Discovery of small-molecule inhibitors of multidrug-resistance plasmid maintenance using a high-throughput screening approach
Katelyn E. Zulaufa,b and James E. Kirbya,b,1
aDepartment of Pathology, Beth Israel Deaconess Medical Center, Boston, MA 02215; and bHarvard Medical School, Boston, MA 02215
Edited by Ralph R. Isberg, Tufts University School of Medicine, Boston, MA, and approved October 12, 2020 (received for review March 30, 2020) Carbapenem-resistant Enterobacteriaceae (CRE) are multidrug- DNA, cause DNA strand breakage, affect supercoiling, inhibit resistant pathogens for which new treatments are desperately conjugation, or cause plasmid-dependent fitness defects (5). needed. Carbapenemases and other types of antibiotic resistance Almost all, where investigated, acted nonspecifically and were genes are carried almost exclusively on large, low-copy-number highly toxic to the host bacterial cell, for example chemothera- plasmids (pCRE). Accordingly, small molecules that efficiently evict peutic intercalators. Of interest, however, DeNap et al. (6) and pCRE plasmids should restore much-needed treatment options. We Thomas et al. (7) identified several positively charged amino- therefore designed a high-throughput screen to identify such com- glycosides that affected the RNA-regulated plasmid replication pounds. A synthetic plasmid was constructed containing the plas- machinery of the IncB incompatibility group plasmid, pMU2403. mid replication machinery from a representative Escherichia coli These findings supported the possibility of identifying anti- CRE isolate as well as a fluorescent reporter gene to easily monitor plasmid agents with greater mechanistic specificity. plasmid maintenance. The synthetic plasmid was then introduced As pCRE plasmids encode carbapenemase genes, we hypoth- into an E. coli K12 tolC host. We used this screening strain to test a esized that interference with plasmid maintenance would restore library of over 12,000 known bioactive agents for molecules that carbapenem susceptibility and offer new therapeutic options. We selectively reduce plasmid levels relative to effects on bacterial therefore designed a high-throughput screening approach to iden- growth. From 366 screen hits we further validated the antiplasmid tify antiplasmid agents that did not presuppose a particular mech- activity of kasugamycin, an aminoglycoside; CGS 15943, a nucleo- anism of action. For proof of principle, we screened known MICROBIOLOGY side analog; and Ro 90-7501, a bibenzimidazole. All three com- bioactive compounds that might more quickly advance our under- pounds exhibited significant antiplasmid activity including up to standing of antiplasmid mechanisms and would be available in complete suppression of plasmid replication and/or plasmid evic- sufficient quantities for follow-up studies. To do so, we constructed tion in multiple orthogonal readouts and potentiated activity of a synthetic screening plasmid (pScreening) containing the IncFIA the carbapenem, meropenem, against a strain carrying the large, pCRE plasmid from which we constructed the synthetic screening Significance plasmid. Additionally, we found kasugamycin and CGS 15943 blocked plasmid replication, respectively, by inhibiting expression or function of the plasmid replication initiation protein, RepE. In summary, we Carbapenem-resistant Enterobacteriaceae (CRE) are multidrug- validated our approach to identify compounds that alter plasmid resistant bacterial pathogens designated as urgent threats by maintenance, confer resensitization to antimicrobials, and have spe- the US Centers for Disease Control and Prevention. Resistance to cific mechanisms of action. carbapenems and other antibiotics is usually carried on diverse large, low-copy-number plasmids. Interfering with the replica- plasmid | multidrug resistance | carbapenem-resistant Enterobacteriaceae | tion of such resistance plasmids could potentially restore anti- antimicrobial | high-throughput screening biotic susceptibility. Therefore, we designed a high-throughput screen to identify compounds with anti-CRE plasmid activity. We identified several compounds which by blocking plasmid repli- he US Centers for Disease Control and Prevention lists cation and/or evicting a representative IncFIA CRE plasmid po- Tcarbapenem-resistant Enterobacteriaceae (CRE) in its most tentiated carbapenem activity, thereby providing proof of urgent antimicrobial resistant threat category (1). CRE strains β principle for our approach. Our findings underscore the potential are resistant to carbapenems, a class of last-resort -lactam an- of antiplasmid therapeutics to restore treatment options for tibiotics. CRE strains are also largely resistant to multiple other highly drug-resistant pathogens and validate a high-throughput classes of antibiotics as well. As a result, CRE infections are screening approach to identify these agents. often incredibly difficult, if not impossible, to treat. Carbapenemase and other antibiotic resistance genes are Author contributions: K.E.Z. and J.E.K. designed research; K.E.Z. performed research; typically carried on diverse, large, low-copy-number plasmids (2, K.E.Z. and J.E.K. analyzed data; and K.E.Z. and J.E.K. wrote the paper. 3). CRE resistance plasmids (pCRE) are maintained at only 1 to This article is a PNAS Direct Submission. 10 copies per cell and can be as large as 300 kilobases (kb) in Competing interest statement: The authors declare a competing interest (as defined by size. These large, low-copy-number plasmids utilize a combination PNAS policy). This work was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under award number R33AI119114 to J.E.K. of precise replication machinery and maintenance strategies to K.E.Z. was supported in part by a National Institute of Allergy and Infectious Diseases ensure their persistence, including specific plasmid replication training grant (T32AI007061). The content is solely the responsibility of the authors and genes, partitioning mechanisms that segregate plasmids to progeny does not necessarily represent the official views of the National Institutes of Health. The HP D300 digital dispenser and TECAN M1000 were provided for our use by TECAN (Morris- bacteria, resolvases to disentangle plasmid multimers, conjugation ville, NC). Tecan had no role in study design, data collection/interpretation, manuscript systems, and plasmid addiction systems (4). Plasmid addiction preparation, or decision to publish. systems encode a stable toxin and unstable antidote. Bacterial host Published under the PNAS license. cells that lose their plasmids can no longer make antidote and are 1To whom correspondence may be addressed. Email: [email protected]. thus killed by the persisting toxin. This article contains supporting information online at https://www.pnas.org/lookup/suppl/ Previously, a limited number of compounds with antiplasmid doi:10.1073/pnas.2005948117/-/DCSupplemental. activity were identified. They were found to intercalate into First published November 9, 2020.
www.pnas.org/cgi/doi/10.1073/pnas.2005948117 PNAS | November 24, 2020 | vol. 117 | no. 47 | 29839–29850 Downloaded by guest on September 26, 2021 replication and maintenance machinery from a representative pCRE drugs, and a variety of compounds with at least partially known plasmid as well as a fluorescent reporter that would allow us to easily biological effects including active biolipids, kinase inhibitors, ion monitor plasmid loss upon exposure to small-molecule inhibitors. channel inhibitors, and G protein-coupled receptor inhibitors. Here, we describe the results of a screen of over 12,000 known- To distinguish between compounds that affect plasmid main- bioactive compounds for antiplasmid activity in which we identify tenance directly rather than indirectly through inhibiting growth several potent antiplasmid small molecules. We further characterize of the host cell, we imposed two constraints in selecting positive their activity and find support for the predicted ability to restore screening hits: 1) the RFU must be reduced greater than two antibiotic susceptibility to CRE strains. times more than any reduction in the A600 in both replicate plates and 2) screening hits must not be overtly antibacterial, that Results and Discussion is, the A600 was not reduced by more than 80% compared to the High-Throughput Screening Assay to Identify Antiplasmid Agents. To median of all treatment wells in both replicate plates. Using identify prospective anti-pCRE agents, we designed a high- these criteria, we identified 366 compounds with antiplasmid throughput screening approach to identify small molecules that activity (Dataset S1) and 1,205 compounds with antibacterial disrupt bacterial plasmid maintenance. Our screening strategy activity (Dataset S2). The latter was not unexpected as the made use of a synthetic screening plasmid (pScreening) that known bioactive collection contains over 250 known antimicro- contains the maintenance, replication, and resolvase machinery of a bials, which are often represented several times in the libraries carbapenemase-encoding plasmid from a representative Escherichia (23, 24). coli CRE isolate, BIDMC20a (8). The CRE plasmid in BIDMC20a belongs to the IncF incompatibility group, a leading incompatibility Validation of Antiplasmid Activity. We chose to characterize three group associated with multidrug resistance (9–12). Specifically, we antiplasmid compounds based on potency and known activities: chose the IncFIA replicon present on pCRE BIDMC20a as the kasugamycin (Fig. 1C), CGS 15943 (Fig. 1D), and Ro 90-7501 target of the screen (9–12). IncFIA replicons have high sequence (Fig. 1E). Kasugamycin is an aminoglycoside antibiotic. Previ- conservation and are present on a wide array of diverse plasmids ously, apramycin, another aminoglycoside, was found to block (13). The genetic material incorporated from pCRE BIDMC20a replication of an IncB incompatibility-group plasmid leading to encoded the origin of replication, the RepE replication initiation plasmid curing, although the ability to potentiate antimicrobial protein, the IncC incompatibility region, the ResV resolvase, and effects was not specifically examined (6). CGS 15943 is an the SopABC plasmid partitioning system (Fig. 1A). Importantly, we adenosine nucleoside analog and adenosine receptor antagonist elected to exclude the plasmid addiction system, CcdAB, as we with pharmacological effects in mammals similar to caffeine (25, predicted that its presence would hinder our ability to distinguish 26). Ro 90-7501 has several previously identified mammalian cell between antiplasmid and antibacterial effects. The synthetic plasmid activities: activating immune pattern recognition receptor sig- reduced the pCRE BIDMC20a plasmid size from 140 kb to 8 kb, naling, inhibiting protein phosphatase 5, and interfering with focused our screen on plasmid maintenance mechanisms conserved amyloid β42 fibril assembly (27–29). CGS 15943 and Ro 90-7501 in many CRE plasmids, and in the future will enable testing ma- (Fig. 1 D and E and Dataset S1) were notable for their especially chinery of other incompatibility groups through simple substitution. potent antiplasmid activity. We chose not to pursue further Finally, to monitor plasmid abundance in bacterial cells we analysis of antiplasmid compounds that were known DNA also incorporated an mNeptune2 fluorescence reporter gene intercalator chemotherapeutics due to their toxicity profiles. (14). The mNeptune2 gene was driven by the constitutive, in- As a first step in hit confirmation, we performed a dose– sulated proD promoter (15) and was linked to a nourseothricin response assessment with the same readouts as the primary selectable marker as previously described (16). Importantly, al- screen: RFU and A600 (Fig. 2). CGS 15943 and Ro 90-7501 re- though we drastically reduced the size of our synthetic construct duced fluorescence in a dose-dependent manner but had no ef- by over 10-fold compared with the parent plasmid, pCRE fect on bacterial growth, confirming highly selective antiplasmid BIDMC20a, the synthetic plasmid was maintained at comparable activity (Fig. 2 B and C). Although kasugamycin had antibacte- levels based on qPCR analysis (Fig. 1B), suggesting appropriate rial properties at higher concentrations, it was nevertheless rel- function of plasmid maintenance mechanisms. atively selective for antiplasmid activity (Fig. 2A). For high-throughput screening purposes, pScreening was in- As an orthogonal confirmation of antiplasmid activity, we di- troduced into an E. coli K-12 tolC mutant. We reasoned that rectly quantified pScreening plasmid levels using real-time inactivating major classes of TolC-dependent efflux pumps qPCR. To control for antibacterial effects, data were normal- would allow small molecules to more easily access the bacterial ized to qPCR quantification of the chromosomal metabolic gene, cytoplasm and thereby increase sensitivity of the screening assay dxs, in order to determine plasmid level relative to genomic (17, 18). Medicinal chemistry approaches could then later be content (30). By qPCR, all compounds significantly reduced used to develop analogs with more favorable gram-negative pScreening levels in a dose-dependent manner (Fig. 3). Notably, membrane penetration characteristics (19, 20). after treatment with either CGS 15943 or Ro 90-7501, complete To perform the high-throughput screen, the screening strain clearance of pScreening was observed within the assay detection was inoculated into white, clear-bottomed, 384-well plates at a limit (Fig. 3 B and C). low inoculum. Compounds were robotically transferred to indi- As an additional quantitative measure of antiplasmid activity, vidual test wells. Testing of each compound was performed in we plated serial dilutions of treated bacteria on media with and duplicate on separate screening plates to reduce the false dis- without nourseothricin. Since pScreening expresses a nourseo- covery rate (21). Subsequent incubation at 37 °C allowed ∼12 thricin resistance marker, bacterial colonies should only form if generations of bacterial growth and concomitant replication of host cells retain the pScreening plasmid. Using this approach, we pScreening. After incubation, the screening wells were assayed for found that kasugamycin reduced plasmid levels by about 90% both mNeptune2 fluorescence (relative fluorescence units, RFU) (Fig. 4). In contrast, CGS 15943 and Ro 90-7501 were consid- to monitor plasmid levels and for absorbance at 600 nm (A600)to erably more effective. Plasmid levels were reduced over 99.9% monitor bacterial growth. Z′ for both measurements routinely after treatment with 20 μg/mL of CGS 15943 (Fig. 4). The ab- exceeded 0.7, supporting robust assay performance (22). We solute level of plasmid after the 24-h incubation was similar to screened a library of 12,301 compounds from the known bioactive the plasmid level in the starting inoculum, indicating that CGS collection at the ICCB-Longwood Screening Facility (Harvard 15943 completely halted plasmid replication and/or passage of Medical School, Boston, MA). Compounds in this collection in- the plasmids to daughter cells. When bacteria were treated with clude United States Food and Drug Administration–approved Ro 90-7501 at concentrations greater than 10 μg/mL, plasmid
29840 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021 A B 2.4 n.s.
1.8
1.2
pScreening 0.6
Plasmid copy number 0.0
pScreening
pCRE BIDMC20a
CEO D Cl NN O N N N N OO N N N O O N N O N N
N O O O
Fig. 1. High-throughput screen identified antiplasmid compounds. (A) Genetic content of 8.1-kb high-throughput screening plasmid (pScreening) includes ori2, origin of replication; repE, encoding replication initiation protein; IncC, incompatibility region; sopABC, partioning system; and resV, resolvase, cloned MICROBIOLOGY from a carbapenemase-encoding plasmid (pCRE BIDMC20a) from a representative CRE strain. In addition, pScreening also encodes a mNeptune2 fluorescent reporter under control of the constitutive proD promoter, which allows real-time monitoring of plasmid levels, and natR, a selectable marker conferring nourseothricin resistance. (B) Plasmid levels of pCRE BIDMC20a and pScreening were comparable by qPCR. Data were normalized to the chromosomal gene dxs and plotted relative to chromosome number. P = 0.82 by Student’s t test. Structures of selected screening hits: (C)kasugamycin,(D) CGS 15943, and (E) Ro 90-7501.
levels were reduced over 99.99%. The number of bacteria Ro 90-7501 Has Antiplasmid Activity Distinct from Other DNA Intercalators. retaining plasmid was well below the number of bacteria in the As some DNA intercalators are known to cure plasmids (5), we next starting inoculum, to the extent that very few, if any, bacteria tested the ability of the compounds to intercalate into DNA. To do retained plasmid (Fig. 4). This result suggested Ro 90-7501 must so, we employed a previously described acridine orange intercalator go beyond simply interfering with plasmid replication or parti- displacement assay (31). Acridine orange fluoresces strongly when tioning and also cause eviction or destruction of remaining bound to DNA. If a compound has DNA intercalating activity, it will plasmid DNA. displace acridine orange resultinginareducedacridineorange As a tolC mutant was utilized in the initial high-throughput fluorescent signal. We found that Ro 90-7501 reduced acridine or- screen and confirmatory assays to increase compound perme- ange fluorescence in this assay to a greater extent than mitoxantrone, ability, we tested the effect of the screening hits in wild-type a known intercalator control (32), suggesting that Ro 90-7501 is also a E. coli K-12. Kasugamycin demonstrated antiplasmid activity, DNA intercalator (Fig. 5A). The absence of acridine orange dis- as indicated by RFU reduction, although activity was less pro- placement for other compounds suggested that DNA intercalation nounced than in the tolC background (SI Appendix, Fig. S1 A and does not account for their antiplasmid effects. B). In contrast, CGS 15943 and Ro 90-7501 showed no anti- As Ro 90-7501 treatment resulted in almost complete plasmid plasmid activity, suggesting that these compounds are not able to eviction (Figs. 2–4), we examined whether such extreme anti- efficiently penetrate the gram-negative outer membrane barrier plasmid activity is a common feature of other DNA intercalators. (SI Appendix, Fig. S1 D and F). We compared the antiplasmid activity of Ro 90-7501 to a panel
A B C 120% 120% 120% A600 100% RFU 100% 100% 80% 80% 80% 60% 60% 60% 40% 40% 40% 20% 20% 20% 0 0 0 0 20406080100 036912 0255075 Kasugamycin (ug/ml) CGS 15943 (ug/ml) Ro 90-7501 (ug/ml)
Fig. 2. Dose–response and selectivity of screening hits. Primary high-throughput screening hits were tested for antiplasmid and antibacterial activity against
the screening strain in dose–response experiments. After a 24-h treatment, A600 (absorbance to monitor bacterial growth, demarcated with a red line) and RFU (mNeptune2 fluorescence, a marker for plasmid abundance, demarcated with a blue line) were determined. Data were normalized to no treatment controls. (A) Kasugamycin, (B) CGS 15943, and (C) Ro 90-7501.
Zulauf and Kirby PNAS | November 24, 2020 | vol. 117 | no. 47 | 29841 Downloaded by guest on September 26, 2021 ABC 100% 100% 100%
80% 80% 80%
60% 60% 60%
40% 40% 40%
20% 20% 20%
0 0 0 0 1020304050 0 5 10 15 20 0 5 10 15 20 Kasugamycin (ug/ml) CGS 15943 (ug/ml) Ro 90-7501 (ug/ml)
Fig. 3. Screening hits quantitatively reduced plasmid level by orthogonal qPCR assay. DNA was isolated from bacteria treated with doubling dilutions of (A) kasugamycin, (B) CGS 15943, and (C) Ro 90-7501. Plasmid level, normalized to the single copy chromosomal gene, dxs, was determined by qPCR. Data are plotted as a percentage of plasmid level in no treatment controls.
of known antiplasmid DNA intercalators including ethidium not clear but may relate to preferred DNA binding under bromide, acridine orange, and 9-aminoacridine. Based on RFU supercoiling torsion. Interestingly, Ro 90-7501 was previously values, all comparators produced a dose-dependent reduction in shown to inhibit λ phage propagation (33). This activity may be plasmid levels (Fig. 5B). However, all also showed significant partially explained by observations of Ro 90-7501 treatment antibacterial effects at concentrations ranging from 5 μg/mL to leading to forced genome ejection from λ phage particles, leaving 80 μg/mL (Fig. 5C), that is, in the same concentration range as empty phage heads (34). Although the genome ejection mech- their antiplasmid effects. In contrast, Ro 90-7501 demonstrated anism is not understood, this forced ejection is reminiscent of Ro only minimal antibacterial effects at 80 μg/mL, substantially 90-7501’s ability to evict pScreening plasmid from E. coli. above the 20 to 40 μg/mL associated with maximal plasmid Ro 90-7501 was also previously found to have no toxic effects eviction, indicating a considerably higher antiplasmid selectivity. on mammalian cells at over 700 μg/mL (28), a concentration that We then quantified plasmid abundance after intercalator is over 30 times higher than the concentration where Ro 90-7501 treatment by qPCR and by plating on nourseothricin-selective exerts maximal antiplasmid effect. Therefore, although our ini- media as described above (Fig. 5 D and E). Although ethidium tial supposition was that all types of intercalators should a priori bromide, acridine orange, and 9-aminoacride all demonstrated be excluded as antiplasmid therapeutic candidates, it is possible antiplasmid activity by these measures, these intercalators were that some of these compounds may still have compelling, selec- not so effective as Ro 90-7501 (Fig. 5 D and E) and did not tive properties. Precedent for this can be found in commonly reduce plasmid levels below quantities present in the starting used, well-tolerated, nonchemotherapeutic intercalators such as inoculum. These data indicate that Ro-90-7501 is unique among riboflavin (35). DNA intercalators examined in both potency and selectivity. One potential explanation for the unique antiplasmid activity Identification and Characterization of CGS 15943-Resistant Mutation. is that Ro 90-7501 intercalates more selectively into plasmid Since CGS 15943 was potent, selective, and lacking potentially DNA than other intercalators. To investigate this hypothesis, we undesirable DNA intercalation activity, we sought to identify its performed an acridine orange displacement assay using either mechanism of action. To do so, we passaged the screening strain pScreening plasmid DNA or E. coli tolC genomic DNA as an in 10 μg/mL CGS 15943 while simultaneously selecting for intercalation substrate. We found that Ro 90-7501 was signifi- maintenance of pScreening with nourseothricin. After four se- cantly more effective at displacing acridine orange from plasmid quential passages we isolated a single clone (CGSR) resistant to DNA than genomic DNA in contrast to ethidium bromide, antiplasmid effects of 20 μg/mL CGS 15943, the highest con- whose ability to displace acridine orange from plasmid and ge- centration tested (see Fig. 7A). In contrast, CGSR remained nomic DNA was indistinguishable (Fig. 5 F and G). Potential completely susceptible to antiplasmid effects of both Ro 90-7501 reasons for the selectivity of Ro 90-7501 for plasmid DNA are and kasugamycin (Fig. 6 B and C).
Fig. 4. Compounds reduced plasmid level as determined by colony-forming unit enumeration. The screening strain was treated with doubling dilutions of kasugamycin, CGS 15943, and Ro 90-7501. After 24 h of treatment, bacteria were serially diluted and plated on media with or without nourseothricin. The pScreening plasmid encodes nourseothricin resistance. Therefore, the ratio of colony-forming unit counts with and without nourseothricin selection indicates the percentage of bacteria still retaining plasmid. The horizontal black line corresponds to the plasmid content in the initial bacteria inoculum prior to in- cubation. Therefore, reduction of plasmid to this level during compound treatment suggests complete block of plasmid replication, and reduction below this level suggests additional eviction of plasmid.
29842 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021 A B 6000 140% 120% 4000 100% 80% RFU 60% 2000 40% 20% Orange RFU 0 0 Percent Acridine 0 40 80 120 160 200 0 5 10 15 20 ug/ml Compound ug/ml Kasugamycin Ro 90-7501 Ro 90-7501 EtBr CGS 15943 Mitoxatrone Acridine Orange 9-aminoacridine C D 100% 0.25
0.20 10% 0.15 600
A 0.10 1% 0.05
0.00 % plasmid (qPCR) 0.1% 0 20406080 0 4 8 12 16 20
ug/ml ug/ml MICROBIOLOGY Ro 90-7501 Ro 90-7501 EtBr EtBr Acridine Orange Acridine Orange 9-aminoacridine 9-aminoacridine
E 100
10
1
0.1
0.01 Percent Plasmid Retention (CFU) 0.001
5ug/ml 5ug/ml 5ug/ml 5ug/ml 0.6ug/ml2.5ug/ml 10ug/ml 20ug/ml2.5ug/ml 2.5ug/ml 10ug/ml 20ug/ml40ug/ml80ug/ml 10ug/ml 20ug/ml 0.15ug/ml0.3 ug/ml No treatment Ro 90-7501 EtBr Acridine Orange 9-AA F G 100% tolC Genomic DNA 100% pScreening DNA pScreening DNA tolC Genomic DNA 80% 80%
60% *** 60% *** *** *** 40% 40% Orange RFU Orange RFU 20% 20% Percent Acridine Percent Acridine 0 0 0 50 100 150 200 0 50 100 150 200 Ro 90-7501 (ug/ml) EtBr (ug/ml)
Fig. 5. Ro 90-7501 is a DNA intercalator with unique activity. (A) Acridine orange displacement assay. The DNA intercalator acridine orange was added to wells containing DNA and doubling dilutions of compounds were subsequently added. After incubation, the RFU of acridine orange bound to DNA was determined. Data points are normalized to negative controls. (B–D) Comparison of activity of Ro 90-7501 and known DNA intercalators on pScreening. After
24 h, the (B) RFU, (C)A600, and (D) percentage plasmid retention by qPCR were determined as described earlier. (E) After 24 h of treatment with intercalators, screening strain cultures were plated on media with and without nourseothricin as described in Fig. 4 to quantify percent plasmid retention. (F and G) The DNA intercalator acridine orange was added to wells containing either pScreening DNA or tolC genomic DNA and doubling dilutions of (F) Ro 90-7501 or (G) EtBr as indicated. After incubation, the RFU of acridine orange bound to DNA was determined. Data points are normalized to negative controls. ***P < 0.0001.
Zulauf and Kirby PNAS | November 24, 2020 | vol. 117 | no. 47 | 29843 Downloaded by guest on September 26, 2021 To test whether the resistance mutation was localized to pScre- using site-directed mutagenesis (pScreening-7xT) and again ob- ening or the chromosome, we isolated the pScreening plasmid served complete resistance to CGS 15943 (Fig. 6A). (pCGSR)fromCGSR and transferred it into a drug-naive tolC Fortuitously, the pScreening plasmid replicon is essentially strain. In parallel, we cured the pCGSR from the resistant isolate identical to that of the F plasmid, which was used as a tool in using Ro 90-7501 treatment and transformed a copy of drug-naive early genetic mapping of E. coli and therefore has been well pScreening plasmid into this host strain background. Only the studied (36). From this earlier investigation we know that RepE former strain containing pCGSR was resistant to CGS 15943, indi- is a critical regulator of plasmid copy number. RepE binds to cating that the resistance phenotype tracks with the pCGSR plasmid iteron repeats in the origin of replication where it cooperates (Fig. 6A). with DnaA to melt the origin and initiate plasmid replication. Therefore, in order to identify the resistance mutation, we The sequence of the repE promoter region and the −35/−10 sequenced pCGSR. The only mutation present was a single base spacing of exactly 16 base pairs is highly conserved across very di- pair insertion in the promoter of the plasmid replication gene, verse IncFIA plasmids (by BLAST analysis), in contrast to the repE (Fig. 6D). This insertion was located between the −35 generally predominant 17-base pair spacing in E. coli promoters (37). and −10 promoter elements, increasing the length of an existing Therefore, we next investigated whether it was the specific mutation thymidine nucleotide repeat from six to seven thymidine residues in the promoter of repE or the increased spacing between −35 (Fig. 6D). To confirm that this single base alteration was re- and −10 elements that was responsible for CGS 15943 resistance. sponsible for resistance, we recreated this mutation in pScreening We created two additional mutations in the repE promoter: one with
A B C
100% 100% 100% 80% 80% 80% 60% 60% 60% 40% 40% 40% 20% 20% 20% 0 0 0 0 5 10 15 20 0 5 10 15 20 0 1020304050 CGS 15943 (ug/ml) Ro 90-7501 (ug/ml) Kasugamycin (ug/ml) tolC+pScreening tolC+pScreening tolC+pScreening R CGSR CGSR CGS R R tolC+pCGS tolC+pCGSR tolC+pCGS R R CGS +pScreening CGSR +pScreening CGS +pScreening pScreening-7xT pScreening-7xT pScreening-7xT
D E 100% 80% CCT ori2 repE 60% 40% 20% 0 05101520 CGS 15943 (ug/ml) pScreening pScreening-7xT pScreening -35 C pScreening -10 C FGH 8 100% 2.0 6 80% 1.5 60% mRNA mRNA 4 1.0 40% 2
Normalized 0.5 20% repE Plasmid level 0 0 0.0 0 1020304050 R R relative to pScreening
Kasugamycin (ug/ml) CGS CGS
pScreening pScreening pScreening pScreening-7xT pScreening- 7xT pScreeningpScreening -35 C -10 C pScreening-pScreeningpScreening 7xT -35 C -10 C pScreening -35 C pScreening -10 C
Fig. 6. Characterization of CGS 15943-resistant mutant. The original screening strain (pScreening), the CGS 15943 resistant mutant (designated CGSR), a treatment-naive tolC strain transformed with the CGS 15943 resistant plasmid (designated tolC+pCGSR), CGSR cured of its plasmid and transformed with a pScreening plasmid unexposed to CGS 15943 (designated CGSR + pScreening), and a tolC strain transformed with a pScreening engineered to contain an insertion of an additional thymidine (7xT) in its promoter region identical to the mutation observed in pCGSR (designated pScreening + 7xT) were treated with doubling dilutions of (A) CGS 15943, (B) Ro 90-7501, and (C) kasugamycin. Plasmid levels were determined, normalized to the single-copy chromosomal dxs gene, by qPCR and are expressed as a percentage of untreated controls. (D) The CGS 15943 resistance mutation was identified as an insertion of an extra thymidine in the poly-T tract (6xT -> 7xT) located between the predicted −35 and −10 regions of the repE promoter in pScreening, notated in red text in the figure. Through site-direct mutagenesis, a cytosine was also inserted at either end of the 6 poly-thymidine repeat as indicated. Then the effect of (E) CGS 15943 and (F) kasugamycin on levels of plasmid with these insertions compared with unmutated pScreening was determined by qPCR, normalized to the chromosomal dxs gene, and expressed as a percentage of plasmid level in untreated controls. (G) repE mRNA was quantified by qPCR after RNA isolation from bacterial cultures and reverse transcription. Values were normalized to the housekeeping gene dxs and expressed relative to levels of pScreening control strain. (H) Relative plasmid levels were quantified by qPCR normalized to chromosomal dxs and plotted relative to pScreening levels.
29844 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021 a cytosine inserted on the −35 side of the stretch of six thymidines When repE54 was substituted for repE in pScreening, we observed and one with a cytosine inserted on the −10 side (Fig. 6D). Both a ∼1,000-fold reduction in CGS 15943 antiplasmid effects by conferred complete resistance to CGS 15943 (Fig. 6E), suggesting qPCR; however, it is noteworthy that complete resistance to CGS that increased promoter spacing was responsible for resistance. As 15943 comparable to the 7xT mutation was not conferred expected, neither mutation affected the antiplasmid activity of (Fig. 7C). These results suggest that CGS 15943 may not be acting kasugamycin (Fig. 6F). In summary, it appears that expansion of the solely through shifting equilibrium of RepE to the dimeric form. distance between the −35 and −10 promoter sequences is critical to Our results are consistent with several potential CGS 15943 CGS 15943 resistance, rather than the specific base and site of in- antiplasmid mechanisms in the context of RepE regulatory cir- sertion, at least based on the limited number of insertions that were cuits currently understood for the IncFIA replicon (diagrammed tested (Fig. 6). These observations further suggest that RepE is ei- in SI Appendix, Fig. S3). The critical nature of internal repE therthedirectorindirecttargetofCGS15943andthatconserved promoter spacing for the effects of CGS 15943 is intriguing and promoter spacing is integral to its effects. suggests possibilities involving disruption of the alignment of replicon machinery, effects on open plasmid replication complex CGS 15943 Mechanism of Action. As the mutations conferring re- formation, effects on interactions that may be dependent on sistance were located in the repE promoter, we tested whether DNA twist, or effects on binding of yet unknown factors in the the mutations altered repE transcription. We first isolated RNA repE promoter region. Such possibilities will be the basis of from the screening strain and CGS 15943-resistant strains and future studies. quantified repE mRNA by RT-qPCR. An approximately fourfold increase in repE transcript in CGS 15943-resistant strains was Kasugamycin Mechanism of Action. Aminoglycosides such as observed (Fig. 6G). There was also a corresponding ∼50% in- apramycin have been shown previously to disrupt plasmid rep- crease in plasmid levels (Fig. 6H). lication of an IncB incompatibility group plasmid by interfering To examine effects of CGS 15943 on repE levels, we generated with expression of the replication protein, RepA (28). The two sets of β-galactosidase reporter fusions: a transcriptional translation of RepA is controlled by an antisense RNA that binds fusion of lacZ directly under control of the repE promoter and a to the 5′ untranslated region of the repA mRNA to stabilize a translational fusion of the entire repE promoter and gene to messenger RNA (mRNA) secondary structure that blocks access lacZ. All constructs were driven by either wild-type or 7xT repE of the ribosome to its Shine–Dalgarno sequence. Apramycin is promoters and cloned into a pUC19 plasmid backbone. pUC19 presumptively a natural mimetic of this inhibitory RNA based on is resistant to the antiplasmid activity of CGS 15943 (SI Appen- its site of mRNA binding and activity. In contrast, repE expression
dix, Fig. S2), allowing us to examine the effects of CGS 15943 is thought to be primarily regulated through binding of a RepE MICROBIOLOGY without loss of the plasmid constructs. In both types of lacZ dimer to an operator sequence in its own promoter. To determine fusions, the mutated promoter increased β-galactosidase activity if kasugamycin blocks expression of the functionally analogous two- to threefold (Fig. 7A), consistent with RT-qPCR observa- RepE, we tested the effect of kasugamycin on the repE-lacZ tions (Fig. 6G). transcriptional and translation reporter fusions described above. CGS 15943 treatment significantly reduced β-galactosidase Importantly, kasugamycin treatment significantly reduced the activity of the wild-type repE promoter transcriptional fusion β-galactosidase activity of the repE translational fusion but had no by ∼33% (Fig. 7B). In contrast, the corresponding 7xT promoter effect on the repE transcriptional fusion (Fig. 7D). In contrast to fusion was unaffected. (Fig. 7B). Similarly, a reduction in the observations for CGS 15943, the 7xT mutation did not inhibit translational fusion expression driven by the wild-type repE pro- kasugamycin’ssuppressionofrepE translation, and exogenous moter was also observed upon CGS 15943 treatment, although it expression of repE from an arabinose-inducible, pBAD promoter did not reach statistical significance (P = 0.1). Again, the 7xT dramatically reduced kasugamycin antiplasmid activity (Fig. 7 D translational fusion was unaffected by CGS 15943 treatment. and F). Additionally, substitution of the monomeric repE54 for Taken together, these data initially suggested that CGS 15943 repE in pScreening did not reduce kasugamycin activity. There- disrupted plasmid maintenance through reduced repE expression fore, kasugamycin’s antiplasmid activity appears to result from and that the 7xT mutation might negate this effect. inhibition of repE translation. To investigate this possibility we placed repE under the control We also examined the effect of apramycin on repE expression. of the arabinose inducible pBAD promoter on a pBR322-based Similar to kasugamycin, apramycin significantly reduced repE plasmid resistant to the antiplasmid effects of CGS 15943 (SI translation but not transcription, and activity was unaffected by Appendix, Fig. S2). If the effects of CGS 15943 were solely due to the 7xT resistance mutation (Fig. 7E). Therefore, the anti- repression of repE expression, then arabinose induction of ex- plasmid effects of aminoglycosides on IncFIA and IncB plasmids ogenous repE expression should impart CGS 15943 resistance. are analogous (Fig. 7), and the antiplasmid effects of amino- However, the effect of exogenous repE expression was not con- glycosides and CGS 15943 on IncFIA are distinct. sistent with the complete abrogation of CGS 15943 activity in the promoter mutants (Figs. 6A and 7C). Therefore, the simple Compounds Potentiate Meropenem Activity. We next tested model for CGS antiplasmid activity, that CGS 15943 decreases whether the compounds have antiplasmid activity against the repE expression and the 7xT mutation restores this expression, parent pCRE plasmid from BIDMC20A. To perform these ex- could not fully account for our observations. periments, we transformed the ∼140-kb pCRE BIDMC20a plas- The monomer to dimer ratio of RepE is a key regulator of mid into the E. coli tolC strain, treated that strain with antiplasmid plasmid replication. Monomers bind to ori and melt the DNA in compounds, quantified plasmid levels by qPCR, and normalized concert with DnaA to allow binding of the DNA replication data to bacterial chromosomal DNA as described above. Unex- complex. Dimers bind to the repE operator to inhibit its own pectedly, however, none of the compounds decreased the relative transcription (38) and also participate in DNA looping between plasmid levels of pCRE BIDMC20a normalized to the chromo- iteron repeats in ori and incC, which locks the DNA in a con- somal dxs gene, as determined by qPCR, with the exception of a formation in which replication cannot occur (39, 40). In a gen- 20% reduction in relative pCRE BIDMC20a levels observed for eral sense, monomer predominance favors plasmid replication kasugamycin (SI Appendix, Figs. S4 and S8A). However, for CGS and dimer predominance the converse. We therefore considered 15943 and Ro 90-7501, absolute levels of plasmid and genome whether alteration of the monomer:dimer equilibrium might copies were dramatically reduced (SI Appendix,Fig.S4B), sug- account for the effects of CGS 15943 on plasmid replication. The gesting a potential link between antiplasmid activity and loss of RepE mutant, RepE54, exists only in monomeric form (41, 42). viability of host cells containing pCRE BIDMC20a.
Zulauf and Kirby PNAS | November 24, 2020 | vol. 117 | no. 47 | 29845 Downloaded by guest on September 26, 2021 CGS 15943 A BC120% p=0.1 8000 * 100% 100% 6000 80% 80% 4000 ** 2400 60% * 60% 1800 40% 40%
Miller Units 1200 600 20% 20% 0 0 0 0246810
pLac LacZ CGS 15943 (ug/ml) pRepE LacZ pLac LacZ pScreening Negative Control pRepE-7xT LacZ pRepE LacZ pRepE RepE-LacZ pRepE-7xT LacZ pScreening (Arabinose) pRepE-7xT RepE-LacZ pRepE RepE-LacZ pScreening+pBad repE pRepE-7xT RepE-LacZ pScreening+pBad repE (Arabinose) pScreening repE54 D Kasugamycin E Apramycin F *** ** 120% n.s. n.s. 100% 100% 100% 80% 80% n.s. 80% n.s. 60% 60% 60% 40% 40% 40% 20% 20% 20% 0 0 0 0 1020304050 Kasugamycin (ug/ml) pLac LacZ pLac LacZ pRepE LacZ pRepE LacZ pScreening pRepE-7xT LacZ pRepE-7xT LacZ pScreening (Arabinose) pRepE RepE-LacZ pRepE RepE-LacZ pScreening+pBad repE pRepE-7xT RepE-LacZ pRepE-7xT RepE-LacZ pScreening+pBad repE (Arabinose) pScreening repE54
Fig. 7. repE levels are altered by CGS 15943 and aminoglycosides. (A) β-Galactosidase activity of the lacZ fusions was assayed to characterize repE regulatory circuits. Two types of fusions were analyzed: transcriptional fusions with expression of the lacZ gene driven by wild-type repE or CGSR repE promoters and translational fusions of repE with lacZ genes driven by wild-type or CGSR repE promoters. Miller units were determined after 4 h of growth. (B) Effect of 4-h CGS 15943 treatment on lacZ fusion activity. β-Galactosidase activity was expressed as a percentage of activity in no treatment controls. (C) Effect of CGS 15943 on pScreening levels in the presence of a second plasmid exogenously expressing repE from a pBAD regulated promoter in the presence or absence of arabinose inducer or on pScreening with the monomeric mutant repE54 substituted for repE. DNA was isolated after 24 h of treatment and quantified by qPCR. Data were normalized to the chromosomal dxs gene and expressed as a percentage of pScreening levels in untreated controls. (D) Kasugamycin and (E) apramycin effects on lacZ fusion expression. (F) Effect of kasugamycin on pScreening levels in the presence of repE54 or exogenously expressed repE. (*P < 0.05, **P < 0.001, ***P < 0.0001; n.s., not statistically significant).
It is noteworthy that pCRE BIDMC20a, but not pScreening, pCRE BIDMC20a, decreasing the minimal inhibitory concen- contains the CcdAB plasmid addiction system. Therefore, based tration (MIC) by 2- to 32-fold depending on the concentration of on our findings, we further considered whether CcdAB-mediated inhibitor tested (Fig. 8 C–E). The current understanding of host cell death might account at least in part for the difference in carbapenem therapeutic efficacy, codified in rules used in clini- observations between pScreening (relative plasmid loss) and cal laboratories to interpret isolates as carbapenem susceptible native pCRE BIDMC20a plasmid (absolute plasmid loss). No- or resistant for clinicians (43), is that the MIC alone should be tably, by colony-forming unit analysis, treatment with CGS 15943 used to predict therapeutic efficacy without regard to underlying and Ro 90-7501 significantly reduced survival of bacteria con- strain genotype. The clinical susceptibility breakpoint is a mer- taining pCRE BIDMC20a to the extent that no viable bacteria openem MIC ≤1 μg/mL, and several concentrations of each were recovered during treatment with higher concentrations of Ro active compound were able to push the meropenem MIC to or 90-7501 (Fig. 8B), but not survival of bacteria containing pScre- below this threshold, albeit in a tolC background. Therefore, our ening which lacks the ccdAB genes (Fig. 2). Therefore, antibac- results demonstrate that an antiplasmid compound can render a terial properties of CGS 15943 and Ro 90-7501 were specific to CRE strain susceptible to carbapenems and thereby restore ac- pCRE BIDMC20a and likely resulted from the toxic effects of tivity of a critical, drug-of-last-resort therapeutic. retained, stable CcdB toxin in the absence of unstable CcdA an- titoxin during compound-induced plasmid curing. Therefore, re- Compounds Show Differential Activity against IncFII. As pCRE plas- moval of the CcdAB plasmid addiction system from pScreening mids often contain multiple incompatibility groups, we sequenced proved prescient, as we were able to identify screening hits that pCRE BIDMC20a using PacBio technology [GenBank accession would have otherwise been misclassified as antibacterial com- no. MW057772 (50)] to definitively link together plasmid se- pounds and not further studied. quence present on multiple contigs in previously available Illu- The pCRE from BIDMC20A encodes a Klebsiella pneumoniae mina sequence data (GenBank accession no. GCA_000522145.1). carbapenemase (KPC) gene conferring resistance to mer- PacBio sequencing allowed full assembly of the 142.8-kb pCRE openem. Therefore, we predicted that the compounds might BIDMC 20a plasmid and identified the presence of a second potentiate the activity of meropenem due to their antiplasmid plasmid replicon from incompatibility group IncFII. To test activity. Notably, kasugamycin, Ro 90-7501, and CGS 15943 all whether the IncFII replicon was functional, we substituted this potentiated meropenem activity against a tolC strain containing putative IncFII replication machinery for the IncFIA replicon in
29846 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021 A B 120% 100% 100% 80% 80% * **** 60% 60% 40% ******* 40% 20% ******* 20% **** 0 # 0 1020304050 0 Percent Plasmid (qPCR) Kasugamycin (ug/ml) Percent Recovered CFU pScreening pCRE BIDMC20a No treatment
Ro 90-7501 5ug/ml CGS 15943CGS 1594310ug/ml 20ug/mlRo 90-7501Ro 90-7501 10ug/ml 20ug/ml CDE 0.3 0.3 0.3
0.2 0.2 0.2 600 600 600 A A 0.1 A 0.1 0.1
0.0 0.0 0.0 01234 01234 01234 ug/ml Meropenem ug/ml Meropenem ug/ml Meropenem 0ug/ml Kasugamycin 0ug/ml Ro 90-7501 0ug/ml CGS 15943 66.25ug/ml Kasugamycin 2.5ug/ml2 Ro 90-7501 10ug/ml1 CGS 5943 112.5ug/ml Kasugamycin 5ug/ml5 Ro 90-7501 20ug/ml CGS 15943 25ug/ml2 Kasugamycin 10ug/ml Ro 90-7501 550ug/ml Kasugamycin
Fig. 8. Compounds exhibit synergy with meropenem. (A) Levels of pScreening and pCRE BIDMC20a were quantified by qPCR after kasugamycin treatment, normalized to chromosomal dxs, and expressed as a percentage of untreated controls. (B) pCRE BIDMC20a containing tolC bacteria were treated with in- dicated concentrations of CGS 15943 or Ro 90-7501 for 24 h and plated for viability on solid media without antibiotics. Data are expressed as a percentage of
viable colonies in untreated controls. # indicates no viable bacteria detected (limit of detection 15 cfu per well). In pCRE BIDMC20a-containing bacteria, (C) MICROBIOLOGY
kasugamycin, (D) Ro 90-7501, and (E) CGS 15943 significantly potentiated activity of meropenem up to 32-fold. In these assays, an A600 of 0.05 is equivalent to the reference MIC, that is, complete visible inhibition of bacterial growth (49), based on our prior validation studies (33), and corresponds to media control without bacteria. (*P < 0.05, **P < 0.001, ***P < 0.0001).
pScreening to create pIncFII. Interestingly, pIncFII replicated in a ineffective. Therefore, we hypothesized that small-molecule– stable fashion with a plasmid copy number approximately four induced eviction of these plasmids would restore susceptibility to times higher than pScreening (IncFIA) and pCRE BIDMC 20a. carbapenems. As many additional resistance genes are carried on (Fig. 9A). Therefore, as compounds were active against pCRE these plasmids, the strategy presumably would restore susceptibility BIDMC 20a containing both replicons, we considered whether to many other antibiotics as well. We therefore designed a high- they would also inhibit pIncFII. We found that kasugamycin dem- throughput screening assay to identify antiplasmid agents that did onstrated equivalent antiplasmid activity against pIncFII and not presuppose a particular mechanism of action. For proof of pScreening (IncFIA) by qPCR (Fig. 9 B–D). However, CGS 15943 principle, we screened known bioactive compounds that might more and Ro 90-7501 only reduced pIncFII plasmid levels by a modest quickly advance our understanding of antiplasmid mechanism and 25% at most compared with their reduction of pScreening (IncFIA) would be immediately available in sufficient quantities for follow-up levels below the limit of detection (Fig. 4). Similar results were studies. We discuss validation of the antiplasmid activity of three observed when plating treated bacteria on nourseothricin to quan- identified compounds, all of which were active against the native tify the number of bacteria maintaining nourseothricin resistance- pCRE BIDMC20a plasmid. Furthermore, for two of these com- expressing pIncFII (Fig. 9E). pounds we identified the plasmid replication protein, RepE, as the Based on these results, it is striking that pCRE BIDMC20a putative target. Our work also demonstrated that by targeting was susceptible to CGS 15943 and Ro 90-7501, as these compounds pCRE BIDMC 20a, carbapenem susceptibility can be restored. only have minimal activity against the second IncFII replicon on Although the antiplasmid compounds identified in this study have pCRE BIDMC20a. IncFII replicons are regulated by an antisense been validated to work on an IncFIA replicon, further study will be transcriptional control of the RepA replication protein rather than needed to determine if these compounds are active against other by iteron-based mechanisms found in IncFIA. Our results suggest common incompatibility groups. Importantly, the ability to inhibit that the mechanistically distinct IncFIA replicon is dominant over plasmid maintenance in a clinical setting would allow us to treat IncFII in pCRE BIDMC20a, as both pCRE BIDMC20a’s plasmid previously resistant CRE infections. In addition to more direct copy number and susceptibility to CGS 15943 and Ro 90-7501 are clinical implications, antiplasmid compounds will also provide reflected in effects on the IncFIA replicon individually. Taken to- powerful tools to learn more about the basic biology of large, low- gether, our data suggest that compounds that specifically target the copy, multidrug-resistance plasmids and thereby identify additional IncFIA incompatibility group can successfully inhibit replication of therapeutic targets in the future. Our work demonstrates the fea- a large carbapenemase-encoding plasmid, despite the presence of sibility of a high-throughput screening approach to identify anti- plasmid agents with specific mechanisms of action. an additional, distinct, functional replicon. Conclusions Materials and Methods Strain Backgrounds. In this study we utilized the E. coli CRE clinical isolate Carbapenems are a last-resort antibiotic that provides safe, ef- β – BIDMC 20A, the sequence of which is available in multiple contigs (GenBank fective therapy against most otherwise -lactam resistant, gram- accession no. GCA_000522145.1), the E.coli K12 strain BW25113, and a tolC negative pathogens. Unfortunately, carbapenemase genes, carried mutant, JW5503-KanS. The latter two were from the Keio collection (44) and on large plasmids, hydrolyze these antibiotics, rendering them obtained from the Coli Genetic Stock Center (Yale University, New Haven,
Zulauf and Kirby PNAS | November 24, 2020 | vol. 117 | no. 47 | 29847 Downloaded by guest on September 26, 2021 AB C 5 100% IncFIA 100% 4 80% IncFII 80% 3 60% 60% 2 40% 40% IncFIA IncFII 1 20% 20%
to pCRE BIDMC20a 0 0
Plasmid Level Relative 0 0 1020304050 0 5 10 15 20
IncFIAIncFII Kasugamycin (ug/ml) CGS 15943 (ug/ml)
pCRE BIDMC20a
D E 100% 100% 80% 60% 10% 40% IncFIA
IncFII Retention (CFU) 20% Percent Plasmid 1% 0 0 5 10 15 20 5 ug/ml 5 ug/ml 25 ug/ml50 ug/ml 10 ug/ml20 ug/ml 10 ug/ml20 ug/ml Ro 90-7501 (ug/ml) 12.5 ug/ml No treatment Kasugamycin CGS 15943 Ro 90-7501
Fig. 9. Compounds have differing activity against IncFII. (A) The relative abundance of pCRE BIDMC20a, IncFIA (pScreening), and IncFII plasmids in a tolC strain was determined by qPCR and is shown normalized to pCRE BIDMC20a copy number. After treatment with (B) kasugamycin, (C) CGS 15943, or (D)Ro90- 7501 for 24 h, plasmids levels were quantified by qPCR relative to the chromosomal dxs gene and are expressed as a percentage of plasmid level in untreated controls. (E) The tolC strain containing the IncFII plasmid was treated with doubling dilutions of kasugamycin, CGS 15943, and Ro 90-7501. After 24 h of treatment, bacteria were serially diluted and plated on media with or without nourseothricin. The IncFII plasmid encodes nourseothricin resistance. Therefore, the ratio of colony-forming unit counts with and without nourseothricin selection indicates the percentage of bacteria still retaining plasmid.
CT). BIDMC20A was propagated on blood agar plates; all other strains were 20 μg/mL of meropenem (to prevent bacterial growth and plasmid replica- cultured on lysogeny broth (LB) agar or in LB media (BD). Where indicated, tion) (Ark Pharm). Negative control wells were not seeded with compound. μ nourseothricin (GoldBio) at 50 g/mL was used for selection. A600 and RFU of the mNeptune2 reporter (excitation 600 nm and emission 650 nm) were then quantified using an EnVision Plate Reader (PerkinElmer).
Construction of the Incompatibility Group Plasmids. Primers 1 and 2 were used Compounds were scored as antibacterial if they reduced the A600 in both to amplify a previously described ProD driven mNeptune2 reporter gene replicate wells by more than 80% compared to the median of all treatment linked in an operon format with a nourseothricin resistance cassette (16). wells. If not antibacterial, compounds were scored as antiplasmid hits if the Primers also contained sequences homologous to pCRE of BIDMC20A in reduction in RFU was greater than two times the reduction in A600 in both order to facilitate downstream cloning steps. The replication and mainte- replicate wells compared to the median RFU and A600 of all treatment wells. nance machinery of pCRE BIDMC20a was amplified in two PCR fragments: 4 one was amplified with primer 3 and 4 and the other with primers 5 and 6. Antiplasmid Hit Confirmation. Bacteria at midlog phase were seeded at 10 cfu The two pCRE fragments along with the mNeptune2 fragment were as- per well in 50 μL of LB media in 384-well plates. Doubling dilutions of sembled using the HiFi system (New England Biolabs). To remove the toxin compounds were dispensed into the 384-well plates using a D300 Digital CcdB from this construct, the plasmid was again amplified in two fragments, Dispensing System (TECAN). Compounds tested include kasugamycin one with primers 7 and 8 and the other with primers 9 and 10, and the two (Sigma-Aldrich), CGS 15943 (Alfa Aesar), Ro 90-7501 (Tocris Bioscience), and fragments were reassembled using the HiFi system. The final pScreening apramycin (Alfa Aesar). Total dimethyl sulfoxide (DMSO) concentration in plasmid was confirmed to be error-free by sequencing. Primer sequences are the wells was kept below 1% (43). Plates were incubated at 37 °C for 24 h. shown in Dataset S3. Once constructed, pScreening was transformed into Although assays were evaluated after a 48-h incubation during the high- throughput screen, for convenience a 24-h incubation was used for all con- the E. coli K12 tolC mutant by electroporation. firmatory and exploratory investigation, as all hits showed essentially equiv- The IncFII plasmid was amplified from pCRE BIDMC using primers F IncFII alent readouts at both time points. Bacterial growth and RFU were quantified and R IncFII (Dataset S3). The IncFII fragment was assembled with the as described above except measurements were made using a TECAN M1000 mNeptune2 fragment using the HiFi system. The final plasmid was con- plate reader. Percent growth and plasmid abundance was normalized to no firmed to be error-free by sequencing, and IncFII was transformed into the treatment controls. Antiplasmid activity of known DNA intercalators including E. coli K12 tolC mutant by electroporation. ethidium bromide (Life Technologies), 9-aminoacridine (TCI America), and acridine orange (Sigma-Aldrich) was quantified in an identical manner to hit μ High-Throughput Screen. Cultures were started in LB media containing 50 g/ compounds in this assay and additional assays described below. mL nourseothricin the afternoon prior to screening. The next morning cul- tures were diluted 10-fold with fresh medium and allowed to grow for 2 to Real-Time qPCR. Midlog phase cultures were seeded into 384-well plates in 3 h until reaching midlog phase. Bacteria were then seeded into white, clear- 50 μL of media containing doubling dilutions of compounds at a concen- 4 bottomed, 384-well plates (Grenier Bio-One) at 10 colony-forming units tration of 104 cfu per well. After 24 h incubation, bacteria were pelleted, μ (cfu) per well in 30 L of LB media without antibiotic utilizing a Multidrop resuspended in 50 mM NaOH, and heated at 98 °C for 10 min to lyse the Combi Reagent Dispenser (Thermo Fisher Scientific). Plates were then bacterial cells. Then, 0.5 M Tris·HCl was added to neutralize the sample, and centrifuged at 150 × g for 1 s, and 300 nL of each test compound was added DNA was diluted 1:5 with deionized water to a concentration suitable for to screening wells in duplicate screening plates using a pin transfer robot. downstream applications. To quantify pScreening and pCRE BIDMC20a, we Plates were incubated for 48 h at 37 °C. Twenty-four positive and negative utilized primers that bind to the partitioning factor gene, sopA. For pUC19 controls wells were included per microplate to monitor Z′ on an ongoing and pBR322 plasmids quantified in this study, we utilized primers that bind basis and ensure continued robustness of assay during screening. Z′ was to ampR. Real-time qPCR was completed using 3 μL of DNA template in determined as described previously (23). Positive control wells contained triplicate technical replicates using DyNAmo HS SYBR Green qPCR Kit
29848 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021 (Thermo Fisher). Transcripts were normalized to the single-copy, chromo- a HiFi cloning kit (New England Biolabs). Primers are listed in Dataset S5.The somal gene, dxs. Using qPCR we are able to detect a decrease in plasmid pBAD-RepE plasmids were transformed into a tolC mutant strain containing levels up to 99.95%. Primer sequences were as follows: sopA (GGACTGAGA- pScreening. RepE transcription was induced using 0.001% arabinose for 4 h GCCATTACTATTGCTGT and GACTACACCTCCGCACTGC), ampR (GACAGT- before adding varying concentrations of CGS 15943 or kasugamycin. DNA was AAGAGAATTATGCAGTGCTGC and GGCTTCATTCAGCTCCGGTTCC), IncFII also isolated and plasmid levels were quantified by qPCR as described above. (GGTCTTTTTCTGCATCACTGGGC) and (GCGTAACGACCTATGAGGACG), and dxs (CGCTTCATCAAGCGGTTTCAC and GCGAGAAACTGGCGATCCTTAAC). RNA Isolation. Triplicate cultures were grown overnight in 50 μg/mL nour- seothricin. The next day cultures were diluted 1:200 and grown at 37 °C until Plasmid Quantification by Colony-Forming Unit Enumeration. Bacteria at reaching an A600 of 0.6. RNA was extracted from the samples using Direct-zol midlog phase were seeded as above into 384-well plates containing com- RNA Miniprep Plus (Zymo Research). Complementary DNA (cDNA) was syn- pounds at indicated concentrations. After a 24-h incubation, bacteria were thesized using the iScript cDNA Synthesis Kit (Bio-Rad). Real-time qPCR was serially diluted, plated in 10-μL drops onto plates with or without 50 μg/mL completed using 25 ng of cDNA template in triplicate technical replicates nourseothricin and enumerated by the drop plate method (45). Data were using the DyNAmo SYBR Green qPCR kit (Thermo Fisher). Transcripts were normalized to growth on plates without antibiotic. normalized to the housekeeping gene dxs (primer sequences as above). The sequences of the repE primers were GAGCCATCCGGCTTACGATAC and Acridine Orange Displacement Assay. The acridine orange displacement assay CCCATATCTCATTCCCTTCTTTATCGGGTTA. was conducted as previously described (31) in 384-well plate format. Briefly, the DNA substrate (salmon sperm DNA, pScreening plasmid DNA, or tolC LacZ Fusions and β-Galactosidase Assay. To create LacZ fusions, lacZ was genomic DNA) was diluted to 6 μg/mL in HENS buffer (10 mM Hepes, pH 7.5, 1 mM EDTA, and 100 mM NaCl), and 30 μL of the DNA solution was added to amplified from MG1655 and joined to a fragment containing either the each well with acridine orange (Sigma-Aldrich) at 50 nM final concentration. promoter of repE or the promoter and repE gene amplified from pScreening R Compounds were added in doubling series with mitoxantrone (Selleck or pCGS .InthelacZ translational fusions, lacZ was fused to the C terminus Chemical) used as a positive intercalator control. Plates were incubated at of repE. The respective fragments were assembled with the pUC19 vector room temperature for 20 min, and acridine orange fluorescence was read on using HiFi (NEB). Primer sequences are provided in Dataset S6. a TECAN M1000 plate reader (excitation 480 nm, emission 535 nm). Data To quantify β-galactosidase activity of indicated strain constructs, tripli- were normalized to control wells without test compound. cate cultures of relevant strains were grown overnight in 100 μg/mL ampicillin. The next day the cultures were diluted 1:200 and grown with 20 μg/mL CGS Meropenem Synergy Assay. Synergy with meropenem (Ark Pharm) was ex- 15943, 6 μg/mL kasugamycin, 2 μg/mL apramycin, or DMSO control for 4 h, at
amined using a checkerboard array. Bacteria at midlog phase were seeded at which time the A600 of the cultures was determined, and β-galactosidase ac- 104 cfu per well in 50 μL of LB media in 384-well plates. Serial twofold di- tivity was assayed using the single-step method described by Schaefer et al. lutions of meropenem and test compounds were dispensed into wells in (48). Briefly, 80 μLofeachsampleand120μLofβ-galactosidase mix were orthogonal titrations using the D300 Digital Dispensing System. Plates were transferred to a 96-well plate. The optical density at 420 nm was read every MICROBIOLOGY incubated for 24 h and combinatorial MICs determined based on A600 minute for 1 h, and Miller units were quantified. measure using the TECAN M1000 as previously described (46, 47). pCRE BIDMC 20a Plasmid Sequencing. pCRE BIDMC20a was isolated using a Isolation of CGS 15943-Resistant Strain. To isolate CGS 15943-resistant mu- Qiagen Large Construct Kit. The plasmid was sequenced by PacBio long read μ μ tants, the screening strain was cultured in 10 g/mL CGS 15943 and 50 g/mL sequencing at Genewiz. The sequence was deposited at GenBank and nourseothricin. Every 24 h for 4 d the culture was diluted to an A600 of 0.5 assigned the accession number MW057772 (50). and allowed to regrow at 37° for 24 h. The culture was then plated on LB agar medium with 50 μg/mL nourseothricin. Over 150 isolated colonies were Statistical Analysis. All experiments were conducted with at least three bi- screened for resistance to pScreening plasmid eviction by CGS 15943 and ological replicates and repeated at least three independent times. Statistical retained sensitivity to plasmid eviction by Ro 90-7501, based on mNeptune2 comparisons were performed using Prism 8 for macOS (Graphpad Software, fluorescence. One such isolate was identified: CGSR. The plasmid was iso- LLC) using Student’s t test or ANOVA with a Holm–Sidak post hoc test to lated from this strain and sequenced to identify the resistance mutation < (pCGSR). To cure the plasmid from the resistant isolate, the strain was cul- correct for multiple comparisons. A P 0.05 was considered significant. tured overnight in 20 μg/mL Ro 90-7501 and then plated without antibiotic selection. Colonies were tested on plates with and without nourseothricin to Data Availability. All study data are included in the paper, SI Appendix, – identify candidates cured of pScreening. Datasets S1 S6, and GenBank accession number MW057772.
Site-Directed Mutagenesis. Mutations were made in the promoter region of ACKNOWLEDGMENTS. This work was supported by the National Institute of repE on pScreening using overlap extension PCR site-directed mutagenesis. Allergy and Infectious Diseases of the NIH under award R33AI119114 to J.E.K. Site directed mutagenesis was also utilized to generate pScreening-repE54 K.E.Z. was supported in part by a National Institute of Allergy and Infectious Diseases training grant (T32AI007061). The content is solely the responsibility using pScreening as a template. Primer sequences are provided in Dataset of the authors and does not necessarily represent the official views of the NIH. S4. After PCR, DpnI (New England Biolabs) was added to degrade unmu- The screening work was performed at ICCB-Longwood (Boston, MA). We tated, methylated template prior to electroporation to isolate pScreening thank Jennifer Smith, Jennifer Nale, David Wrobel, Stewart Rudnicki, Erin mutant candidates. Mutations were confirmed by Sanger sequencing. Lilienthal, and Richard Siu (ICCB-Longwood) for their assistance. The HP D300 digital dispenser and TECAN M1000 were provided for our use by TECAN Arabinose-Inducible repE. To create a pBAD-regulated repE, repE was am- (Morrisville, NC). TECAN had no role in study design, data collection/interpre- plified from pScreening and joined to the linearized pBAD/HisB vector using tation, manuscript preparation, or decision to publish.
1. CDC, “Antibiotic resistance threats in the United States, 2019” (US Department of 7. J. R. Thomas, J. C. DeNap, M. L. Wong, P. J. Hergenrother, The relationship between Health and Human Services, CDC, Atlanta, GA, 2019). aminoglycosides’ RNA binding proclivity and their antiplasmid effect on an IncB 2. A. Carattoli, Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents plasmid. Biochemistry 44, 6800–6808 (2005). Chemother. 53, 2227–2238 (2009). 8. G. C. Cerqueira et al., Multi-institute analysis of carbapenem resistance reveals re- 3. P. M. Bennett, Plasmid encoded antibiotic resistance: Acquisition and transfer of markable diversity, unexplained mechanisms, and limited clonal outbreaks. Proc. Natl. antibiotic resistance genes in bacteria. Br. J. Pharmacol. 153 (suppl. 1), S347–S357 Acad. Sci. U.S.A. 114, 1135–1140 (2017). (2008). 9. A. Baraniak et al.; KPC-PL Study Group, Molecular characteristics of KPC-producing 4. M. Sengupta, S. Austin, Prevalence and significance of plasmid maintenance Enterobacteriaceae at the early stage of their dissemination in Poland, 2008-2009. functions in the virulence plasmids of pathogenic bacteria. Infect. Immun. 79, Antimicrob. Agents Chemother. 55, 5493–5499 (2011). 2502–2509 (2011). 10. M. L. Hargreaves et al., Clonal dissemination of Enterobacter cloacae harboring 5. M. M. C. Buckner, M. L. Ciusa, L. J. V. Piddock, Strategies to combat antimicrobial blaKPC-3 in the Upper Midwestern United States. Antimicrob. Agents Chemother. 59, resistance: Anti-plasmid and plasmid curing. FEMS Microbiol. Rev. 42, 781–804 (2018). 7723–7734 (2015). 6. J. C. Denap, J. R. Thomas, D. J. Musk, P. J. Hergenrother, Combating drug-resistant 11. L. Chen et al., Complete sequence of a bla(KPC-2)-harboring IncFII(K1) plasmid from a bacteria: Small molecule mimics of plasmid incompatibility as antiplasmid com- Klebsiella pneumoniae sequence type 258 strain. Antimicrob. Agents Chemother. 57, pounds. J. Am. Chem. Soc. 126, 15402–15404 (2004). 1542–1545 (2013).
Zulauf and Kirby PNAS | November 24, 2020 | vol. 117 | no. 47 | 29849 Downloaded by guest on September 26, 2021 12. K. D. Chavda et al., Complete sequence of a bla(KPC)-harboring cointegrate plasmid 32. D. Kreft, Y. Wang, M. Rattay, K. Toensing, D. Anselmetti, Binding mechanism of anti- isolated from Escherichia coli. Antimicrob. Agents Chemother. 59, 2956–2959 (2015). cancer chemotherapeutic drug mitoxantrone to DNA characterized by magnetic 13. L. Villa, A. García-Fernández, D. Fortini, A. Carattoli, Replicon sequence typing of IncF tweezers. J. Nanobiotechnology 16, 56 (2018). plasmids carrying virulence and resistance determinants. J. Antimicrob. Chemother. 33. S. Kronheim et al., A chemical defence against phage infection. Nature 564, 283–286 65, 2518–2529 (2010). (2018). 14. J. Chu et al., Non-invasive intravital imaging of cellular differentiation with a bright 34. D. Zhuang, “Identification and characterization of novel anti-phage compounds us- – red-excitable fluorescent protein. Nat. Methods 11, 572 578 (2014). ing a high throughput approach,” M.Sc. thesis, University of Toronto, Toronto, ON, 15. J. H. Davis, A. J. Rubin, R. T. Sauer, Design, construction and characterization of a set Canada (2016). – of insulated bacterial promoters. Nucleic Acids Res. 39, 1131 1141 (2011). 35. F. Corbin, 3rd, Pathogen inactivation of blood components: Current status and in- 16. Y. S. Kang, J. E. Kirby, Promotion and rescue of intracellular Brucella neotomae troduction of an approach using riboflavin as a photosensitizer. Int. J. Hematol. 76, replication during coinfection with Legionella pneumophila. Infect. Immun. 85, 253–257 (2002). e00991-16 (2017). 36. B. C. Kline, A review of mini-F plasmid maintenance. Plasmid 14,1–16 (1985). 17. K. P. Smith et al., A whole-cell screen for adjunctive and direct antimicrobials active 37. C. B. Harley, R. P. Reynolds, Analysis of E. coli promoter sequences. Nucleic Acids Res. against carbapenem-resistant Enterobacteriaceae. SLAS Discov. 24, 842–853 (2019). 15, 2343–2361 (1987). 18. H. I. Zgurskaya, G. Krishnamoorthy, A. Ntreh, S. Lu, Mechanism and function of the 38. L. Søgaard-Andersen, L. A. Rokeach, S. Molin, Regulated expression of a gene im- outer membrane channel TolC in multidrug resistance and physiology of enter- portant for replication of plasmid F in E. coli. EMBO J. 3, 257–262 (1984). obacteria. Front. Microbiol. 2, 189 (2011). 39. H. Uga, F. Matsunaga, C. Wada, Regulation of DNA replication by iterons: An inter- 19. M. F. Richter, P. J. Hergenrother, The challenge of converting Gram-positive-only compounds into broad-spectrum antibiotics. Ann. N. Y. Acad. Sci. 1435,18–38 (2019). action between the ori2 and incC regions mediated by RepE-bound iterons inhibits – 20. T. Brennan-Krohn, R. Manetsch, G. A. O’Doherty, J. E. Kirby, New strategies and DNA replication of mini-F plasmid in Escherichia coli. EMBO J. 18, 3856 3867 (1999). structural considerations in development of therapeutics for carbapenem-resistant 40. S. Zzaman, D. Bastia, Oligomeric initiator protein-mediated DNA looping negatively Enterobacteriaceae. Transl. Res. 220,14–32 (2020). regulates plasmid replication in vitro by preventing origin melting. Mol. Cell 20, 21. N. Malo, J. A. Hanley, S. Cerquozzi, J. Pelletier, R. Nadon, Statistical practice in high- 833–843 (2005). throughput screening data analysis. Nat. Biotechnol. 24, 167–175 (2006). 41. M. Ishiai, C. Wada, Y. Kawasaki, T. Yura, Mini-F plasmid mutants able to replicate in 22. J. H. Zhang, T. D. Chung, K. R. Oldenburg, A simple statistical parameter for use in Escherichia coli deficient in the DnaJ heat shock protein. J. Bacteriol. 174, 5597–5603 evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, (1992). 67–73 (1999). 42. M. Ishiai, C. Wada, Y. Kawasaki, T. Yura, Replication initiator protein RepE of mini-F 23. L. Chiaraviglio, J. E. Kirby, High-throughput intracellular antimicrobial susceptibility plasmid: Functional differentiation between monomers (initiator) and dimers (au- testing of Legionella pneumophila. Antimicrob. Agents Chemother. 59, 7517–7529 togenous repressor). Proc. Natl. Acad. Sci. U.S.A. 91, 3839–3843 (1994). (2015). 43. Clinical and Laboratory Standards Institute, “Performance standards for antimicrobial 24. Y. S. Kang, J. E. Kirby, A chemical genetics screen reveals influence of p38 mitogen- suceptibility testing: Twenty-ninth informational supplement M100S-29” (CLSI, activated protein kinase and autophagy on phagosome development and intracel- Wayne, PA, 2019). lular replication of Brucella neotomae in macrophages. Infect. Immun. 87, e00044-19 44. T. Baba et al., Construction of Escherichia coli K-12 in-frame, single-gene knockout (2019). mutants: The Keio collection. Mol. Syst. Biol. 2, 2006.0008 (2006). 25. C. E. Edling, F. Selvaggi, R. Ghonaim, T. Maffucci, M. Falasca, Caffeine and the analog 45. B. Herigstad, M. Hamilton, J. Heersink, How to optimize the drop plate method for CGS 15943 inhibit cancer cell growth by targeting the phosphoinositide 3-kinase/Akt enumerating bacteria. J. Microbiol. Methods 44, 121–129 (2001). – pathway. Cancer Biol. Ther. 15, 524 532 (2014). 46. T. Brennan-Krohn, J. E. Kirby, Antimicrobial synergy testing by the inkjet printer- 26. S. G. Holtzman, CGS 15943, a nonxanthine adenosine receptor antagonist: Effects on assisted automated checkerboard array and the manual time-kill method. J. Vis. locomotor activity of nontolerant and caffeine-tolerant rats. Life Sci. 49, 1563–1570 Exp. e58636 (2019). (1991). 47. T. Brennan-Krohn, K. A. Truelson, K. P. Smith, J. E. Kirby, Screening for synergistic 27. B. Bohrmann et al., Self-assembly of beta-amyloid 42 is retarded by small molecular activity of antimicrobial combinations against carbapenem-resistant Enter- ligands at the stage of structural intermediates. J. Struct. Biol. 130, 232–246 (2000). obacteriaceae using inkjet printer-based technology. J. Antimicrob. Chemother. 72, 28. F. Guo et al., RO 90-7501 enhances TLR3 and RLR agonist induced antiviral response. – PLoS One 7, e42583 (2012). 2775 2781 (2017). 29. T. J. Hong, K. Park, E. W. Choi, J. S. Hahn, Ro 90-7501 inhibits PP5 through a novel, 48. J. Schaefer, G. Jovanovic, I. Kotta-Loizou, M. Buck, A data comparison between a β – TPR-dependent mechanism. Biochem. Biophys. Res. Commun. 482, 215–220 (2017). traditional and the single-step -galactosidase assay. Data Brief 8, 350 352 (2016). “ 30. C. Lee, J. Kim, S. G. Shin, S. Hwang, Absolute and relative QPCR quantification of 49. Clinical and Laboratory Standards Institute, Methods for dilution antimicrobial su- plasmid copy number in Escherichia coli. J. Biotechnol. 123, 273–280 (2006). ceptibility tests for bacteria that grow aerobically: Tenth edition M07-A10” (CLSI, 31. C. Beauchemin, N. J. Moerke, P. Faloon, K. M. Kaye, Assay development and high- Wayne, PA, 2015). throughput screening for inhibitors of kaposi’s sarcoma-associated herpesvirus 50. K. E. Zulauf, J. E. Kirby, Sequence data for pCRE_BIDMC20a, complete plasmid se- N-terminal latency-associated nuclear antigen binding to nucleosomes. J. Biomol. quence. NCBI Nucleotide Database. https://www.ncbi.nlm.nih.gov/nuccore/MW057772. Screen. 19, 947–958 (2014). Deposited 2 October 2020.
29850 | www.pnas.org/cgi/doi/10.1073/pnas.2005948117 Zulauf and Kirby Downloaded by guest on September 26, 2021