Redalyc.Primer Registro Para El Sur Del Perú De Rhynchoconger Nitens
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
CAT Vertebradosgt CDC CECON USAC 2019
Catálogo de Autoridades Taxonómicas de vertebrados de Guatemala CDC-CECON-USAC 2019 Centro de Datos para la Conservación (CDC) Centro de Estudios Conservacionistas (Cecon) Facultad de Ciencias Químicas y Farmacia Universidad de San Carlos de Guatemala Este documento fue elaborado por el Centro de Datos para la Conservación (CDC) del Centro de Estudios Conservacionistas (Cecon) de la Facultad de Ciencias Químicas y Farmacia de la Universidad de San Carlos de Guatemala. Guatemala, 2019 Textos y edición: Manolo J. García. Zoólogo CDC Primera edición, 2019 Centro de Estudios Conservacionistas (Cecon) de la Facultad de Ciencias Químicas y Farmacia de la Universidad de San Carlos de Guatemala ISBN: 978-9929-570-19-1 Cita sugerida: Centro de Estudios Conservacionistas [Cecon]. (2019). Catálogo de autoridades taxonómicas de vertebrados de Guatemala (Documento técnico). Guatemala: Centro de Datos para la Conservación [CDC], Centro de Estudios Conservacionistas [Cecon], Facultad de Ciencias Químicas y Farmacia, Universidad de San Carlos de Guatemala [Usac]. Índice 1. Presentación ............................................................................................ 4 2. Directrices generales para uso del CAT .............................................. 5 2.1 El grupo objetivo ..................................................................... 5 2.2 Categorías taxonómicas ......................................................... 5 2.3 Nombre de autoridades .......................................................... 5 2.4 Estatus taxonómico -
CHECKLIST and BIOGEOGRAPHY of FISHES from GUADALUPE ISLAND, WESTERN MEXICO Héctor Reyes-Bonilla, Arturo Ayala-Bocos, Luis E
ReyeS-BONIllA eT Al: CheCklIST AND BIOgeOgRAphy Of fISheS fROm gUADAlUpe ISlAND CalCOfI Rep., Vol. 51, 2010 CHECKLIST AND BIOGEOGRAPHY OF FISHES FROM GUADALUPE ISLAND, WESTERN MEXICO Héctor REyES-BONILLA, Arturo AyALA-BOCOS, LUIS E. Calderon-AGUILERA SAúL GONzáLEz-Romero, ISRAEL SáNCHEz-ALCántara Centro de Investigación Científica y de Educación Superior de Ensenada AND MARIANA Walther MENDOzA Carretera Tijuana - Ensenada # 3918, zona Playitas, C.P. 22860 Universidad Autónoma de Baja California Sur Ensenada, B.C., México Departamento de Biología Marina Tel: +52 646 1750500, ext. 25257; Fax: +52 646 Apartado postal 19-B, CP 23080 [email protected] La Paz, B.C.S., México. Tel: (612) 123-8800, ext. 4160; Fax: (612) 123-8819 NADIA C. Olivares-BAñUELOS [email protected] Reserva de la Biosfera Isla Guadalupe Comisión Nacional de áreas Naturales Protegidas yULIANA R. BEDOLLA-GUzMáN AND Avenida del Puerto 375, local 30 Arturo RAMíREz-VALDEz Fraccionamiento Playas de Ensenada, C.P. 22880 Universidad Autónoma de Baja California Ensenada, B.C., México Facultad de Ciencias Marinas, Instituto de Investigaciones Oceanológicas Universidad Autónoma de Baja California, Carr. Tijuana-Ensenada km. 107, Apartado postal 453, C.P. 22890 Ensenada, B.C., México ABSTRACT recognized the biological and ecological significance of Guadalupe Island, off Baja California, México, is Guadalupe Island, and declared it a Biosphere Reserve an important fishing area which also harbors high (SEMARNAT 2005). marine biodiversity. Based on field data, literature Guadalupe Island is isolated, far away from the main- reviews, and scientific collection records, we pres- land and has limited logistic facilities to conduct scien- ent a comprehensive checklist of the local fish fauna, tific studies. -
Efectos De La Pesca De Arrastre En El Golfo De California
ste libro y su contenido de 24 capítulos son un producto de Einvestigaciones originales, que aportan información sobre la pesca de arrastre de camarón en el Golfo de California desde varios puntos de vista. Efectos de la Pesca de Se ha prestado especial atención a la evaluación de algunas especies que Editores Arrastre en el Golfo son capturadas como pesca incidental, intentando obtener información biológica y poblacional que permita obtener conocimiento de su condición Juana López Martínez Juana de California actual. Este enfoque es un reto a nivel mundial, ya que al tratarse de pesca Bojórquez Enrique Morales incidental, los márgenes de incertidumbre son altos, es decir, los volúmenes capturados, las cantidades retornadas al mar que aun regresan con vida, dañadas o muertas no se conocen del todo. El libro contribuye así al difícil Editores: y pobremente entendido problema de la pesca de arrastre en el Golfo de Juana López Martínez California. Enrique Morales Bojórquez Características: • Compila el status mundial de arrastre de fondo. • Documenta el papel ecológico de las especies capturadas incidentalmente. • Provee información de la dinámica poblacional de varias especies. • Muestra información sobre estudios genéticos de especies capturadas incidentalmente. • Analiza la dispersión por sedimentos en la pesca de arrastre. • Analiza los sistemas de arrastre de fondo y sus tecnologías. • Propone en algunos casos formas de manejo pesquero de camarón. • Revisa el impacto de las áreas marinas protegidas. en el Golfo de California • Caracteriza la condición social y económica de la pesca de arrastre. • Incluye la opinión de la industria pesquera nacional. Efectos de la Pesca de Arrastre de Efectos de la Pesca Mar Bermejo # 195 Col. -
A Review of Congrid Eels of the Genus Ariosoma from Taiwan, With
Zoological Studies 37(1): 7-12 (1998) A Review of Congrid Eels of the Genus Ariosoma from Taiwan, with Description of a New Species Shih-Chieh Shen Department of Zoology, National Taiwan University, Taipei, Taiwan 106, R.O.C. Tel: 886-2-23630231 ext. 2353. Fax: 886-2-23636837. E-mail: [email protected] (Accepted September 10, 1997) Shih-Chieh Shen (1998) A review of congrid eels of the genus Ariosoma from Taiwan, with description of a new species. Zoological Studies 37(1): 7-12. Diagnosis, description, and figures are presented for the 4 Formosan species of Ariosoma which include A. anago (Temminck and Schlegel, 1842), A. anagoides (Bleeker, 1864), A. shiroanago major (Asano, 1958) and a new species A. nancyae. Ariosoma nancyae is distinctive in its combination of a stout body; 157 total vertebrae; 53 preanal lateral-line pores, and 95 pores behind anus to tail; upper end of gill opening at level of 1/4 upper end of pectoral-fin base; black spots on head, and black bands on body, tail, and fins. Key words: Fish taxonomy, Congridae, Fish fauna, New species, Taiwan. The congrid eel genus Ariosoma Swainson, gate; preanal length more than 40% of total; tip of 1838 is not a well-known group of fishes because tail blunt and stiff, caudal fin reduced; dorsal fin of its small size and unusual habitats. It is, how- insertion origin near level of pectoral fin base; pec- ever, one of the most abundant and diverse toral fin well developed; snout rounded, projecting congrid genera in the world. -
Redalyc.Peces De La Fauna De Acompañamiento En La Pesca
Revista de Biología Tropical ISSN: 0034-7744 [email protected] Universidad de Costa Rica Costa Rica López-Martínez, Juana; Herrera-Valdivia, Eloisa; Rodríguez-Romero, Jesús; Hernández-Vázquez, Sergio Peces de la fauna de acompañamiento en la pesca industrial de camarón en el Golfo de California, México Revista de Biología Tropical, vol. 58, núm. 3, septiembre, 2010, pp. 925-942 Universidad de Costa Rica San Pedro de Montes de Oca, Costa Rica Disponible en: http://www.redalyc.org/articulo.oa?id=44918839010 Cómo citar el artículo Número completo Sistema de Información Científica Más información del artículo Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto Peces de la fauna de acompañamiento en la pesca industrial de camarón en el Golfo de California, México Juana López-Martínez1, Eloisa Herrera-Valdivia1, Jesús Rodríguez-Romero2 & Sergio Hernández-Vázquez2 1. Centro de Investigaciones Biológicas del Noroeste, S.C. Km 2.35 Carretera a Las Tinajas, S/N Colonia Tinajas, Guaymas, Sonora, México C. P. 85460; [email protected], [email protected] 2. Centro de Investigaciones Biológicas del Noroeste, S.C. Apdo. postal 128 La Paz, B.C.S. C.P. 23000; [email protected], [email protected] Recibido 19-VII-2009. Corregido 15-III-2010. Aceptado 16-IV-2010. Abstract: Bycatch fish species from shrimp industrial fishery in the Gulf of California, Mexico. The shrimp fishery in the Gulf of California is one the most important activities of revenue and employment for communi- ties. -
A New Congrid Eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an Analysis of Its Relationships
Zootaxa 4845 (2): 191–210 ISSN 1175-5326 (print edition) https://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2020 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4845.2.2 http://zoobank.org/urn:lsid:zoobank.org:pub:B2DA6D79-874E-48C1-B054-FEC08546223C A new congrid eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an analysis of its relationships DAVID G. SMITH1*, EMMA S. KARMOVSKAYA2 & JOÃO PAULO CAPRETZ BATISTA DA SILVA3 1Smithsonian Institution, Museum Support Center, MRC-534, 4210 Silver Hill Road, Suitland, MD 20746 [email protected]; https://orcid.org/0000-0002-6354-2427 2Shirshov Institute of Oceanology, Russian Academy of Sciences, Moscow, 117218, Russia [email protected]; https://orcid.org/0000-0002-0636-4265 3Departamento de Sistemática e Ecologia, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, Castelo Branco, 58051-900, João Pessoa, PB, Brazil [email protected]; https://orcid.org/0000-0002-2373-3421 *Corresponding author Abstract A new species of congrid eel, Bathycongrus villosus sp. nov., is described from the Philippines and Vanuatu. It is similar to some of the small-toothed species currently placed in Bathycongrus and to the species of Bassanago. In this paper we compare the new species to Bassanago albescens (Barnard, 1923) and to Bathycongrus parviporus Karmovskaya, 2011, which it most closely resembles. An analysis of 19 characters shows that it agrees with Bat. parviporus in 16 characters and with Bas. albescens in one. In two characters, the three species are all different. We therefore place it in Bathycongrus. Key words: Taxonomy, Pisces, Bathycongrus, new species Introduction The species described here was discovered independently by two of the authors. -
Peces De La Fauna De Acompañamiento En La Pesca Industrial De Camarón En El Golfo De California, México
Peces de la fauna de acompañamiento en la pesca industrial de camarón en el Golfo de California, México Juana López-Martínez1, Eloisa Herrera-Valdivia1, Jesús Rodríguez-Romero2 & Sergio Hernández-Vázquez2 1. Centro de Investigaciones Biológicas del Noroeste, S.C. Km 2.35 Carretera a Las Tinajas, S/N Colonia Tinajas, Guaymas, Sonora, México C. P. 85460; [email protected], [email protected] 2. Centro de Investigaciones Biológicas del Noroeste, S.C. Apdo. postal 128 La Paz, B.C.S. C.P. 23000; [email protected], [email protected] Recibido 19-VII-2009. Corregido 15-III-2010. Aceptado 16-IV-2010. Abstract: Bycatch fish species from shrimp industrial fishery in the Gulf of California, Mexico. The shrimp fishery in the Gulf of California is one the most important activities of revenue and employment for communi- ties. Nevertheless, this fishery has also created a large bycatch problem, principally fish. To asses this issue, a group of observers were placed on board the industrial shrimp fleet and evaluated the Eastern side of the Gulf during 2004 and 2005. Studies consisted on 20kg samples of the capture for each trawl, and made possible a sys- tematic list of species for this geographic area. Fish represented 70% of the capture. A total of 51 101 fish were collected, belonging to two classes, 20 orders, 65 families, 127 genera, and 241 species. The order Perciformes was the most diverse with 31 families, 78 genera, and 158 species. The best represented families by number of species were: Sciaenidae (34) and Paralichthyidae (18) and Haemulidae and Carangidae (16 each). -
Congrid Eels of the Eastern Pacific and Key to Their Leptocephali
22 NOAA Technical Report NMFS 22 Congrid Eels of the Eastern Pacific and Key to Their Leptocephali Solomon N. Raju February 1985 u.S. DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration National Marine Fisheries Service NOAA TECHNICAL REPORTS NMFS The major responsibilities of the National Marine Fisheries Service (NMFS) are to monitor and assess the abundance and geographic distrihution of fishery resources, to understand and predict fluctuations in the quantity and distribution of these resources, and to establish levels for optimum use of the resources. NMFS is also charged with the development and implemen tation of policies for managing national fishing grounds, development and enforcement of domestic fisheries regulations, surveillance of foreign fishing off United States coastal waters, and the development and enforcement of international fishery agreements and policies. NMFS also assists the fishing industry through marketing service and economic analysis programs, and mortgage insurance and vessel construction subsidies. It collects. analyzes. and publishes statistics on various phases of the industry. The NOAA Technical Report NMFS series was established in 1983 to replace two subcategories of the Technical Reports series: "Special Scientific Report-Fisheries" and "Circular." The series contains the following types of reports: Scientific investigations thai document long-term continuing programs of NMFS, intensive scientific reports on studies of restricted scope, papers on applied fishery problems. technical reports of general jntere~t intended 10 aid conservation and management, reports that review in considerable detail and at a high technical level certain broad areas of research, and technical papers originating in economics studies and from management investigations. Copies of NOAA Technical Report NMFS are available free in limited numbers to governmental agencies, both Federal and State. -
Chec List Marine and Coastal Biodiversity of Oaxaca, Mexico
Check List 9(2): 329–390, 2013 © 2013 Check List and Authors Chec List ISSN 1809-127X (available at www.checklist.org.br) Journal of species lists and distribution ǡ PECIES * S ǤǦ ǡÀ ÀǦǡ Ǧ ǡ OF ×±×Ǧ±ǡ ÀǦǡ Ǧ ǡ ISTS María Torres-Huerta, Alberto Montoya-Márquez and Norma A. Barrientos-Luján L ǡ ǡǡǡǤͶǡͲͻͲʹǡǡ ǡ ȗ ǤǦǣ[email protected] ćĘęėĆĈęǣ ϐ Ǣ ǡǡ ϐǤǡ ǤǣͳȌ ǢʹȌ Ǥͳͻͺ ǯϐ ʹǡͳͷ ǡͳͷ ȋǡȌǤǡϐ ǡ Ǥǡϐ Ǣ ǡʹͶʹȋͳͳǤʹΨȌ ǡ groups (annelids, crustaceans and mollusks) represent about 44.0% (949 species) of all species recorded, while the ʹ ȋ͵ͷǤ͵ΨȌǤǡ not yet been recorded on the Oaxaca coast, including some platyhelminthes, rotifers, nematodes, oligochaetes, sipunculids, echiurans, tardigrades, pycnogonids, some crustaceans, brachiopods, chaetognaths, ascidians and cephalochordates. The ϐϐǢ Ǥ ēęėĔĉĚĈęĎĔē Madrigal and Andreu-Sánchez 2010; Jarquín-González The state of Oaxaca in southern Mexico (Figure 1) is and García-Madrigal 2010), mollusks (Rodríguez-Palacios known to harbor the highest continental faunistic and et al. 1988; Holguín-Quiñones and González-Pedraza ϐ ȋ Ǧ± et al. 1989; de León-Herrera 2000; Ramírez-González and ʹͲͲͶȌǤ Ǧ Barrientos-Luján 2007; Zamorano et al. 2008, 2010; Ríos- ǡ Jara et al. 2009; Reyes-Gómez et al. 2010), echinoderms (Benítez-Villalobos 2001; Zamorano et al. 2006; Benítez- ϐ Villalobos et alǤʹͲͲͺȌǡϐȋͳͻͻǢǦ Ǥ ǡ 1982; Tapia-García et alǤ ͳͻͻͷǢ ͳͻͻͺǢ Ǧ ϐ (cf. García-Mendoza et al. 2004). ǡ ǡ studies among taxonomic groups are not homogeneous: longer than others. Some of the main taxonomic groups ȋ ÀʹͲͲʹǢǦʹͲͲ͵ǢǦet al. -
Nagasaki University's Academic Output SITE
NAOSITE: Nagasaki University's Academic Output SITE Record body size of the beach conger Conger japonicus (Anguilliformes: Title Congridae) in the East China Sea Yagi, Mitsuharu; Shimoda, Masako; Uchida, Jun; Shimizu, Kenichi; Author(s) Aoshima, Takashi; Kanehara, Hisao Citation Marine Biodiversity Records, 6, e110; 2013 Issue Date 2013-10-11 URL http://hdl.handle.net/10069/33898 Right © Marine Biological Association of the United Kingdom 2013 This document is downloaded at: 2017-12-22T05:20:34Z http://naosite.lb.nagasaki-u.ac.jp Marine Biodiversity Records, page 1 of 5. # Marine Biological Association of the United Kingdom, 2013 doi:10.1017/S1755267213000882; Vol. 6; e110; 2013 Published online Record body size of the beach conger Conger japonicus (Anguilliformes: Congridae) in the East China Sea mitsuharu yagi, masako shimoda, jun uchida, kenichi shimizu, takashi aoshima and hisao kanehara Faculty of Fisheries, Nagasaki University, 1-14 Bunkyo, Nagasaki 852-8521, Japan A record body size, length of 1520 mm and weight of 12,600 g for the beach conger, Conger japonicus was recorded, which is approximately 120 mm and 2600 g larger than the previous international record. The specimen was female and obtained during an otter trawl survey on 4 April 2013 in the East China Sea (31852.16′N 127842.94′E) at a depth of approximately 140 m on the slope of the continental shelf. Morphometric measurements and meristic counts are reported in this paper. We also report profiles of water temperature, salinity, dissolved oxygen and chlorophyll-a taken immediately prior to the trawl, and species composition of concurrent catch with the otter trawling as environmental and biological characteristics of the habitat. -
61661147.Pdf
Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska–Yukon Border OCS Study MMS 2005-030 and USGS/NBII 2005-001 Project Cooperation This research addressed an information need identified Milton S. Love by the USGS Western Fisheries Research Center and the Marine Science Institute University of California, Santa Barbara to the Department University of California of the Interior’s Minerals Management Service, Pacific Santa Barbara, CA 93106 OCS Region, Camarillo, California. The resource inventory [email protected] information was further supported by the USGS’s National www.id.ucsb.edu/lovelab Biological Information Infrastructure as part of its ongoing aquatic GAP project in Puget Sound, Washington. Catherine W. Mecklenburg T. Anthony Mecklenburg Report Availability Pt. Stephens Research Available for viewing and in PDF at: P. O. Box 210307 http://wfrc.usgs.gov Auke Bay, AK 99821 http://far.nbii.gov [email protected] http://www.id.ucsb.edu/lovelab Lyman K. Thorsteinson Printed copies available from: Western Fisheries Research Center Milton Love U. S. Geological Survey Marine Science Institute 6505 NE 65th St. University of California, Santa Barbara Seattle, WA 98115 Santa Barbara, CA 93106 [email protected] (805) 893-2935 June 2005 Lyman Thorsteinson Western Fisheries Research Center Much of the research was performed under a coopera- U. S. Geological Survey tive agreement between the USGS’s Western Fisheries -
FIS-P7 Kei Nakaya
Seasonal occurrence pattern of leptocephali in the north Satsunan area, southern Japan FIS-P-14042 Gen Kume1, Satoru Jinno1, Toru Kobari1, Kazuhiro Shiozaki2, Atsushi Narumi1, Shuya Ito1, Kei Nakaya1, Mutsuo Ichinomiya3 and Tomohiro Komorita3 1 Aquatic Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. Email: [email protected] 2 Food and Life Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. 3 Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, Kumamoto, Japan. Introduction nMany leptocephali are found in the Satsunan area, southern Japan throughout the year. nThey may include important fishery-targeting species. (e.g. Anguilla spp., Conger spp., Muraenesox spp.) nThe purpose is to clarify the seasonal and spatial occurrence pattern of leptocephali in the north Satsunan area in relation to the Kuroshio. Materials and methods n Field surveys • Field surveys were condected from February in 2015 to August in 2018 by RV Nansei-maru and in November in 2015 and November in 2017 by RV Kagoshima-maru. • Study stations were fixed 15 stations in the inshore of Kuroshio path, 2 stations in Kuroshio path and 2 stations in the offshore of Kuroshio path. A. .Inshore of Kuroshio path • Specimens were collected by the ORI net (diameter, 160 cm; mesh size, 335 µm) which was obliquely towed from the bottom (ca. 10 m above the depth) to the surface at approximately 2 knots for 30 min. • Specimens were preserved in 99.5 % ethanol. B. Kuroshio path n Analyses Kuroshio • Species identification by morphological and genetic methods (16SrRNA)* and morphological measurements *16Sar-L (CGCCTGTTTATCAAAAACAT), 16Sbr-H (GGTCTGAACTCAGATCACGT) (Kurogi et al.