And Low-Risk Aberrant Crypt Foci in a Mouse Model of Sporadic Colon Cancer

[CANCER RESEARCH 64, 6394–6401, September 15, 2004] Genetic signatures of High- and Low-Risk Aberrant Crypt Foci in a Mouse Model of Sporadic Colon Cancer

Prashant R. Nambiar,1,2 Masako Nakanishi,1 Rishi Gupta,3 Evelyn Cheung,4 Ali Firouzi,4 Xiao-Jun Ma,4 Christopher Flynn,1 Mei Dong,1 Kishore Guda,1 Joel Levine,5 Rajiv Raja,4 Luke Achenie,3 and Daniel W. Rosenberg1 1Center for Molecular Medicine and Program in Colorectal Cancer, University of Connecticut Health Center, Farmington, Connecticut; Departments of 2Pathobiology and Veterinary Sciences and 3Chemical Engineering, University of Connecticut, Storrs, Connecticut; 4Arcturus Bioscience, Inc., Mountain View, California; and 5Department of Medicine and Program in Colorectal Cancer, University of Connecticut Health Center, Farmington, Connecticut

ABSTRACT cyclin D1, and cyclin-dependent kinase 4 (11–20). The model provides an appropriate experimental system for studying molecular and To determine whether cancer risk is related to histopathological fea- pathological changes associated with the human disease. Importantly, tures of preneoplastic aberrant crypt foci (ACF), gene expression analysis inbred mice demonstrate differences in azoxymethane sensitivity. For was performed on ACF from two mouse strains with differing tumor sensitivity to the colonotropic carcinogen, azoxymethane. ACF from sen- example, A/J mice develop 10 to 20 tumors in distal colon, whereas sitive A/J mice were considered at high risk, whereas ACF from resistant tumors in AKR/J mice are rare (10, 11, 20). Interestingly, initiation of AKR/J mice were considered at low risk for tumorigenesis. A/J and ACF upon carcinogen exposure is a feature common to both strains (5, AKR/J mice received weekly injections of azoxymethane (10 mg/kg body 10, 18). However, a higher percentage of dysplastic ACF form in A/J weight), and frozen colon sections were prepared 6 weeks later. Immuno- colons compared with AKR/J. These observations provide the basis histochemistry was performed using biomarkers associated with colon for additional stratification of ACF in terms of cancer risk, an ap- cancer, including adenomatous polyposis coli, ␤-catenin, p53, c-myc, cy- proach that may eventually lead to identification of genes involved in clin D1, and proliferating cell nuclear antigen. Hyperplastic ACF, dys- early stages of colon tumorigenesis. plastic ACF, microadenomas, adjacent normal-appearing epithelium, and ACF are comprised of aggregates of abnormal crypts and charac- vehicle-treated colons were laser captured, and RNA was linearly ampli- terized by hyperproliferation, increased size, expanded pericryptal fied (LCM-LA) and subjected to cDNA microarray-based expression analysis. Patterns of gene expression were identified using adaptive cen- zones, and elongated or slit-like crypt lumina (5, 10, 21, 22). A troid algorithm. ACF from low- and high-risk colons were not discrimi- number of studies support the contention that only limited subsets of nated by immunohistochemistry, with the exception of membrane staining ACF have the potential to progress, whereas most lesions remain of ␤-catenin. To develop genetic signatures that predict cancer risk, behaviorally benign (10). Sequential analyses demonstrate that hyper- LCM-LA RNA from ACF was hybridized to cDNA arrays. Of 4896 plastic ACF that are prevalent within the AKR/J colons fail to pro- interrogated genes, 220 clustered into six broad clusters. A total of 226 and gress, thereby representing a subpopulation of colon lesions that may 202 genes was consistently altered in lesions from A/J and AKR/J mice, be considered low risk (10, 20, 23–25). Alternatively, ACF that form respectively. Although many alterations were common to both strains, in sensitive A/J colons are likely to progress to tumors and are expression profiles stratified high- and low- risk lesions. These data dem- therefore considered high risk. This stratification of risk thus provides onstrate that ACF with distinct tumorigenic potential have distinguishing the basis to our experimental approach. molecular features. In addition to providing insight into colon cancer promotion, our data identify potential biomarkers for determining colon Although a recent report describes gene expression profiles in cancer risk in humans. human dysplastic colonic adenomas (26), there have been no attempts to stratify high- and low-risk ACF on the basis of gene expression profiles as an adjunct to histologic staging. To determine whether INTRODUCTION differential cancer sensitivity is associated with histopathological features of preneoplastic ACF, we performed a molecular analysis of The majority of colorectal cancer cases are sporadic, characterized low- and high-risk ACF with a goal toward developing a molecular by pathologically defined stages, including formation of preneoplastic signature that enables a reasonable discrimination of their risk poten- aberrant crypt foci (ACF), preinvasive adenomas, and malignant tial. Our data demonstrate that ACF with distinct tumorigenic poten- carcinomas (1–3). ACF, although not yet fully committed to neopla- tial have distinguishing genetic signatures, thus providing a potential sia, are stratified into two broad classes, hyperplastic and dysplastic, resource for identifying biomarkers that may be used to establish based on morphology and predicted biological behavior (4, 5). His- colon cancer risk in human populations. tomorphologic grading of ACF, in terms of size and dysplasia, represent one of the few biomarkers of colorectal cancer risk (6–10). Therefore, establishing molecular criteria that enhance prediction of MATERIALS AND METHODS ACF progression is relevant to clinical prognostication. The colonotropic carcinogen, azoxymethane, produces tumors and Animal Treatment and Laser Capture Microdissected (LCM). Five A/J and AKR/J male mice (The Jackson Laboratory, Bar Harbor, ME) of 5 weeks preneoplastic lesions in mice that closely recapitulate key molecular of age received injections of azoxymethane (10 mg/kg body weight) weekly features of human colorectal cancer, including alterations in Ki-ras, for 6 weeks (10, 20). A separate group received 0.9% NaCl (vehicle controls). ␤ adenomatous polyposis coli (APC), transforming growth factor , Animals were sacrificed 6 weeks after the last injection and colons were flushed with PBS, embedded in cryoprotectant OCT, and frozen at Ϫ80°C. Received 3/18/04; revised 6/17/04; accepted 7/15/04. Eight serial cryosections (7-␮m thick) with appropriate representations of Grant support: NIH Grant CA 81248 and a grant from the Robert Leet and Clara preneoplastic lesions and abutting normal tissue were prepared. One section Guthrie Patterson Trust. was stained with H&E for histologic classification of lesions, whereas the The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with remaining six sections were stained using the HistoGene LCM staining kit 18 U.S.C. Section 1734 solely to indicate this fact. (Arcturus, Mountain View, CA). Pure populations of epithelial cells compris- Note: P.R. Nambiar and M. Nakanishi contributed equally to this publication. ing lesions were microdissected using the PixCell II LCM system (Arcturus). Requests for reprints: Daniel W. Rosenberg, Center for Molecular Medicine, Uni- A summary of lesions is provided (Table 1). Because of the rarity of AKR/J versity of Connecticut Health Center, 263 Farmington Avenue, CT 06030-3101. Phone: (860) 679-8704; Fax: (860) 679-1140; E-mail: [email protected]. dysplastic ACF, step-sections were prepared to obtain five lesions. Laser- ©2004 American Association for Cancer Research. captured saline-treated colonic epithelia were pooled and used as reference 6394

Table 1 Summary of tissues harvested from saline and azoxymethane-treated A/J and minutes at 95°C, followed by 40 cycles of 10 seconds at 95°C and 1 minute at AKR/J mice 60°C. The averages of the threshold cycle (CT) values were analyzed for Mouse Saline Normal-appearing Hyperplastic Dysplastic relative quantitation using the comparative CT method. CT values for lesions strain controls epithelium ACF ACF Microadenomas were normalized to a reference gene (glyceraldehyde-3-phosphate dehydro- A/J 3 5 6 6 10 genase) and calibrator (saline control), which were used to determine relative AKR/J 3 6 6 5 expression. Immunohistochemistry (IHC). IHC of formalin-fixed, paraffin-embedded sections for APC, p53, ␤-catenin, cyclin D1, and c-myc was performed using control, eliminating potential field effects that may exist within azoxymethane- a peroxidase-conjugated avidin-biotin method as described previously (11, 16). exposed normal-appearing epithelium. The validity of this approach is dem- Primary antibodies were used as follows: rabbit polyclonal p53 CM5 antibody onstrated by similar expression profiles from laser-captured, saline-treated (Novacastra, Newcastle-upon-Tyne, United Kingdom) at 1:500 dilution; colonic epithelium from both strains (correlation coefficient, r ϭ 0.86), vali- mouse monoclonal ␤-catenin (Sigma-Aldrich, Inc., St. Louis, MO) at 1:1000; dating their use as reference controls and avoiding potentially confounding cyclin D1 (Novacastra) at 1:40; c-Myc (Upstate, Waltham, MA) at 1:100; APC effects of potentially heterogeneous expression profiles associated with inde- (N-15 and C-20; Santa Cruz Biotechnology, Santa Cruz, CA) at 1:200 and pendently captured adjacent normal epithelium from azoxymethane-treated 1:50, respectively; and goat polyclonal IEX-1 (Santa Cruz Biotechnology) at mice. Approximately 50 to 1000 cells were laser-captured from each sample. 1:1000 dilution. Heat-antigen retrieval was used only for APC, cyclin D1, and ACF Classification. Histologic evaluation was carried out on H&E-stained c-myc antibodies. Lymphoid nodules within colon sections served as internal colon sections. The criteria used for histologic grading of ACF have been positive controls for cyclin D1 and p53. Duplicate sections were immuno- adapted from previous studies (10, 27–29) as follows: (1) hyperplastic; small stained with isotype-matched IgG in place of primary antibody (negative (1 to 5 crypts/focus), moderately hypercellular, normal cellular differentiation control). Immunostained sections were graded by a board-certified veterinary with Ͻ30% loss of goblet cell differentiation, slight variation in crypt diameter pathologist (P. Nambiar) for cellular localization as follows: nuclear (N), relative to normal, basally arranged and slightly hyperchromatic nucleus; (2) cytoplasmic (C), or membrane (M) and percentage of positively stained cells. dysplastic; moderate size (5 to 10 crypts/focus), markedly hypercellular, For nuclear staining, criteria used were as follows: grade 1, 0 to 20% positive Ͼ50% loss of goblet cell differentiation; enlarged, often tortuous crypts with cells; grade 2, 20 to 50% positive cells; and grade 3, Ͼ50% positive cells. For slit-shaped lumina, loss of polarity, dark, elongate to oval, hyperchromatic cytoplasmic and membrane staining, the criteria were as follows: grade nuclei with pseudostratification and mitotic figures of 0 to 1/high power field; 1, ϩ mild staining; grade 2, ϩϩ moderate staining; and grade 3, ϩϩϩ marked (3) microadenoma; large size (Ͼ10 crypts/focus) but not visible by the naked staining. Samples were considered negative if staining was not greater than eye, severely hypercellular, complete loss of goblet cell differentiation, en- negative controls. For immunohistochemistry of human IEX-1, paraffin-em- larged tortuous crypts; loss of cellular polarity, moderate nuclear anisokaryosis bedded tumors and adjacent normal colon sections from colorectal cancer and mitotic figures of 1 to 2/high power field. ACF are defined as high- or patients were incubated with goat antihuman IEX-1 (Santa Cruz Biotechnol- low-risk based on established strain sensitivity to azoxymethane (5, 20). ogy) at 1:1000 dilution. Sections were washed with PBS and incubated with RNA Extraction, Linear Amplification, and Array Hybridization. To- biotinylated antigoat IgG (Vector Laboratories, Burlingame, CA) at a 1:100 tal RNA from 50 to 1000 laser-captured tumor cells and vehicle-treated control dilution for 30 minutes at room temperature. After washing, the sections were colons was extracted using the Picopure RNA isolation kit (Arcturus). Because incubated with avidin-biotin peroxidase complex provided by Vectastain Elite ACF are generally comprised of 20 to 100 cells (400 to 800 pg of total RNA), ABC kit (Vector Laboratories) for 30 minutes at room temperature. Color was we used a high-yield T7-based RNA amplification method (RiboAmp HS; developed with 3,3Ј-diaminobenzidine as the substrate. Sections were then Arcturus) to generate adequate amounts of aRNA for hybridization. A 5 to 8 counterstained with hematoxylin. million-fold amplification was achieved with two rounds, yielding ϳ30 to 70 Statistical Analysis. Analysis was carried out using Kruskal-Wallis one- ␮g of aRNA. cDNA was transcribed from 8 to 10 ␮g aRNA in the presence way ANOVA by ranks for nonparametric data followed by Dunn’s post hoc of Cy5-dUTP (Amersham Pharmacia, Piscataway, NJ). Fluorescently labeled analysis for multigroup comparisons (Graphpad Software, San Diego, CA). cDNA was hybridized to a 14,976-element mouse cDNA array consisting of 4,896 mouse genes, 64 bacterial controls, and 32 targets with only spotting buffer, printed in triplicate across 8 subarrays. Control targets incorporated RESULTS across all subarrays provide a means of measuring nonspecific target:probe hybridization and potential variation across different regions of the array Histopathological Examination. Colon sections were examined (11, 30). microscopically to confirm the histology of each lesion (Fig. 1). Data Analysis. Raw images were analyzed using Imagene 4.2 (BioDiscov- Significant numbers of ACF were observed in colons of both strains, ery, Los Angeles, CA) and subjected to spot filtering and normalization. Spot although in A/J, a higher percentage of ACF was dysplastic (5, 10, filtering was performed by considering only genes above a predetermined level 20). Hyperplastic ACF from both strains showed increased crypt size, over background threshold. Coefficient of variation was calculated for each moderate loss of goblet cell differentiation, low crypt multiplicity, and replicate spot. Spots that did not satisfy strict coefficient of variation criteria mild to moderate anisokaryosis (Fig. 1, A and C). Dysplastic ACF had (10%) were not included in the analysis. Data were normalized using a robust increased crypt size, marked loss of differentiated goblet cells, in- 75-percentile method (31, 32). In this method, the 75th percentile intensity value for each chip is calculated, and the mean of all these values is used as the creased crypt multiplicity, moderate to marked anisokaryosis, and reference value to which each chip is scaled. After normalization, genes with nuclear pseudostratification. In addition, paneth cell metaplasia was expression values close to background were brought to scale by performing noted in multifocal dysplastic A/J ACF (Fig. 1B). floor thresholding using total background of each slide. Normalized ratios were Immunohistochemical Profiling of ACF. An initial attempt to used to represent relative gene expression levels in experimental samples. discriminate populations of ACF from A/J and AKR/J colons was Because genes were spotted in triplicate, the average ratio was calculated for performed by IHC. Expression of several key tumor-related markers, each gene and used for additional clustering analysis. A novel method for including proliferating cell nuclear antigen, p53, ␤-catenin, APC, clustering microarray data sets, adaptive centroid algorithm, was used to find cyclin D1, and c-Myc, was evaluated (2, 11, 13, 20, 34–36). Dereg- gene clusters displaying similar and distinct expression patterns between ulation of the Wnt signaling pathway, including mutations in the lesions of similar morphology across strains and also between ACF from the ␤-catenin gene and/or APC loss, has been implicated in colon tumor- same strain (30, 33). The dendrogram of obtained clusters were viewed using ␤ Genesite (BioDiscovery). igenesis. Such alterations result in translocation of -catenin from Quantitative Real-Time PCR Analysis. Linearly amplified aRNA (4 ␮g/ membrane to nucleus, with subsequent transcriptional activation of ␮L) was converted into cDNA by reverse transcription as described earlier key target genes, including cyclin D1 and c-myc. ␤-Catenin was (31). Quantitative real-time PCR was performed on 100 ng of cDNA using detected at comparably high levels in the nucleus and cytoplasm of standard conditions. Reactions were run in duplicate for 2 minutes at 50°C, 10 ACF from either strain, whereas adjacent normal-appearing and ve- 6395

Fig. 1. Histology of azoxymethane-induced ACF and immunohistochemical analyses of tumor-related proteins. Colon lesions were induced in A/J and AKR/J mice as described under Materials and methods. Representative sections of hyperplastic ACF from A/J (A) and AKR/J (C) mice. Dysplastic ACF from A/J (B) and AKR/J (D) mice. Note the similar histology. The dysplastic ACF from both strains exhibit greater nuclear atypia and increased loss of goblet cell differentiation. In addition, the dysplastic A/J ACF (B) show Paneth cell metaplasia (arrow- head). IHC analyses were done on the colon lesions with antibodies against proliferating cell nuclear antigen (PCNA; E and F); ␤-catenin (G and H); APC (I and J); p53 (K and L); cyclin D1 (M and N); and c-myc (O and P). ACF were graded for immunohistochemical staining (percentage of epithelial cells), and the scores are represented in scatterplots adjacent to their respective panels with a median score represented by a horizontal line. For ␤-Catenin, the scoring included membrane (M), cytoplasmic (C), and nuclear staining (N).

hicle-treated control colons showed only faint membrane staining of ␤-catenin, there were no mutations identified in either strain within (Fig. 1). However, there were differences in immunohistochemical the mutation prone glycogen synthase kinase-3␤ phosphorylation sites scores for membrane staining of ACF. A/J ACF had a lower score (data not shown). Because nuclear accumulation of ␤-catenin is often relative to AKR/J (Fig. 1, G and H). Despite elevated nuclear staining associated with loss of APC, we evaluated APC status using antibod- 6396

Fig. 2. Representative laser-captured sections of ACF from azoxymethane-treated mice and raw fluorescence intensities. Seven-micrograms thick OCT- embedded frozen sections were subjected to LCM as described under Materials and methods. ACF before laser-capture (A–D); same section after laser capture (E–H); captured cells from ACF (I–L).

ies specific to the NH2 terminus. As shown in Fig. 1, we found amplified RNA from three adenomas and observed high correlation moderate elevation of APC, eliminating a causal relationship between (r ϭ 95). To additionally evaluate reproducibility of our labeling and APC loss and ␤-catenin accumulation. To rule out the possibility that hybridization strategies, eight random samples were collected in du- accumulated APC protein has undergone truncation, tissues were plicate and hybridized to the array. The correlation coefficient of these probed with APC antibody specific for the COOH terminus. APC duplicate experiments was r ϭ 0.92. These results indicate that the levels were increased in lesions, primarily localized to the nucleus, an T7-RNA amplification method preserves differential gene expression observation that is consistent with the presence of full-length func- patterns. This methodology has been independently validated (31). tional protein (37). Finally, no mutations were detected within the Gene Expression Profiling of ACF. Using LCM-LA, 50 colon APC mutation cluster region in 10 A/J adenocarcinomas and ACF. specimens (Table 1; including random duplicates) resulted in 928,000 These results suggest that ␤-catenin accumulation within ACF occurs data points from 58 separate arrays. Single color hybridization with independently of APC status. To assess the potential for differential Cy5 enabled elimination of dye bias, a frequent problem in dual-color activation of the Wnt pathway in A/J and AKR/J colons, we evaluated hybridization (31). This strategy, combined with the 75-percentile the status of c-myc and cyclin D1, two important ␤-catenin targets. normalization method, enabled direct comparison between multiple Although elevated nuclear c-Myc and cyclin D1 were detected in ACF arrays (32). The similarities in global expression profiles of saline- from both strains, staining intensity was comparable (Fig. 1). treated reference controls (r ϭ 0.86) indicate that differences are an While alterations in p53 nuclear staining are typically associated outcome of azoxymethane-induced alterations and not from inherent with later stages of colorectal cancer, the status of this tumor sup- differences in basal gene expression between mouse lines (Fig. 3). To pressor in ACF has not been extensively evaluated (11, 34, 35). determine whether ACF could be segregated independent of histo- Although p53 nuclear staining was consistently observed in ACF, the logic staging, we carried out cluster analysis on the entire data set (44 staining intensity was comparable between the two strains (Fig. 1, K samples; refs. 30, 33). As shown in Fig. 4A, of 4896 genes interro- and L). To extend our previous observations of accumulated wild-type gated by adaptive centroid algorithm, there was a clear separation p53 in A/J tumors (11), we carried out PCR-based sequence analyses between strains. Six general clusters (a-f, Fig. 4A) were identified (exons 5 to 8) of the p53 gene, using 10 laser-captured ACF from both strains and 5 A/J microadenomas. No mutations within this highly mutable region were identified. Thus, immunohistochemical analysis of key tumor biomarkers provided only minimal discrimination of high- and low-risk ACF. LCM-Based Gene Expression Profiling. We next carried out a genome-wide, array-based gene expression analysis to identify unique and discriminatory molecular profiles. LCM was used to procure pure cell populations. Hyperplastic and dysplastic ACF, microadenomas, and adjacent normal epithelium were laser-captured (Fig. 2). Because ACF are comprised of only limited numbers of cells (20 to 500), the RNA yield is minimal (Ϸ50 to 500 fg/cell). Therefore, to circumvent the issues of contaminating cells and limiting RNA yield associated with these microscopic lesions, we combined the use of LCM with linear amplification (LCM-LA), using T7-based linear RNA amplification. This method routinely generated 30 to 70 ␮g of aRNA from laser-captured colonocytes (50 to 1000 cells). However, the size of ACF precluded verification of amplification linearity with a conven- Fig. 3. Comparison of raw fluorescence intensities of saline-treated colons. Expression tional comparison of nonamplified RNA versus amplified aRNA. levels (in raw fluorescence intensity) of 4896 genes from laser-dissected cells from the Therefore, we analyzed expression profiles between nonamplified and colons of saline-treated A/J (n ϭ 3) and AKR/J (n ϭ 3) mice. 6397

Fig. 4. Cluster analysis of ACF from azoxymethane- treated mice using the adaptive centroid algorithm. A, dendrogram and heat map of the gene expression levels from hyperplastic ACF (H), dysplastic ACF (D), microadenoma (M), and adjacent normal-appearing (N) from azoxymethane-treated A/J and AKR/J colons, visualized using Genesite software (BioDiscovery). Of the 4896 genes represented on the array, 220 genes (rows) clustered into six broad clusters (A–F) showing similar and distinct expression patterns at different stages (columns) of colon tumor progression in A/J and AKR/J mice. Note the complete segregation of the lesions from sensitive and resistant strains. B, Venn diagram of the total number of significantly altered (2-fold) genes that were identified by adaptive centroid algorithm from A/J and AKR/J colons. Note that 126 of the genes identified were common to A/J and AKR/J ACF. C, expression profiles of a subset of genes from four clusters representing hyperplastic ACF (HACF), dysplastic ACF (DACF), microadenoma (MA), and adjacent normal cells from both strains. Although the histologic phenotype of the corresponding lesions are similar, gene clustering of hyperplastic (D) and dysplastic (E) ACF showed that the observed transcriptional profiles are unique and therefore useful in discriminating low- and high-risk ACF. The expression level of each gene is represented by the ratio of gene intensity in the lesion relative to expression in the saline-treated control colons. The color-bar at the bottom correlates color intensity to gene expression.

based on unique expression, allowing complete segregation of A/J and tion according to histology using unsupervised clustering, subsequent AKR/J lesions. The six gene clusters (Fig. 4A) contained a total of 226 analysis of specific data subsets derived from histologically similar genes in A/J ACF and 202 genes in AKR/J ACF that were signifi- lesions showed clear separation. Although most of the microadenomas cantly up- or down-regulated (2-fold) in at least one histologically clustered together, it was difficult to segregate hyperplastic and dys- defined subgroup. Although lesions did not show complete segrega- plastic ACF; additional evidence that subtle differences in gene ex- 6398

Table 2 Target genes validated by quantitative reverse transcription-PCR and their primer sequences Primers (5Ј33Ј) Relative to control*

Account number Gene Forward Reverse A/J AKR/J Hyperplastic lesions AI413975 Rnh1 GTCAGGCTGGACGACTGTG GGCTCAGCTTCTGGATCTTG 1.27 Ϯ 0.84 2.35 Ϯ 2.09 AI427137 Psmd13 CAGTGTCTGAGCAGCAGGAG GCCACTGTTGAAGGCATAGAG 0.16 Ϯ 0.24 1.83 Ϯ 1.10 Dysplastic lesions AI323680 Iex-1 ATAGGGTCGGTAAGACAGAGTTG CCTGAGAAGCAACCAGAAGAC 0.65 Ϯ 0.66 1.89 Ϯ 0.83 AI324871 Thbs4 CATCATCTGGTCCAACCTCAA GTTGTGGGATTGCTTCTTGG 13.88 Ϯ 16.4 0.07 Ϯ 0.09 AI324948 Slpi GAGGGTATATGTGGGAAAGTCTG CCTGGGAGCAGGGAAGTAGT 2.30 Ϯ 1.00 0.94 Ϯ 1.07 AI450297 EST TCCTTGGCTAACATCCTTGG TGTCCCCCAATTCATCTTTC 6.23 Ϯ 8.93 0.41 Ϯ 0.67 AI451408 He4V3 AGGACCAGTGTCAGGTGGAC GGCTGAAGCTCAGAATTTGG 7.07 Ϯ 4.54 0.21 Ϯ 0.21 AI528651 Asml3a GCCTGGTGATTACACATTGC GCCTGAGTCAAGACATACTCCA 2.07 Ϯ 2.07 0.28 Ϯ 0.33 * Expression levels of pooled saline control samples were used as calibrator. The values Ͻ 1.00 indicate a decrease, and values Ͼ 1.00 indicate an increase in gene expression relative to the control. pression profiles characterize these lesions. There was obvious seg- biological behavior (4, 5). Histomorphologic evaluation and grading regation of adjacent normal-appearing mucosa from ACF (Fig. 4A). of ACF represent one of the few available biomarkers of colon cancer As shown in the Venn diagram (Fig. 4B), there was overlap of 126 risk (6–10). The present study was undertaken as an initial attempt to genes between strains, demonstrating the likelihood of shared path- develop a molecular signature to discriminate ACF risk potential. IHC ways in high- and low-risk lesions. Fig. 4C shows four representative analysis of proliferating cell nuclear antigen, p53, and several com- gene subclusters with distinct expression profiles. These subclusters ponents of the Wnt signaling pathway, including ␤-catenin, APC, were selected on the basis of divergent expression patterns and in- cyclin D1, and c-Myc (2, 11, 13, 20, 34–36), afforded minimal clude genes consistently up- or down-regulated across lesions of discrimination of ACF. Surprisingly, intense ␤-catenin nuclear stain- variable histology within mouse strains. ing was observed in ACF from both strains. This accumulation oc- Gene Profiles of Low- and High-Risk ACF. To test the principal curred in the absence of mutations within the glycogen synthase that ACF of similar morphology, but different risk potential, have kinase-3 phosphorylation site and was independent of APC loss. unique molecular signatures, the following analyses were undertaken. Increased nuclear staining was associated with elevated levels of Hyperplastic ACF were separated between high (A/J)- and low (AKR/ several key ␤-catenin target genes, including cyclin D1 and c-myc, an J)-risk colons. Genes that are significantly and differentially regulated effect that was not strain specific. The significance of the subtle (up or down) at least 2-fold between A/J and AKR/J are represented difference in membrane staining of ACF between sensitive and re- in Fig. 4D. The high-risk-A/J hyperplastic ACF showed increased sistant strains is presently under study. expression levels of several genes belonging to the GTPase family, Limited ACF discrimination by conventional IHC prompted a including Rac3 and Rab5.6 Genes involved in cell-cell adhesion genome-wide, array-based expression analysis to identify discrimina- (Mfge8), immune response (Psmd1), antiangiogenesis (Rnh1), as well tory molecular profiles. Optimization of LCM-LA-MA afforded the as the transcriptional regulator Usf2, were all significantly up-regu- opportunity to study gene expression patterns within individual co- lated in the low-risk AKR/J hyperplastic ACF.5 lonic crypts. Although unsupervised clustering provided separation in Dysplastic ACF were examined using a similar set of criteria. Nine the A/J and AKR/J colons, segregation of lesions based on histology of 11 dysplastic ACF were segregated between the strains. We fo- was incomplete (Fig. 4A). However, within the complete data set, cused our analysis on clusters representing genes that afforded max- there were subsets of genes in both strains that were consistently imal segregation across strains (Fig. 4E). Genes that were up-regu- altered by azoxymethane treatment. For example, in A/J colons, lated in high-risk A/J ACF and down-regulated in low-risk AKR/J elevated levels of Pole2, Hes6, and sf3b1 were observed in hyper- ACF include acid sphingomyelinase-like protein (ASML3a), plastic and dysplastic ACF, microadenomas, and adjacent normal- membrane-associated protein-17 (MAP-17), Rab24, secretory leuko- appearing epithelium. Consistent alterations in these genes throughout cyte serine protease inhibitor (SLPI1), thrombospondin 4, and Grim- the carcinogenic process imply a fundamental role in tumor progres- 19. To validate the array data, eight targets were selected from the sion. On the other hand, genes involved in immune response (Ubc-rs2, various lesions for confirmation by real-time PCR. These results are Psmd13, and Li), cell-cell adhesion (Mfge8), and antiangiogenesis shown in Table 2 and confirm the expression changes observed on the (Rnh1)6 were elevated in ACF from the resistant AKR/J colons. arrays. Effective immune surveillance, contact inhibition, and controlled an- One of the genes that was elevated in the low-risk AKR/J ACF was giogenesis are likely to play a fundamental role in limiting ACF IEX-1 (Fig. 4; Table 2). IEX-1 plays a role in cell death and is progression, and the additional interrogation of these pathways in regulated in part by nuclear factor-␬B, p53, and c-Myc (38). Given its human colorectal cancer may prove informative. robust increase in the resistant ACF, we examined IEX-1 status in To test the principal that ACF of comparable morphology, but human colon tumors by IHC. Cytoplasmic staining of IEX-1 was distinctly divergent risk potential, are characterized by unique molec- present in normal-appearing colonic crypts (Fig. 5), consistent with ular signatures, analysis of hyperplastic and dysplastic ACF was previous studies (39). However, protein staining was minimal in a undertaken using adaptive centroid algorithm. These analyses enabled subset (6 of 10) of matched tumors, providing preliminary evidence a correlation of transcriptional profile(s) within lesion subtypes with for its potential role in colorectal cancer. respect to morphologic stage, an approach that will enable our understanding of transcriptional programs that influence tumor progression DISCUSSION or growth arrest of putative precancerous lesions. Because dysplastic ACF are associated with tumor progression, we focused our analysis ACF can be stratified into two broad classes, dysplastic and hyper- on clusters representing genes that afforded maximal segregation plastic, based in part on morphologic characteristics and predicted across strains (Fig. 4E). Genes that are elevated in the A/J dysplastic ACF and down-regulated in the AKR/J dysplastic ACF include 6 Internet address: http://www.celera.com. ASML3a, MAP-17, Rab24, SPI1, thrombospondin 4, and Grim-19. 6399

Fig. 5. Immunohistochemical analysis of IEX1 expression in human normal and colorectal tumor tissue. A, strong cytoplasmic staining of IEX1 was present in adjacent normal-appearing colonic crypts. B, a markedly reduced level of staining for IEX1 was observed in the tumor crypts from the same patient. C, a second patient showing positive staining within normal colon crypts adjacent to tumor cells that are mostly negative (arrows). D, negative control section in which IEX-1 antibody was replaced with normal serum.

ASML3a is a recently identified protein that binds with the DBCCR1 tially play a role in limiting ACF progression. For example, IEX-1 is (deleted in bladder cancer chromosome region 1) tumor suppressor induced by various cell stressors, including ionizing radiation, UV gene (40). In fact, elevated expression of both genes was reported in radiation, and growth factors (45). IEX-1, an nuclear factor-␬B target human urinary bladder tumors (40), and it is possible that the high gene, inhibits the activation of nuclear factor-␬B, thereby counteract- levels of ASML3a observed in dysplastic A/J ACF contribute to tumor ing its antiapoptotic potential (45). Whether IEX-1 elicits a compa- progression. Several other discriminatory targets were also identified. rable protective effect in low-risk ACF is certainly a possibility. To MAP-17 was overexpressed in A/J dysplastic ACF, with only mod- assess the potential relevance of IEX-1 in human colorectal cancer, we erate levels present in morphologically matched AKR/J lesions. Al- evaluated a total of 10 matched tumors with adjacent normal epithe- though the precise role of MAP-17 has not been clarified, previous lium by IHC. As shown in Fig. 5, there was a marked reduction in studies conducted in renal tubular epithelial cells have identified its IEX-1 staining within the tumor cells, suggesting the potential in- association with the cytoplasmic aspect of the plasma membrane, volvement of this immediate early gene in colon tumorigenesis. Ad- implicating its role in cell-cell communication (41). In addition, ditional analysis of this protein and its functional significance in abundant levels of MAP-17 have been detected within carcinomas human colorectal cancer is under way. arising from kidney, colon, lung, and breast (41). Although beyond Although the importance of ACF as biomarkers of colon cancer risk the scope of the present investigation, additional studies to define the is well established (5, 10, 36, 46, 47), few studies have attempted to role of MAP-17 in human colon cancer is warranted. Rab24 (part of additionally stratify these lesions at the molecular/genetic level. The the Ras superfamily) is involved in vesicle transport, and we found incipient and dynamic nature of ACF is likely to complicate histology- that it was elevated in dysplastic A/J ACF. The potential significance based methods of prognostication. Additionally, it is known that early of this observation with respect to colorectal cancer is based in part on adenomas that are similar in appearance may be biologically distinct earlier reports demonstrating high levels of this protein in hepatocel- with varying rates of malignant conversion (46, 47). Thus, our pri- lular carcinomas, prompting speculation that Rab24 may represent a mary objective was to identify unique transcriptional profiles of ACF proto-oncogene (42). Protease inhibitors have been associated with at similar histologically defined stages before the onset of adenomas. attenuation of tumor progression and metastasis. However, recent Although one cannot rule out the possibility that the luminal environ- studies indicate that expression of secretory leukocyte serine protease ment may affect ACF outcome, it is clear from the identified gene inhibitors (SLPI1) may elicit an opposite effect, facilitating tumor clusters that ACF do, in fact, harbor distinct genetic profiles that may progression, metastasis, and even a poor prognosis in humans (43). result in a divergence of phenotypes and subsequent tumorigenic Interestingly, high levels of SLPI1 transcripts were observed in A/J potential. Interestingly, the genes that were differentially expressed in dysplastic ACF, representing the first association of this serine pro- A/J and AKR/J ACF represent only a small percentage (Ͻ5%) of the tease inhibitor in colon tumorigenesis. total number of genes interrogated, underscoring the fundamental Cluster analysis identified a gene panel that was significantly similarity of lesions at the earliest stages of tumorigenesis. Despite induced in resistant AKR/J ACF. These genes include IEX-1, Mfge8, significant overlap, however, our data have identified a number of Rnh1, Psmd13, and Usfs2 (Fig. 4E). The increased expression of a discriminatory targets that may affect the biological outcome of ACF. subset of genes involved in protein biosynthesis, DNA repair, tran- These data thus provide a proof-in-principle of our ability to stratify scription regulation, members of the nuclear factor-␬B family, ion risk potential of ACF and provide the rationale for assessing the transport, and cell metabolism raise the possibility for establishing a expression characteristics of a unique set of genes in human ACF. gene signature for low-risk ACF. In fact, each of the genes repre- Increased knowledge of gene expression patterns and risks inherent sented within this cluster have putative functions that could poten- in ACF may additionally inform the relationship between human ACF 6400

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2004 American Association for Cancer Research. GENE SIGNATURE OF ACF RISK POTENTIAL and tumorigenic potential. Patients with colorectal cancer demonstrate 20. Nambiar PR, Girnun G, Lillo NA, Guda K, Whiteley HE, Rosenberg DW. Prelimi- increased numbers of ACF (with greater percentages of large and nary analysis of azoxymethane induced colon tumors in inbred mice commonly used as transgenic/knockout progenitors. Int J Oncol 2003;22:145–50. dysplastic ACF) relative to patients with benign adenomas or those 21. Bird RP. Observation and quantification of aberrant crypts in the murine colon treated without evidence of pathology. These ACF are not uniformly distrib- with a colon carcinogen. Cancer Lett 1987;37:147–51. 22. Rosenberg DW, Liu Y. Induction of aberrant crypts in murine colon with varying uted and cluster, both in cancer and polyp patients, within the distal sensitivity to colon carcinogenesis. Cancer Lett 1995;92:209–14. bowel (48–50). Takayama et al. (51) have reported that in patients 23. Park HS, Goodlad RA, Wright NA. The incidence of aberrant crypt foci and colonic with adenomas and ACF, 96% of polyps were located in the left carcinoma in dimethylhydrazine-treated rats varies in a site-specific manner and depends on tumor histology. Cancer Res 1997;57:4507–10. colon. The gene expression profiles from high- and low-risk mouse 24. Shpitz B, Hay K, Medline A, et al. Natural history of aberrant crypt foci. A surgical strains suggest that identification of molecular signatures from clini- approach. Dis Colon Rectum 1996;39:763–7. cally accessible distal ACF may give new insight into cumulative risk 25. Bouzourene H, Chaubert P, Seelentag W, Bosman FT, Saraga E. Aberrant crypt foci in patients with neoplastic and nonneoplastic colonic disease. Hum Pathol 1999;30: for an individual or population at large. Thus, the use of predictive 66–71. gene profiling as an adjunct to traditional histologic analysis permits 26. Lechner S, Muller-Ladner U, Renke B, Scholmerich J, Ruschoff J, Kullmann F. Gene the recognition of differences between histologies that may otherwise expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut 2003;52:1148–53. be difficult to stratify. By extrapolation, a similar approach to dis- 27. Roncucci L, Stamp D, Medline A, Cullen JB, Bruce WR. Identification and quanti- criminate human ACF on the basis of expression profiles may provide fication of aberrant crypt foci and microadenomas in the human colon. Hum Pathol 1991;22:287–94. enormous prognostic benefit in individuals at varying risk of colorec- 28. Siu IM, Pretlow TG, Amini SB, Pretlow TP. Identification of dysplasia in human tal cancer. colonic aberrant crypt foci. Am J Pathol 1997;150:1805–13. 29. Whiteley LO, Anver MR, Botts S, Jokinen MP. Proliferative lesions of the intestine, salivary glands, oral cavity and esophagus in rats. In: STP/ARP/AFIP, editors. Guides REFERENCES for toxicologic pathology. Washington, DC: STP/ARP/AFIP; 1996. p. 1–18. 1. Landis SH, Murray T, Bolden S, Wingo PA. Cancer statistics. CA - Cancer J Clin 30. Guda K, Cui H, Garg S, et al. Multistage gene expression profiling in a differentially 1999;49:8–31. susceptible mouse colon cancer model. Cancer Lett 2003;191:17–25. 2. Markowitz SD, Dawson DM, Willis J, Willson JKV. Focus on colon cancer. Cancer 31. Ma XJ, Salunga R, Tuggle JT, et al. Gene expression profiles of human breast cancer Cell 2002;1:233–6. progression. Proc Natl Acad Sci USA 2003;100:5974–9. 3. Larsen-Kobaek M, Thorup I, Diederichsen A, Fenger C, Hoitinga MR. Review of 32. Wolkenhauer O, Moller-Levet C, Sanchez-Cabo F. The curse of normalization. Comp colorectal cancer and its metastases in rodent models: comparative aspects with those Funct Genom 2002;3:375–9. in humans. Comp Med 2000;50:16–26. 33. Garg S, Hansen MF, Rowe DW, Achenie LE. An adaptive strategy for single- and 4. Wei K, Kucherlapati R, Edelmann W. Mouse models for human DNA mismatch- multi-cluster gene assignment. Biotechnol Prog 2003;19:1142–8. repair gene defects. Trends Mol Med 2002;8:346–53. 34. Renehan AG, O’Dwyer ST, Haboubi NJ, Potten CS. Early cellular events in colo- 5. Papanikolaou A, Wang QS, Delker DA, Rosenberg DW. Azoxymethane-induced rectal carcinogenesis. Colorectal Dis 2002;4:76–89. colon tumors and aberrant crypt foci in mice of different genetic susceptibility. 35. Fujimori T, Kawamata H, Kashida H. Precancerous lesions of the colorectum. J Cancer Lett 1998;14:29–34. Gastroenterol 2001;36:587–94. 6. McLellan EA, Medline A, Bird RP. Sequential analyses of the growth and morpho- 36. Arends JW. Molecular interactions in the Vogelstein model of colorectal carcinoma. logical characteristics of aberrant crypt foci: putative preneoplastic lesions. Cancer J Pathol 2000;190:412–6. Res 1991;51:5270–4. 37. Neufeld KL, White RL. Nuclear and cytoplasmic localizations of the adenomatous 7. Nucci MR, Robinson CR, Longo P, Campbell P, Hamilton SR. Phenotypic and polyposis coli protein. Proc Natl Acad Sci USA 1997;94:3034–9. genotypic characteristics of aberrant crypt foci in human colorectal mucosa. Hum 38. Huang YH, Wu JY, Zhang Y, Wu MX. Synergistic and opposing regulation of the Pathol 1997;28:1396–407. stress-responsive gene IEX-1 by p53, c-Myc, and multiple NF-kB/rel complexes. 8. Kristinsson J, Roseth AG, Sundset A, et al. Granulocyte marker protein is increased Oncogene 2002;21:6819–28. in stools from rats with azoxymethane-induced colon cancer. Scand J Gastroenterol 39. Feldmann KA, Pittelkow MR, Roche PC, Kumar R, Grande JP. Expression of an 1999;34:1216–23. immediate early gene, IEX-1, in human tissues. Histochem Cell Biol 2001;115:489– 9. Thorup I. Histomorphological and immunohistochemical characterization of colonic 97. aberrant crypt foci in rats: relationship to growth factor expression. Carcinogenesis 40. Wright KO, Messing EM, Reeder JE. Increased expression of the acid sphingomy- (Lond.) 1997;18:465–72. elinase-like protein ASML3a in bladder tumors. J Urol 2002;168:2645–9. 10. Papanikolaou A, Wang Q-S, Papanikolaou D, Whiteley HE, Rosenberg DW. Sequen- 41. Kocher O, Cheresh P, Lee SW. Identification and partial characterization of a novel tial and morphological analyses of aberrant crypt foci formation in mice of differing membrane-associated protein (MAP17) up-regulated in human carcinomas and mod- susceptibility to azoxymethane-induced colon carcinogenesis. Carcinogenesis (Lond.) ulating cell replication and tumor growth. Am J Pathol 1996;149:493–500. 2000;21:1567–72. 42. He H, Dai F, Yu L, et al. Identification and characterization of nine novel human 11. Nambiar PR, Giardina C, Guda K, Aizu W, Raja R, Rosenberg DW. Role of the small GTPases showing variable expressions in liver cancer tissues. Gene Expr alternating reading frame (P19)-p53 paper pathway in an in vivo murine colon tumor 2002;10:231–42. model. Cancer Res 2002;62:3667–74. 43. Devoogdt N, Hassanzadeh Ghassabeh G, Zhang J, Brys L, De Baetselier P, Revets H. 12. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990; Secretory leukocyte protease inhibitor promotes the tumorigenic and metastatic 61:759–67. potential of cancer cells. Proc Natl Acad Sci USA 2003;100:5778–82. 13. Wang QS, Papanikolaou A, Sabourin CL, Rosenberg DW. Altered expression of 44. Hu J, Angell JE, Zhang J, et al. Characterization of monoclonal antibodies against cyclin D1 and cyclin-dependent kinase 4 in azoxymethane-induced mouse colon GRIM-19, a novel IFN-beta and retinoic acid-activated regulator of cell death. tumorigenesis. Carcinogenesis (Lond.) 1998;19:2001–6. J Interferon Cytokine Res 2002;22:1017–26. 14. Singh J, Kulkarni N, Kelloff G, Reddy BS. Modulation of azoxymethane-induced 45. Arlt A, Kruse ML, Breitenbroich M, et al. The early response gene IEX-1 attenuates mutational activation of ras proto-oncogenes by chemopreventive agents in colon NF-kappaB activation in 293 cells, a possible counter-regulatory process leading to carcinogenesis. Carcinogenesis (Lond.) 1994;15:1317–23. enhanced cell death. Oncogene 2003;22:3343–51. 15. Maltzman T, Whittington J, Driggers L, Stephens J, Ahnen D. AOM-induced mouse 46. Bird RP, Good CK. The significance of aberrant crypt foci in understanding the colon tumors do not express full-length APC protein. Carcinogenesis (Lond.) 1997; pathogenesis of colon cancer. Toxicol Lett 2000;112–113:395–402. 18:2435–59. 47. Jass JR, Whitehall VLJ, Young J, Leggett B. Emerging concepts of colorectal 16. Wang QS, Papanikolaou A, Nambiar PR, Rosenberg DW. Differential expression of neoplasia. N Engl J Med 2002;123:862–76. p16(INK4a) in azoxymethane-induced mouse colon tumorigenesis. Mol Carcinog 48. Roncucci L, Stamp D, Medline A, Cullen JB, Bruce WR. Identification and quanti- 2000;28:139–47. fication of aberrant crypt foci and microadenomas in the human colon. Hum Pathol 17. Vivona AA, Shpitz B, Medline A, et al. K-Ras mutations in aberrant crypt foci, 1991;22:287–94. adenomas and adenocarcinomas during azoxymethane-induced colon carcinogenesis. 49. Bouzourene H, Chaubert P, Seelentag W, Bosman FT, Saraga E. Aberrant crypt foci Carcinogenesis (Lond.) 1993;14:1777–81. in patients with neoplastic and nonneoplastic colonic disease. Hum Pathol 1999;30: 18. Bolt AB, Papanikolaou A, Delker DA, Wang QS, Rosenberg DW. Azoxymethane 66–71. induces Ki-ras activation in the tumor resistant AKR/J mouse colon. Mol Carcinog 50. Shpitz B, Bomstein Y, Mekori Y, et al. Aberrant crypt foci in human colons: 2000;27:210–8. distribution and histomorphologic characteristics. Hum Pathol 1998;29:469–75. 19. Fenoglio-Preiser CM, Noffsinger A. Aberrant crypt foci: a review. Toxicol Pathol 51. Takayama T, Katsuki S, Takahashi Y, et al. Aberrant crypt foci of the colon as 1999;27:632–42. precursors of adenoma and cancer. N Engl J Med 1998;339:1277–84.

6401

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2004 American Association for Cancer Research. Genetic signatures of High- and Low-Risk Aberrant Crypt Foci in a Mouse Model of Sporadic Colon Cancer

Prashant R. Nambiar, Masako Nakanishi, Rishi Gupta, et al.

Cancer Res 2004;64:6394-6401.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/18/6394

Cited articles This article cites 46 articles, 7 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/18/6394.full#ref-list-1

Citing articles This article has been cited by 10 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/18/6394.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/18/6394. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.