to either the genus Ralstonia or Burkholderia grown on Ashdown’s agar after performing soil dispersion using either distilled water (W) or polyethylene glycol and sodium deoxycholate solution (P•D) on three soil samples (RFT01, RFT02 and RFT08). The dispersions were incubated for 2 h followed by a centrifugation step and subsequent incubation of the supernatants on agar as described in the Materials and methods section. Genotypic identification was based on recA and 16S rRNA gene sequence analysis of 34 non• B. pseudomallei colonies representing different morphotypes. Besides representatives of the genera Burkholderia and Ralstonia , no members belonging to other genera were detected. 350 T.T. Trung et al. / Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351 lower ( P = 0.0012, Wilcoxon signed•rank test) for the PEG• Authors’ contributions: TTT, AH, VW and IS planned the DOC method (CV = 0.2472) compared with the traditional study; VW managed the collection of soil samples; TTT and protocol (CV = 0.3991). There was no significant change in ET conducted the microbiological analysis of soil samples CFU counts between subsamples analysed in the first or and molecular typing of strains; all authors analysed and third culture experiment (paired Student’s t•test), respec• interpreted data; AG and DL performed the statistical anal• tively. Considering only the 31 samples that were positive yses; IS, AH and TTT drafted the paper. All authors critically by either method including enrichment on any day, there is revised the manuscript and read and approved the final a trend showing that the qualitative sensitivity of the PEG• version. TTT, AH and IS are guarantors of the paper. DOC protocol is higher than of the traditional method [93% (95% CI 87–97%) vs. 87% (95% CI 81–94%); P > 0.10]. Conflicts of interest: None.

4. Discussion Funding: None.

The true numbers of viable bacterial cells from soil sam• Ethical approval: Not required. ples are likely to be underestimated in any culture•based method for a variety of reasons. In this study, we focused on References preparation of the cell suspension from soil samples prior to the culture steps. A PEG•DOC solution has previously 1. Wiersinga WJ, van der Poll T, White NJ, Day NP, Peacock SJ. Melioido• been used in a protocol designed to extract Streptomycete sis: insights into the pathogenicity of Burkholderia pseudomallei . Nat 27 Rev Microbiol 2006; 4:272–82. spores but not vegetative bacterial cells from soil. In con• 2. Limmathurotsakul D, Wuthiekanun V, Chantratita N, Wongsuvan G, trast to the spore enrichment protocol, addition of the Amornchai P, Day NPJ, et al. Burkholderia pseudomallei is spatially chelating agent Chelex 100 to PEG and DOC did not sig• distributed in soil in Northeast Thailand. PloS Negl Trop Dis 2010; 4:8. 3. Vuddhakul V, Tharavichitkul P, Na•Ngam N, Jitsurong S, Kunthawa nificantly enhance the recovery of viable B. pseudomallei B, Noimay P, et al. Epidemiology of Burkholderia pseudomallei in cells (data not shown). As the novel protocol does not Thailand. Am J Trop Med Hyg 1999; 60 :458–61. require overnight sedimentation, samples are processed 4. U’Ren JM, Hornstra H, Pearson T, Schupp JM, Leadem B, Georgia S, et al. Fine•scale genetic diversity among Burkholderia pseudo• more rapidly, which may reduce changes in the initial mallei soil isolates in northeast Thailand. Appl Environ Microbiol composition of B. pseudomallei strains in a given sample. 2007; 73 :6678–81. This assumption is supported by the fact that lower num• 5. Chantratita N, Wuthiekanun V, Limmathurotsakul D, Vesaratchavest bers of non• Burkholderia CFU were observed by the shorter M, Thanwisai A, Amornchai P, et al. Genetic diversity and microevo• lution of Burkholderia pseudomallei in the environment. PloS Negl Trop PEG•DOC culture protocol compared with the traditional Dis 2008; 2:e182. protocol (data not shown), which is likely to favour pheno• 6. Tumapa S, Holden MTG, Vesaratchavest M, Wuthiekanun V, Lim• typic identification of B. pseudomallei . mathurotsakul D, Chierakul W, et al. Burkholderia pseudomallei genome plasticity associated with genomic island variation. BMC A limitation of this study might be the restriction of soil Genomics 2008; 9:190. samples to a sandy loam soil type, which is most preva• 7. Wuthiekanun V, Limmathurotsakul D, Chantratita N, Feil EJ, Day NPJ, lent in Northeast Thailand. The type of soil might influence Peacock SJ. Burkholderia pseudomallei is genetically diverse in agri• cultural land in Northeast Thailand. PloS Negl Trop Dis 2009; 3:6. the efficacy of any soil dispersion method. Although spik• 8. Smith MD, Wuthiekanun V, Walsh AL, White NJ. Quantitative recov• ing experiments with B. pseudomallei using different soil ery of Burkholderia pseudomallei from soil in Thailand. Trans R Soc types such as clay loam and clay soil type also indicated an Trop Med Hyg 1995; 89 :488–90. 9. Wuthiekanun V, Smith MD, Dance DAB, White NJ. Isolation of Pseu• improved recovery after several weeks using the PEG•DOC domonas pseudomallei from soil in north•eastern Thailand. Trans R protocol compared with distilled water (data not shown), Soc Trop Med Hyg 1995; 89 :41–3. the general usefulness of the new protocol for other soil 10. Parry CM, Wuthiekanun V, Hoa NTT, Diep TS, Thao LTT, Van Loc P, et al. Melioidosis in southern Vietnam: clinical surveillance and types will have to be addressed in future field studies. The environmental sampling. Clin Infect Dis 1999; 29 :1323–6. new soil dispersion method clearly demonstrates a higher 11. Wuthiekanun V, Mayxay M, Chierakul W, Phetsouvanh R, Cheng yield of viable B. pseudomallei from soil samples over a wide AC, White NJ, et al. Detection of Burkholderia pseudomallei in range of bacterial concentrations. However, future stud• soil within the Lao People’s Democratic Republic. J Clin Microbiol 2005; 43 :923–4. ies extended to high numbers of samples containing lower 12. Rolim DB, Rocha MFG, Brilhante RSN, Cordeiro RA, Leitao•Junior numbers of viable cells are required to provide further sta• NP, Inglis TJJ, et al. Environmental isolates of Burkholderia pseu• tistical evidence that the new method will indeed increase domallei in Ceará State, northeastern Brazil. Appl Environ Microbiol 2009; 75 :1215–8. the qualitative sensitivity in habitats with very low B. pseu• 13. Ma G, Zheng D, Cai Q, Yuan Z. Prevalence of Burkholderia pseudomallei domallei abundance. in Guangxi, China. Epidemiol Infect 2010; 138 :37–9. 14. Kao CM, Chen SC, Chen YS, Lin HM, Chen YL. Detection of Burkholderia pseudomallei in rice fields with PCR•based technique. Folia Microbiol 5. Conclusions (Praha) 2003; 48 :521–4. 15. Brook MD, Currie B, Desmarchelier PM. Isolation and identifica• tion of Burkholderia pseudomallei from soil using selective culture In summary, we describe a simple and cheap method techniques and the polymerase chain reaction. J Appl Microbiol leading to a higher quantitative recovery of viable B. pseu• 1997; 82 :589–96. domallei from soil samples compared with the conventional 16. Currie BJ, Mayo M, Anstey NM, Donohoe P, Haase A, Kemp DJ. A cluster of melioidosis cases from an endemic region is clonal and is linked to method. The new protocol has potential to improve knowl• the water supply using molecular typing of Burkholderia pseudomallei edge of the distribution of B. pseudomallei in its natural soil isolates. Am J Trop Med Hyg 2001; 65 :177–9. environment and to increase the statistical robustness of 17. Inglis TJJ, Foster NF, Gal D, Powell K, Mayo M, Norton R, et al. Prelim• inary report on the northern Australian melioidosis environmental 7 cell enumeration in low abundance habitats. surveillance project. Epidemiol Infect 2004; 132 :813–20. T.T. Trung et al. / Transactions of the Royal Society of Tropical Medicine and Hygiene 105 (2011) 346–351 351

18. Kidd SE, Chow Y, Mak S, Bach PJ, Chen HM, Hingston AO, et al. agglutination based on an exopolysaccharide•specific monoclonal Characterization of environmental sources of the human and ani• antibody. J Clin Microbiol 1999; 37 :225–8. mal pathogen Cryptococcus gattii in British Columbia, Canada, and 24. Mahenthiralingam E, Urban TA, Goldberg JB. The multifarious, the Pacific Northwest of the United States. Appl Environ Microbiol multireplicon Burkholderia cepacia complex. Nat Rev Microbiol 2007; 73 :1433–43. 2005; 3:144–56. 19. Qiu DH, Ruan JS, Huang Y. Selective isolation and rapid identifica• 25. Payne GW, Vandamme P, Morgan SH, LiPuma JJ, Coenye T, Weight• tion of members of the genus Micromonospora . Appl Environ Microbiol man AJ, et al. Development of a recA gene•based identification 2008; 74 :5593–7. approach for the entire Burkholderia genus. Appl Environ Microbiol 20. Lindahl V, Bakken LR. Evaluation of methods for extraction of bacteria 2005; 71 :3917–27. from soil. FEMS Microbiol Ecol 1995; 16 :135–42. 26. Johnson JL. Similarity analysis of rRNAs. In: Gerhardt P, Murray RGE, 21. Robertson J, Levy A, Sagripanti JL, Inglis TJJ. The survival of Burkholde• Wood WA, Krieg NR, editors. Methods for general and molecular bac• ria pseudomallei in liquid media. Am J Trop Med Hyg 2010; 82 :88–94. teriology . Washington, DC: American Society for Microbiology; 1994. 22. Chantratita N, Wuthiekanun V, Boonbumrung K, Tiyawisutsri R, p. 683–700. Vesaratchavest M, Limmathurotsakul D, et al. Biological relevance of 27. Herron PR, Wellington EMH. New method for extraction of strepto• colony morphology and phenotypic switching by Burkholderia pseu• mycete spores from soil and application to the study of lysogeny domallei . J Bacteriol 2007; 189 :807–17. in sterile amended and nonsterile soil. Appl Environ Microbiol 23. Steinmetz I, Reganzerowski A, Brenneke B, Haussler S, Simpson A, 1990; 56 :1406–12. White NJ. Rapid identification of Burkholderia pseudomallei by latex Chapter 4

Chapter 4

Highly sensitive direct detection and quantification of Burkholderia pseudomallei in environmental soil samples using real-time PCR

Trinh Thanh Trung, Adrian Hetzer, Andre Göhler, Eylin Topfstedt, Direk Limmathurotsakul, Vanaporn Wuthiekanun, Sharon J. Peacock, and Ivo Steinmetz.

Applied and Environmental Microbiology. 2011. 77 (18): 6486-94.

38 APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Sept. 2011, p. 6486–6494 Vol. 77, No. 18 0099-2240/11/$12.00 doi:10.1128/AEM.00735-11 Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Highly Sensitive Direct Detection and Quantiﬁcation of Burkholderia pseudomallei Bacteria in Environmental Soil Samples by Using Real-Time PCR ᰔ† Trinh Thanh Trung, 1 Adrian Hetzer, 1 Andre´Go¨hler, 1 Eylin Topfstedt, 1 Vanaporn Wuthiekanun, 2 Direk Limmathurotsakul, 2,3 Sharon J. Peacock, 2,4,5 and Ivo Steinmetz 1* Friedrich Loefﬂer Institute of Medical Microbiology, Ernst Moritz Arndt University of Greifswald, Greifswald, Germany 1; Mahidol-Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand 2; Department of Tropical Hygiene, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand 3; Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand 4; and Department of Medicine, Cambridge University, Addenbrooke’s Hospital, Cambridge, United Kingdom 5

Received 31 March 2011/Accepted 18 July 2011

The soil bacterium and potential biothreat agent Burkholderia pseudomallei causes the infectious disease melioidosis, which is naturally acquired through environmental contact with the bacterium. Environmental detection of B. pseudomallei represents the basis for the development of a geographical risk map for humans and livestock. The aim of the present study was to develop a highly sensitive, culture-independent, DNA-based method that allows direct quantification of B. pseudomallei from soil. We established a protocol for B. pseudomallei soil DNA isolation, purification, and quantification by quantitative PCR (qPCR) targeting a type three secretion system 1 single-copy gene. This assay was validated using 40 soil samples from Northeast Thailand that underwent parallel bacteriological culture. All 26 samples that were B. pseudomallei positive by ,direct culture were B. pseudomallei qPCR positive, with a median of 1.84 ؋ 10 4 genome equivalents (range ؋ 10 2 to 7.85 ؋ 10 5) per gram of soil, assuming complete recovery of DNA. This was 10.6-fold (geometric 3.65 mean; range, 1.1- to 151.3-fold) higher than the bacterial count defined by direct culture. Moreover, the qPCR detected B. pseudomallei in seven samples (median, 36.9 genome equivalents per g of soil; range, 9.4 to 47.3) which were negative by direct culture. These seven positive results were reproduced using a nested PCR targeting a second, independent B. pseudomallei -specific sequence. Two samples were direct culture and qPCR negative but nested PCR positive. Five samples were negative by both PCR methods and culture. In conclusion, our PCR-based system provides a highly specific and sensitive tool for the quantitative environmental surveillance of B. pseudomallei .

The Gram-negative betaproteobacterium Burkholderia pseu- and countries of endemicity where melioidosis is likely to domallei , a natural inhabitant of soil and surface water, causes occur, diagnostic resources in the clinical laboratory are the infectious disease melioidosis, with high mortality rates limited, and therefore, the true burden of the disease and for infected humans in tropical and subtropical regions the worldwide distribution of B. pseudomallei remain un- where the disease is endemic (7, 10, 58). Clinical cases of clear. melioidosis have been reported regularly in Southeast Asian Apart from the detection of B. pseudomallei in clinical cases, countries, such as Thailand (28, 53), Vietnam (42), and knowledge of the distribution and lifestyle of B. pseudomallei in Malaysia (43, 62), in northern and Western Australia (12, its natural soil environment is important for understanding the 19), and sporadically in India (1, 49), South and Central epidemiology of melioidosis. In this context, quantitative de- America (20, 45), and West and East Africa (21). The dis- tection of B. pseudomallei is crucial for investigating its asso- ease can be acquired by inoculation of B. pseudomallei ciations with specific habitats, as well as the influence of factors through skin lesions, by aerosols from contaminated soil and such as climate change. Several investigations have used cul- surface water, or by ingestion (11, 15). Melioidosis has at- ture-based quantification (39, 50) to enumerate B. pseudomal- tracted interest outside its known distribution areas by cases lei bacteria within its natural environment. Quantitative culti- in travelers (9) and soldiers (32, 40) returning from regions vation of B. pseudomallei from soil samples depends on of B. pseudomallei endemicity and by its classification as a efficient detachment of microorganisms from the soil matrix, category B bioterrorism agent (47). In many known areas which relies on the selected dispersion method (56). However, detection of B. pseudomallei by culture can be hindered by the * Corresponding author. Mailing address: Friedrich Loeffler Insti- presence and overgrowth of other environmental bacterial spe- tute of Medical Microbiology, Ernst Moritz Arndt University of Greif- cies capable of growing on the currently used selective media swald, Martin-Luther-Strasse 6, 17475 Greifswald, Germany. Phone: (6), especially when only low B. pseudomallei cell numbers are 49 3834 865587. Fax: 49 3834 865561. E-mail: steinmetz.ivo@uni present. Additionally, the proportion of B. pseudomallei envi- -greifswald.de. ᰔ ronmental cells which might be viable but are in a noncultur- Published ahead of print on 29 July 2011. † The authors have paid a fee to allow immediate free access to able state under standard laboratory conditions is unknown. It this article. seems likely that this phenomenon, described for other envi-

6486 VOL . 77, 2011 PCR-BASED ENUMERATION OF B. PSEUDOMALLEI CELLS IN SOIL 6487

TABLE 1. Bacterial isolates used in this study

No. of Reference(s) or Type of isolate Species Origin isolates source Reference a B. pseudomallei K96243 1 Female diabetic patient, Thailand 17 B. pseudomallei E8 1 Rice field soil, North Thailand 61 Burkholderia thailandensis DSM13276 T 1 Rice field soil, Central Thailand 5 Burkholderia vietnamiensis LMG 18835 1 Cystic fibrosis isolate, USA 26 Burkholderia cepacia H111 1 Cystic fibrosis isolate, Germany 16, 46

Clinical a B. pseudomallei 25 Northern Vietnam 42

Environmental b B. pseudomallei 2 Northern Vietnam This study B. thailandensis 44 Northern Vietnam This study B. cepacia 1 Northern Vietnam This study B. seminalis 1 Northern Vietnam This study B. pyrrocinia 1 Northern Vietnam This study B. diffusa 4 Northern Vietnam This study B. latens 5 Northern Vietnam This study B. vietnamiensis 12 Northern Vietnam This study R. solanacearum 2 Northern Vietnam This study Total 102

a Collection of strains deposited at the Friedrich Loefﬂer Institute of Medical Microbiology, Greifswald University, Greifswald, Germany. b Strains isolated from soil collected in northern Vietnam in 2006.

ronmental species (2, 36), also contributes to an underestima- The plates were then incubated overnight at 37°C in air. Fresh cultures grown on tion of the B. pseudomallei bacterial load or to false-negative agar were harvested for bacterial DNA extraction. results from environmental habitats. Environmental strains were isolated from soil samples collected in northern Vietnam in 2006 using the traditional method based on soil dispersion in water Molecular methods based on direct bacterial nucleic acid according to Smith et al. (50). The colonies on Ashdown’s agar plates were extraction from environmental samples and subsequent ampli- screened for B. pseudomallei morphotypes (6). Suspected B. pseudomallei isolates fication have the potential to overcome many restrictions of were identified by oxidase test and a specific latex agglutination test (51). B. traditional microbiological approaches but are associated with pseudomallei isolates and representatives of non- B. pseudomallei colonies were further identified by sequencing the 16S rRNA gene and the recA gene (22, 41). other pitfalls (57). Efficient DNA isolation from soil is biased Sequence similarity searches were performed using the BLAST algorithm im- by incomplete cell lysis and nucleic acid adsorption to soil plemented in the NCBI database (http://www.ncbi.nlm.nih.gov). particles (13, 25, 31). Furthermore, soil-derived PCR inhibitors Soil samples. The PCR methods were validated on sandy loam soil samples coextracted with nucleic acids affect downstream amplification collected in January (samples S 01 to S 95) or March (samples RFT 01 to RFT reactions (38, 57). Although a multitude of DNA extraction 30) 2010 from randomly selected rice fields with known high positivity rates for B. pseudomallei in Amphoe Lao Sua Kok, Ubon Ratchathani province, North- and purification methods exist, including several commercially east Thailand, as described previously (56). Briefly, a standard soil sampling available kits, there is no universal standard protocol and technique was used (29), and 200 g of soil was collected from a depth of 30 cm. methods have to be adapted to the specific experimental needs. Soil samples sealed in plastic bags and plastic containers were shipped by air The present study was undertaken to develop a quantitative freight at ambient temperatures to the laboratory in Greifswald, Germany, and PCR method for the direct quantification of B. pseudomallei stored at room temperature until analyzed, because low temperatures are able to reduce the viable cell count of B. pseudomallei (55). Samples S 01 to S 95 and cells from soil. We first established a protocol for efficient RFT 01 to RFT 30 were processed for DNA extraction (see below) within 10 DNA extraction and the removal of coextracted amplification days after soil sampling in Northeast Thailand. There was no significant differ- inhibitors. B. pseudomallei cells were then detected as genome ence in the qPCR-based B. pseudomallei detection (see below) between sub- equivalents (GE) in a quantitative PCR (qPCR) using primers samples extracted on different days (data not shown). The original 200-g soil samples were mechanically homogenized prior to the experiments, and three 1-g, and a probe, specific to a 115-bp fragment of the type three 0.5-g, or 0.1-g subsamples of each original 200-g sample were processed for DNA secretion system 1 (TTSS1) of B. pseudomallei , which have extraction and purification using different methods as described below. For recently been developed to detect this pathogen in both clinical culture experiments, three 25-g subsamples were processed as previously de- samples and supernatants from environmental enrichment cul- scribed (56). Additionally, 10 soil samples were taken from a 30-cm depth from tures (23, 24, 33). A nested PCR targeting a second B. pseu- agricultural land around Greifswald, Germany, as negative controls from an area of nonendemicity to confirm the specificity of the PCR methods and to test for domallei -specific sequence (52) was applied to qualitatively cross-contamination. confirm the qPCR results. This experimental approach was Culture-based detection of B. pseudomallei cells in environmental soil samples. validated on 40 environmental soil samples collected in North- The single PCR data of the 40 soil samples from this study were compared to the east Thailand and proved to be a highly sensitive tool for rapid single culture results of the same samples, previously reported as summarized B. pseudomallei B. pseudomallei data by Trung and colleagues (56). Briefly, cells were detached environmental surveillance of , compared to from the soil matrices of 25-g subsamples by shaking in 50 ml of a solution culture methods. containing 2.5% (wt/vol) polyethylene glycol 6000 (SERVA Electrophoresis, Heidelberg, Germany) and 0.1% (wt/vol) sodium deoxycholate (Merck KGaA, Darmstadt, Germany) for 2 h. The soil particles were then sedimented by cen- MATERIALS AND METHODS trifugation at 1,400 ϫ g for 10 min. One hundred microliters of the supernatant Bacterial strains and growth conditions. Bacterial strains used are listed in was used to enumerate B. pseudomallei cells on Ashdown’s agar (containing 10 g Table 1. Bacteria stored in frozen vials were streaked onto Columbia agar plates of Trypticase soy broth, 40 ml of glycerol, 5 ml of 0.1% crystal violet, 5 ml of 1% supplemented with 5% sheep blood (Becton Dickinson, Heidelberg, Germany). neutral red, 5 mg of gentamicin, and 15 g of agar per liter). For a qualitative 6488 TRUNG ET AL. APPL . E NVIRON . M ICROBIOL .

TABLE 2. Primers and probes used for the noncompetitive ampliﬁcation control, the TTSS1 gene qPCR assay, and the nested PCR

Ampliﬁed DNA Source or Purpose Primer or probe Oligonucleotide sequence (5 Ј–3 Ј)a fragment reference Detection of PCR IAC2 forward GAATTCGCCCTTATTAGCCGAC Insertion sequence of This study inhibitors IAC2 reverse GGAATTCGCCCTTTAATGCGC pCR2.1-IAC CMV3 probe HEX-TGATCGGCGTTATCGCGTTCTTGATC-BHQ2

qPCR target BpTT4176 forward CGTCTCTATACTGTCGAGCAATCG TTSS1 gene/5 Ј region 37 BpTT4290 reverse CGTGCACACCGGTCAGTATC (Ϫ82 to ϩ34) of BpTT4208 probe FAM-CCGGAATCTGGATCACCACCACTTTCC-BHQ1 BPSS1407 sctD b,c

Nested-PCR 174 outer forward ACCTTTCGTCGGCATGGTAG BPSS1187 d coding This study target 725 outer reverse GCCCGCTTCTGGTCTTTATTC region b 8653 inner forward ATCGAATCAGGGCGTTCAAG BPSS1187 d coding 52 8653 inner reverse CATTCGGTGACGACACGACC region b 8653 inner probe FAM-CGCCGCAAGACGCCATCGTTCAT-BHQ1

a HEX, hexachloro-6-carboxyﬂuorescein; BHQ2, black hole quencher 2; FAM, 6-carboxyﬂuorescein; BHQ1, black hole quencher 1. b Coding sequence denoted for the complete genome sequence of B. pseudomallei K96243 (17). c The NCBI accession number of BPSS1407 sctD is NC_006351 (region 1920833 to 1921882). d The NCBI accession number of BPSS1187 is NC_06351 (region 1593544 to 1594350).

culture, 1 ml of the same supernatant was mixed with 9 ml of Galimand broth and placing the tube horizontally at 4°C for 24 h. After the last washing step, the (threonine-basal salt plus colistin [TBSS-C50]) (61), supplemented with 1 g/liter purified DNA remained embedded in the LMP agarose matrix and was stored at of polymyxin B. Enrichment cultures were incubated at 40°C for 4 days before Ϫ20°C. Before incorporation into the PCR, the DNA-agarose block was incu- being plated on Ashdown’s agar plates. All plates were incubated at 40°C for 4 bated at 70°C for 2 min and the melted solution was used as a template. Initial days, and the numbers of B. pseudomallei CFU were determined. experiments revealed that the melted agarose solution did not affect PCR per- DNA extraction from soil and subsequent purification. Total genomic DNA formance (data not shown). was extracted from mechanically homogenized soil samples by two commercially Detection of PCR inhibitors in purified soil DNA. A quantitative PCR assay available kits according to the manufacturers’ instructions, except where noted, was developed in order to detect the presence of PCR inhibitors coextracted with and by the extraction method developed in this study. nucleic acids in the soil DNA extracts and to validate the quality of the different The SoilMaster DNA extraction kit (Epicentre Biotechnologies, Madison, WI) soil DNA extraction methods. The plasmid pCR2.1-IAC was constructed by was used according to the manufacturer’s instructions. Briefly, 0.1 g of soil was inserting an artificial synthesized DNA fragment (MWG-Biotech, Ebersberg, added to 250 ␮l of soil DNA extraction buffer. Then bacterial cell lysis and DNA Germany) of 135 bp (AGCCGACACGCGTCTCTATACTGTCGAGCAATCG purification were performed using a hot detergent lysis process and a column GCGGATATCCCGTCACGCTGTTTG TGATCGGCGTTATCGCGTTCTTGA chromatography step, respectively. The final precipitated DNA preparation was TC GCACTTTACGAAGCTGTTACGGATACTGACCGGTGTGCACGCGG resuspended in 50 ␮l of Tris-EDTA (TE) buffer and stored at Ϫ20°C until used. GCGCGCA), containing a unique nucleotide sequence of cytomegalovirus (in- The FastDNA spin kit for soil (MP Biomedicals, Illkirch, France) was applied dicated in bold), into a pCR2.1 plasmid (Invitrogen, Darmstadt, Germany). The according to the manufacturer’s instructions. Briefly, 0.5 g of soil was added to quantitative PCR assay of the recombinant plasmid pCR2.1-IAC had the same ␮ the lysing matrix A tube, which contained 987 l of sodium phosphate buffer, 122 thermal conditions as the TTSS1 target amplification. One hundred copies of ␮ l of MT buffer (from the Fast DNA spin kit), and a mixture of ceramic and silica pCR2.1-IAC were incorporated into a 25- ␮l reaction mixture as described for the particles. Then the bacterial cell disruption and DNA purification steps were following TTSS1 gene qPCR assay (see below), except that the primers and the performed using a vortex and a silica-based procedure, respectively. The final probe were replaced with a 400 nM concentration each of primers IAC2 forward DNA preparation was eluted in 50 ␮l of DNase–pyrogen-free water and stored and IAC2 reverse and a 260 nM concentration of CMV3 probe (MWG-Biotech, at Ϫ20°C until used. Ebersberg, Germany), labeled with hexachloro-6-carboxyfluorescein (HEX) at The DNA extraction part of the protocol developed in this study is based on its 5 Ј end and black hole quencher 2 (BHQ2) at its 3 Ј position (Table 2). The the protocol of Gabor et al. (14), with slight modifications. First, 1 g of soil was thermal cycling profile was as described for the TTSS1 qPCR assay (see below), mixed with 750 ␮l of lysis buffer (100 mM Tris HCl, 100 mM Na EDTA, 1.5 M 2 except that the number of thermal cycles was set to 60. The degree of PCR NaCl, 1% cetyltrimethyl ammonium bromide [CTAB], pH 8.0) by vortexing the inhibition caused by soil DNA extracts was determined by cycle threshold dif- mixture at maximal speed until the soil was completely homogenized. After the ferences ( ⌬C ), which were calculated by subtracting the C values of the PCR addition of 40 ␮l of lysozyme (50 mg ml Ϫ1) and 10 ␮l of proteinase K (10 mg T T Ϫ with the recombinant plasmid and soil DNA extracts from the C values of the ml 1), the tubes were incubated at 37°C for 30 min. Then 200 ␮l of SDS (20% T wt/vol) was added prior to incubation at 65°C for 2 h, with a vigorous vortex for PCR mixture containing the recombinant plasmid as a single template (control). Quantitative TTSS1 PCR for the detection of B. pseudomallei . several seconds after 1 h of incubation. The first supernatant (supernatant A) was The TTSS1 gene collected by centrifugation at 6,000 ϫ g for 10 min, and the soil pellet was qPCR mixture, at a final volume of 25 ␮l, consisted of 1 ϫ TaqMan universal reextracted by adding 1 ml of lysis buffer, in contrast to the original protocol (14). PCR master mix (Applied Biosystem, Branchburg, NJ), which contained the Vortexing for a few seconds was followed by incubation at 65°C for 30 min. following: AmpliTaq Gold DNA polymerase and AmpErase uracil- N-glycosylase Centrifugation was performed at 6,000 ϫ g for 10 min, and the second superna- (UNG); a 400 nM concentration each of primer BpTT4176 forward and tant (supernatant B) was collected and combined with supernatant A. Instead of BpTT4290 reverse; a 260 nM concentration of BpTT4208 probe (MWG-Biotech, chloroform (14), an equal volume of chloroform-isoamyl alcohol (49:1) was Ebersberg, Germany), labeled with 6-carboxyfluorescein (FAM) at its 5 Ј end and added to the mixture before the DNA was precipitated from the upper water black hole quencher 1 (BHQ1) at its 3 Ј position (Table 2); 10 ␮g of nonacety- phase by an addition of 0.6 volume of isopropanol and incubated at Ϫ20°C lated bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO); and 4 ␮l of overnight (or at least 1 h). The DNA precipitate was collected by centrifugation purified soil DNA embedded in an agarose matrix as a template. Amplification at 16,000 ϫ g for 7 min, washed with prechilled 70% ethanol, and resuspended and detection were performed on the Mx3000P qPCR system (Stratagene, Cedar in 50 ␮l of TE buffer, followed by incubation at room temperature for 1 h. Creek, TX) using the manufacturer’s standard settings. Thermal conditions were To purify DNA from potential coextracted PCR inhibitors, a modified form of 50°C for 2 min to activate UNG, which prevents carryover contamination, fol- Moreira’s protocol (35) was used. Crude soil DNA was gently mixed with an lowed by an initial denaturation step at 95°C for 10 min and 45 cycles of equal amount of melted 1.6% low-melting-point (LMP) agarose (AppliChem, denaturation at 95°C for 15 s and amplification at 60°C for 1 min. The cycle

Darmstadt, Germany) in a sterile 2-ml tube. After the tube was allowed to stand threshold ( CT) values were automatically calculated by applying adaptive base - at 4°C for 15 min, the solidiﬁed DNA-agarose matrix was subjected to three line algorithms (MXPro-Mx3000P v. 320, build 340). The primers used were washing steps, with each step performed by adding 1.5 ml of TE buffer to the tube empirically tested and produced no artifacts (data not shown). VOL . 77, 2011 PCR-BASED ENUMERATION OF B. PSEUDOMALLEI CELLS IN SOIL 6489

cession no. FP885907.1) showed sequence similarities only with gaps and mismatches of more than ﬁve nucleotides within the alignments (8) (data not shown). PCR-based detection and quantiﬁcation of B. pseudomallei from soil. For the detection of B. pseudomallei in soil samples by using either TTSS1 qPCR or BPSS1187 nested PCR, each of the three 1-g subsamples was analyzed in duplicate. TTSS1 qPCR bacterial counts of each replicate, expressed as genome equivalents (GE) per PCR mixture, were determined with the standard curve shown in Fig. 1. The bacterial count per g of soil was calculated with the following equation:

No. of GE copies/g of soil ϭ ͓͑ 50 ␮l eluate ϩ 50 ␮l LMP agarose ͒/g of soil ͔

ϫ ͓͑ no. of GE copies/PCR mix ͒/͑4 ␮l eluate-LMP mix/PCR mix ͔͒

(2)

Statistical analysis. The statistical significance of differences was determined by two-tailed Student’s t tests and Wilcoxon signed rank tests with GraphPad Prism software version 4.0 for Windows (GraphPad Software, San Diego, CA). FIG. 1. Straight calibration line based on genomic B. pseudomallei The quartile coefficient of dispersion (interquartile range/median) was used to DNA for TTSS1 gene qPCR. The equation and the square regression specify the intrasample variation of qPCR results obtained in the three PCR coefficient ( r2) of the standard curve and the efficiency (E) of the PCR runs, each performed in duplicate. are given. Values are the means of nine independent determinations Ϯ standard errors of the mean (SEM) (error bars). RESULTS Detection of coisolated PCR inhibitors in soil DNA by using BPSS1187 gene nested PCR for the detection of B. pseudomallei . To further different extraction methods. improve the sensitivity of B. pseudomallei detection and to reduce the effect of We first evaluated the quality of any remaining PCR inhibitors, a nested-PCR approach was applied. The outer genomic DNA with respect to coisolated PCR inhibitors after primers, 174 forward (174F) and 725 reverse (725R) (Table 2), were used to using different extraction methods in 10 soil samples from amplify a 552-bp fragment of BPSS1187, which encodes a hypothetical B. pseu- Northeast Thailand. These samples were culture positive for B. domallei -specific protein (according to the genome sequence of B. pseudomallei pseudomallei . The genomic DNA was isolated with either the K96243) (52). The first PCR was performed in a 25- ␮l reaction mixture which SoilMaster DNA extraction kit, the FastDNA spin kit for soil, consisted of 1 ϫ PCR buffer containing 1.5 mM MgCl 2, 1 U of AmpliTaq Gold DNA polymerase (Applied Biosystem, Foster City, CA), a 125 ␮M concentration or our method based on enzymatic and chemical methods plus each of deoxynucleotides dATP, dCTP, dGTP, and dTTP (Roche, Mannheim, subsequent purification in an agarose matrix. A noncompeti- Germany), a 400 nM concentration each of primers 174F and 725R (Table 2), 10 tive internal amplification control was applied to determine the ␮g of BSA, and 4 ␮l of purified soil DNA immobilized in solid agarose as a template. Thermal cycling was carried out in an Uno II thermocycler (Biometra, rate of inhibition. The differences in cycle threshold ( ⌬CT) Goettingen, Germany), with an initial denaturation step of 95°C for 5 min, values between PCRs with and without soil DNA extracts, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 45 s, and a final supplemented with 100 recombinant plasmid copies, were used extension step at 72°C for 5 min. One microliter of the resulting PCR product to determine the grade of inhibition. All three tested DNA was then applied as the template in a second PCR using the 8563 PCR assay isolation methods failed to completely remove PCR inhibitors (Table 2) as described by Supaprom and colleagues (52). A melting-curve analysis was performed using the SYBR green I master kit (Roche Applied Science, coisolated with genomic DNA from soil. Table 3 (columns Mannheim, Germany) to check for primer-dimer artifact formation. without BSA) shows that accurate detection of the copy num- Determining sensitivities, specificities, and efficiencies of the PCRs by using bers of the incorporated recombinant plasmid failed for 6 pure bacterial cultures. To determine the detection limits and efficiencies of the samples (60%) isolated by the SoilMaster DNA extraction kit, TTSS1 qPCR genomic DNA from freshly grown cultures of B. pseudomallei , B. pseudomallei strain K96243 was isolated using the DNeasy blood and tissue kit with either no amplification at all or very high ⌬CT values, and (Qiagen, Hilden, Germany). Quantification was performed using SYBR green I for all 10 samples (100%) obtained from both the FastDNA master mix (Stratagene, Cedar Creek, TX) and lambda DNA as the standard spin kit for soil and our developed protocol. The majority of (molecular weight marker XV; Roche, Mannheim, Germany), by following the soil DNA extracts showing no qPCR amplifications were manufacturer’s protocol, on the Mx3000P qPCR system (Stratagene, Cedar brownish in color, indicating the presence of coextracted soil Creek, TX). The amount of DNA was then converted to genome equivalent (GE) copies based on the B. pseudomallei K96243 genome size of 7.25 Mb (17): compounds interfering with the qPCR assay. Additional washing steps using either 5.5 M guanidine thiocyanate or humic ͑6.02 ϫ 10 23 copies/mol ͒ ϫ DNA amount (g) No. of GE copies ϭ (1) acid wash solution, optional in the FastDNA spin kit, did not ϫ 6 ϫ ͑ ͒ 7.25 10 bp 660 g/mol bp improve PCR performance for DNA samples isolated by this Serially diluted DNA was used as a template to generate nine individual standard kit (data not shown). curves for each real-time PCR assay (Fig. 1). To validate the specificities of the Significant reduction of PCR inhibitory effects of soil com- qPCR assay, the nested-PCR genomic DNA was isolated from bacterial cultures pounds. We overcame PCR inhibition by the incorporation of of 29 B. pseudomallei strains (Table 1) and 73 strains closely related phylogenetically to B. pseudomallei (Table 1) as described above. Furthermore, all nonacetylated BSA into the qPCR assay as follows. All 26 primers were bioinformatically compared with published Burkholderiales se- samples that were initially qPCR negative displayed amplifica- quences. By use of the Primer-BLAST tool (48), implemented on the NCBI tion in the presence of BSA (Table 3, columns with BSA). The website with default parameters and with exclusion of sequences with four or ⌬CT values for each of the three tested extraction protocols, B. pseudomallei more mismatches, a specificity of primers for only sequences was with 10 soil samples each, were significantly reduced using revealed. Both probes shared full-length identity only with sequences of B. pseudomallei . The comparison of the TTSS1 primers and probe with the TTSS of BSA as a PCR adjuvant, with overall ⌬CT values of 0.48 Ϯ Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp (44) (GenBank ac- 0.09, 0.47 Ϯ 0.22, and 0.85 Ϯ 0.17 for the SoilMaster DNA 6490 TRUNG ET AL. APPL . E NVIRON . M ICROBIOL .

TABLE 3. Presence of PCR inhibitory effects after using different soil DNA extraction protocols

a ⌬CT Sample SoilMaster kit FastDNA kit Protocol of this study

Without BSA With BSA Without BSA With BSA Without BSA With BSA S 01 Inhibited 0.88 Ϯ 0.55 Inhibited 1.65 Ϯ 0.08 Inhibited 1.47 Ϯ 0.23 S 03 Inhibited 0.32 Ϯ 0.06 Inhibited 0.74 Ϯ 0.20 Inhibited 1.21 Ϯ 0.19 S 04 Inhibited 0.93 Ϯ 0.12 Inhibited 1.74 Ϯ 0.27 Inhibited 1.49 Ϯ 0.15 S 05 0.86 Ϯ 0.31 0.32 Ϯ 0.13 >6.55 b 0.01 Ϯ 0.18 Inhibited 0.74 Ϯ 0.26 S 06 13.47 ؎ 1.38 0.33 Ϯ 0.06 Inhibited 0.08 Ϯ 0.04 Inhibited 1.13 Ϯ 0.12 S 07 1.59 Ϯ 0.14 0.27 Ϯ 0.06 Inhibited 0.04 Ϯ 0.05 Inhibited 0.68 Ϯ 0.32 S 10 1.31 Ϯ 0.23 0.07 Ϯ 0.10 Inhibited 0.06 Ϯ 0.10 Inhibited Ϫ0.19 Ϯ 0.26 S 12 2.45 ؎ 0.45 0.59 Ϯ 0.08 Inhibited Ϫ0.06 Ϯ 0.21 Inhibited 0.47 Ϯ 0.20 S 92 Inhibited 0.79 Ϯ 0.15 Inhibited 0.57 Ϯ 0.26 Inhibited 1.22 Ϯ 0.15 S 95 0.64 Ϯ 0.11 0.36 Ϯ 0.03 >4.83 b Ϫ0.11 Ϯ 0.30 Inhibited 0.30 Ϯ 0.11 Overall ⌬CT 0.48 Ϯ 0.09 0.47 Ϯ 0.22 0.85 Ϯ 0.17

a The degree of PCR inhibition is reflected by the cycle threshold difference ( ⌬CT), which was calculated by subtracting CT values of the PCR of soil DNA extracts with the incorporation of a noncompetitive internal amplification control (IAC) from CT values of the PCR mixture containing the IAC as a single template (control). PCRs with ⌬CT values greater than 2 were considered to be strongly inhibited (boldface). Data are the means and standard errors of the means (SEM) of results from three independent experiments. “Inhibited” indicates that no PCR amplification signal could be detected in three subsamples after 60 cycles. b PCR amplification signal could be detected in only one or two subsamples after 60 cycles.

extraction kit, the FastDNA spin kit for soil, and our developed whereas all 29 different B. pseudomallei isolates proved to be protocol, respectively (Table 3, columns with BSA). positive in our assays. Sensitivity and specificity of TTSS1 gene qPCR and Comparison of results of B. pseudomallei DNA detection BPSS1187 gene nested PCR. We then optimized a TTSS1 gene from soil by different DNA extraction methods. To finally se- qPCR assay which should subsequently be used for the direct lect the DNA extraction protocol to be used for the qPCR- quantitative detection of B. pseudomallei in soil. Figure 1 shows based quantification of B. pseudomallei in soil, we compared the straight calibration line relating the CT values to the num - the results of the TTSS1 qPCR with added BSA for five DNA bers of B. pseudomallei genome equivalents by using a 10-fold soil samples (S 03 to S 07) processed by the three different dilution series of genomic B. pseudomallei K96243 DNA. DNA extraction methods. Despite the lower average ⌬CT val - There was a strong linear inverse relationship ( r2 ϭ 99.9%) ues obtained for the two commercially available kits, our newly between the CT values and the log 10 genome equivalents of B. developed method led to a higher detection rate of B. pseu- pseudomallei over 6 orders of magnitude. Higher variations of domallei genome equivalents, indicating a better template the CT values were observed if fewer than 10 genome equiva - quality or quantity (Fig. 2). The detection factors for the Soil- lents per PCR mixture were used. Therefore, 10 B. pseudomal- Master DNA extraction kit and FastDNA spin kit for soil were lei genome equivalents per PCR mixture was used as the lower limit for calculation. The limit of detection (LOD) was 3 B. pseudomallei genome equivalents per single qPCR mixture, corresponding to 75 B. pseudomallei cells per g of soil when assuming a DNA extraction efficiency of 100%. The efficiency of qPCR amplification was 98.7%. To ensure accurate quantification of the qPCR, melting-curve analyses were conducted, which confirmed the absence of any primer- dimers (data not shown). To qualitatively confirm any TTSS1-based qPCR signal by a second PCR target in case of negative results in culturing, we also established a BPSS1187 gene-based nested PCR. The LOD of this assay was 1 GE/PCR mixture with a used volume of 5 ␮l. This corresponds to a theoretical value of 20 GE per g of soil for the qualitative detection of B. pseudomallei . The specificity of the TTSS1 primers and probe and the specificity of the inner BPSS1187 primers and probe for B. pseudomallei strains have already been rigorously tested in previous studies (24, 37, 52). In accordance with these results, our extended FIG. 2. Comparison of B. pseudomallei DNA recoveries from soil testing of the primers and probes of both PCR methods against for the SoilMaster DNA extraction kit, the FastDNA spin kit for soil, 73 isolates of species that are closely related phylogenetically, and the extraction method of this study. DNA was isolated from five soil samples, and B. pseudomallei genome equivalents were quantified including species such as Burkholderia seminalis , Burkholderia by the TTSS1 qPCR assay with added BSA. The data are the mean latens , Burkholderia diffusa , and Burkholderia pyrrocinia (listed values Ϯ SEM (error bars) from three independent experiments, each in Table 1; data not shown), revealed no PCR amplification, performed in duplicate. VOL . 77, 2011 PCR-BASED ENUMERATION OF B. PSEUDOMALLEI CELLS IN SOIL 6491

FIG. 3. Quantitative DNA-based detection of B. pseudomallei in 26 direct quantitative culture-positive soil samples collected in Northeast Thailand. (A) Samples with values above 25,000 GE per g of soil; (B) samples with values from 300 to 25,000 GE per g of soil. The data of qualitative and quantitative cultures of single samples are from experiments reported in summary in a parallel study in which two culture protocols were compared (56). The given GE and CFU values per g of soil represent the median, the 25th and 75th quartiles, and the range of all replicates of the subsamples. Fractions show the number of positive replicates out of all replicates. “ ϩ” indicates detection of B. pseudomallei in all replicates. np, not performed.

0.24 Ϯ 0.01 times and 0.52 Ϯ 0.05 times that of our method, from Northeast Thailand which were B. pseudomallei positive respectively. by direct quantitative culture were B. pseudomallei qPCR pos- PCR-based quantification of B. pseudomallei in environmen- itive (Fig. 3A, 13 samples with Ͼ25,000 GE/g of soil; Fig. 3B, tal soil samples from Northeast Thailand. Our PCR systems 13 samples with 300 to 25,000 GE/g of soil), with a median of were validated using 40 environmental soil samples collected in 1.84 ϫ 10 4 genome equivalents per gram of soil (range, 3.65 ϫ Northeast Thailand. The same samples were used in a parallel 10 2 to 7.85 ϫ 10 5). In those 26 samples, raw data of colony study in which we validated our newly developed protocol for counts were poorly linearly related to qPCR results ( r2 ϭ the culture-based detection of B. pseudomallei based on soil 0.629), whereas log transformation of culture and qPCR data dispersion in a polyethylene glycol and sodium deoxycholate resulted in a high correlation ( r2 ϭ 0.96). All samples exhibited solution (56). In addition, we tested 10 soil samples from Ger- a ⌬CT value below 2 (data not shown), indicating no significant many as negative controls from an area of nonendemicity. A inhibition of qPCR amplification. Moreover, determination of sample was classified as PCR positive when B. pseudomallei total DNA by fluorescent dye staining or of total bacterial DNA could be detected in at least one replicate of the three DNA by bacterial 16S rRNA gene copies from representative 1-g subsamples. The results in Fig. 3 show that all 26 samples soil samples did not correlate with the quantity of B. pseu- 6492 TRUNG ET AL. APPL . E NVIRON . M ICROBIOL .

TABLE 4. PCR-based detection of B. pseudomallei in 14 quantitative direct culture-negative soil samples collected in Northeast Thailand a

b Bacterial count from No. of positive replicates/total no. of replicates c Group Sample qPCR (mean no. of BPSS1187 gene Enrichment Direct qPCR GE/g of soil Ϯ SEM) nested PCR culture d culture I RFT 04 129 (174) 3/9 ϩ ϩ Ϫ RFT 28 47 e (62) 3/9 4/6 1/3 Ϫ S 95 37 e (28) 2/8 ϩ 1/3 Ϫ RFT 05 11 e (27) 1/9 4/6 1/3 Ϫ RFT 23 Ϫ Ϫ 4/6 2/6 Ϫ

II RFT 22 509 (610) 2/9 ϩ Ϫ Ϫ RFT 15 22 e (54) 1/9 ϩ Ϫ Ϫ RFT 10 9 e (23) 1/9 2/6 Ϫ Ϫ RFT 19 Ϫ Ϫ 4/6 Ϫ Ϫ RFT 06 Ϫ Ϫ Ϫ ϪϪ RFT 07 Ϫ Ϫ Ϫ ϪϪ RFT 09 Ϫ Ϫ Ϫ ϪϪ RFT 25 Ϫ Ϫ Ϫ ϪϪ RFT 30 Ϫ Ϫ Ϫ ϪϪ

a The data of enrichment cultures of single samples are from experiments reported in summary in a parallel study in which two culture protocols were compared (66). The bacterial counts, determined by qPCR as the numbers of GE copies per g of soil, represent the means of all replicates of the subsamples. Samples were grouped as follows: group I, positive enrichment culture; group II, negative enrichment culture. b ϩ, detection of B. pseudomallei in all replicates; Ϫ, no detection of B. pseudomallei in any replicates. c The data are the means and SEM of the results of three independent PCR experiments performed in duplicate (ﬁrst subsample of S 95) or triplicate. Calculations were performed using equation 2. Ϫ, no bacterial count was obtained. d Culture results on Ashdown’s agar after a 4-day enrichment step in Galimand broth at 40°C. e GE value was extrapolated using the equation shown in Fig. 1.

domallei GE (data not shown), indicating that the degree of B. sample was positive by nested PCR only, and five samples were pseudomallei DNA detection was not generally linked to the negative by both PCR methods. amount of bacterial DNA present or to the efficiency of recov- In other words, the increased sensitivity of the qPCR compared ering bacterial DNA from single samples. to that of the quantitative direct culture was demonstrated by Importantly, the qPCR assay yielded, on average, 10.6-fold detection of B. pseudomallei in seven samples which were negative (geometric mean; range, 1.1-fold to 151.3-fold) higher cell by direct culture, as shown in Table 4 (33 [94%] qPCR positive numbers than the respective CFU counts per gram obtained versus 26 [74%] direct quantitative culture positive, P ϭ 0.045, with our newly developed culture protocol based on soil dis- Fisher’s exact test). Those seven samples were all positive by persion in a polyethylene glycol and sodium deoxycholate so- nested PCR and, in the case of four samples, positive in enrich- lution (56). The qPCR-based cell count was 42.8-fold higher ment cultures, supporting the qPCR results. Templates extracted (geometric mean; range, 14-fold to 276-fold) than the cell and purified from the 10 German soil samples were negative, as count of the less sensitive standard soil culture protocol based expected, in the TTSS1 qPCR assay (data not shown), as B. on soil dispersion in water (50, 56). These differences were pseudomallei is not endemic in that country, providing further significant for both culture protocols when they were com- confirmation of the specificity of the PCR assays. pared to qPCR, with P values below 0.0001 (Wilcoxon signed rank test). DISCUSSION Only three 1-g subsamples were used for the qPCR out of the original 200-g sample, compared to the three 25-g sub- Although described almost a century ago (60), the world- samples used for culture experiments (56). Nonetheless, the wide environmental distribution of B. pseudomallei is still un- intrasample dispersion (quartile coefficient of dispersion) of B. known and our understanding of the environmental factors pseudomallei detection was significantly lower ( P ϭ 0.0007; determining the presence of B. pseudomallei is rudimentary. As Wilcoxon signed rank test) for the qPCR results (median, 0.33; a basis for a better understanding of B. pseudomallei ecology in range, 0.1 to 7.47) than for the direct culture results (median, its natural habitat, quantitative culture-dependent and quanti- 0.98; range, 0.38 to 9.36), as determined by Trung et al. (56). tative culture-independent molecular methods are needed to The PCR results of the samples which were negative by detect the organism. The two methodological approaches are direct culture but positive by enrichment culture or which were likely to complement rather than replace each other. To the negative by both culture methods are shown in Table 4. Out of best of our knowledge, the direct quantitative detection of B. five samples positive only by enrichment culture and negative pseudomallei from an environmental habitat using molecular by direct culture (Table 4, group I), four samples were qPCR methods has not been reported. We therefore aimed to estab- positive, with a median of 4.2 ϫ 10 1 genome equivalents, and lish a quantitative DNA-based method to detect B. pseudomal- another sample was positive only by the nested PCR. lei in soil samples from an area of endemicity. Out of nine samples negative by both culture methods (Ta- The soil samples used for validation of our PCR methods ble 4, group II), three samples were positive by qPCR, one originated from randomly selected rice fields in Amphoe Lao Sua VOL . 77, 2011 PCR-BASED ENUMERATION OF B. PSEUDOMALLEI CELLS IN SOIL 6493

Kok, Ubon Ratchathani province, Northeast Thailand, and con- TTSS1 qPCR protocol developed in this study led to an im- sisted of sandy loam taken at a depth of 30 cm. This habitat is proved PCR efficiency and a wider linear range of B. pseu- normally anoxic except for the rhizosphere of the rice plants (27), domallei detection compared to those of a PCR protocol ap- where members of the order Burkholderiales can also be found plied for the detection of B. pseudomallei in environmental (30). Generally, Proteobacteria represent a minor group of the enrichment cultures, with the same TTSS1 gene sequence used whole microbial community in bulk rice field paddies (27). as the target (24). Direct molecular bacterial detection from soil is method- Combining the TTSS1 qPCR assay with the BPSS1187 gene ologically challenging because PCR inhibitors are often coex- nested approach, we could classify 35 out of 40 soil samples as tracted with the DNA. Depending on the soil type, different B. pseudomallei positive. Out of these B. pseudomallei -positive concentrations of inhibitory components can be found. These samples, 26 samples were positive using our recently improved include humic acid, fulvic acid, polysaccharides, and metal ions quantitative culture-based method (56) and therefore were (59), all of which negatively affect the DNA polymerase activity directly compared to our qPCR protocol developed in this and/or the availability of DNA templates (38). Various strat- study. The significantly higher numbers of B. pseudomallei bac- egies have been proposed for excluding or reducing inhibitory teria detected in those 26 soil samples by TTSS1 qPCR (Fig. 3) effects in soil samples prior to PCR, such as the use of cesium might be explained by the coextraction of extracellular DNA chloride density gradient ultracentrifugation (4), dialysis (3), and/or DNA originating from viable but nonculturable cells of cetyltrimethylammonium bromide (CTAB) for complexing in- the bacterium (18). Although the subsamples used for PCR hibitors, polyvinylpolypyrrolidone (PVPP) (63), chromatogra- consisted of much less soil material than the subsamples used phy, electrophoresis, or multivalent cations (59) or the proce- for the culture method, the TTSS1 qPCR resulted in a signif- dures of separating inhibitors from nucleic acids applying gel icantly lower intrasample dispersion. It seems likely that an filtration (34), washing DNA immobilized in agarose (35), or uneven distribution in the culturable proportion of B. pseu- using PCR additives, such as nonacetylated bovine serum al- domallei populations, which might be due to differences in the bumin (BSA) and phage T4 gene 32 protein (59). hydration status of the soil as well as in the soil type itself (54), PCR inhibition was also observed in this study for the two is responsible for this phenomenon. commercial soil DNA isolation kits and the protocol developed Thirty (96.8%) out of 31 samples which were positive by in this study. Although both commercial kits tested coupled either direct culture or enrichment culture resulted in a posi- DNA extraction with purification by either chromatography tive signal in the TTSS1 qPCR assay. The only exception was (SoilMaster DNA extraction kit) or silica (FastDNA spin kit sample RFT 23, in which case the culture after the enrichment for soil), inhibition of amplification was not significantly pre- step was positive for B. pseudomallei but the TTSS1 gene vented until BSA was added to the PCR reagent mix. This was amplification was negative. However, this sample tested posi- also true for our protocol, which combined a conventional, tive in the nested BPSS1187 PCR. Out of the 35 B. pseudomal- slightly modified DNA extraction protocol with the washing of lei -positive samples, the TTSS1 qPCR detected more positive extracted DNA embedded in an agarose matrix. However, samples than did quantitative direct culture (33 [94%] versus using this protocol together with BSA as a PCR additive re- 26 [74%], P ϭ 0.045, Fisher’s exact test). However, with our sulted in the highest sensitivity for B. pseudomallei detection in sample size, the qualitative sensitivities were not significantly soil with a TTSS1-based qPCR. different when we compared the 35 samples which were posi- A limitation of our study is the restriction to soil samples of tive by either qPCR or nested BPSS1187 PCR to the 31 sam- sandy loam only, which is the most prevalent soil type in North- ples which were positive by either direct or enrichment culture east Thailand. Therefore, further field studies have to demon- (P ϭ 0.39, Fisher’s exact test). strate the general usefulness of our protocol for different soil In conclusion, our presented qPCR method is able to detect types. For the calculation of the sensitivity of our PCR meth- significantly larger numbers of B. pseudomallei bacteria within ods, we assumed a theoretical DNA extraction efficiency of soil samples, with a lower dispersion of subsample results, than 100%, being well aware that the soil type might influence the direct culturing methods. The nested-PCR approach detects B. efficiency of bacterial DNA extraction. We addressed this issue pseudomallei in samples at a detection limit that is below that in preliminary experiments in which we quantified total bacte- of the qPCR and thereby is able to further improve the culture- rial DNA by 16S rRNA gene copies in soil samples collected independent sensitivity of B. pseudomallei detection in soil. around Greifswald in Northeast Germany and in representa- Taken together, our experimental system will likely help un- tive samples from Northeast Thailand. Our results revealed a ravel the ecology of B. pseudomallei in its natural habitat. comparable, even slightly higher bacterial load in the soil ACKNOWLEDGMENTS around Greifswald, including samples with clay loam- and silty loam-like textures (data not shown), indicating a potential use- We thank Gumphol Wongsuvan, Sukanya Pangmee, Premjit fulness of our protocol for other soil types. Amornchai, Sayan Langla, and Anne Krause for their excellent technical assistance. Previous studies targeted the TTSS1 gene and BPSS1187 for This study was funded in part by the Wellcome Trust of Great the qualitative detection of B. pseudomallei in enrichment cul- Britain. tures of soil samples (24) and clinical samples (52), respec- REFERENCES tively. The results of our study confirm the specificity of these 1. Anuradha, K., A. K. Meena, and V. Lakshmi. 2003. Isolation of Burkholderia targets, since the TTSS1 gene and the BPSS1187 coding se- pseudomallei from a case of septicaemia—a case report. Indian J. Med. quence were present in all B. pseudomallei bacteria tested. Microbiol. 21: 129–132. 2. Barer, M. R., L. T. Gribbon, C. R. Harwood, and C. E. Nwoguh. 1993. The Furthermore, these sequences could not be detected within viable but non-culturable hypothesis and medical bacteriology. Rev. Med. genomic DNA of closely related species. Importantly, the Microbiol. 4: 183–191. 6494 TRUNG ET AL. APPL . E NVIRON . M ICROBIOL .

3. Barton, H. A., N. M. Taylor, B. R. Lubbers, and A. C. Pemberton. 2006. DNA 33. Meumann, E. M., et al. 2006. Clinical evaluation of a type III secretion extraction from low-biomass carbonate rock: an improved method with re- system real-time PCR assay for diagnosing melioidosis. J. Clin. Microbiol. duced contamination and the low-biomass contaminant database. J. Micro- 44: 3028–3030. biol. Methods 66: 21–31. 34. Miller, D. N. 2001. Evaluation of gel filtration resins for the removal of 4. Billi, D., M. Grilli Caiola, L. Paolozzi, and P. Ghelardini. 1998. A method PCR-inhibitory substances from soils and sediments. J. Microbiol. Methods for DNA extraction from the desert cyanobacterium Chroococcidiopsis and 44: 49–58. its application to identification of ftsZ . Appl. Environ. Microbiol. 64: 4053– 35. Moreira, D. 1998. Efficient removal of PCR inhibitors using agarose-embed- 4056. ded DNA preparations. Nucleic Acids Res. 26: 3309–3310. 5. Brett, P. J., D. DeShazer, and D. E. Woods. 1998. Burkholderia thailandensis 36. Nocker, A., P. Sossa-Fernandez, M. D. Burr, and A. K. Camper. 2007. Use sp. nov., a Burkholderia pseudomallei -like species. Int. J. Syst. Bacteriol. of propidium monoazide for live/dead distinction in microbial ecology. Appl. 48: 317–320. Environ. Microbiol. 73: 5111–5117. 6. Chantratita, N., et al. 2007. Biological relevance of colony morphology and 37. Novak, R. T., et al. 2006. Development and evaluation of a real-time PCR phenotypic switching by Burkholderia pseudomallei . J. Bacteriol. 189: 807– assay targeting the type III secretion system of Burkholderia pseudomallei . 817. J. Clin. Microbiol. 44: 85–90. 7. Cheng, A. C., and B. J. Currie. 2005. Melioidosis: epidemiology, pathophys- 38. Opel, K. L., D. Chung, and B. R. McCord. 2010. A study of PCR inhibition iology, and management. Clin. Microbiol. Rev. 18: 383–416. mechanisms using real time PCR. J. Forensic Sci. 55: 25–33. Chenna, R., et al. 8. 2003. Multiple sequence alignment with the Clustal series 39. Parry, C. M., et al. 1999. Melioidosis in southern Vietnam: clinical surveil- 31: of programs. Nucleic Acids Res. 3497–3500. lance and environmental sampling. Clin. Infect. Dis. 29: 1323–1326. 9. Currie, B. J. 2003. Melioidosis: an important cause of pneumonia in resi- 40. Patterson, M. C., C. L. Darling, and J. B. Blumenthal. 1967. Acute melioid- dents of and travellers returned from endemic regions. Eur. Respir. J. 22: osis in a soldier home from South Vietnam. JAMA 200: 447–451. 542–550. 41. Payne, G. W., et al. 2005. Development of a recA gene-based identification 10. Currie, B. J., D. A. Dance, and A. C. Cheng. 2008. The global distribution of approach for the entire Burkholderia genus. Appl. Environ. Microbiol. 71: Burkholderia pseudomallei and melioidosis: an update. Trans. R. Soc. Trop. 3917–3927. Med. Hyg. 102 (Suppl. 1) :S1–S4. 11. Currie, B. J., et al. 2000. The epidemiology of melioidosis in Australia and 42. Phuong, D. M., et al. 2008. Clinical and microbiological features of melioid- Papua New Guinea. Acta Trop. 74: 121–127. osis in northern Vietnam. Trans. R. Soc. Trop. Med. Hyg. 102 (Suppl. 1) : 12. Currie, B. J., et al. 2000. Endemic melioidosis in tropical northern Australia: S30–S36. a 10-year prospective study and review of the literature. Clin. Infect. Dis. 43. Puthucheary, S. D., N. Parasakthi, and M. K. Lee. 1992. Septicaemic me- 31: 981–986. lioidosis: a review of 50 cases from Malaysia. Trans. R. Soc. Trop. Med. Hyg. 13. Frostegard, A., et al. 1999. Quantification of bias related to the extraction of 86: 683–685. DNA directly from soils. Appl. Environ. Microbiol. 65: 5409–5420. 44. Remenant, B., et al. 2010. Genomes of three tomato pathogens within the 14. Gabor, E. M., E. J. de Vries, and D. B. Janssen. 2003. Efficient recovery of Ralstonia solanacearum species complex reveal significant evolutionary di- environmental DNA for expression cloning by indirect extraction methods. vergence. BMC Genomics 11: 379. FEMS Microbiol. Ecol. 44: 153–163. 45. Rolim, D. B., et al. 2005. Melioidosis, northeastern Brazil. Emerg. Infect. 15. Gibney, K. B., A. C. Cheng, and B. J. Currie. 2008. Cutaneous melioidosis in Dis. 11: 1458–1460. the tropical top end of Australia: a prospective study and review of the 46. Romling, U., et al. 1994. Epidemiology of chronic Pseudomonas aeruginosa literature. Clin. Infect. Dis. 47: 603–609. infections in cystic fibrosis. J. Infect. Dis. 170: 1616–1621. 16. Gotschlich, A., et al. 2001. Synthesis of multiple N-acylhomoserine lactones 47. Rotz, L. D., A. S. Khan, S. R. Lillibridge, S. M. Ostroff, and J. M. Hughes. is wide-spread among the members of the Burkholderia cepacia complex. 2002. Public health assessment of potential biological terrorism agents. Syst. Appl. Microbiol. 24: 1–14. Emerg. Infect. Dis. 8: 225–230. 17. Holden, M. T. G., et al. 2004. Genomic plasticity of the causative agent of 48. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users melioidosis, Burkholderia pseudomallei . Proc. Natl. Acad. Sci. U. S. A. 101: and for biologist programmers. Methods Mol. Biol. 132: 365–386. 14240–14245. 49. Saravu, K., et al. 2010. Melioidosis in southern India: epidemiological and 18. Inglis, T. J. J., and J.-L. Sagripanti. 2006. Environmental factors that affect clinical profile. Southeast Asian J. Trop. Med. Public Health 41: 401–409. the survival and persistence of Burkholderia pseudomallei . Appl. Environ. 50. Smith, M. D., V. Wuthiekanun, A. L. Walsh, and N. J. White. 1995. Quan- Microbiol. 72: 6865–6875. titative recovery of Burkholderia pseudomallei from soil in Thailand. Trans. 19. Inglis, T. J. J., et al. 1999. Acute melioidosis outbreak in Western Australia. R. Soc. Trop. Med. Hyg. 89: 488–490. Epidemiol. Infect. 123: 437–443. 51. Steinmetz, I., et al. 1999. Rapid identification of Burkholderia pseudomallei 20. Inglis, T. J. J., D. B. Rolim, and A. D. Sousa. 2006. Melioidosis in the by latex agglutination based on an exopolysaccharide-specific monoclonal Americas. Am. J. Trop. Med. Hyg. 75: 947–954. antibody. J. Clin. Microbiol. 37: 225–228. 21. Issack, M. I., C. D. Bundhun, and H. Gokhool. 2005. Melioidosis in Mauri- 52. Supaprom, C., et al. 2007. Development of real-time PCR assays and eval- tius. Emerg. Infect. Dis. 11: 139–140. uation of their potential use for rapid detection of Burkholderia pseudomallei 22. Johnson, J. 1994. Similarity analysis of rRNAs, p. 683–700. In P. Gerhardt, in clinical blood specimens. J. Clin. Microbiol. 45: 2894–2901. E. Murray, W. Wood, and N. Krieg (ed.), Methods for general and molecular 53. Suputtamongkol, Y., et al. 1994. The epidemiology of melioidosis in Ubon bacteriology. American Society for Microbiology, Washington, DC. Ratchatani, Northeast Thailand. Int. J. Epidemiol. 23: 1082–1090. Kaestli, M., et al. 23. 2009. Landscape changes influence the occurrence of the 54. Thomas, A. D., and J. C. Forbesfaulkner. 1981. Persistence of Pseudomonas melioidosis bacterium Burkholderia pseudomallei in soil in northern Austra- pseudomallei in Soil. Aust. Vet. J. 57: 535–536. lia. PLoS Negl. Trop. Dis. 3: e364. 55. Tong, S. D., S. Yang, Z. Z. Lu, and W. H. He. 1996. Laboratory investigation 24. Kaestli, M., et al. 2007. Sensitive and specific molecular detection of Burk- of ecological factors influencing the environmental presence of Burkholderia holderia pseudomallei , the causative agent of melioidosis, in the soil of trop- pseudomallei . Microbiol. Immunol. 40: 451–453. ical northern Australia. Appl. Environ. Microbiol. 73: 6891–6897. 56. Trung, T. T., et al. 2011. Improved culture-based detection and quantifica- 25. Krsek, M., and E. M. Wellington. 1999. Comparison of different methods for tion of Burkholderia pseudomallei from soil. Trans. R. Soc. Trop. Med. Hyg. the isolation and purification of total community DNA from soil. J. Micro- 105: 346–351. biol. Methods 39: 1–16. von Wintzingerode, F., U. B. Gobel, and E. Stackebrandt. 26. Larsen, G. Y., T. L. Stull, and J. L. Burns. 1993. Marked phenotypic vari- 57. 1997. Determina- ability in Pseudomonas cepacia isolated from a patient with cystic fibrosis. tion of microbial diversity in environmental samples: pitfalls of PCR-based J. Clin. Microbiol. 31: 788–792. rRNA analysis. FEMS Microbiol. Rev. 21: 213–229. 27. Liesack, W., S. Schnell, and N. P. Revsbech. 2000. Microbiology of flooded 58. White, N. J. 2003. Melioidosis. Lancet 361: 1715–1722. rice paddies. FEMS Microbiol. Rev. 24: 625–645. 59. Wilson, I. G. 1997. Inhibition and facilitation of nucleic acid amplification. 28. Limmathurotsakul, D., et al. 2010. Increasing incidence of human melioid- Appl. Environ. Microbiol. 63: 3741–3751. osis in Northeast Thailand. Am. J. Trop. Med. Hyg. 82: 1113–1117. 60. Woods, D., and P. Sokol. 2006. The genus Burkholderia , p. 848–860. In M. 29. Limmathurotsakul, D., et al. 2010. Burkholderia pseudomallei is spatially Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt distributed in soil in Northeast Thailand. PLoS Negl. Trop. Dis. 4: e694. (ed.), The prokaryotes, vol. 5. Proteobacteria: alpha and beta subclasses. 30. Lu, Y. H., D. Rosencrantz, W. Liesack, and R. Conrad. 2006. Structure and Springer Science, New York, NY. activity of bacterial community inhabiting rice roots and the rhizosphere. 61. Wuthiekanun, V., M. D. Smith, D. A. Dance, and N. J. White. 1995. Isolation Environ. Microbiol. 8: 1351–1360. of Pseudomonas pseudomallei from soil in north-eastern Thailand. Trans. R. 31. Martin-Laurent, F., et al. 2001. DNA extraction from soils: old bias for new Soc. Trop. Med. Hyg. 89: 41–43. microbial diversity analysis methods. Appl. Environ. Microbiol. 67: 2354– 62. Yee, K. C., M. K. Lee, C. T. Chua, and S. D. Puthucheary. 1988. Melioidosis, 2359. the great mimicker: a report of 10 cases from Malaysia. J. Trop. Med. Hyg. 32. Mays, E. E., and E. A. Ricketts. 1975. Melioidosis: recrudescence associated 91: 249–254. with bronchogenic carcinoma twenty-six years following initial geographic 63. Zhou, J., M. A. Bruns, and J. M. Tiedje. 1996. DNA recovery from soils of exposure. Chest 68: 261–263. diverse composition. Appl. Environ. Microbiol. 62: 316–322. References

References

1. Amornchai, P., W. Chierakul, et al. (2007). "Accuracy of Burkholderia pseudomallei

identification using the API 20NE system and a latex agglutination test." J Clin

Microbiol 45 (11): 3774-3776.

2. Brett, P. J., D. DeShazer, et al. (1998). " Burkholderia thailandensis sp. nov., a

Burkholderia pseudomallei -like species." Int J Syst Bacteriol 48 Pt 1 : 317-320.

3. Brook, M. D., B. Currie, et al. (1997). "Isolation and identification of Burkholderia

pseudomallei from soil using selective culture techniques and the polymerase chain

reaction." J Appl Microbiol 82 (5): 589-596.

4. Chaowagul, W., N. J. White, et al. (1989). "Melioidosis: a major cause of community-

acquired septicemia in northeastern Thailand." J Infect Dis 159 (5): 890-899.

5. Cheng, A. C. and B. J. Currie (2005). "Melioidosis: epidemiology, pathophysiology, and

management." Clin Microbiol Rev 18 (2): 383-416.

6. Cheng, A. C., N. P. Day, et al. (2005). " Burkholderia pseudomallei strain type, based on

pulsed-field gel electrophoresis, does not determine disease presentation in

melioidosis." Microbes Infect 7(1): 104-109.

7. Cheng, A. C., D. Godoy, et al. (2004). "Isolates of Burkholderia pseudomallei from

Northern Australia are distinct by multilocus sequence typing, but strain types do not

correlate with clinical presentation." J Clin Microbiol 42 (12): 5477-5483.

8. Cheng, A. C., V. Wuthiekanun, et al. (2006). "Role of selective and nonselective media for

isolation of Burkholderia pseudomallei from throat swabs of patients with melioidosis."

J Clin Microbiol 44 (6): 2316.

9. Chiarini, L., A. Bevivino, et al. (2006). " Burkholderia cepacia complex species: health

hazards and biotechnological potential." Trends Microbiol 14 (6): 277-286.

48 References

10. Coenye, T. and P. Vandamme (2003). "Diversity and significance of Burkholderia species

occupying diverse ecological niches." Environ Microbiol 5(9): 719-729.

11. Colwell, R. R. (2000). "Viable but nonculturable bacteria: a survival strategy." J Infect

Chemother 6(2): 121-125.

12. Currie, B. J. (2008). "Advances and remaining uncertainties in the epidemiology of

Burkholderia pseudomallei and melioidosis." Trans R Soc Trop Med Hyg 102 (3): 225-

227.

13. Currie, B. J., D. A. Dance, et al. (2008). "The global distribution of Burkholderia

pseudomallei and melioidosis: an update." Trans R Soc Trop Med Hyg 102 Suppl 1 :

S1-4.

14. Currie, B. J., D. A. Fisher, et al. (2000). "Endemic melioidosis in tropical northern

Australia: a 10-year prospective study and review of the literature." Clin Infect Dis

31 (4): 981-986.

15. Currie, B. J. and S. P. Jacups (2003). "Intensity of rainfall and severity of melioidosis,

Australia." Emerg Infect Dis 9(12): 1538-1542.

16. Currie, B. J., S. P. Jacups, et al. (2004). "Melioidosis epidemiology and risk factors from a

prospective whole-population study in northern Australia." Trop Med Int Health 9(11):

1167-1174.

17. Currie, B. J., M. Mayo, et al. (2001). "A cluster of melioidosis cases from an endemic

region is clonal and is linked to the water supply using molecular typing of

Burkholderia pseudomallei isolates." Am J Trop Med Hyg 65 (3): 177-179.

18. Dale, J., E. P. Price, et al. (2011). "Epidemiological tracking and population assignment of

the non-clonal bacterium, Burkholderia pseudomallei ." PLoS Negl Trop Dis 5(12):

e1381.

19. Dance, D. A. (1991). "Melioidosis: the tip of the iceberg?" Clin Microbiol Rev 4(1): 52-

60.

49 References

20. Douglas, M. W., G. Lum, et al. (2004). "Epidemiology of community-acquired and

nosocomial bloodstream infections in tropical Australia: a 12-month prospective study."

Trop Med Int Health 9(7): 795-804.

21. Gal, D., M. Mayo, et al. (2004). "Contamination of hand wash detergent linked to

occupationally acquired melioidosis." Am J Trop Med Hyg 71 (3): 360-362.

22. Godoy, D., G. Randle, et al. (2003). "Multilocus sequence typing and evolutionary

relationships among the causative agents of melioidosis and glanders, Burkholderia

pseudomallei and Burkholderia mallei ." J Clin Microbiol 41 (5): 2068-2079.

23. Hagen, R. M., Y. P. Gauthier, et al. (2002). "Strategies for PCR based detection of

Burkholderia pseudomallei DNA in paraffin wax embedded tissues." Mol Pathol 55 (6):

398-400.

24. Holden, M. T., R. W. Titball, et al. (2004). "Genomic plasticity of the causative agent of

melioidosis, Burkholderia pseudomallei ." Proc Natl Acad Sci U S A 101 (39): 14240-

14245.

25. Hsueh, P. R., L. J. Teng, et al. (2001). "Melioidosis: an emerging infection in Taiwan?"

Emerg Infect Dis 7(3): 428-433.

26. Inglis, T. J., A. Merritt, et al. (2005). "Comparison of diagnostic laboratory methods for

identification of Burkholderia pseudomallei ." J Clin Microbiol 43 (5): 2201-2206.

27. Inglis, T. J., L. O'Reilly, et al. (2002). "Comparison of rapid, automated ribotyping and

DNA macrorestriction analysis of Burkholderia pseudomallei ." J Clin Microbiol 40 (9):

3198-3203.

28. Inglis, T. J., D. B. Rolim, et al. (2006). "Clinical guideline for diagnosis and management

of melioidosis." Rev Inst Med Trop Sao Paulo 48 (1): 1-4.

29. Inglis, T. J. and J. L. Sagripanti (2006). "Environmental factors that affect the survival and

persistence of Burkholderia pseudomallei ." Appl Environ Microbiol 72 (11): 6865-6875.

50 References

30. John, T. J., M. V. Jesudason, et al. (1996). "Melioidosis In India: the tip of the iceberg?"

Indian J Med Res 103 : 62-65.

31. Kaestli, M., M. Mayo, et al. (2009). "Landscape changes influence the occurrence of the

melioidosis bacterium Burkholderia pseudomallei in soil in northern Australia." PLoS

Negl Trop Dis 3(1): e364.

32. Kaestli, M., M. Mayo, et al. (2007). "Sensitive and specific molecular detection of

Burkholderia pseudomallei , the causative agent of melioidosis, in the soil of tropical

northern Australia." Appl Environ Microbiol 73 (21): 6891-6897.

33. Kaestli, M., M. Schmid, et al. (2011). "Out of the ground: aerial and exotic habitats of the

melioidosis bacterium Burkholderia pseudomallei in grasses in Australia." Environ

Microbiol.

34. Kao, C. M., S. C. Chen, et al. (2003). "Detection of Burkholderia pseudomallei in rice

fields with PCR-based technique." Folia Microbiol (Praha) 48 (4): 521-524.

35. Karunakaran, R. and S. D. Puthucheary (2007). "Burkholderia pseudomallei : in vitro

susceptibility to some new and old antimicrobials." Scand J Infect Dis 39 (10): 858-861.

36. Kim, H. S., M. A. Schell, et al. (2005). "Bacterial genome adaptation to niches:

divergence of the potential virulence genes in three Burkholderia species of different

survival strategies." BMC Genomics 6: 174.

37. Kunakorn, M., K. Raksakait, et al. (2000). "Comparison of three PCR primer sets for

diagnosis of septicemic melioidosis." Acta Trop 74 (2-3): 247-251.

38. Leelarasamee, A. (2004). "Recent development in melioidosis." Curr Opin Infect Dis

17 (2): 131-136.

39. Limmathurotsakul, D., W. Chaowagul, et al. (2006). "Risk factors for recurrent

melioidosis in northeast Thailand." Clin Infect Dis 43 (8): 979-986.

40. Limmathurotsakul, D., V. Wuthiekanun, et al. (2010). " Burkholderia pseudomallei is

spatially distributed in soil in northeast Thailand." PLoS Negl Trop Dis 4(6): e694.

51 References

41. Mahenthiralingam, E., A. Baldwin, et al. (2008). " Burkholderia cepacia complex bacteria:

opportunistic pathogens with important natural biology." J Appl Microbiol 104 (6):

1539-1551.

42. Maiden, M. C., J. A. Bygraves, et al. (1998). "Multilocus sequence typing: a portable

approach to the identification of clones within populations of pathogenic

microorganisms." Proc Natl Acad Sci U S A 95 (6): 3140-3145.

43. Malczewski, A. B., K. M. Oman, et al. (2005). "Clinical presentation of melioidosis in

Queensland, Australia." Trans R Soc Trop Med Hyg 99 (11): 856-860.

44. McCombie, R. L., R. A. Finkelstein, et al. (2006). "Multilocus sequence typing of

historical Burkholderia pseudomallei isolates collected in Southeast Asia from 1964 to

1967 provides insight into the epidemiology of melioidosis." J Clin Microbiol 44 (8):

2951-2962.

45. Meumann, E. M., R. T. Novak, et al. (2006). "Clinical evaluation of a type III secretion

system real-time PCR assay for diagnosing melioidosis." J Clin Microbiol 44 (8): 3028-

3030.

46. Moore, R. A., A. Tuanyok, et al. (2008). "Survival of Burkholderia pseudomallei in

water." BMC Res Notes 1: 11.

47. Novak, R. T., M. B. Glass, et al. (2006). "Development and evaluation of a real-time PCR

assay targeting the type III secretion system of Burkholderia pseudomallei ." J Clin

Microbiol 44 (1): 85-90.

48. Palasatien, S., R. Lertsirivorakul, et al. (2008). "Soil physicochemical properties related to

the presence of Burkholderia pseudomallei ." Trans R Soc Trop Med Hyg 102 Suppl 1 :

S5-9.

49. Parry, C. M., V. Wuthiekanun, et al. (1999). "Melioidosis in Southern Vietnam: clinical

surveillance and environmental sampling." Clin Infect Dis 29 (5): 1323-1326.

52 References

50. Payne, G. W., P. Vandamme, et al. (2005). "Development of a recA gene-based

identification approach for the entire Burkholderia genus." Appl Environ Microbiol

71 (7): 3917-3927.

51. Peacock, S. J. (2006). "Melioidosis." Curr Opin Infect Dis 19 (5): 421-428.

52. Pearson, T., P. Giffard, et al. (2009). "Phylogeographic reconstruction of a bacterial

species with high levels of lateral gene transfer." BMC Biol 7: 78.

53. Phung, L. V., T. B. Tran, et al. (1995). "Cellular lipid and fatty acid compositions of

Burkholderia pseudomallei strains isolated from human and environment in Viet Nam."

Microbiol Immunol 39 (2): 105-116.

54. Robertson, J., A. Levy, et al. (2010). "The survival of Burkholderia pseudomallei in liquid

media." Am J Trop Med Hyg 82 (1): 88-94.

55. Rolim, D. B., D. C. Vilar, et al. (2005). "Melioidosis, northeastern Brazil." Emerg Infect

Dis 11 (9): 1458-1460.

56. Samosornsuk, N., A. Lulitanond, et al. (1999). "Short report: evaluation of a monoclonal

antibody-based latex agglutination test for rapid diagnosis of septicemic melioidosis."

Am J Trop Med Hyg 61 (5): 735-737.

57. Shih, H. I., Y. C. Chuang, et al. (2009). "Sporadic and outbreak cases of melioidosis in

southern Taiwan: clinical features and antimicrobial susceptibility." Infection 37 (1): 9-

15.

58. Sim, S. H., Y. Yu, et al. (2008). "The core and accessory genomes of Burkholderia

pseudomallei : implications for human melioidosis." PLoS Pathog 4(10): e1000178.

59. Simpson, A. J., Y. Suputtamongkol, et al. (1999). "Comparison of imipenem and

ceftazidime as therapy for severe melioidosis." Clin Infect Dis 29 (2): 381-387.

60. Sprague, L. D. and H. Neubauer (2004). "Melioidosis in animals: a review on

epizootiology, diagnosis and clinical presentation." J Vet Med B Infect Dis Vet Public

Health 51 (7): 305-320.

53 References

61. Steinmetz, I., A. Reganzerowski, et al. (1999). "Rapid identification of Burkholderia

pseudomallei by latex agglutination based on an exopolysaccharide-specific monoclonal

antibody." J Clin Microbiol 37 (1): 225-228.

62. Stone, R. (2007). "Infectious disease. Racing to defuse a bacterial time bomb." Science

317 (5841): 1022-1024.

63. Suarez-Moreno, Z. R., J. Caballero-Mellado, et al. (2012). "Common features of

environmental and potentially beneficial plant-associated burkholderia." Microb Ecol

63 (2): 249-266.

64. Supaprom, C., D. Wang, et al. (2007). "Development of real-time PCR assays and

evaluation of their potential use for rapid detection of Burkholderia pseudomallei in

clinical blood specimens." J Clin Microbiol 45 (9): 2894-2901.

65. Suputtamongkol, Y., W. Chaowagul, et al. (1999). "Risk factors for melioidosis and

bacteremic melioidosis." Clin Infect Dis 29 (2): 408-413.

66. Thibault, F. M., E. Hernandez, et al. (2004). "Antibiotic susceptibility of 65 isolates of

Burkholderia pseudomallei and Burkholderia mallei to 35 antimicrobial agents." J

Antimicrob Chemother 54 (6): 1134-1138.

67. Tong, S., S. Yang, et al. (1996). "Laboratory investigation of ecological factors

influencing the environmental presence of Burkholderia pseudomallei ." Microbiol

Immunol 40 (6): 451-453.

68. Tuanyok, A., B. R. Leadem, et al. (2008). "Genomic islands from five strains of

Burkholderia pseudomallei ." BMC Genomics 9: 566.

69. Tumapa, S., M. T. Holden, et al. (2008). " Burkholderia pseudomallei genome plasticity

associated with genomic island variation." BMC Genomics 9: 190.

70. Turner, K. M., W. P. Hanage, et al. (2007). "Assessing the reliability of eBURST using

simulated populations with known ancestry." BMC Microbiol 7: 30.

54 References

71. Van Phung, L., H. T. Quynh, et al. (1993). "Pilot study of exposure to Pseudomonas

pseudomallei in northern Vietnam." Trans R Soc Trop Med Hyg 87 (4): 416.

72. Vanlaere, E., J. J. Lipuma, et al. (2008). " Burkholderia latens sp. nov., Burkholderia

diffusa sp. nov., Burkholderia arboris sp. nov., Burkholderia seminalis sp. nov. and

Burkholderia metallica sp. nov., novel species within the Burkholderia cepacia

complex." Int J Syst Evol Microbiol 58 (Pt 7): 1580-1590.

73. Vermis, K., T. Coenye, et al. (2002). "Evaluation of species-specific recA-based PCR

tests for genomovar level identification within the Burkholderia cepacia complex." J

Med Microbiol 51 (11): 937-940.

74. Vesaratchavest, M., S. Tumapa, et al. (2006). "Nonrandom distribution of Burkholderia

pseudomallei clones in relation to geographical location and virulence." J Clin

Microbiol 44 (7): 2553-2557.

75. Vidyalakshmi, K., M. Chakrapani, et al. (2008). "Tuberculosis mimicked by melioidosis."

Int J Tuberc Lung Dis 12 (10): 1209-1215.

76. Vuddhakul, V., P. Tharavichitkul, et al. (1999). "Epidemiology of Burkholderia

pseudomallei in Thailand." Am J Trop Med Hyg 60 (3): 458-461.

77. Walsh, A. L., M. D. Smith, et al. (1994). "Immunofluorescence microscopy for the rapid

diagnosis of melioidosis." J Clin Pathol 47 (4): 377-379.

78. White, N. J. (2003). "Melioidosis." Lancet 361 (9370): 1715-1722.

79. White, N. J., D. A. Dance, et al. (1989). "Halving of mortality of severe melioidosis by

ceftazidime." Lancet 2(8665): 697-701.

80. Wuthiekanun, V., M. Mayxay, et al. (2005). "Detection of Burkholderia pseudomallei in

soil within the Lao People's Democratic Republic." J Clin Microbiol 43 (2): 923-924.

81. Wuthiekanun, V., M. D. Smith, et al. (1995). "Isolation of Pseudomonas pseudomallei

from soil in north-eastern Thailand." Trans R Soc Trop Med Hyg 89 (1): 41-43.

55 References

82. Yabuuchi, E., Y. Kosako, et al. (1992). "Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov." Microbiol Immunol 36 (12): 1251-1275. 83. Yamamoto, H. (2000). "Viable but nonculturable state as a general phenomenon of non- spore-forming bacteria, and its modeling." J Infect Chemother 6(2): 112-114. 84. Yang, H. C., W. T. Im, et al. (2006). " Burkholderia terrae sp. nov., isolated from a forest soil." Int J Syst Evol Microbiol 56 (Pt 2): 453-457. 85. Yang, S. (2000). "Melioidosis research in China." Acta Trop 77 (2): 157-165.

56 Declaration

Eidesstattliche Versicherung

Hiermit erkläre ich, dass diese Arbeit bisher von mir weder an der Mathematisch- Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald noch an einer anderen wissenschaftlichen Einrichtung zum Zwecke der Promotion eingereicht wurde.

Ferner erkläre ich, dass ich diese Arbeit selbstständig verfasst und keine anderen als die darin angegebenen Hilfsmittel und Hilfen benutzt und keine Textabschnitte eines Dritten ohne Kennzeichnung übernommen habe.

Trinh, Thanh Trung

57 Curriculum Vitae

Curriculum Vitae

Personal details Name : Trinh Thanh Trung Gender : Male Date of birth : 17 th November 1980 Place of birth : Gia Lam - Nho Quan - Ninh Binh - Viet Nam Marital status : Married Nationality : Viet Nam Religion : None Education From 1986 to 1995, studied at Gia Lam primary and secondary school From 1996 to 1998, studied at Nho Quan high school From 1998 to 2002, studied at Ha Noi University of Science, Faculty of Biology, Department of Microbiology - Thesis title: Isolation and characterization of antibiotic-producing filamentous fungi against phytopathogenic bacterium Ralstonia solanacearum. - Degree: Bachelor of Science (grade: good) From 2002 to 2004, worked at Institute of Microbiology and Biotechnology, Hanoi National University From 2004 to 2005, studied in the Joint Graduate Education Program of Ha Noi University of Science and Greifswald University, Germany - Degree: Diploma Equivalent From 2005 to date, Ph.D student at Institute of Medical Microbiology, Greifswald University, Germany

Publications

Original articles

T. T. Trinh , A. Hetzer, A. Göhler, E. Topfstedt, D. Limmathurotsakul, V. Wuthiekanun, S. J. Peacock, and I. Steinmetz. 2011. Highly sensitive detection and quantification of Burkholderia pseudomallei in environmental soil samples using real- time PCR. Appl. Environ. Microbiol Vol 77, 2011, S. 6486-6494. (2010 Impact Factor: 3,778).

T. T. Trinh , A. Hetzer, E. Topfstedt, A. Göhler, D. Limmathurotsakul, V. Wuthiekanun, M. E. Peacock, and I. Steinmetz. 2011. Improved culture-based detection and quantification of Burkholderia pseudomallei from soil. Trans R Soc Trop Med Hyg 105(6): 346-51. (2010 Impact-Factor: 2,832)

M. P. Doan, T. T. Trinh , K. Breitbach, Q. T. Nguyen, U. Nubel, G. Flunker, D. K. Dinh, X. Q. Nguyen, and I. Steinmetz. 2008. Clinical and microbiological features of melioidosis in Northern Vietnam. Trans R Soc Trop Med Hyg 102 Suppl 1:S30-6. (2010 Impact-Factor: 2,832)

T. L. Dao, V. T. Pham, T. T. Trinh , L. D. Nguyen. 2004. Biological properties and antibiotic activities of Streptomyces sp. L30 strain against Ralstonia solanacearum . Journal of Genetics and Applications. ISSN 0886-5866.

Poster presentations

T. T. Trinh , A. Hetzer, and I. Steinmetz. 2010. Direct molecular detection of environmental Burkholderia pseudomallei in soil from endemic areas. Poster presented at the 3 rd joint conference of German Society for Hygiene and Microbiology (DGHM) and Association for General and Applied Microbiology (VAAM). Hannover, Germany T. T. Trinh , M. P. Doan, N. Meukow, K. Breitbach, Q. T. Nguyen, G. Flunker, D. K. Dinh, X. Q. Nguyen, and I. Steinmetz. 2007. Clinical and microbial characteristics of melioidosis in Northern Vietnam. Poster presented at the meeting of the Deutschen Gesellschaft für Hygiene und Mikrobiologie (DGHM), Göttinggen, Germany, and at the meeting of the 5 th World Melioidosis, Khon Kaen, Thailand. 59

Contributions to articles

Clinical and microbiological features of melioidosis in Northern Vietnam Doan Mai Phuong, Trinh Thanh Trung, Katrin Breitbach, Nguyen Quang Tuan, Ulrich Nübel, Gisela Flunker, Dinh Duy Khang, Nguyen Xuan Quang, and Ivo Steinmetz. Transactions of The Royal Society of Tropical Medicine and Hygiene. 2008. 102 Suppl 1: S30-36.

Contributions to the article: Together with Doan Mai Phuong and Katrin Breitbach, the author of the thesis conducted the classical microbiological characterization of strains. He performed molecular typing of strains, supporting by Gisela Flunker. He also performed the analysis and interpretation of clinical and/or laboratory data, together with the other authors. He critically read and approved the final manuscript.

Improved culture-based detection and quantification of Burkholderia pseudomallei from soi Trinh Thanh Trung, Adrian Hetzer, Eylin Topfstedt, Andre Göhler, Direk Limmathurotsakul, Vanaporn Wuthiekanun, Sharon J. Peacock, and Ivo Steinmetz. Transactions of The Royal Society of Tropical Medicine and Hygiene. 2011. 105(6): 346-51.

Contributions to the article: Together with Adrian Hetzer, Vanaporn Wuthiekanun and Ivo Steinmetz, the author of the thesis planned the study. He conducted the microbiological analysis of soil samples and molecular identification of strains supported by Eylin Topfstedt. He analyzed the data, and wrote and approved the manuscript in cooperation with the other authors.

Highly sensitive direct detection and quantification of Burkholderia pseudomallei in environmental soil samples using real-time PCR Trinh Thanh Trung, Adrian Hetzer, Andre Göhler, Eylin Topfstedt, Direk Limmathurotsakul, Vanaporn Wuthiekanun, Sharon J. Peacock, and Ivo Steinmetz. Applied and Environmental Microbiology. 2011. 77 (18): 6486-94.

Contributions to the article: Together with Adrian Hetzer, Vanaporn Wuthiekanun and Ivo Steinmetz, the author of the thesis planned the study. He performed the molecular assays and analysis of the data. He also wrote and approved the manuscript in cooperation with the other authors.

Prof. Dr. Ivo Steinmetz Trinh, Thanh Trung

60 Acknowledgements

Acknowledgements

In 2004, during the spring course of the Joint Graduate Education Program (JGEP) at Hanoi University of Science, I had the great opportunity to hear many scientific research topics presented by active professors from the University of Greifswald. Of those interesting topics, I was most impressed by melioidosis as a human infectious disease and research topic which I wished to pursue for a PhD. Now, I am very happy to thank everyone who has helped me throughout my studies. Without your care and consideration, my dream could never have become true. Firstly, I would like to express my deepest gratitude to my supervisor, Prof. Dr. Ivo Steinmetz, for giving me a golden opportunity to work in your laboratory. You are the first one who taught me the basic concepts of melioidosis, and inspired me with enthusiasm to discover the forgotten subject in the field of infectious disease in my country. You taught me every step to start a scientific project, always encouraged my creative side when we initiated a new experiment, and gave me a great chance to extend my knowledge by participating in the world’s scientific community at international conferences. I really appreciate your invaluable help and nurturing attitude during my study in Greifswald. Secondly, I am so grateful to Dr. Doan Mai Phuong at the Department of Medical Microbiology, Bach Mai hospital, Hanoi, for giving me a chance to gain much experience in the diagnosis of infectious disease in your laboratory. You were always willing to share valuable information which let me understand the current status in the diagnosis of infectious disease in Vietnam. You encouraged me throughout my study. I have really come to appreciate your openness and your passion. Without your contributions, this thesis would never have been possible. Thirdly, I would like to thank Dr. Vanaporn Wuthiekanun, Dr. Direk Limmathurotsakul, and Prof. Dr. Sharon Peacock at the Mahidol-Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand, for soil sampling in Northeast Thailand. Via email, you gave me a great deal of valuable advice on bacterial culturing techniques.

61 Acknowledgements

My special thanks also go to: Dr. Katrin Breitbach for guiding me throughout the laboratory regulations, analyzing clinical data, and assisting me greatly during my first days living in Germany. Dr. Gisela Flunker for molecular advice. Dr. Adrian Hetzer for supervising me through the soil DNA extraction techniques. Dr. Andre Göhler for enthusiastic work on manuscripts. Mrs. Helga Schalimow for teaching many excellent techniques in the clinical laboratory and Mrs Kathleen Splieth for English grammar proofreading and correction of my thesis. Many wonderful and brilliant friends, whose names I can’t list here, for taking time to discuss problems that occurred during experiments and showing me how to adapt to and enjoy the lifestyle in Germany. I appreciate financial assistance from the Vietnamese government, Deutscher Akademischer Austausch Dienst (DAAD), and the Faculty of Medicine, Greifswald University. I would also thank the people organizing the JGEP program, especially Dr. Le Tran Binh, Dr. Le Thi Lai, and Dr. Jörn Kasbobm, for giving us a great chance to study in Germany. Finally, my deep gratitude goes to my family, especially to my wife and my little sons, for their help, encouragement, and patience.

62 Appendix

Appendix

A. Lists of media used in the thesis Glimand’s broth

KH 2PO 4 0.451 g

K 2HPO 4 1.730 g

MgSO 47H 2O 0.123 g

CaCl 2 0.0147 g NaCl 10 g Nitrilotriacetic acid 0.200 g Solution A 20 ml Distilled water 900 ml Adjust pH to 7.2 with 1N KOH, sterilize at 121 oC for 15 minutes Add 100 ml aseptic L-Threonine to get a final concentration of 0.05 M (5.956 g/L) Add polymyxin B sulfate salt powder (Fulka) to get a final concentration of 1 g/L

SOLUTION A

H 3PO 4 85% 2.306 ml (1.96g/L)

FeSO 4.7H 2O 0.556 g

ZnSO 4.7H 2O 0.297 g

CuSO 4.5H 2O 0.0218 g (CuSO 4.7H 2O=0.025g)

MnSO 4.H 2O 0.125 g

Co(NO 3) 2 .6H 2O 0.030 g

Na 2MoO 4H2O 0.030 g

H 3BO 3 0.062 g Distilled water 1000 ml

Aseptic L-Threonine

L-Threonine(AppliChem) 5.95 g Distilled water 100 ml Sterilize through a 0.22 µm filter (Millipore)

63 Appendix

Ashdown agar

Tryptone soya broth 10 g Agar 15 g Glycerol 40 ml Crystal violet0.1% 5 ml Neutral red 1% 5 ml Distilled water 950 ml Autoclave at 121 oC for 15 min Add gentamicin to a final concentration of 5mg/L and then dispense into petri-dish

B. Lists of solutions and buffers used in the thesis PEG-DOC solution Sodium deoxycholate 1 g Polyethylene glycol 6000 25 g Distilled water 1000 ml Completely dissolve the reagents by magnetic stirring for 30 min and then sterilize through 0.22µm filter

CTAB solution

1M Tris HCl pH 8.0 100 ml

0.5 Na 2EDTA pH 8.0 200 ml SDS 10 g Cetyltrimethyl ammonium bromide 10 g Stir vigorously on a magnetic stirrer for 2 hours Bring total volume to 1000ml with distilled water and then adjust pH to 8.0 Sterilize through 0.22 µm filter

1.6% LMP agarose

Low melting point agarose 0.4 g Distilled water 25 ml Boil the mixture in a microwave for 1min Add the same amount of distilled water evaporated during boiling process Pipette the melted LMP agarose into 2 ml tubes and store at 4ºC. Heat the tube at 70°C for 2 min before use

64 Appendix

Lysis buffer

1M Tris HCl pH 8.0 100 ml

0.5 Na 2EDTA pH 8.0 200 ml 5M NaCl 300 ml Cetyltrimethyl ammonium bromide 10 g Stir vigorously on a magnetic stirrer for 2 hours Bring total volume to 1000ml with distilled water and then adjust pH to 8.0 Sterilize through 0.22 µm filter

TE buffer

1M Tris HCl pH 8.0 10 ml

0.5M Na 2EDTA pH 8.0 200 µl Distilled water 1000 ml Sterilize by autoclaving at 121 0C for 20min

20% SDS

SDS 200 g Distilled water 1000 ml Heat in the water bath at 70 oC until SDS is dissolved Adjust pH to 7.2 with 1% HCl and sterilize through 0.22 µm filter

1 M Tris HCl pH 8.0

Tris 121.1 g Distilled water 800 ml Adjust pH to 8.0 using concentrated HCl (approximately 42 ml) and then bring total volume to 1000 ml with distilled water

0.5 M Na 2EDTA pH 8.0

Na 2EDTA 186.12 g NaOH ~ 20 g Distilled water 800 ml Completely dissolve the reagents by magnetic stirring for 2 hours Adjust pH to 8.0 and then bring total volume to 1000 ml with distilled water

65 Appendix

5 M NaCl

NaCl 292.5 g Distilled water 1000 ml

50 mg/ml lysozyme

Lysozyme 50 mg 10 mM Tris HCl pH 8.0 1 ml Store at 4 oC

10 mg/ml proteinase K

Proteinase K 10 mg 10 mM Tris HCl pH 8.0 1 ml Store at 4 oC

C. List of primers used for end-point PCR assays in the thesis

Annealing Product Gene target Primer name Primer sequence (5’ to 3’) temperature size (bp) (oC)

BUR1 forward GATCGAA(G)AAGCAGTTCGGCAA recA 60 967 BUR2 reverse TTGTCCTTGCCCTGA(G)CCGAT

ace forward CGGCGCTTCTCAAAACGATA ace 60 617 ace reverse GAATCGCCTTCACCATGTC

gltB forward ACGCTCGCGATCGCGATGAA gltB 60 647 gltB reverse TTCAGCACGAGCGTCTGCTG

gmhD forward GCAGTTCCTGTATGCGTC gmhD 60 559 gmhD reverse GAAGCACTGGTACTTGCC

lepA forward CATATTCGCAATTTCTCGATC lepA 60 624 lepA reverse CACGAGCATCACGACGCCG

lipA forward GGCACCGCGACGTTCATG lipA 60 462 lipA reverse GACCATCAGGCCCGATTTCG

narK forward CTACTCGTGCGCTGGGAT narK 60 642 narK reverse GACGATGAACGGCACCCAC

ndh forward AGTCGCGACGTTCTACAC ndh 60 567 ndh reverse CGAGTTGCAGACGAGATA

66 Appendix

D. Soil sampling for the environmental detection of B. pseudomallei in Northern Vietnam Three soil sampling rounds were conducted in the rice fields surrounding the patients’ homes as described in chapter 2: the first one was in July 2005 (6 soil samples collected at 3 different sites; 2 soil samples per site), the second one was in March 2006 (134 soil samples collected at 31 different sites; 4 to 20 soil samples per site), and the last one was in May 2006 (144 soil samples collected at 20 different sites; 4 to 10 soil samples per site). During the third round, soil samples were repeated at 14 sites of the second round in order to determine the isolation rate of B. pseudomallei at different time points during the year. The site for soil sampling was a rice field of approximately 100 m 2 in which several holes were dug using a sterile auger; the distance from one hole to another ranged from 5 to 20 m. From each hole, soil samples were collected at a depth of 30 cm (surface soil) or 60 cm (deep soil). After taking each sample, the auger was cleaned with fresh water and then sterilized by heating with a gas burner to avoid cross contamination. Each soil sample was put in two 50 ml tubes and then each tube was wrapped separately in a plastic bag (Figure A2 to A5). At each soil sampling site, the coordinate of the site was recorded using Global Positioning System (GPS, eTrex Garmin). When available, roots of rice plants were also gathered in order to determine the presence of B. pseudomallei within the rice rhizosphere (Figure A6). In total, 82 root samples were collected. Upon arrival at the laboratory, soil and root samples were kept at 4 oC until processed.

67 Appendix

Figure A1. Sampling sites for the detection of B. pseudomallei in the environment of Northern Vietnam. According to the patients’ homes described in chapter 2, thirty-seven sites were selected for soil sampling in July 2005, March 2006 and May 2006. Based on the coordinate records (see Table 1), the sampling sites were plotted on the map using MapInfo professional software, version 7.8 (MapInfo Corp., Troy, NY, USA). Dots and squares are the sites where soil sampling was conducted once and twice in 2006, respectively. Asterisks are the sites positive for B. pseudomallei . The grey color indicates the Hanoi area.

68 Appendix

Figure A2. Soil sampling in the rice field in Northern Vietnam. A steel auger was used to dig soil at different depths. B. pseudomallei 18/8 was isolated from this site. The work was performed by Trinh Thanh Trung. Photo: Ivo Steinmetz.

69 Appendix

Figure A3. Collection of soil samples from the steel auger. The work was performed by Trinh Thanh Trung. Photo: Ivo Steinmetz.

70 Appendix

Figure A4. Collection of soil sample in 50 ml tubes. This work was performed by Trinh Thanh Trung.

Photo: Ivo Steinmetz.

71 Appendix

Figure A5. Sterilization of steel auger using gas burner. Experiment was performed by Trinh Thanh Trung.

Photo: Ivo Steinmetz

72 Appendix

Figure A6. Collection of rice plant roots. Experiment was performed by Trinh Thanh Trung. Photo: Ivo Steinmetz.

73 Appendix

E. Isolation of B. pseudomallei and Burkholderia spp. in samples collected from Northern Vietnam Methodology: To isolate B. pseudomallei from soil samples, two grams of each sample were added to a 15 ml tube containing 8 ml of Galimand’s broth supplemented with polymyxin B (final conc. of 1 g/L) and gentamicin (final conc. of 5 mg/L). Then, the culture tubes were vortexed vigorously for awhile and subsequently left for soil sedimentation for approximately 30 minutes. One hundred µl of an appropriate 10-fold dilution of supernatants was subcultured on Ashdown’s agar in order to quantify the original number of B. pseudomallei in soil samples. The tubes were then inoculated aerobically at 42 oC for 4 days and the supernatants of the enriched cultures were subcultured again on Ashdown’s agar. The Ashdown’s agar plates were incubated at 42 oC for 4 days and all bacterial isolates growing on agar with distinct characteristics of colony morphology were collected. Primary screening for Burkholderia species was based on a positive oxidase test, resistance to polymyxin B and gentamicin was determined by using the disc diffusion method and the ability to grow on Burkholderia cepacia agar (Becton Dickinson). Further screening for B. pseudomallei was performed using the latex agglutination test (Steinmetz et al., 1999). For the root samples, the roots were cut into small pieces of approximately 2 mm in length using sterile scissors prior to placing in a 15 ml tube containing 8 ml of Galimand’s broth supplemented with polymyxin B (final conc. of 1 g/L) and gentamicin (final conc. of 5 mg/L). The amount of the roots placed in the tube was approximately 2 g. Subsequent steps were processed as described above for the isolation of B. pseudomallei . Results: In total, 1,199 bacterial isolates were obtained from Ashdown’s agar. Of those, 653 (54%) isolates showed a positive oxidase test, were resistant to polymyxin B and gentamicin, and grew on Burkholderia cepacia agar. Those isolates were referred to as suspected Burkholderia species. Of the suspected species, 446 isolates were cultured from soil and 102 isolates were obtained from roots. Presumptive identification based on colony characteristics on Ashdown’s agar and latex agglutination tests (158 tests) identified two B. pseudomallei isolates: (i) one was named strain 17/11, which was isolated at a soil depth of 60 cm (N 21 o 07.733’; E 106 o 12.979’) and (ii) the other was named strain 18/8, which was isolated from surface soil (N 21 o 08.806’; E 105 o 20.403’) (see Figure A1).

74 Appendix

F. Genotypic identification of suspected Burkholderia spp. from Northern Vietnam Nucleotide sequence analysis: Of the suspected Burkholderia isolates cultured from soil and root samples collected in Northern Vietnam, 322 isolates from 108 soil and 22 root samples were randomly selected for genomic DNA extraction. Standard PCR amplification was performed on the genomic DNA and only 270 (83.8%) isolates produced a desired recA fragment by using Burkhoderia -specific BUR1 and BUR2 primers. The other isolates (16.2%) negative for recA gene amplification were more likely to belong to other genera (Payne et al., 2005). For molecular identification, 254 recA PCR products were selected for sequencing using both BUR1 and BUR2 primers. The recA nucleotide sequences were successfully obtained from 246 PCR products. Bacterial diversity: Using the BLAST search tool available on the website http://blast.ncbi.nlm.nih.gov , 237 (96.3%) recA sequences were identified as Burkholderia species, 8 (3.3%) as Ralstonia species, and 1 (0.4%) as Bordetella species (Table 1). The two environmental B. pseudomallei isolates 17/11 and 18/8 were confirmed as B. pseudomallei because their recA nucleotide sequences were identical to the respective gene of B. pseudomallei K96243. Multilocus sequence typing as described in Chapter 2 revealed sequence types 46 and 542 of strain 18/8 and 17/11, respectively. No B. pseudomallei recA sequences could be found in the set of environmental bacteria collected in 2006. Alignment of all recA sequences revealed 33 distinct recA alleles. The recA alleles were assigned to allele number as shown in Figure 2. Only 4 recA alleles obtained from 105 isolates (42.6%) were completely identical to those existing in the nucleotide sequence database (BLAST search, November 2009): (i) recA allele 7 of the two isolates 17/11 and 18/8 was identical to the recA gene of B. psedomallei K96243, (ii) recA allele 3 of one isolate was identical to the recA gene of B. cenocepacia J2315, (iii) recA allele 9 of 101 isolates was identical to the recA gene of B. thailandensis E264, and (iv) recA allele 22 of one isolate was identical to the recA gene of B. vietnamensis PC259. The sequence identities from the 29 novel recA alleles to the next related taxon in the database ranged from from 88% to 99%. Of 246 isolates used for recA sequence analysis, 158 isolates (64.6%) were identified as B. thailandensis . This is also reflected in a high proportion of soil samples containing B. thailandensis, as this bacterium grew from 71 (65.7%) of 108 soil samples examined. The high proportion of the closely related species B. thailandensis might have led to overgrowth of B. pseudomallei colonies. Moreover, a recent study has reported that viable B. pseudomallei cell counts significantly decrease in water at a temperature of 2 oC after only a 28-day incubation period (Robertson et al., 2010). In this study, low temperature applied

75 Appendix during storage of soil samples collected in Northern Vietnam probably contributed to the reduction of viable B. pseudomallei cells, resulting in a large number of B. pseudomallei- negative soil samples. Phylogenetic analysis: To determine the diversity of species in the bacterial collection, a phylogenetic analysis was performed on all of the assigned recA allele numbers. The phylogenetic tree produced three distinct groups. The largest group consists of 24 recA alleles, from allele 1 to 24, including one of B. pseudomallei . These novel alleles were more likely related to species in the B. cepacia complex group, as they were nearly identical to recA sequences of the B. cepacia complex species (>96%). The second group consists of 6 novel alleles, from allele 25 to 30. These novel alleles had a poor sequence identity (<89%) to the recA sequences of both B. cepacia complex species and other Burkholderia species. The third group consists of 3 novel alleles which did not match any Burkholderia species and had poor sequence identity to other non- Burkholderia species, such as Bordetella parapertusis 12822 and Ralstonia solanacearum GMI1000. 16S rRNA sequence analysis revealed that allele 32 shared a high sequence identity with strain Ralstonia mannitolilytica AU255 (99%).

76 Appendix

89 Allele 1 (1, 97%) 87 Allele 2 (2, 98%) Burkholderia cenocepacia J2315 31 Allele 3 (1, 100%) Allele 4 (1, 99%) Burkholderia seminalis LMG 24067T Allele 5 (1, 99 %) 38 Burkholderia cepacia ESR63 61 Allele 6 ( 1, 96 %) Allele 7 (2, 100 %) Burkholderia pseudomallei K96243 50 Allele 8 (57, 99 %) 100 Burkholderia thailandensis E264 100 Allele 9 (101, 100 %) 70 Allele 10 (6, 98%) 99 Allele 11 (5, 98%) Burkholderia diffusa LMG24065 93 Allele 12 (2, 98%) Allele 13 (9, 99%) 100 77 Allele 14 (3, 97%) Allele 15 (3, 97%) 100 Allele 16 (1, 97%) Burkholderia latens LMG24064 59 42 Allele 17 (2, 97%) 39 Allele 18 (7, 97%) 87 Allele 19 (1, 99%) Allele 20 (1, 99%) 93 Allele 21 (9, 99%) 100 Burkholderia vietnamensis PC259 Allele 22 (1, 100%) 70 Allele 23 (8, 99%) 73 Allele 24 (4, 99%) Allele 25 (1, 88%) 100 Allele 26 (1, 88%) Burkholderia stabilis LMG14294 Allele 27 (2, 89%) 100 Allele 28 (1, 88%) 90 Allele 29 (1, 88%) Burkholderia multivorans C1576 53 Allele 30 (1, 88%) Allele 31 (1, 92%) Bordetella parapertusis 12822 Allele 32 (1, 93%) Ralstonia solanacearum GMI1000 100 Allele 33 (8, 93%)

0.08 0.06 0.04 0.02 0.00

Figure 2. Phylogenetic analysis of bacterial collection isolated from soil samples collected in Northern Vietnam using recA nucleotide sequences. Thirty-three recA alleles representative for 246 isolates are shown. The phylogenetic tree was constructed using the MEGA program, version 5.03, with the methods previously described by Payne et al., (2005). Bootstrap values of 1,000 replicates and genetic distance scale are indicated. In the brackets, the numbers of isolates sharing the same recA allele are presented on the left; the percentages of recA sequence identical to that of reference isolate are on the right.

77 Appendix

Table 1. List of bacterial isolates identified by recA sequence analysis

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 20. 738´ 1 230/14 11 - Jul - 06 30 1 97 E 105° 30. 373´ N 20° 24. 842´ 2 106/5 13 - Apr - 06 30 2 98 E 106° 31. 223´ Burkholderia cenocepacia J2315 N 20° 20. 711´ 3 192/2 14 - Jul - 06 30 2 98 E 106° 06. 142´ N 21° 20. 738´ 4 230/11 11 - Jul - 06 30 3 100 E 105° 30. 373´ N 21° 08. 860´ 5 16/10 19 - Jun - 05 30 4 99 Burkholderia seminalis LMG 24067 E 106° 20. 403´ N 21° 07. 375´ 6 3/7 19 - Jun - 05 30 5 99 E 105° 50. 576´ Burkholderia cepacia ESR63 N 21° 07. 375´ 7 14/4 19 - Jun - 05 30 6 96 E 105° 50. 576´ N 21 o 07.733´ 8 17/7 12 - Jun - 05 60 7 100 E 106 o 12.979´ Burkholderia pseudomallei K96243 N 21 o 08.806´ 9 18/8 19 - Jun - 05 30 7 100 E 105 o 20.403´ N 21° 30. 437´ 10 120/5 14 - Apr - 06 30 8 99 E 105° 08. 862´ N 21° 30. 437´ 11 120/7 14 - Apr - 06 30 8 99 Burkholderia thailandensis E264 E 105° 08. 862´ N 21° 30. 437´ 12 120/8 14 - Apr - 06 30 8 99 E 105° 08. 862´

78 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 30. 437´ 13 121/1 14 - Apr - 06 30 8 99 E 105° 08. 862´ N 21° 30. 437´ 14 121/3 14 - Apr - 06 30 8 99 E 105° 08. 862´ N 21° 30. 437´ 15 121/4 14 - Apr - 06 30 8 99 E 105° 08. 862´ N 21° 30. 437´ 16 121/5 14 - Apr - 06 30 8 99 E 105° 08. 862´ N 21° 27. 904´ 17 129/4 14 - Apr - 06 30 8 99 E 105° 11. 086´ N 21° 27. 273´ 18 130/3 14 - Apr - 06 30 8 99 E 105° 14. 400´ N 21° 26. 409´ 19 200/2 14 - Jul - 06 30 8 99 Burkholderia thailandensis E264 E 105° 24. 405´ N 21° 26. 409´ 20 202/6 r 20 - Jun - 06 8 99 E 105° 24. 405´ N 21° 27. 073´ 21 205/1 14 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 27. 073´ 22 205/6 14 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 27. 073´ 23 208/8 14 - Jul - 06 30 8 99 E 105° 27. 068´ N 21° 27. 073´ 24 210/8 12 - Jul - 06 30 8 99 E 105° 27. 068´ N 21° 27. 073´ 25 211/1 12 - Jul - 06 60 8 99 E 105° 27. 068´

79 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 27. 073´ 26 212/1 r 20 - Jun - 06 8 99 E 105° 27. 068´ N 21° 27. 073´ 27 213/2 12 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 27. 073´ 28 213/3 12 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 27. 073´ 29 213/5 12 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 27. 073´ 30 213/6 12 - Jul - 06 60 8 99 E 105° 27. 068´ N 21° 25. 751´ 31 216/4 12 - Jul - 06 30 8 99 E 105° 24. 819´ N 21° 25. 303´ 32 222/1 r 21 - Jun - 06 30 8 99 Burkholderia thailandensis E264 E 105° 25. 798´ N 21° 25. 303´ 33 222/3 r 21 - Jun - 06 30 8 99 E 105° 25. 798´ N 21° 20. 738´ 34 226/9 12 - Jul - 06 30 8 99 E 105° 30. 373´ N 21° 20. 738´ 35 231/1 r 21 - Jun - 06 8 99 E 105° 30. 373´ N 21° 13. 867´ 36 237/1 11 - Jul - 06 60 8 99 E 105° 43. 900´ N 21° 13. 867´ 37 237/2 11 - Jul - 06 60 8 99 E 105° 43. 900´ N 21° 13. 867´ 38 237/3 11 - Jul - 06 60 8 99 E 105° 43. 900´

80 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 13. 867´ 39 238/2 11 - Jul - 06 30 8 99 E 105° 43. 900´ N 21° 41. 005´ 40 244/3 r 21 - Jun - 06 8 99 E 105° 45. 484´ N 21° 41. 005´ 41 246/4 01 - Jul - 06 30 8 99 E 105° 45. 484´ N 21° 38. 056´ 42 249/2 01 - Jul - 06 60 8 99 E 105° 44. 087´ N 21° 16. 866´ 43 256/5 r 13 - Jun - 06 30 8 99 E 105° 50. 446´ N 21° 16. 866´ 44 256/7 r 13 - Jun - 06 8 99 E 105° 50. 446´ N 21° 16. 866´ 45 256/9 r 13 - Jun - 06 8 99 Burkholderia thailandensis E264 E 105° 50. 446´ N 21° 06. 230´ 46 271/1 01 - Jul - 06 60 8 99 E 105° 52. 702´ N 21° 08. 860´ 47 276/4 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 48 276/5 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 49 277/1 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 50 277/2 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 51 278/6 23 - Jun - 06 30 8 99 E 106° 20. 403´

81 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 08. 860´ 52 280/10 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 53 281/4 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 54 282/7 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 55 283/3 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 56 285/1 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 57 285/2 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 58 286/4 23 - Jun - 06 30 8 99 Burkholderia thailandensis E264 E 106° 20. 403´ N 21° 08. 860´ 59 286/5 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 60 292/4 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 61 292/5 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 62 292/6 23 - Jun - 06 30 8 99 E 106° 20. 403´ N 21° 08. 860´ 63 293/1 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 64 294/8 23 - Jun - 06 30 8 99 E 106° 20. 403´

82 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 08. 860´ 65 295/1 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 08. 860´ 66 295/2 23 - Jun - 06 60 8 99 E 106° 20. 403´ N 21° 07. 375´ 67 1/4 19 - Jun - 05 30 9 100 E 105° 50. 576´ N 21° 07. 375´ 68 1/10 19 - Jun - 05 30 9 100 E 105° 50. 576´ N 21° 07. 375´ 69 27/1 12 - Jun - 05 60 9 100 E 105° 50. 576´ N 21° 16. 118´ 70 53/6 10 - Apr - 06 30 9 100 E 105° 50. 693´ N 21° 30. 437´ 71 122/4 14 - Apr - 06 30 9 100 Burkholderia thailandensis E264 E 105° 08. 862´ N 21° 30. 437´ 72 122/5 14 - Apr - 06 30 9 100 E 105° 08. 862´ N 21° 27. 904´ 73 128/5 14 - Apr - 06 30 9 100 E 105° 11. 086´ N 21° 26. 867´ 74 135/4 14 - Apr - 06 30 9 100 E 105° 14. 877´ N 21° 24. 622´ 75 164/4 17 - Apr - 06 30 9 100 E 106° 16. 134´ N 21° 24. 622´ 76 165/5 17 - Apr - 06 30 9 100 E 106° 16. 134´ N 20° 20. 218´ 77 168/1 r 16 - Jun - 06 9 100 E 106° 00. 041´

83 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 20° 20. 218´ 78 168/2 r 16 - Jun - 06 9 100 E 106° 00. 041´ N 20° 20. 218´ 79 177/3 16 - Jul - 06 60 9 100 E 106° 00. 041´ N 20° 19. 462´ 80 184/1 16 - Jul - 06 30 9 100 E 106° 00. 103´ N 20° 19. 462´ 81 184/2 16 - Jul - 06 30 9 100 E 106° 00. 103´ N 20° 19. 462´ 82 188/2 16 - Jul - 06 30 9 100 E 106° 00. 103´ N 20° 19. 462´ 83 189/1 14 - Jul - 06 60 9 100 E 106° 00. 103´ N 20° 19. 462´ 84 189/2 14 - Jul - 06 60 9 100 Burkholderia thailandensis E264 E 106° 00. 103´ N 20° 19. 462´ 85 189/3 14 - Jul - 06 60 9 100 E 106° 00. 103´ N 21° 26. 409´ 86 200/10 14 - Jul - 06 30 9 100 E 105° 24. 405´ N 21° 26. 409´ 87 202/7 r 14 - Jul - 06 9 100 E 105° 24. 405´ N 21° 26. 409´ 88 202/10 20 - Jun - 06 30 9 100 E 105° 24. 405´ N 21° 27. 073´ 89 204/4 14 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 90 204/8 14 - Jul - 06 30 9 100 E 105° 27. 068´

84 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 27. 073´ 91 204/10 14 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 92 207/1 14 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 93 210/5 12 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 94 210/6 12 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 95 210/7 12 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 96 211/3 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 97 211/5 12 - Jul - 06 60 9 100 Burkholderia thailandensis E264 E 105° 27. 068´ N 21° 27. 073´ 98 211/6 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 99 212/4 12 - Jul - 06 30 9 100 E 105° 27. 068´ N 21° 27. 073´ 100 213/1 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 101 213/4 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 102 214/3r 20 - Jun - 06 9 100 E 105° 27. 068´ N 21° 27. 073´ 103 214/4 12 - Jul - 06 30 9 100 E 105° 27. 068´

85 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 27. 073´ 104 215/1 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 105 215/2 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 27. 073´ 106 215/3 12 - Jul - 06 60 9 100 E 105° 27. 068´ N 21° 25. 751´ 107 216/1 r 12 - Jul - 06 9 100 E 105° 24. 819´ N 21° 25. 751´ 108 216/6 12 - Jul - 06 30 9 100 E 105° 24. 819´ N 21° 25. 751´ 109 218/1 12 - Jul - 06 30 9 100 E 105° 24. 819´ N 21° 25. 303´ 110 220/10 12 - Jul - 06 30 9 100 Burkholderia thailandensis E264 E 105° 25. 798´ N 21° 25. 303´ 111 220/6 r 20 - Jun - 06 9 100 E 105° 25. 798´ N 21° 25. 303´ 112 220/7 12 - Jul - 06 30 9 100 E 105° 25. 798´ N 21° 25. 303´ 113 220/8 12 - Jul - 06 30 9 100 E 105° 25. 798´ N 21° 25. 303´ 114 221/1 12 - Jul - 06 60 9 100 E 105° 25. 798´ N 21° 25. 303´ 115 221/5 12 - Jul - 06 60 9 100 E 105° 25. 798´ N 21° 25. 303´ 116 222/6 12 - Jul - 06 30 9 100 E 105° 25. 798´

86 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 25. 303´ 117 223/1 12 - Jul - 06 60 9 100 E 105° 25. 798´ N 21° 25. 303´ 118 223/2 12 - Jul - 06 60 9 100 E 105° 25. 798´ N 21° 25. 303´ 119 223/3 12 - Jul - 06 60 9 100 E 105° 25. 798´ N 21° 20. 738´ 120 226/10 12 - Jul - 06 30 9 100 E 105° 30. 373´ N 21° 20. 738´ 121 226/6 r 12 - Jul - 06 9 100 E 105° 30. 373´ N 21° 20. 738´ 122 226/7 r 21 - Jul - 06 9 100 E 105° 30. 373´ N 21° 20. 738´ 123 228/1 r 21 - Jul - 06 9 100 Burkholderia thailandensis E264 E 105° 30. 373´ N 21° 20. 738´ 124 229/1 11 - Jul - 06 60 9 100 E 105° 30. 373´ N 21° 20. 738´ 125 230/7 r 21 - Jun - 06 9 100 E 105° 30. 373´ N 21° 13. 867´ 126 234/1 r 21 - Jun - 06 9 100 E 105° 43. 900´ N 21° 13. 867´ 127 234/4 r 21 - Jun - 06 9 100 E 105° 43. 900´ N 21° 13. 867´ 128 234/7 11 - Jul - 06 30 9 100 E 105° 43. 900´ N 21° 13. 867´ 129 234/8 11 - Jul - 06 30 9 100 E 105° 43. 900´

87 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 13. 867´ 130 236/1 r 21 - Jun - 06 9 100 E 105° 43. 900´ N 21° 13. 867´ 131 236/7 11 - Jul - 06 30 9 100 E 105° 43. 900´ N 21° 13. 867´ 132 238/1 11 - Jul - 06 30 9 100 E 105° 43. 900´ N 21° 13. 867´ 133 239/1 11 - Jul - 06 60 9 100 E 105° 43. 900´ N 21° 13. 867´ 134 239/2 11 - Jul - 06 60 9 100 E 105° 43. 900´ N 21° 13. 867´ 135 239/3 11 - Jul - 06 60 9 100 E 105° 43. 900´ N 21° 13. 867´ 136 239/4 11 - Jul - 06 60 9 100 Burkholderia thailandensis E264 E 105° 43. 900´ N 21° 13. 867´ 137 239/5 11 - Jul - 06 60 9 100 E 105° 43. 900´ N 21° 41. 005´ 138 240/3 11 - Jul - 06 30 9 100 E 105° 45. 484´ N 21° 41. 005´ 139 246/1 r 21 - Jun - 06 9 100 E 105° 45. 484´ N 21° 41. 005´ 140 246/5 01 - Jul - 06 30 9 100 E 105° 45. 484´ N 21° 41. 005´ 141 246/8 01 - Jul - 06 30 9 100 E 105° 45. 484´ N 21° 41. 005´ 142 247/2 01 - Jul - 06 60 9 100 E 105° 45. 484´

88 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 41. 005´ 143 247/3 01 - Jul - 06 60 9 100 E 105° 45. 484´ N 21° 38. 056´ 144 248/9 01 - Jul - 06 30 9 100 E 105° 44. 087´ N 21° 38. 056´ 145 249/3 01 - Jul - 06 60 9 100 E 105° 44. 087´ N 21° 38. 056´ 146 249/4 01 - Jul - 06 60 9 100 E 105° 44. 087´ N 21° 38. 056´ 147 250/2 01 - Jul - 06 30 9 100 E 105° 44. 087´ N 21° 38. 056´ 148 250/4 r 13 - Jun - 06 9 100 E 105° 44. 087´ N 21° 38. 056´ 149 251/1 01 - Jul - 06 60 9 100 Burkholderia thailandensis E264 E 105° 44. 087´ N 21° 38. 056´ 150 252/5 r 13 - Jun - 06 9 100 E 105° 44. 087´ N 21° 38. 056´ 151 252/7 r 13 - Jun- 06 9 100 E 105° 44. 087´ N 21° 38. 056´ 152 254/1 01 - Jul - 06 30 9 100 E 105° 44. 087´ N 21° 38. 056´ 153 254/2 01 - Jul - 06 30 9 100 E 105° 44. 087´ N 21° 38. 056´ 154 254/3 01 - Jul - 06 30 9 100 E 105° 44. 087´ N 21° 38. 056´ 155 254/5 01 - Jul - 06 30 9 100 E 105° 44. 087´

89 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 16. 866´ 156 258/11 01 - Jul - 06 30 9 100 E 105° 50. 446´ N 21° 16. 866´ 157 258/12 01 - Jul - 06 30 9 100 E 105° 50. 446´ N 21° 16. 866´ 158 258/5 r 13 - Jun - 06 9 100 E 105° 50. 446´ N 21° 16. 866´ 159 258/8 01 - Jul - 06 30 9 100 E 105° 50. 446´ N 21° 16. 866´ 160 258/9 01 - Jul - 06 30 9 100 E 105° 50. 446´ N 21° 16. 118´ 161 262/2 r 13 - Jun - 06 9 100 E 105° 50. 693´ Burkholderia thailandensis E264 N 21° 07. 375´ 162 273/1 01 - Jul - 06 60 9 100 E 105° 50. 576´ N 21° 07. 375´ 163 273/3 01 - Jul - 06 60 9 100 E 105° 50. 576´ N 21° 08. 860´ 164 276/9 23 - Jun - 06 30 9 100 E 106° 20. 403´ N 21° 08. 860´ 165 281/3 23 - Jun - 06 60 9 100 E 106° 20. 403´ N 21° 08. 860´ 166 282/9 23 - Jun - 06 30 9 100 E 106° 20. 403´ N 21° 08. 860´ 167 283/2 23 - Jun - 06 60 9 100 E 106° 20. 403´ N 21° 08. 860´ 168 276/7 23 - Jun - 06 30 10 98 Burkholderia diffusa LMG24065 E 106° 20. 403´

90 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 08. 860´ 169 277/3 23 - Jun - 06 60 10 98 E 106° 20. 403´ N 21° 08. 860´ 170 277/4 23 - Jun - 06 60 10 98 E 106° 20. 403´ N 21° 08. 860´ 171 278/8 23 - Jun - 06 30 10 98 E 106° 20. 403´ N 21° 08. 860´ 172 281/2 23 - Jun - 06 60 10 98 E 106° 20. 403´ N 21° 08. 860´ 173 285/3 23 - Jun - 06 60 10 98 E 106° 20. 403´ N 21° 08. 860´ 174 281/1 23 - Jun - 06 60 11 98 E 106° 20. 403´ N 21° 08. 860´ 175 283/4 23 - Jun - 06 60 11 98 Burkholderia diffusa LMG24065 E 106° 20. 403´ N 21° 08. 860´ 176 285/4 23 - Jun - 06 60 11 98 E 106° 20. 403´ N 21° 08. 860´ 177 278/7 23 - Jun - 06 30 11 98 E 106° 20. 403´ N 21° 08. 860´ 178 278/9 23 - Jun - 06 30 11 98 E 106° 20. 403´ N 21° 08. 860´ 179 279/1 23 - Jun - 06 60 12 98 E 106° 20. 403´ N 21° 08. 860´ 180 283/5 23 - Jun - 06 60 12 98 E 106° 20. 403´ N 21° 30. 437´ 181 122/1 14 - Apr - 06 30 13 99 E 105° 08. 862´

91 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 27. 273´ 182 135/1 14 - Apr - 06 30 13 99 E 105° 14. 400´ N 21° 24. 622´ 183 156/7 17 - Apr - 06 30 13 99 E 106° 16. 134´ N 21° 26. 409´ 184 200/4 14 - Jul - 06 30 13 99 E 105° 24. 405´ N 21° 06. 240´ 185 265/1 01 - Jul - 06 60 13 99 E 105° 52. 721´ Burkholderia diffusa LMG24065 N 21° 06. 240´ 186 265/2 01 - Jul - 06 60 13 99 E 105° 52. 721´ N 21° 06. 240´ 187 265/3 01 - Jul - 06 60 13 99 E 105° 52. 721´ N 21° 08. 860´ 188 291/1 23 - Jun - 06 60 13 99 E 106° 20. 403´ N 21° 07. 733´ 189 303/1 22 - Jun - 06 60 13 99 E 106° 12. 979´ N 21° 16. 866´ 190 48/5 10 - Apr - 06 30 14 97 E 105° 50. 446´ N 21° 27. 073´ 191 208/9 14 - Jul - 06 30 14 97 E 105° 27. 068´ N 21° 38. 056´ 192 248/12 01 - Jul - 06 30 14 97 Burkholderia latens LMG24064 E 105° 44. 087´ N 21° 26. 867´ 193 134/2 14 - Apr - 06 30 15 97 E 105° 14. 877´ N 21° 26. 867´ 194 135/7 14 - Apr - 06 30 15 97 E 105° 14. 877´

92 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 26. 867´ 195 135/10 14 - Apr - 06 30 15 97 E 105° 14. 877´ N 21° 20. 738´ 196 230/9 11 - Jul - 06 30 16 97 E 105° 30. 373´ N 21° 20. 738´ 197 229/4 11 - Jul - 06 60 17 97 E 105° 30. 373´ N 21° 20. 738´ 198 230/15 11 - Jul - 06 30 17 97 E 105° 30. 373´ N 21° 26. 867´ 199 134/1 14 - Apr - 06 30 18 97 E 105° 14. 877´ N 21° 24. 622´ 200 157/8 17 - Apr - 06 30 18 97 Burkholderia latens LMG24064 E 106° 16. 134´ N 21° 24. 622´ 201 158/3 17 - Apr - 06 30 18 97 E 106° 16. 134´ N 21° 20. 738´ 202 229/2 11 - Jul - 06 60 18 97 E 105° 30. 373´ N 21° 20. 738´ 203 229/3 11 - Jul - 06 60 18 97 E 105° 30. 373´ N 21° 20. 738´ 204 230/17 11 - Jul - 06 30 18 97 E 105° 30. 373´ N 21° 41. 005´ 205 246/6 01 - Jul - 06 30 18 97 E 105° 45. 484´ N 20° 19. 462´ 206 190/1 14 - Jul - 06 30 19 99 E 106° 00. 103´ Burkholderia vietnamensis PC259 N 20° 19. 462´ 207 190/2 14 - Jul - 06 30 20 99 E 106° 00. 103´

93 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 27. 273´ 208 137/1 14 - Apr - 06 30 21 99 E 105° 14. 400´ N 21° 27. 273´ 209 137/3 14 - Apr - 06 30 21 99 E 105° 14. 400´ N 21° 27. 273´ 210 137/5 14 - Apr - 06 30 21 99 E 105° 14. 400´ N 20° 20. 218´ 211 169/2 16 - Jul - 06 60 21 99 E 106° 00. 041´ N 20° 20. 008´ 212 176/2 16 - Jul - 06 30 21 99 E 105° 59. 725´ N 20° 20. 008´ 213 178/2 16 - Jul - 06 30 21 99 E 105° 59. 725´ N 21° 06. 240´ 214 266/5 01 - Jul - 06 30 21 99 Burkholderia vietnamensis PC259 E 105° 52. 721´ N 21° 06. 240´ 215 266/8 01 - Jul - 06 30 21 99 E 105° 52. 721´ N 21° 07. 733´ 216 311/1 22 - Jun - 06 60 21 99 E 106° 12. 979´ N 21° 08. 860´ 217 279/2 23 - Jun - 06 60 22 100 E 106° 20. 403´ N 20° 20. 218´ 218 168/3 16 - Jul - 06 30 23 99 E 106° 00. 041´ N 20° 20. 218´ 219 169/1 16 - Jul - 06 60 23 99 E 106° 00. 041´ N 20° 20. 218´ 220 172/5 16 - Jul - 06 30 23 99 E 106° 00. 041´

94 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 20° 20. 218´ 221 173/1 16 - Jul - 06 60 23 99 E 106° 00. 041´ N 20° 20. 218´ 222 173/3 16 - Jul - 06 60 23 99 E 106° 00. 041´ N 20° 20. 218´ 223 174/4 16 - Jul - 06 30 23 99 E 106° 00. 041´ N 20° 20. 008´ 224 177/1 16 - Jul - 06 60 23 99 E 105° 59. 725´ N 21° 06. 240´ 225 266/7 01 - Jul - 06 30 23 99 Burkholderia vietnamensis PC259 E 105° 52. 721´ N 20° 20. 008´ 226 176/1 16 - Jul - 06 30 24 99 E 105° 59. 725´ N 20° 20. 008´ 227 176/2 16 - Jul - 06 30 24 99 E 105° 59. 725´ N 20° 20. 008´ 228 182/1 16 - Jul - 06 30 24 99 E 105° 59. 725´ N 20° 20. 711´ 229 194/2 14 - Jul - 06 30 24 99 E 106° 06. 142´ N 21° 30. 437´ 230 119/2 14 - Apr - 06 30 25 88 E 105° 08. 862´ N 21° 26. 867´ 231 135/9 14 - Apr - 06 30 26 88 E 105° 14. 877´ Burkholderia stabilis LMG14294 N 21° 30. 437´ 232 118/7 14 - Apr - 06 30 27 89 E 105° 08. 862´ N 21° 06. 230´ 233 271/3 01 - Jul - 06 60 27 89 E 105° 52. 702´

95 Appendix

Date of bacterial Soil depth recA identity ** No. Isolate Co-ordinate No. of allele * Reference strain isolation (cm) (%) N 21° 30. 437´ 234 120/6 14 - Apr - 06 30 28 88 E 105° 08. 862´ N 21° 30. 437´ 235 118/8 14 - Apr - 06 30 29 88 Burkholderia multivorans C1576 E 105° 08. 862´ N 21° 30. 437´ 236 119/4 14 - Apr - 06 30 30 88 E 105° 08. 862´ N 20° 20. 711´ 237 196/3 14 - Jul - 06 30 31 92 Bordetella parapertusis 12822 E 106° 06. 142´ N 21° 38. 056´ 238 250/7 01 - Jul - 06 30 32 93 E 105° 44. 087´ N 20° 20. 008´ 239 177/2 16 - Jul - 06 60 33 93 E 105° 59. 725´ N 21° 26. 409´ 240 202/9 14 - Jul - 06 30 33 93 E 105° 24. 405´ N 21° 26. 409´ 241 202/12 14 - Jul - 06 30 33 93 E 105° 24. 405´ N 21° 26. 409´ 242 202/13 14 - Jul - 06 30 33 93 Ralstonia solanacearum GMI1000 E 105° 24. 405´ N 21° 25. 303´ 243 220/9 12 - Jul - 06 30 33 93 E 105° 25. 798´ N 21° 16. 866´ 244 258/10 01 - Jul - 06 30 33 93 E 105° 50. 446´ N 21° 16. 866´ 245 258/10 01 - Jul - 06 30 33 93 E 105° 50. 446´ N 21° 08. 860´ 246 293/2 23 - Jun - 06 60 33 93 E 106° 20. 403´

96 Appendix

* Allelic number assigned in this thesis ** Identity percentage of recA sequence compared to that of reference isolate r Isolates obtained from root samples

G. Pilot experiments for the development of an improved culture-based quantification of Burkholderia pseudomallei from soil samples (see Chapter 3) using spiked soils Methodology: In order to improve the soil dispersion and the dissociation of bacteria, we evaluated five different solutions during this homogenization step using spiked soil samples collected in Northern Vietnam. To reduce the error caused by different soil types, 5 soil mixtures, each pooled from 5 different soil types (ranging from clay loam to clay), were involved in this experiment. Prior to the spiking experiment, B. pseudomallei E8 was streaked on Colombia blood agar (Becton Dickinson) and incubated overnight at 37 oC. A fresh suspension of B. pseudomallei E8 was prepared using PBS buffer and then inoculated into the soil mixtures at a cell concentration of 6.4 x 10 5 CFU per gram soil. After incubating at room temperature for 4 weeks, 25 g of soil mixture was transferred into a sterile 250-ml Erlenmeyer flask and combined with 50 ml of the following solutions: (i) polyethylene glycol and sodium deoxycholate (PEG-DOC) solution supplemented with 10% Chelex 100 resin (w/v), (ii) PEG- DOC solution, (iii) cetyltrimethyl ammonium bromide (CTAB) solution, (iv) phosphate buffered saline (PBS) and (iv) distilled water. The homogenization step and enumeration of bacteria in the supernatant were performed as for the PEG-DOC method described in chapter 3. Results: Based on the cell count, we found that the number of B. pseudomallei cells in the supernatants of the spiked soils homogenized with PEG-DOC solution or PEG-DOC solution plus Chelex 100 resin was significantly higher than that of the spiked soils homogenized with CTAB solution, PBS solution, or distilled water (p<0.001 in all comparative analyses using Student’s t-test) (Figure 3A). We further enumerated B. pseudomallei cells in the supernatants by using a quantitative TTSS 1 real-time PCR assay as described in chapter 4. The results showed that the amount of B. pseudomallei genome copies in the supernatants of the spiked soils homogenized with PEG-DOC solution was significantly higher than that homogenized with CTAB solution, PBS solution, or distilled water (p<0.001 in all comparative analyses using Student’s t-test) (Figure 3B). The comparison of the two PEG-DOC solutions suggested that the addition of Chelex 100 resin to the PEG-DOC solution did not show any increase in either B. pseudomallei cell count (Figure 3). Therefore, we decided to use PEG-

97 Appendix

DOC solution in a new protocol to dislodge the bacteria from natural soil matrix collected in Thailand. Further evaluations of the new protocol are presented in chapter 3.

A) B) 6 6 5 5 4 4 3

CFU/ml 3 10

2 (GE/PCR tube) 2 log 10

1 log 1 0 0 O BS 2 -D O D-C P-D P 2 - dH -D-C P PBS H P CTAB P CTAB d

Figure 3. Possibility of different solutions to dislodge bacteria out of the soil matrix. Five soil mixtures, each pooled from 5 different soil samples with clay loam and clay characteristics, were spiked with B. pseudomallei

E8 cells at a cell concentration of 6.4 x 10 5 CFU per gram soil. The soil mixtures were inoculated at room temperature for 4 weeks. Then, 25 g of the spiked soil mixtures was homogenized by shaking at 200 rpm for 2 h in 50 ml of five different solutions: (i) polyethylene glycol and sodium deoxycholate (PEG-DOC) solution plus 5 g Chelex 100 resin (P-D-C), (ii) PEG-DOC solution (P-C), (iii) cetyltrimethyl ammonium bromide (CTAB), (iv) phosphate buffered saline (PBS) and (v) distilled water (dH 2O). The soil particles were pelleted by centrifugation at 1,400 g for 10 min. The supernatants were collected and enumerated for B. pseudomallei CFU using Ashdown agar (A) and TTSS 1 real-time PCR assay (B). Data are representative results for two independent experiments.

Error bars present the mean values (± SEM) from 5 soil mixtures, with each performed in duplicate.