The Lipogenic Regulator SREBP2 Induces Transferrin in Circulating Melanoma Cells and Suppresses Ferroptosis

Total Page:16

File Type:pdf, Size:1020Kb

The Lipogenic Regulator SREBP2 Induces Transferrin in Circulating Melanoma Cells and Suppresses Ferroptosis Published OnlineFirst November 17, 2020; DOI: 10.1158/2159-8290.CD-19-1500 RESEARCH ARTICLE The Lipogenic Regulator SREBP2 Induces Transferrin in Circulating Melanoma Cells and Suppresses Ferroptosis Xin Hong1, Whijae Roh2, Ryan J. Sullivan1,3, Keith H.K. Wong4,5, Ben S. Wittner1, Hongshan Guo1, Taronish D. Dubash1, Moshe Sade-Feldman1,2, Benjamin Wesley1, Elad Horwitz1, Genevieve M. Boland1,6, Dieuwke L. Marvin1, Todd Bonesteel1, Chenyue Lu1, François Aguet2, Risa Burr1, Samuel S. Freeman2, Laxmi Parida9, Katherine Calhoun1,4, Michelle K. Jewett1,4, Linda T. Nieman1, Nir Hacohen1,2, Anders M. Näär1, David T. Ting1,3, Mehmet Toner4,5,6, Shannon L. Stott1,3, Gad Getz1,2,7, Shyamala Maheswaran1,6, and Daniel A. Haber1,3,8 ABSTRACT Circulating tumor cells (CTC) are shed by cancer into the bloodstream, where a viable subset overcomes oxidative stress to initiate metastasis. We show that Bianca Dunn by Illustration single CTCs from patients with melanoma coordinately upregulate lipogenesis and iron homeostasis pathways. These are correlated with both intrinsic and acquired resistance to BRAF inhibitors across clonal cultures of BRAF-mutant CTCs. The lipogenesis regulator SREBP2 directly induces transcription of the iron carrier Transferrin (TF), reducing intracellular iron pools, reactive oxygen species, and lipid peroxidation, thereby conferring resistance to inducers of ferroptosis. Knockdown of endogenous TF impairs tumor formation by melanoma CTCs, and their tumorigenic defects are partially rescued by the lipophilic antioxidants ferrostatin-1 and vitamin E. In a prospective melanoma cohort, presence of CTCs with high lipogenic and iron metabolic RNA signatures is correlated with adverse clinical outcome, irre- spective of treatment regimen. Thus, SREBP2-driven iron homeostatic pathways contribute to cancer progression, drug resistance, and metastasis. SIGNIFICANCE: Through single-cell analysis of primary and cultured melanoma CTCs, we have uncov- ered intrinsic cancer cell heterogeneity within lipogenic and iron homeostatic pathways that modulates resistance to BRAF inhibitors and to ferroptosis inducers. Activation of these pathways within CTCs is correlated with adverse clinical outcome, pointing to therapeutic opportunities. 1Massachusetts General Hospital Cancer Center and Harvard Medical X. Hong and W. Roh contributed equally to this article. 2 School, Boston, Massachusetts. Broad Institute of Harvard and MIT, Cam- Current address for X. Hong: School of Medicine, Southern University of 3 bridge, Massachusetts. Department of Medicine, Massachusetts General Science and Technology, Shen Zhen, China; and current address for A.M. 4 Hospital and Harvard Medical School, Boston, Massachusetts. Center for Näär, Department of Nutritional Sciences and Toxicology, University of Engineering in Medicine, Department of Surgery, Massachusetts General California, Berkeley, California. Hospital and Harvard Medical School, Boston, Massachusetts. 5Shriners Hospitals for Children, Boston, Massachusetts. 6Department of Surgery, Corresponding Authors: Daniel A. Haber, MGH Cancer Center, Building Massachusetts General Hospital and Harvard Medical School, Boston, Mas- 149, 13th Street, Charlestown, MA 02129. Phone: 617-726-7805; E-mail: sachusetts. 7Department of Pathology, Massachusetts General Hospital and [email protected]; and Shyamala Maheswaran, maheswaran@ Harvard Medical School, Boston, Massachusetts. 8Howard Hughes Medical helix.mgh.harvard.edu Institute, Bethesda, Maryland. 9IBM Research, Yorktown Heights, New York. Cancer Discov 2021;11:678–95 Note: Supplementary data for this article are available at Cancer Discovery doi: 10.1158/2159-8290.CD-19-1500 Online (http://cancerdiscovery.aacrjournals.org/). ©2020 American Association for Cancer Research. 678 | CANCER DISCOVERY MARCH 2021 AACRJournals.org Downloaded from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst November 17, 2020; DOI: 10.1158/2159-8290.CD-19-1500 Illustration by Bianca Dunn by Illustration INTRODUCTION lating tumor cells (CTC) to diverse metastatic sites, as is the progression from oligometastatic to widespread metastatic Metastatic melanoma remains a highly lethal malignancy, disease. Although melanoma cells are notoriously invasive despite breakthroughs in the targeted treatment of BRAF- and resistant to any therapeutic interventions other than mutant cases (1–3) and the application of immune check- immunologic and BRAF-targeted treatments, the exceptional point therapies irrespective of genotype (4–8). Melanomas with environment in the bloodstream may provide new therapeu- BRAFV600E and associated oncogenic variants typically undergo tic opportunities to suppress metastasis. rapid tumor shrinkage following treatment with combina- Specifically, the high oxygen content of blood has been tion BRAF and MEK inhibitors, although there is consider- shown to render primary melanoma cells vulnerable to reac- able variation in the degree of initial response, and virtually tive oxygen species (ROS; ref. 17). Identifying innate mecha- all cases recur with drug-resistant disease. The effectiveness nisms that confer resistance to ROS, and thereby enable a of immune-targeted therapies appears to be determined in subset of melanoma cells to remain viable as they circulate in part by total mutational burden in the tumor and the associ- the blood, may thus provide new therapeutic targets to sup- ated presentation of neoantigens, which are typically high in press metastatic precursors. melanoma (9–14), but only a third of patients have sustained The small number of CTCs present within a blood speci- responses (15, 16). For both targeted and immune-based thera- men, admixed to billions of normal blood cells, presents pies, innate and acquired resistance is compounded by tumor significant technical challenges to their isolation and func- heterogeneity in signaling pathways, expression of cell surface tional analysis (18). Neural crest–derived melanoma cells epitopes, and intrinsic cell survival pathways. do not express the epithelial cell surface protein epithelial The transition from primary melanoma to metastatic dis- cell adhesion molecule EPCAM, which is traditionally used ease is characterized by blood-based dissemination of circu- to capture CTCs using magnetically conjugated antibody March 2021 CANCER DISCOVERY | 679 Downloaded from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst November 17, 2020; DOI: 10.1158/2159-8290.CD-19-1500 RESEARCH ARTICLE Hong et al. enrichment (19, 20). Furthermore, melanoma cells display a independent media, under hypoxic conditions, and in the high degree of heterogeneity in cell surface epitope expres- presence of heparin and RHO kinase inhibitor (refs. 22, 23, 25; sion, which complicates their direct capture using lineage- or see Methods). To confirm their identity as melanoma cells, tumor-specific antibody panels (21). In designing a tumor- the cultured CTCs were tested for expression of characteristic agnostic strategy for isolating CTCs within blood specimens, melanoma markers (ref. 24; Fig. 1A; Supplementary Fig. S1A we developed a platform (CTC-iChip) for efficient depletion and S1B) and shown to have shared mutational profiles with of normal blood cells, thereby enriching for cancer cells irre- their respective parental tumors, including the canonical spective of cell surface markers (22, 23). Taking advantage drug-sensitizing BRAFV600E or NRASQ61K mutations, as well of microfluidic flow kinetics, this CTC-iChip achieves initial as displaying predicted BRAF and MEK inhibitor sensitivity size-based exclusion of red blood cells and platelets, followed patterns (Fig. 1A; Supplementary Fig. S1C and S1D). The by inertial focusing of all nucleated blood cells into a single melanoma CTC lines were tested for tumorigenesis potential streamline, through which antibody-tagged leukocytes are in immunosuppressed NOD/SCID gamma (NSG) mice. All magnetically separated from unlabeled CTCs. Across multi- five cultured lines are highly tumorigenic following sub- ple tumor types, this platform achieves 104 enrichment for cutaneous inoculation, and four of them (PEM-78 being CTCs, and we have applied a digital RNA-based readout to the exception) generated metastases upon direct intravascu- allow highly sensitive measurement of melanoma tumor cell lar injection, either by tail-vein or intracardiac inoculation burden in the blood (24). The enrichment of untagged and (Fig. 1B and C; Supplementary Fig. S1E–S1J). Both pri- unmanipulated CTCs not only enhances their RNA quality mary tumors and metastases generated from GFP-luciferase– for such diagnostic purposes, but also helps to preserve their tagged CTCs show preservation of characteristic melanosome cell viability for functional studies. markers (Fig. 1C; Supplementary Fig. S1F, S1H, and S1K). We We have previously reported the establishment of long- selected two of these CTC lines, Mel-167 and Mel-182-2, for term CTC cultures from blood specimens of women with detailed functional studies. hormone receptor–positive breast cancer, which are often Having established robust tumorigenic and metastatic oligoclonal in origin and which recapitulate somatic muta- competent CTC cultures, we compared their transcriptomic tions acquired during the course of therapy, and their epige- profiles with those of standard melanoma tumor–derived cell netic cell states
Recommended publications
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Targeting Fibrosis in the Duchenne Muscular Dystrophy Mice Model: an Uphill Battle
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427485; this version posted January 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Targeting fibrosis in the Duchenne Muscular Dystrophy mice model: an uphill battle 2 Marine Theret1#, Marcela Low1#, Lucas Rempel1, Fang Fang Li1, Lin Wei Tung1, Osvaldo 3 Contreras3,4, Chih-Kai Chang1, Andrew Wu1, Hesham Soliman1,2, Fabio M.V. Rossi1 4 1School of Biomedical Engineering and the Biomedical Research Centre, Department of Medical 5 Genetics, 2222 Health Sciences Mall, Vancouver, BC, V6T 1Z3, Canada 6 2Department of Pharmacology and Toxicology, Faculty of Pharmaceutical Sciences, Minia 7 University, Minia, Egypt 8 3Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, 9 Darlinghurst, NSW, 2010, Australia 10 4Departamento de Biología Celular y Molecular and Center for Aging and Regeneration (CARE- 11 ChileUC), Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, 8331150 12 Santiago, Chile 13 # Denotes Co-first authorship 14 15 Keywords: drug screening, fibro/adipogenic progenitors, fibrosis, repair, skeletal muscle. 16 Correspondence to: 17 Marine Theret 18 School of Biomedical Engineering and the Biomedical Research Centre 19 University of British Columbia 20 2222 Health Sciences Mall, Vancouver, British Columbia 21 Tel: +1(604) 822 0441 fax: +1(604) 822 7815 22 Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427485; this version posted January 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Interactions Between the Parasite Philasterides Dicentrarchi and the Immune System of the Turbot Scophthalmus Maximus.A Transcriptomic Analysis
    biology Article Interactions between the Parasite Philasterides dicentrarchi and the Immune System of the Turbot Scophthalmus maximus.A Transcriptomic Analysis Alejandra Valle 1 , José Manuel Leiro 2 , Patricia Pereiro 3 , Antonio Figueras 3 , Beatriz Novoa 3, Ron P. H. Dirks 4 and Jesús Lamas 1,* 1 Department of Fundamental Biology, Institute of Aquaculture, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 2 Department of Microbiology and Parasitology, Laboratory of Parasitology, Institute of Research on Chemical and Biological Analysis, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 3 Institute of Marine Research, Consejo Superior de Investigaciones Científicas-CSIC, 36208 Vigo, Spain; [email protected] (P.P.); antoniofi[email protected] (A.F.); [email protected] (B.N.) 4 Future Genomics Technologies, Leiden BioScience Park, 2333 BE Leiden, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +34-88-181-6951; Fax: +34-88-159-6904 Received: 4 September 2020; Accepted: 14 October 2020; Published: 15 October 2020 Simple Summary: Philasterides dicentrarchi is a free-living ciliate that causes high mortality in marine cultured fish, particularly flatfish, and in fish kept in aquaria. At present, there is still no clear picture of what makes this ciliate a fish pathogen and what makes fish resistant to this ciliate. In the present study, we used transcriptomic techniques to evaluate the interactions between P. dicentrarchi and turbot leucocytes during the early stages of infection. The findings enabled us to identify some parasite genes/proteins that may be involved in virulence and host resistance, some of which may be good candidates for inclusion in fish vaccines.
    [Show full text]
  • Human Kinome Profiling Identifies a Requirement for AMP-Activated
    Human kinome profiling identifies a requirement for AMP-activated protein kinase during human cytomegalovirus infection Laura J. Terrya, Livia Vastagb,1, Joshua D. Rabinowitzb, and Thomas Shenka,2 aDepartment of Molecular Biology and bDepartment of Chemistry and the Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544 Contributed by Thomas Shenk, January 11, 2012 (sent for review December 29, 2011) Human cytomegalovirus (HCMV) modulates numerous cellular (7). Thus, the connections between AMPK activity and metabolic signaling pathways. Alterations in signaling are evident from the changes during HCMV infection have remained unclear. broad changes in cellular phosphorylation that occur during HCMV We confirmed the requirement for AMPK during infection, infection and from the altered activity of multiple kinases. Here we and we show that an AMPK antagonist, compound C, blocks report a comprehensive RNAi screen, which predicts that 106 cellular HCMV-induced changes to glycolysis and inhibits viral gene kinases influence growth of the virus, most of which were not expression. These studies argue that AMPK or a related, com- previously linked to HCMV replication. Multiple elements of the pound C-sensitive kinase is an essential contributor to metabolic AMP-activated protein kinase (AMPK) pathway scored in the screen. changes initiated by HCMV and provide unique insight into As a regulator of carbon and nucleotide metabolism, AMPK is poised potential antiviral strategies. to activate many of the metabolic pathways induced by HCMV infection. An AMPK inhibitor, compound C, blocked a substantial Results portion of HCMV-induced metabolic changes, inhibited the accumu- HumanKinomeScreenIdentifies Putative Effectors of HCMV Replication. lation of all HCMV proteins tested, and markedly reduced the We conducted an siRNA screen of the human kinome to perform an production of infectious progeny.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
    ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer
    [Show full text]
  • The Role of Ferroptosis in Breast Cancer Patients: a Comprehensive Analysis Zeng-Hong Wu1,2, Yun Tang3,Hongyu1 and Hua-Dong Li4
    Wu et al. Cell Death Discovery (2021) 7:93 https://doi.org/10.1038/s41420-021-00473-5 Cell Death Discovery ARTICLE Open Access The role of ferroptosis in breast cancer patients: a comprehensive analysis Zeng-Hong Wu1,2, Yun Tang3,HongYu1 and Hua-Dong Li4 Abstract Breast cancer (BC) affects the breast tissue and is the second most common cause of mortalities among women. Ferroptosis is an iron-dependent cell death mode that is characterized by intracellular accumulation of reactive oxygenspecies(ROS).Weconstructed a prognostic multigene signature based on ferroptosis-associated differentially expressed genes (DEGs). Moreover, we comprehensively analyzed the role of ferroptosis-associated miRNAs, lncRNAs, and immune responses. A total of 259 ferroptosis-related genes wereextracted.KEGGfunction analysis of these genes revealed that they were mainly enriched in the HIF-1 signaling pathway, NOD-like receptor signaling pathway, central carbon metabolism in cancer, and PPAR signaling pathway. Fifteen differentially expressed genes (ALOX15, ALOX15B, ANO6, BRD4, CISD1, DRD5, FLT3, G6PD, IFNG, NGB, NOS2, PROM2, SLC1A4, SLC38A1,andTP63) were selected as independent prognostic factors for BC patients. Moreover, T cell functions, including the CCR score, immune checkpoint, cytolytic activity, HLA, inflammation promotion, para-inflammation, T cell co-stimulation, T cell co-inhibition, and type II INF responses were significantly different between the low- risk and high-risk groups of the TCGA cohort. Immune checkpoints between the two groups revealed that the expressions of PDCD-1 (PD-1), CTLA4, LAG3, TNFSF4/14, TNFRSF4/8/9/14/18/25,andIDO1/2 among others were significantly different. A total of 1185 ferroptosis-related lncRNAs and 219 ferroptosis-related miRNAs were also included in this study.
    [Show full text]
  • Flow Reagents Single Color Antibodies CD Chart
    CD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
    [Show full text]
  • Quantitative Proteomics Analysis of Young and Elderly Skin with DIA Mass Spectrometry Reveals New Skin Aging-Related Proteins
    www.aging-us.com AGING 2020, Vol. 12, No. 13 Research Paper Quantitative proteomics analysis of young and elderly skin with DIA mass spectrometry reveals new skin aging-related proteins Jing Ma1,2, Mengting Liu1,2, Yaochi Wang1,2, Cong Xin1,2, Hui Zhang1,2, Shirui Chen1,2, Xiaodong Zheng1,2, Xuejun Zhang1,2, Fengli Xiao1,2,3, Sen Yang1,2 1Department of Dermatology of First Affiliated Hospital, and Institute of Dermatology, Anhui Medical University, Hefei, Anhui, China 2Key Laboratory of Dermatology, Anhui Medical University, Ministry of Education, Hefei, Anhui, China 3The Center for Scientific Research of Anhui Medical University, Hefei, Anhui, China Correspondence to: Fengli Xiao, Sen Yang; email: [email protected], [email protected] Keywords: aging, epidermal proteins, skin rejuvenation and aging, proteome, mass spectrometer Received: February 25, 2020 Accepted: May 27, 2020 Published: June 29, 2020 Copyright: Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Skin aging is a specific manifestation of the physiological aging process that occurs in virtually all organisms. In this study, we used data independent acquisition mass spectrometry to perform a comparative analysis of protein expression in volar forearm skin samples from of 20 healthy young and elderly Chinese individuals. Our quantitative proteomic analysis identified a total of 95 differentially expressed proteins (DEPs) in aged skin compared to young skin. Enrichment analyses of these DEPs (57 upregulated and 38 downregulated proteins) based on the GO, KEGG, and KOG databases revealed functional clusters associated with immunity and inflammation, oxidative stress, biosynthesis and metabolism, proteases, cell proliferation, cell differentiation, and apoptosis.
    [Show full text]
  • Lung Proteomic Biomarkers Associated with Chronic Obstructive Pulmonary Disease
    medRxiv preprint doi: https://doi.org/10.1101/2021.04.07.21255030; this version posted April 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Lung proteomic biomarkers associated with chronic obstructive pulmonary disease Yu-Hang Zhang1, Michael R. Hoopmann2, Peter J. Castaldi1, Kirsten A. Simonsen2, Mukul K. Midha2, Michael H. Cho1, Gerard J. Criner3, Raphael Bueno4, Jiangyuan Liu1, Robert L. Moritz2*, Edwin K. Silverman1* 1Channing Division of Network Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA 2Institute for Systems Biology, Seattle, WA, USA 3Temple University School of Medicine, Philadelphia, PA, USA 4Division of Thoracic Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA * These senior authors contributed equally to this work Corresponding Authors: Edwin K. Silverman, Email: [email protected] Robert L. Moritz, Email: [email protected] Keywords: chronic obstructive pulmonary disease, proteomics, biomarkers, mass spectrometry, machine learning NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2021.04.07.21255030; this version posted April 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. ABSTRACT Background: Identifying protein biomarkers for chronic obstructive pulmonary disease (COPD) has been challenging.
    [Show full text]
  • (ALOX15B) (NM 001039130) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214018 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ALOX15B Synonyms: 15-LOX-2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone – RC214018 ORF Nucleotide >RC214018 representing NM_001039130 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGTTCAGGGTCAGGGTGTCCACCGGAGAAGCCTTCGGGGCTGGCACATGGGACAAAGTGTCTG TCAGCATCGTGGGGACCCGGGGAGAGAGCCCCCCACTGCCCCTGGACAATCTCGGCAAGGAGTTCACTGC GGGCGCTGAGGAGGACTTCCAGGTGACGCTCCCGGAGGACGTAGGCCGAGTGCTGCTGCTGCGCGTGCAC AAGGCGCCCCCAGTGCTGCCCCTGCTGGGGCCCCTGGCCCCGGATGCCTGGTTCTGCCGCTGGTTCCAGC TGACACCGCCGCGGGGCGGCCACCTCCTCTTCCCCTGCTACCAGTGGCTGGAGGGGGCGGGGACCCTGGT GCTGCAGGAGGGTACAGCCAAGGTGTCCTGGGCAGACCACCACCCTGTGCTCCAGCAACAGCGCCAGGAG GAGCTTCAGGCCCGGCAGGAGATGTACCAGTGGAAGGCTTACAACCCAGGTTGGCCTCACTGCCTGGATG AAAAGACAGTGGAAGACTTGGAGCTCAATATCAAATACTCCACAGCCAAGAATGCCAACTTTTATCTACA
    [Show full text]