Epidemiology of Β-Lactamase-Producing Enterobacteriaceae in Humans and Livestock

Epidemiology of β-lactamase-producing Enterobacteriaceae in Humans and Livestock

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Dixie Francis Mollenkopf, M.S.

Graduate Program in Comparative and Veterinary Medicine

The Ohio State University

2017

Dissertation Committee:

Joshua Daniels

Gregory Habing

Armando Hoet

Thomas Wittum, Advisor

Copyrighted by

Dixie Francis Mollenkopf

2017

Abstract

Carbapenems have the broadest spectrum of the large β-lactam antimicrobials and have been reserved as a “drug of last resort” against invasive Gram-positive and Gram-negative human infections. The increasing prevalence of complicated MDR infections involving extended spectrum

(ESβL) and AmpC β-lactamases has triggered the increasing need for carbapenem use. The emergence of carbapenemase-producing Enterobactericeae was described as “the end of the antibiotic era” as these potential pathogens harbor highly-mobile genetic elements that confer resistance to our most critically important drugs.

In the US, nontyphoidal Salmonella are a common foodborne zoonotic pathogen causing gastroenteritis. MDR invasive Salmonella infections mediated by ESβL or AmpC genotypes are

more likely to require carbapenem therapy compared to susceptible infections. Of 571 isolates,

we characterized 44 blaCMY-2-bearing Salmonella that resulted from 5,050 individual cattle fecal samples from 68 large (1,000+ head capacity) US feedlots participating in the NAHMS Beef Feedlot

2011 study, and assessed risk factors for blaCMY-2 carriage. Cultured without antimicrobial

selection, the isolates represented eight serotypes and carried the blaCMY-2/IncA/C gene/plasmid combination with most expressing the penta-resistance (ACSSuT) phenotype. Cattle fed chlortetracycline in their diet and heavier weight cattle were less likely to carry Salmonella with

blaCMY-2. In contrast, cattle fed the macrolide feed additive tylosin and cattle in pens with increasing numbers of dairy cattle were more likely to harbor blaCMY-bearing Salmonella.

To determine the prevalence of foodborne resistance mechanisms, we screened human diarrheic stool samples submitted for Clostridium difficle culture from patients of The Ohio State University

Wexner Medical Center (OSUWMC) to estimate the frequency of carriage of ESβL- and AmpC- as well as carbapenemase-producing enteric bacteria. The 692 deidentified samples received between July and December 2013 were cultured using selective media to detect the resistant phenotypes. Our selective culture yielded 184 isolates (26.6 %) with reduced susceptibility to cefotaxime. Of these, 46 (6.7%) samples harbored commensal isolates carrying the AmpC blaCMY.

Another 21 (3.0%) samples produced isolates harboring the ESBL blaCTX-M: 19 carrying CTX-M-15 and 2 with CTX-M-27. Additionally, 13 samples (1.9 %) produced Enterobacteriaceae or

Pseudomonas spp. resistant to carbapenems. Of these, whole genome sequencing identified a prominent CRE strain, sequence type ST258, K. pneumoniae harboring blaKPC-3 and a second K. pneumoniae carrying blaNDM-1 ST1602 which had not been previously reported.

Reporting the first mobile carbapenemase, blaIMP-64 on an IncQ1 plasmid, in US livestock, we followed a cohort of 350+ pigs from late sow gestation to the final finishing phase in order to better understand the maintenance of this rare resistance genotype in a large farrow-to-finish swine operation. Environmental and fecal samples were collected during 8 visits over 5 months in

2016 and screened for CPE using selective media. The frequency of IMP-64-positive environmental (n=32), sow fecal (n=30), and piglet fecal swab (120) samples was highest for all groups when the market pig cohort was between 1 and 10 d, with observed prevalence of 97%,

28%, and 18%, respectively. After weaning, blaIMP-64 was detected in a single environmental sample from a nursery pen, with no CPE recovered in the finishing phase.

iii

For Mom and Dad. Love, Dixie

Acknowledgments

Credit and thanks must be given to my graduate committee members, Dr. Gregory Habing, Dr.

Joshua Daniels, and Dr. Armando Hoet, and especially to my advisor, Dr. Tom Wittum. Without

their knowledge, support and guidance, this character-building experience would have never been possible.

Vita

1997 ...... B.S. Food, Agriculture, and Environmental

Science, The Ohio State University

2012 ...... M.S. Comparative and Veterinary Medicine, The

Ohio State University

Publications

Mollenkopf, DF, Mathys, DA, Dargatz, DA, Erdman, MM, Habing, GG, Daniels, JB, Wittum, TE. 2017. Genotypic and epidemiologic characterization of extended-spectrum cephalosporin resistant Salmonella enterica from US beef feedlots. Prev. Vet. Med. doi: https://doi.org/10.1016/j.prevetmed.2017.08.006. Haywood, L, Spike‐Pierce, D, Barr, B, Mathys, D, Mollenkopf, D. 2017. Gestation length and racing performance in 115 Thoroughbred foals with incomplete tarsal ossification. Equine Vet. J. doi: 10.1111/evj.12712. Mathys, DA, Mollenkopf, DF, Nolting, J, Bowman, AS, Daniels, JB, Wittum, TE. 2017. Extended- Spectrum Cephalosporin-Resistant Enterobacteriaceae in Enteric Microflora of Wild Ducks. J. Wildl. Dis. 53(3):690-694. Adams, RJ, Mathys, DA, Mollenkopf, DF, Whittle, A, Daniels, JB, Wittum, TE. 2017. Carbapenemase-Producing Aeromonas veronii Disseminated in the Environment of an Equine Specialty Hospital. Vector Borne Zoonotic Dis. 17(6):439-442. Mathys, D, Mollenkopf, D, Bremer, C, Daniels, J, Wittum, T. 2017. Prevalence of AmpC‐and Extended‐Spectrum β‐Lactamase‐Harbouring Enterobacteriaceae in Faecal Flora of a Healthy Domestic Canine Population. Zoonoses Public Hlth. doi: 10.1111/zph.12341. Mathys, DA, Mathys, BA, Mollenkopf, DF, Daniels, JB, Wittum, TE. 2017. Enterobacteriaceae Harboring AmpC (blaCMY) and ESBL (blaCTX-M) in Migratory and Nonmigratory Wild Songbird Populations on Ohio Dairies. Vector Borne Zoonotic Dis. 17:254-259.

Landers, T, Mollenkopf, D, Faubel, R, Dent, A, Pancholi, P, Daniels, J, Wittum, T. 2017. Extended‐ Spectrum β‐lactam Resistance in the Enteric Flora of Patients at a Tertiary Care Medical Centre. Zoonoses and Public Health. 64:161-164. Mollenkopf, DF, Stull, JW, Mathys, DA, Bowman, AS, Feicht, SM, Grooters, SV, Daniels, JB, Wittum, TE. 2016. Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States. Antimicrob. Agents Chemother. 61:e01298- 16 Habing, GG, Kessler, SE, Mollenkopf, DF, Wittum, TE, Anderson, TC, Barton Behravesh, C, Joseph, LA, Erdman, MM. 2015. Distribution and Diversity of Salmonella Strains in Shipments of Hatchling Poultry, United States, 2013. Zoonoses Public Hlth. 62:375-380. Mollenkopf, DF, Faubel, RL, Pancholi, P, Landers, TF, Erdman, MM, Daniels, JB, Wittum, TE. 2015. Surveillance and Characterization of Carbapenemase-Producing Klebsiella pneumoniae Recovered from Patient Stool Samples at a Tertiary Care Medical Center. Antimicrob Agents Chemother. 59:5857-5859. Mollenkopf, DF, Cenera, JK, Bryant, EM, King, CA, Kashoma, I, Kumar, A, Funk, JA, Rajashekara, G, Wittum, TE. 2014. Organic or Antibiotic-Free Labeling Does Not Impact the Recovery of Enteric Pathogens and Antimicrobial-Resistant Escherichia coli from Fresh Retail Chicken. Foodborne Pathog Dis. 11:920-929. Mollenkopf, DF, Mirecki, JM, Daniels, JB, Funk, JA, Henry, SC, Hansen, GE, Davies, PR, Donovan, TS, Wittum, TE. 2013. Escherichia coli and Klebsiella pneumoniae producing CTX-M cephalosporinase from swine finishing barns and their association with antimicrobial use. Appl. Environ. Microbiol. 79:1052-1054. Mollenkopf, DF, Weeman, MF, Daniels, JB, Abley, MJ, Mathews, JL, Gebreyes, WA, Wittum, TE. 2012. Variable within- and between-herd diversity of CTX-M cephalosporinase-bearing Escherichia coli isolates from dairy cattle. Appl. Environ. Microbiol. 78:4552-4560. doi: 10.1128/AEM.00373-12. Wittum, TE, Mollenkopf, DF, Erdman, MM. 2012. Detection of Salmonella enterica Isolates Producing CTX-M Cephalosporinase in US Livestock Populations. Appl. Environ. Microbiol. 78:7487-7491. Mollenkopf, DF, Kleinhenz, KE, Funk, JA, Gebreyes, WA, Wittum, TE. 2011. Salmonella enterica and Escherichia coli Harboring blaCMY in Retail Beef and Pork Products. Foodborne Pathog Dis. 8:333-336. doi: 10.1089/fpd.2010.0701. Lutz, EA, McCarty, MJ, Mollenkopf, DF, Funk, JA, Gebreyes, WA, Wittum, TE. 2011. Ceftiofur use in finishing swine barns and the recovery of fecal Escherichia coli or Salmonella spp. resistant to ceftriaxone. Foodborne Pathog Dis. 8:1229-1234. Wittum, TE, Mollenkopf, DF, Daniels, JB, Parkinson, AE, Mathews, JL, Fry, PR, Abley, MJ, Gebreyes, WA. 2010. CTX-M-Type Extended-Spectrum β-Lactamases Present in Escherichia coli from the Feces of Cattle in Ohio, United States. Foodborne Pathog Dis. 7:1575-1579.

vii

Mollenkopf, DF, Glendening, C, Wittum, TE, Funk, JA, Tragesser, LA, Morley, PS. 2010. Association of dry cow therapy with the antimicrobial susceptibility of fecal coliform bacteria in dairy cows. Prev. Vet. Med. 96:30-35.

Fields of Study

Major Field: Comparative and Veterinary Medicine

viii

Table of Contents

Abstract ...... i

Acknowledgments...... v

Vita ...... vi

List of Tables ...... xii

List of Figures ...... xiv

Chapter 1: Introduction ...... 1

Chapter 2: Current state of the “Big Five” ...... 4

Carbapenemase-producing Enterobacteriacae and their trek from humans to the environment

and on to livestock ...... 4

KPC – The American-made Carbapenemase ...... 7

NDM – A global gift from the Indian subcontinent ...... 13

IMP ...... 21

VIM ...... 26

OXA ...... 30

What the heck do we do now? ...... 34

Chapter 3: Genotypic and epidemiologic characterization of extended-spectrum cephalosporin resistant Salmonella enterica from US beef feedlots ...... 39

Abstract ...... 40

Introduction ...... 41

Materials and methods ...... 42

Study population ...... 42

Resistance characterization ...... 43

Identifying blaCMY-2-harboring plasmids ...... 44

Describing Salmonella isolate relatedness ...... 44

Assessing the probability of extended-spectrum cephalosporin resistant Salmonella ...... 45

Results ...... 48

Discussion ...... 54

Chapter 4: Surveillance and characterization of carbapenemase-producing Klebsiella

pneumoniae recovered from patient stool samples at a tertiary care medical center ...... 60

Acknowledgements ...... 65

Chapter 5: Extended Spectrum β-lactam Resistance in the Enteric Flora of Healthcare Patients 66

Summary ...... 67

Impacts ...... 68

Introduction ...... 68

Materials and methods ...... 69 x

Results ...... 70

Discussion ...... 71

Conclusion ...... 72

Chapter 6: Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States ...... 74

Abstract ...... 75

Introduction ...... 76

Materials and methods ...... 77

Results ...... 79

Discussion ...... 88

Chapter 7: Maintenance of carbapenemase-producing Enterobacteriaceae in a farrow-to-finish swine production system ...... 92

Abstract ...... 93

Introduction ...... 94

Materials and methods ...... 95

Results ...... 97

Discussion ...... 102

Chapter 8: Conclusions ...... 106

References ...... 113

List of Tables

Table 1: Feedlot-reported pen level descriptive data collected for each of the 202 pens of cattle

on 68 US feedlots participating in the Salmonella prevalence component of the 2011 NAHMS beef

feedlot study. These variables were used to address possible risk fact ors for the presence of

Salmonella or extended-spectrum cephalosporin resistant Salmonella from the collected fecal

samples...... 46

Table 2:Serotypes and pen types of 44 blaCMY-2-bearing Salmonella isolates cultured from fecal

samples collected in 13 (6.4%) pens on 8 (11.8%) US feedlots participating in the 2011 NAHMS

beef feedlot study ...... 50

Table 3: Results of pen level logistic regression models generated assess survey factors impacting

the carriage of blaCMY-2 Salmonella in the enteric flora of feedlot cattle compared with cattle that

did not harbor blaCMY-2 Salmonella (cattle that were Salmonella-negative or were Salmonella- positive without blaCMY-2) (Model 1), cattle that were Salmonella negative (Model 2), and cattle harboring ESC susceptible Salmonella (Model 3). A total of 44 blaCMY-2-bearing Salmonella isolates

were cultured from fecal samples collected in 13 (6.4%) pens on 8 (11.8%) US feedlots

participating in the 2011 NAHMS beef feedlot study...... 54

Table 4: Resistance phenotypes of suspect carbapenemase-producing Enterobacteriacea cultured from 692 human diarrheic stool submissions received as part of the OSUMC C. difficile surveillance program at the OSU-East Diagnostic Laboratory from July to December, 2013 ...... 62

xii

Table 5: Dendrographic relatedness of K. penumoniae CRE-185 recovered from an OSUWMC

patient stool sample and 5 blaKPC-bearing K. pneunomiae isolates recovered from OSUMC patient clinical diagnostic submissions during the same month. After electrophoresis, ban ding patterns were compared and levels of similarity assigned using generally accepted criteria (6). blaKPC- bearing K. pneumoniae isolates were assessed using the Dice coefficient similarity index and the unweighted pair-group method with arithmetic averages (UPGMA) with clustering settings of

1.00% optimization and 1.00% band position tolerance via Bionumerics software (Applied Maths,

Kortrijik, Belgium)...... 63

Table 6: Phenotypic and genotypic prevalences of ESC resistant isolates recovered using selective

media from stool samples of 692 healthcare patients of The Ohio State University Wexner Medical

Center between July and December, 2013 ...... 71

Table 7: Conjugative plasmid content of 18 environmental isolates harboring blaIMP-27 on an

IncQ1 plasmid recovered from the nursery and farrowing barns of a single swine production

system ...... 84

a Table 8: Minimum inhibitiory concentration of 24 antimicrobials for 18 blaIMP-harboring environmental isolates recovered from the nursery and farrowing barns of a single swine production systemb ...... 86

xiii

List of Figures

Figure 1: Susceptibility profiles of 26 antimicrobial agents for 44 Salmonella isolates containing

blaCMY-2 recovered from fecal samples collected in 13 (6.4%) pens on 8 (11.8%) US beef feedlots participating in the 2011 NAHMS beef feedlot study (numbers of isol ates are shown in the body

of the table). Blue lines represent susceptible breakpoints and red lines represent resistant

breakpoints where available. Corresponding to the concentration listed at the top of each column

(µg/ml), the included range of each antimicrobial is shown in gray...... 52

Figure 2: Map of functional genes and truncated open reading frames (*) on an IncQ1 plasmid

(GenBank accession no. KY126032) present in multiple bacterial species isolated from the environment of a piglet nursery barn at a U.S. swine operation. The replication (rep), mobilization

(mob) , integration, and antibiotic resistance genes are depicted...... 87

Figure 3: Sample prevalence of blaIMP-64-harboring Enterobacteriaceae from sow fecal samples, piglet fecal swabs, finisher pig fecal samples, and electrostatic cloth environmental samples collected from a farrowing, nursery, and finishing barn of a single swine production flow over a five month period...... 99

xiv

Chapter 1: Introduction

Knowing something about cows doesn’t exactly equate to a doctoral dissertation, but that’s how

I got to this point. I grew up on a cow-calf operation in southern Ohio - the same farm as my

father, grandfather, and great-grandfather. I believe the scientific terminology is ‘endemic

population’. Growing up as the fourth generation on our farm, I have always been a huge

proponent of animal health, and agriculture, in general.

Knowing something about cows qualified me to work in veterinary research and I started out with absolutely no laboratory skills. The project I started working on focused on antimicrobial susceptibility patterns of commensal E. coli from the enteric flora of Ohio dairy cows. We (it’s always we – we’re Team Wittum) visited forty dairy farms four times over two years and collected

fecal samples from all cows on each visit for that study. Samples were then inoculated to

MacConkey agar to identify E.coli and one isolate was selected for susceptibility testing using

minimum inhibitory concentrations (MIC) to approximately sixteen antibiotics. We collected data

on isolates from several thousand dairy cows and I only remember being kicked twice…by the

same cow.

Commensal E.coli from Ohio dairy cattle are best described as pan-susceptible and we quickly

began to explore selecting for bacterial with resistance phenotypes. We tried applying different 1

antimicrobial selection pressures in vivo to some cows at the OSU Beef Center and when we

applied a therapeutic dose of ceftiofur, it started the research path I’m still working on.

Ceftiofur is the veterinary extended spectrum cephalosporin that is equivalent to ceftriaxone and

cefotaxime used in human medicine. Since antibiotic use is generally followed by antibiotic

resistance, the use of ceftiofur in livestock that will enter the food chain has always been

controversial. Human medicine blames animal agriculture for resistance and we (I) proponents of

agriculture blame the human doctors. Problematically, bacteria resistant to ceftiofur will also be

resistant to its human counterparts. If ceftiofur-resistant bacteria cause infections in humans, the drugs of choice to treat those most at risk will be rendered ineffective.

There are two predominant ceftiofur resistance genes in US livestock, blaCMY-2 and blaCTX-M.

Fortunately phenotype most often follows genotype and we developed a two-step selection method to distinguish between the two β-lactamases. The first, blaCMY-2, emerged in the late

1990’s and we characterized the epidemiology CMY-2 and the relationships of ceftiofur use in

multiple livestock species. In the early field studies, we found a low prevalence of CMY-2-bearing

Enterobacteriaceae in swine populations (0.8%) and about one-third of dairy cows (34.8%) carried

CMY-2 bacteria. Prevalence increased over time, and now we expect almost all livestock fecal samples to be positive for CMY-2 genes.

We saw this same trend in our field work characterizing the blaCTX-M gene in US livestock. We reported the first CTX-M isolates in US livestock in 2010 and prevalences now approach 100% in some production systems. High prevalences of both the CMY and CTX genotypes are often found 2

in populations where ceftiofur use is also high and it could be hypothesized that antimicrobial

selection pressure plays a key role in the maintanence of this resistence phenotype.

We have studied the epidemiology of extended spectrum cephalosporin resistance primarily in

livestock, but also in humans, companion animals, wildlife, and the environment. Now, we are

moving on to the β-lactam ‘drugs of last resort’, the carbapenems. These are reserved for the life- threatening MDR infections, but bacteria have out-smarted us again. The prevalence of carbapenemase-producing Enterobacteriaceae (CPE) is climbing, Chapters 6 and 7 in this dissertation describe the first report of plasmid-mediated carbapenemases in US livestock and their environment, and that means we have a lot more work to do.

Going forward, as in any research field, there are more questions to answer. Plasmid-mediated carbapenemases have been identified in animals intended to enter the food chain. How do we mitigate the threat of foodborne transmission? Can we eliminate, or at least reduce, carbapenem resistance phenotypes once introduced into production livestock? Additionally, we need to consider the environment. Livestock waste is often spread or knifed into crop fields as fertilized.

What is the fate of CPE in this agricultural environment? All these questions need to be addressed…keep reading, I need to get back to work.

Chapter 2: Current state of the “Big Five”

Carbapenemase-producing Enterobacteriacae and their trek from humans to the environment

and on to livestock

Highly efficacious and highly tolerable, β-lactams are the most commonly prescribed antibiotics today. The β-lactams encompass over half of all antimicrobial drugs and are identified by their four-membered β-lactam ring structure.1 The broadest reaching of this drug class, the carbapenems have been used in clinical healthcare since the introduction of imipenem in 1985.2

Carbapenems have been reserved as a “drug of last resort” against invasive Gram-positive and

Gram-negative human infections, but even with judicious use, resistance was report less than ten

years later.3

The first sparse reports of carbapenemase-producing Enterobacteriaceae (CPE) were described as

heralding the end of the antibiotic era4 because these potential pathogens harbor highly mobile

genetic elements that confer resistance to our most critically important, front-line antimicrobial drugs.5 Triggered by the increasing need for carbapenem use to treat extended-spectrum

cephalosporin resistance, the expansion of this commonly multidrug resistant (MDR) phenotype

threatens the efficacy of the critically important carbapenems as well as multiple other drug

classes. In many cases, these carbapenemases are located on large plasmids carrying additional

resistance genes resulting in isolates with, at times, near pan-resistant phenotypes. Today CPE are

increasing at an accelerating pace and the epidemic emergence and rapid dissemination of these

MDR organisms directly threatens public health worldwide. Both the CDC and WHO have listed

carbapenem resistant infections as highest-level concerns to human health.6, 7

The most important ‘Big Five’ carbapenemases are divided into three enzymatic classes: the

Ambler class A serine carbapenemases (KPC), the class B metallo-β-lactamases (NDM, IMP, and

VIM), and the class D oxacillinases (OXA). True carbapenemases are responsible for bacterial non- susceptibility to virtually all β-lactam antimicrobials without additional genetic mechanisms such as porin or binding site mutations.8 Plasmid-mediated carbapenemases were first reported nearly

30 years ago, but luckily, in many regions, these mobile genes are still predominately recovered

only in human clinical settings. As opportunistic bacteria, the carbapenemases are frequently

associated with urinary tract infections (UTI), device-associated infections, septicemia, peritonitis,

and soft tissue infections.9

At increased risk for carbapenem-resistant infection, patients suffering from severe clinical illness are often transitioned to long-term acute care hospitals (LTACH) for extended acute care. These healthcare facilities quickly were identified as important facilities in the regional dissemination of

CPE. Specializing in patients with severe clinical illness, receiving often multiple antimicrobial therapies, LTACH have been noted as ‘perfect storm’ facilities for antimicrobial resistance.10 While relatively new to the hospital industry, LTACH can receive patients directly from intensive care units (ICU) of acute care hospitals who are already infected with MDR bacterial infections.10

Human community-associated CPE infections (CAI) are still considered rare in comparison to nosocomial infections, but the often-silent prevalence of CAI remains unknown11 Colonization of the enteric flora which may precede infection could occur by oro-fecal transmission via contaminated hands, food, or water within the community.9 It would be expected that asymptomatic carriage would play a role in the dissemination of CPE into community settings. Of

1,800+ hospitalized patients considered colonized with CPE, the subsequent cumulative infection rate was 16.5% with 10% mortality.12 However, transient carriage or colonization is rarely detected unless infection follows. Moreover, although CPE carriage or colonization would likely be a prerequisite for infection, the prevalence of colonizations in the community that progress to clinical infection is not known. A scoping review of CPE in the community evaluated fifteen studies predominately from Asia, North America and Europe. Only 10 of these studies reported community-associated or community-onset CPE infections, with prevalences ranging from <0.1 to

30% of individuals (US study prevalences ranged from 6 to 11%). Notably in these studies,

‘community-acquired’ is poorly defined and in many cases should be considered ‘community onset’, suggesting some connection to healthcare 11. In a study of CPE in seven US communities,

8% of cases had no documented healthcare exposure but it remains unknown how well this finding may represent a true community-associated prevalence.13

Previously demonstrated with other β-lactamase genes, initial reports stem from healthcare associated human clinical isolates, followed by detection of community-acquired infections and later in isolates of animal origin. Problematically, the often highly mobile, plasmid-mediated CPE are now reported beyond the realm of human healthcare, as causes of community-acquired infections, in the natural environment and in livestock populations.14-18 6

KPC – The American-made Carbapenemase

Among the class A carbapenemases, Klebsiella pneumoniae carbapenemases (KPC) are the most clinically significant. They are predominantly identified in the nosocomial pathogen K. pneumoniae and found on transferrable plasmids. Utilizing a catalytically active serine residue to hydrolyze the β-lactam ring, KPCs effectively convey resistance to β-lactam drugs including carbapenems, but are at least partially inhibited by the β-lactamase inhibitors.19, 20

Carbapenemase production mediated by blaKPC-1 first emerged in 1996 in a K. pneumoniae 1534

isolate collect from a North Carolina hospital as part of the Centers for Disease Control (CDC)

Intensive Care Antimicrobial Resistance Epidemiology project (ICARE).21 This isolate showed

minimum inhibitory concentrations (MIC) of 16 μg/ml to both meropenem and imipenem and

was also resistant to extended-spectrum cephalosporins and aztrenam, but was inhibited by clavulanic acid. DNA sequencing revealed this isolate carried a novel carbapenemase gene, blaKPC-

22 1, as well as TEM-1 and a novel SHV-29. Initially thought to differ from KPC-2 by a single

23 nucleotide, KPC-1 was later found to be identical to the KPC-2 gene. In late 1998 blaKPC-2 was

recovered from human clinical outbreak infections in seven New York City metropolitan hospitals

in Brooklyn and Queens between November, 1997 and July, 2002.24 Plasmid-mediated KPC-2 quickly disseminated in healthcare settings in the Eastern US and was detected in not only clinical

Klebsiella25-28 strains, but also Enterobacter,29 Salmonella,27 and later, Escherichia coli.25, 30

Differing by only a single nucleotide, blaKPC-3 was the cause of a second human clinical outbreak

among 24 patients in 4 intensive care units of Tisch Hospital, NYU Medical Center, between April 7

2000 and April 200131 Following early outbreaks, KPC-producing K. pneumoniae became a frequent nosocomial pathogen in New York City healthcare.32

An opportunistic bacterial pathogen, KPC is strongly linked to healthcare-associated infections

(HAI) in immunocompromised patients including the very old, very young and those with

underlying illness. Nosocomial KPC-producing K. pneumoniae isolates are most often associated

with urine, blood, respiratory, and wound infections and, problematically, associated with in-

patient mortality.33 In a case-control study at Mt. Sinai Hospital, New York City, KPC infection was independently associated with recent stem-cell or organ transplant, mechanical ventilation, increased length of hospitalization, and exposure to extended-spectrum cephalosporin or carbapenems. Cases were more likely to die in the hospital and were more likely to die from infection compared to controls.34 Another case-control study, conducted at the Hospital of the

University of Pennsylvania and Penn Presbyterian Medical Center, both of Philadelphia, PA, identified severe illness, prior fluoroquinolone use and prior extended-spectrum cephalosporin use as independent risk factors for KPC infection.33

Until 2005, the geographic reach of KPC extended to New England and the mid-Atlantic US where the gene was considered endemic in health care facilities.24 In February, 2005, the first non-US K. pneumonia isolate carrying a plasmid-mediated KPC-2 was identified in a patient hospitalized at

Cochin hospital in Paris, France. In November, 2005, a second KPC isolate was identified in France.

This isolate, an Enterobacter cloacae harboring KPC-3 was cultured from a surgical abscess debridement performed at the Institut Gustave-Roussy, Villejuif. While the isolates were

unrelated, both patients had been recently admitted to New York City hospital ICUs before their

admissions to French hospitals.35, 36

The first non-US outbreak began in the Tel Aviv Sourasky Medical Center, Israel in October, 2005 and continued through December, 2006. This 18-month outbreak was mediated by both KPC-2 and KPC-3 carried by multiple K. pneumoniae PFGE pulsotypes. Comparison of Israeli and US outbreak-associated K. pneumoniae pulsotypes revealed clonality or highly related isolates from

Israel and New York, New Jersey and Arizona outbreaks.32, 37 A tertiary care hospital in the popular

tourist destination of Crete (Greece) experienced a KPC-2-mediated outbreak in May, 2007. This outbreak, which lasted 12 months, involved patients with no recent history of international travel.

However, the hospital, Venizeleio General, had admitted a patient from the French hospital identified in that countries’ first KPC-2 K. pneumoniae case.38 These reports of international

occurrences of clonal KPC outbreaks emphasized the ease of transmission of this highly resistant

phenotype and other KPC infections associated with international travel began to emerge.

Nosocomial KPC infections and outbreaks were soon reported in many parts of Europe,39-42 Asia,43

South America,44, 45 and Canada.46, 47 Today human clinical KPC-bearing isolates have been reported to the CDC from all US states except Idaho and Maine 48 and this resistance genotype is now considered endemic in the US, southern Europe, Israel, China, and parts of South America.11

Moving beyond human healthcare, KPC-producing Enterobacteriaceae have been found in environmental matrices which present serious implications to public health.49 Effluent water samples collected in August and December, 2008, at a hospital wastewater treatment plant

(WWTP) in metropolitan Rio de Janiero, Brazil carried KPC-2 K. pneumonia.50 Additional KPC-2 9

isolates were later recovered in 2013 from multiple Enterobacteriacaea species including

Aeromonas sp., Citrobacter sp., Enterobacter sp., K. pneumoniae, and Kluyvera sp. These isolates were collected from multiple recreational surface waters in Rio de Janiero.51, 52 These findings

highlight the concerning waste-mediated dissemination of KPC from a hospital setting into open

public waterways.

In Europe, E. coli ST410 harboring KPC-2 on an IncF plasmid were cultured in 2010 from water samples collected from a river which transects the city of Santo Tirso in Northern Portugal. Rarely reported even in endemic regions, this was the first report of KPC-bearing E. coli in the country.53

KPC-2 E. coli have also been recovered from a river ecosystem in neighboring Spain. A set of six

KPC-2 Enterobacteriaceae (3 E. coli, 2 Enterobacter cloacae, 1 K. pneumoniae, 1 K. oxytoca) were found in samples from water and sediment collected the Llobregat River, Catalunya, in 2014. The three E. coli were unrelated to the Portuguese isolate and represented three different sequence

types (216, 1434, and 5001) with KPC-2 carried in IncN and IncR plasmids.54 Real-time PCR (qPCR) quantification of KPC-2 gene copies in hospital effluent from two facilities in the Catalonia region of northeastern Spain was 4.4*107 and 5.4*104 per milliter sample55

In 2010, isolates selected on chromogenic agar from WWTP influent samples in Chengdu, Sichuan

Province, China, revealed both C. freundii and E. cloacae with KPC-2. Although this WWTP services at least one local metropolitan hospital, of the 12,500+ healthcare-associated Enterobacteriaceae

isolates recovered in the previous eighteen months, only four isolates (3 K. oxytoca and 1 E.

cloacae) were reported with KPC.56 qPCR analysis of wastewater and dewatered sludge from a

WWTP in Northern China found KPC-2 bacterial strains which included reported clinical pathogens 10

Klebsiella sp., Enterococcus sp., Acinetobacter sp., and E. coli, as well as the indigenous bacteria,

Paenibacillus sp. which could be explained by horizontal transfer of resistance mechanics. KPC-2 gene copies per milliter sample at the WWTP showed a reduction from 2.2*105 in raw influent to final effluent estimates of 1.5*103. 57 Further study of the receiving river found higher abundance of KPC genes at the WWTF outflow and downstream locations compared to upstream of the plant.58

Recently, blaKPC-4-bearing E. cloacae were recovered from two dogs treated at the Ohio State

University Veterinary Medical Center and from environmental samples collected at the Columbus

Zoo, both in Columbus, OH. Although one of the dogs had been previously hospitalized and treated with antimicrobials for multiple ailments, the second dog was presented for a bite wound and had no history of hospitalization or antimicrobial therapy. From the zoo, three resistant E. cloacae isolates were collected on electrostatic cloths from multiple human/animal contact surfaces at two locations within the zoo. All five resulting isolates carried highly related IncHI2 plasmids bearing the KPC-4 gene (Daniels, unpublished data). A review of human clinical carbapenemase-producing Enterobacteriaceae described ST78 and ST171 E. cloacae with KPC-4

as part of a Tn4401b transposon on IncHI2 and InN plasmids recovered as early as 2011 from the

Clinical Microbiology Laboratory at Brigham and Women’s Hospital, Boston, MA.59 Clinical and

microbiologic data (2006–2015) assembled from the US Veterans Health Administration (VHA)

describe the epidemic dissemination of KPC K. pneumoniae from the eastern US westward and the appearance of KPC E. cloacae. Displacing K. pneumoniae, Enterobacter is now described as

60 the bacterial strain predominating the new US blaKPC “second epidemic”.

To date, 27 KPC gene variants have been characterized and submitted to GenBank61 with KPC-2

62, 63 and KPC-3 remaining the most widely disseminated. Part of the global expansion of blaKPC is

due to a single K. pneumonia clone, sequence type 258 (ST 258), which may account for as much

as 70% of CDC’s K. pneumoniae PFGE isolate database64 and has been identified as the dominant

KPC-harboring clone worldwide.65 This sequence type is part of a 96 member clonal complex,

CC292, which is globally disseminated.62 While ST 258 may have played a role in the global

expansion of KPC, restriction profiles of KPC-harboring plasmids revealed multiple diverse banding patterns within this bacterial strain.64 KPC-bearing isolates are found in other Klebsiella strains and occur in multiple Enterobacteriaceae species as well as Acinetobacter sp. and Pseudomonas sp. Regardless of bacterial species or plasmid incompatibility group, blaKPC is associated with the

Tn3-based 5 isoform (denoted as a to e) transposon Tn4401 (North and South America and

Europe) and, in some reports, Tn1720 (Asia)66 which are theorized to be at the origin of this resistance phenotype’s plasmid mobilization39 and geographic dissemination.67 Notwithstanding bacterial species, plasmid group, or gene sequence type, the multifocal emergence of KPC suggests a human-mediated international spread as opposed to the repeated acquisition of similar carbapenemase mechanisms by prevalent clones.62

This genotype is now widely disseminated in human healthcare and has been recovered from the

environment and in the community, but, surprisingly, has not been reported in livestock. While

reports are rare, the other “Big Five” – NDM, IMP, VIM, and OXA – have been identified in food

animals68 In some cases, bacteria with these carbapenemase genes are cultured from samples collected from morbid animals, but an equal proportion of carbapenemase-positive samples are collected, often at harvest, from healthy livestock. KPC genes are carried by Enterobacteriaceae 12

that are part of the normal enteric flora of livestock. Expected to be only a small proportion of the

bacterial population of the intestinal microbiota, we can hypothesize that KPC-bearing bacteria

are present in food animals, but have not yet been detected. Perhaps enhanced surveillance

would detect the presence of bacteria with this resistance genotype.

NDM – A global gift from the Indian subcontinent

New Delhi metallo-β-lactamases (NDM) are the most recent emerging carbapenemases and

NDM-bearing carbapenemase-producing strains may be considered the most virulent69 A class B metallo-β-lactamase (MβL), NDM exhibit broad spectrum hydrolytic activity to penicillins, cephalosprins and carbapenems, relying on the β-lactam to interact with Zn2+ ions at the active

cite. Activity is not suppressed by the β-lactamase inhibitors, but they are susceptible to the

monobactam aztreonam.19 NDM strains are especially threatening because they confer the most extensive complement of resistance phenotypes observed to date, including not only all β-lactams and inhibitors, but also the fluoroquinolones and aminoglycosides. While more commonly observed in Klebsiella sp. and extraintestinal E. coli infections initially,70 NDM is frequently carried

on broad host range plasmids which can move to multiple bacteria including: Enterobacteriaceae,

Aeromonas, Pseudomonas, Stenotrophomonas, and Vibrio cholera.71

First cultured in 2007 from a Swedish patient who had received medical treatment in New Delhi,

72 India, one-month prior, blaNDM-1 was harbored by K. pneumoniae and E.coli fecal isolates. A survey of isolates referred to the UK Health Protection Agency’s national reference laboratory from 2003 to 2009, along with isolates from Chennai and Haryana, India, Bangladesh, and Pakistan 13

showed a rapid escalation in NDM-1-bearing Enterobacteriaceae after 2007. NDM was first detected in the UK in 2008 and was the predominant CPE phenotype in 2009, accounting for 44% of the 73 carbapenemase-producer submissions that year. Nearly 60% of infected UK patients had traveled to India or Pakistan in the past year and almost half had been hospitalized there. Of the

188 CPE isolates from Chennai and Haryana, 31% and 55%, respectively, were NDM-1 producers.70

Retrospective analysis of isolate collections found NDM was circulating in the Indian subcontinent

as early as 2006 73. By 2010, the prevalence of NDM in the enteric flora of both inpatients and

outpatients in India and Pakistan was estimated to be as high as 18.5%.74, 75

Proposed as a second NDM reservoir, five patients with NDM infections from Belgium, Denmark,

Germany, and Slovenia with no history of travel to the Indian subcontinent had been hospitalized

in the Balkan countries.76 These five patients were among 55 NDM-1 positive cases, of which 33 had recent travel history to India.77 Initial NDM isolates in the Balkans in 2007 may be associated with kidney transplant tourism to Pakistan78 which is similar to reports of medical tourism as a link to some UK NDM-1 infections.70 Later, the Arabian Peninsula was also hypothesized as a third

NDM reservoir, but the majority of this dissemination could be explained by the movement of

people between the Middle East and the Indian subcontinent.79, 80

The first patient colonized with K.pneumoniae carrying NDM-1 in Taiwan was a repatriated man who had recently been hospitalized in India in 2010 for a gun-shot injury.81 This case report evoked lengthy discussions as to cautionary management of colonized patients in Taiwan.82 NDM-1- producing isolates were first identified in China in 2011. An investigation of over 11,000 clinical

Gram-negative bacilli yielded four diverse Acinetobacter baumannii carrying NDM-1 on different 14

plasmids, but NDM was not detected in Enterobacteriaceae or Pseudomonas isolates.83 In

Thailand, the first NDM isolates were found in a screening of clinical Enterobacteriaceae isolates collected in a university hospital between October, 2010, and August, 2011. The six NDM isolates were comprised of two E. coli, two K. pneumoniae, and two Citrobacter and were cultured from three patients with no history of international travel.84

With the exception of Central and South America, NDM-1 had disseminated globally by 20109

when the first clinical infections were reported in the US.85 The first US pediatric NDM infection

involved a 13-month-old boy admitted to a California medical center five months following

hospitalization in Pakistan.86 Soon after, the first US-detected NDM-harboring Salmonella was reported in 2011.87 The Salmonella isolate, an S. Seftenberg, was characterized in a set of nine

NDM clinical isolates from eight US patients submitted to the CDC in 2009 and 2010. In addition to Salmonella, this set included five K. pneumoniae, two E. coli and an E. cloacae.88 All of the early

US cases occurred in patients with a history of recent international travel, and often,

hospitalization or medical care in India or Pakistan.86, 89

As of January, 2017, NDM isolates have been reported from over half of all US states, of 175 reported NDM-producing CPE, the majority accumulated in Illinois (n=81).48 Of the 81 NDM cases in Illinois, 44 were associated with endoscopic procedures at a single 650-bed teaching and referral hospital in northeastern Illinois during 2013. The initial NDM-producing E. coli was cultured in March from a hospitalized patient with no history of international travel. Between

March and July, six additional cases emerged and a source investigation began in August.

Elucidating possible nosocomial transmission routes, both NDM-producing E. coli and KPC- 15

producing K. pneumoniae were recovered from the terminal end of a manually cleaned and

previously disinfected endoscopic device in that hospital.90, 91

There is a paucity of information regarding CPE persistence in non-endemic regions. In 2011, the

Oregon Drug Resistant Organism Prevention and Coordinated Regional Epidemiology (DROP-CRE) network began CRE surveillance and transmission prevention.92 Having previously reported two

KPC-producing K. pneumoniae, DROP-CRE identified the first NDM in Oregon in November, 2013.

The E. coli isolate carried both NDM-1 and CTX-M-27 on an IncF plasmid. The isolate was cultured from a man with a lower leg wound he had suffered at home. Despite treatment with an expired antimicrobial ointment, an infection progressed and the man received local outpatient medical treatment. Neither the man nor his spouse reported common CPE risk exposures such as international travel or hospitalization. DROP-CRE then launched an in depth investigation to find the source and curb possible further transmission. Multiple laboratory reviews, care provider interviews, household screenings, site visits, and environmental testing yielded an NDM-positive

E.coli isolate identical to the wound isolate. This clone, collected two months post infection, was cultured from the household vacuum cleaner bag93 Previous research has demonstrated the

survival of Salmonella in vacuum dust for up to two months.94 This NDM clone provides evidence of environmental persistence of carbapenem-resistant pathogens and potential novel transmission routes.

Described as the first locally-acquired NDM-mediated infection in Canada, an 86-year-old stroke patient was admitted twice to a rehabitiliation center following hospitalization. Upon his second admittance, urine culture revealed an NDM-bearing Morganella morganii although he showed no 16

signs of clinical infection.95 A MDR K. pneumoniae cystitis was described in an 83-year-old woman living with her husband in a small town in southern France. The woman, with no international travel, had a history of UTIs that were previously treated with narrow spectrum antimicrobials.

The NDM-1-producing Klebsiella isolated in this community-acquired autochthonous case also

96 harbored blaCTX-M-15 on a second plasmid, with both being ≈150 kb. An autochthonous and

community-acquired NDM-1-mediated infection that was susceptible to tetracycline and colistin was also reported in a 91-year-old woman in the Aquitaine region of France. In September, 2011, the woman, who lived in an apartment within an eldercare facility, developed an acute NDM K. pneumoniae cystitis which was successfully resolved. Later urine culture revealed a similar NDM- producing K. pneumoniae isolate that was now resistant to colistin.97

It was hypothesized that in India, by 2010, NDM-1 was circulating in the community environment.

Extended spectrum β-lactamases were previously reported in the Indian community and a prevalence study of New Delhi drinking water and seepage water (puddles or run-off) found 2 of

50 tap water samples and 12 of 171 seepage samples positive for bacteria bearing NDM-1.

Associated plasmids were large, ranging from 140 to 400 kb and conjugation was more successful at 30°C – the approximate ambient temperature in New Delhi – compared to 25°C or 37°C.71 One

year later, K. pneumoniae isolates positive for NDM-1 were cultured from environmental samples

collected at two locations along the Kim Nguu River, which runs through the highly populated city

of Hanoi, Vietnam. Vietnam is linked to India both economically and culturally, with people

frequently moving between the two countries. Furthermore, antimicrobials are indiscriminately

used and freely available in Vietnam.98

Multiple Acinetobacter strains have been associated with NDM-1 in China. Moving into the environment, NDM-1-carrying Acinetobacter johnsonii isolates were recovered from hospital effluent in western China in 2010.99 Of 119 water samples also collected in 2010 from local rivers,

treated drinking water, local hospital wastewater, seepage, and community wastewater in

Beijing, China, ten A. baumannii isolates containing NDM-1 were identified. All ten isolates were recovered from the hospital wastewater samples.100 In WWTP effluent and dewatered sludge

from two facilities in northern China in 2011, NDM-1 gene copies per milliliter sample was in the range of 1.3*103 to 1.6*103 in effluent samples discharged into the Haihe River and 4.1*107 to

8.4*107 in waste sludge that is applied to crop soils.101

In addition to water, soil can serve as an antimicrobial resistance reservoir, allowing for the exchange of mobile resistance elements from commensal organisms to human clinical pathogens.102 Of 83 soil samples collected from or near livestock farms in Zhejiang province,

China, two samples collected from soil approximately 15 cm (≈6”) below the soil surface – one from a swine farm and one from a cattle farm – yielded Acinetobacter with NDM-1. Livestock fecal samples (n=30) and wastewater samples (n=6) were also collected at these locations, but no carbapenemase-producing isolates were recovered.103

Carbapenemase-producing Acinetobacter was found in one of 396 swab samples taken from livestock on farms and at harvest in eastern China in 2011. The A. Iwoffii isolate with NDM-1 was cultured from a farm-collected meat-chicken cloacal swab. Antimicrobial use records on the poultry farm indicted penicillins, narrow and extended spectrum cephalosporin use to treat and prevent bacterial infections in the flocks.104 At harvest, nearly 1,300 individual livestock samples 18

were taken in South China’s Guangdong province from November, 2011 to May, 2012 to

investigate NDM-1 prevalence in bacteria of food animal origin. Collected from animals from commercial pig, chicken and duck farms, a single A. baumannii from the lung tissue of a pig with sepsis and pneumonia was positive for the resistance gene. Treatment records reported the use a multiple β-lactams, alone or in combination with β-lactamase inhibitors.105 Another survey of

Chinese livestock accessed NDM carriage in bacteria from 334 lung tissue samples from the

Foshan University diagnostic laboratory in 2013. Three E. coli, two A. baumannii, and an A.

calcoaceticus cultured from six morbid pig lungs were found bearing NDM-1. NDM genes were located on plasmids ranging from ≈47 to 200 kb.106 Fecal samples were collected from healthy and diarrheic pigs on ten Indian government farms from 2014 to 2016. Of the 673 fecal samples, 8 E. coli isolates with NDM were recovered. Seven of the isolates carried NDM-1, while one carried

NDM-5. From four different farms, all of the NDM-positive pigs were gilts less than 90 doa and only one was reported with diarrhea.107 An E. coli with NDM-9 and the colistin resistance gene mrc-1 co-located on an untypeable 100 kb plasmid was cultured from retail chicken wings purchased in July, 2014, from a metropolitan supermarket in Guangzhou, China. This isolates also carried CTX-M-65 on a second, smaller, transferrable plasmid.108

In March 2015, raw milk samples from seven family farms in Algeria were cultured to better

understand carbapenemase gene presence in milk intended for local consumption in the Bejaia,

Algeria area. Thirty-four samples produced four clonal ST1284 E. coli isolates with NDM-5, CTX-

M-15 and CMY-42 from the teats and milk of 2 cows on the same farm. NDM-5 was located on an

IncX3 plasmid of approximately 50 kb. An E.coli isolate with NDM-5 was detected in milk from a dairy cow with clinical mastitis in India in 2012, but the plasmid type was not reported.109 19

However, IncX3 plasmids bearing NDM-5 have also been reported in human clinical infections in

China and Australia.110, 111

The German Salmonella Reference Laboratory houses a collection of over 67,000 isolates. One S.

Corvallis ST1541 isolate showed carbapenem resistance and was analyzed by PCR and plasmid

typing. The isolate harbored NDM-1 and the AmpC blaCMY-16 on a ≈180 kb IncA/C plasmid. S.

Corvallis are rare in Germany, but more prevalent in the Balkan countries. The NDM-1 isolate was collected in 2012 from a migratory raptor, a black kite, which seasonally migrates between Europe and North Africa, often crossing the Balkans.112 Kites spend a majority of their lives near water and the intake of contaminated water could be a source for resistant phenotypes.113

In 2013, FDA researchers reported the recovery of blaNDM-1 E. coli from veterinary diagnostic submissions in the US. The isolates, received between May, 2008 and May, 2009, were cultured from five dogs and a domestic cat in four states.114 Antimicrobial treatment or owner travel

histories were not available. Previously reported in Algeria, in 2015, a rectal swab from a German

Shepard, collected at a clinic in Bejaia, Algeria, carried multiple E. coli isolates expressing NDM-5.

Although the dog had visited the clinic for treatment of a digital tumor, previous antimicrobial

history was not reported.115 In the same city, a survey of 200 rectal swabs were collected from healthy and morbid dogs and cats presented to a local veterinary clinic to screen for carbapenemase production. Collected in late 2014 and early 2015, CPE screening found an NDM-

5 E.coli which also carried blaCTX-M-15. This isolate was cultured from a healthy dog with no antimicrobial history that had been presented for vaccinations.116

If science needs a good example of an antimicrobial resistance threat, blaNDM is an excellent choice. Originating in a geographic location that combines a dense human population with often- poor sanitation and high antibiotic use,117 the NDM gene had already disseminated to a second

continent by the time it was first detected in human healthcare in 2007. Within a few years this

MDR resistance gene was being cultured from both nosocomial and community-acquired infections. By 2015, only eight years after NDM-1 first emerged, this genotype has demonstrated an extensive geographic diffusion pattern and has been reported in human, companion animal, food animal, and environmental isolates.17, 68 Notably, the population-dense environment combined with poor sanitation and frequent antibiotic application that produced this resistance genotype is markedly similar to modern, intensively-managed animal agriculture populations.

IMP

Now endemic in Japan, in 1988 a clinical P. aeruginosa isolates was more fully characterized due to its ability to enzymatically reduced β-lactam drugs including imipenem. This isolate carried a plasmid-mediated carbapenemase that was transferable within bacteria species and may have been the first IMP, but the isolated was not preserved.118 The first reported IMP infection was identified at Aichi Hospital, Okazaki, Japan in 1991. The imipenem resistant Serratia marcescens isolate was cultured from a complicated UTI. The novel resistance gene blaIMP-1 in this case was

chromosomally mediated, but could be transferred in vitro among species of the same bacterial

family.119 Concern over this recent finding prompted a survey of S. marcescens strains collected from seven hospitals in the Aichi Prefecture of Japan’s Chūbu region, near Okazaki. From April to

May, 1993, 105 S. marcescens clinical isolates were collected. From the 105 isolates, 19% showed 21

reduced susceptibility to imipenem and of these, four isolates carried the plasmid-mediated IMP-

1. While three of the isolates were from a single hospital and had IMP on an ≈25 kb plasmid that could only be moved by transformation, one S. marcescens, from the hospital nearest Okazaki, harbored the IMP on a 120 kb plasmid with could be conjugated to an E. coli recipient.120 Between

1992 and 1994, a larger survey of 3,700 P. aeruginosa isolates from seventeen Japanese general hospitals found fifteen P. aeruginosa with clonal IMP genes and flanking regions that were in very diverse bacterial strains. Clonal within hospital, eleven of the isolates were from hospitals in

Nagasaki and Kumamoto where outbreaks had been reported.121

Widely reported in S. marcescens and P. aeruginosa in Japan, IMP-1 was first discovered in a K.

pneumoniae isolate in China in 1996. The IMP-expressing K.pneumoniae was culture from a 25-

year-old leukemia patient in Singapore who received imipenem as treatment for neutropenic

fever. Isolated from blood culture, multiple antimicrobial drugs were required to successfully treat

the infection.122 Imipenem-resistant Pseudomonas and Acinetobacter isolates from twenty-eight hospitals in the Korean Nationwide Surveillance of Antimicrobial Resistance Group collected in

2000 and 2001 were screened for metallo-β-lactamase production. From over 600 isolates, >10% were metallo-β-lactamase producers with 11 of 38 MβL Acinetobacter producing the IMP-1 enzyme.123

As IMP disseminated beyond Asia, this resistance gene made its way to Europe and appeared in

Italy in 1997.124 An A. baumannii recovered from an Italian inpatient at the Intensive Care Unit

of the Verona University Hospital showed resistance to carbapenems and β-lactams. Carried on an integron-borne gene cassette, PCR methodologies identified a novel allelic variant, IMP-2, 22

differing from IMP-1 by approximately 12%.125 Sharing 91% identity with IMP-1, an outbreak in a

Canadian hospital was mediated by a new IMP allele, IMP-7. This novel sequence type was recognized during a 1995 outbreak in two rehabilitation units at the Bow Valley Center of Calgary

General Hospital, Calgary, Alberta. The IMP-7-producing P. aeruginosa mediated infections affected nine spinal injury patients causing UTIs. The following year the rehabilitation program moved to nearby Foothills Hospital and between January and October, fifteen addition patients were infected. Improved isolation and infection control practices curbed the multi-facility outbreak.126

Reported in 2002, the first clinical IMP-1 A. baumannii was isolated from the tracheal secretion

sample of a patient who developed pneumonia while hospitalized at Hospital São Paulo. It is

estimated that carbapenem-resistance among Acinetobacter isolates is approaching 10% in this

127 600-bed Brazilian teaching hospital with other mechanisms, including blaSPM-1, involved. In

2004, a 17-year-old lymphoma patient at Women’s and Children’s Hospital, Adelaide, Australia,

developed neutropenic fevers during chemotherapy hospitalization. Over two weeks after

antimicrobial treatment with meropenem, blood cultures revealed P. aeruginosa harboring IMP-

4. Metallo-β-lactamases had not previously been reported in Australia and IMP-4 had not been reported beyond Asia.128 Less frequent in Enterobacteriaceae, based on submissions to HPA

Microbiology Services, Colindale, clinical Enterobacter cloacae isolates with IMP were first

observed in the UK in 2008-09. Three IMP-1-bearing isolates were identified in blood and urine cultures from ICU patients.129

In L’Aquila, Italy, two IMP-22-bearing Pseudomonas fluorescens isolates were recovered from water samples collected in 2005 and 2006 upstream of a city sewage treatment plant. This novel sequence type was also found in a P. aeruginosa isolate in 2007 from an elderly patient at the

L’Aquila teaching hospital, suggesting the progressive spread of IMP in multiple species and environments.130 In September, 2006, municipal WWTP effluent and activated sludge samples were collected in Bielefeld-Heepen, Germany. Samples were analyzed for 192 resistance-gene- specific genotypes using metagenomic analysis of total plasmid DNA preparations. Multiple IMP sequence types including IMP-2, -5, -9, -11, and -13 were detected in both activated sludge and effluent water samples. Of the 192 reference genes, 64% were found in final effluent which could disseminate to downstream environments.131 River samples were collected in 2010 near Rades and Solimane, Tunisia to assess urban and industrial pollution impacts. A total of 128 isolates with reduced-susceptibility to cefotaxime were recovered. Of these 16 of 25 K. pneumoniae isolates carried IMP genes – IMP-8 (n=6), IMP-10 (n=8), and IMP-13 (n=2) – from river samples collected near Rades thus elucidating the ‘sewage habitat’ as a gathering place for resistance genes.132 IMP-

8 carbapenemase-producing E. coli were recovered from Ave River samples collected in northern

Portugal in 2015. The IMP-8 genes were on large ≈150 kb plasmids which could be conjugated to recipient strains. IMP-8-bearing clinical K. pneumoniae and P. aeruginosa have been previously reported in Portugal and may again signal the movement of CPE beyond hospital settings.133

In the US, IMP clinical isolates remain rare with only eleven reported to CDC as of January 2017.48

The first occurrence of the IMP gene (blaIMP-18) was reported in a P. aeruginosa isolate recovered from the tracheal aspirate of a trauma patient in the southwestern US in 2006.134 The first detection of IMP-producing Enterobacteriaceae strains was reported in K. pneumoniae isolates 24

collected from urine samples of three infants in the pediatric intensive care unit of a single heath

care facility.135 These closely related isolates each carried an IMP-4 gene harbored on a common transferrable plasmid of approximately 100 kb. While the early detection of metallo-β-lactamases in the US was often associated with a history of international travel, these pediatric patients had no travel history and, in fact, one patient had never been outside the hospital setting.135

A novel IMP variant was first identified in 2009 and later in 2011 and 2015. IMP-27 in a class 2

integron were identified in three Proteus mirabilis isolates cultured over a 6-year period from

distinct geographic locations in North America (two US states and Canada). One of the two US

isolates had no plasmid content and expressed a chromosomal IMP-27 while the second isolate carried four large plasmids with IMP-27 both chromosomal and on a large plasmid. The class 2 integron has a premature stop codon in the integrase gene which makes their content very stable and the inclusion of IMP-27 rare.136, 137 The first carbapenemase gene detected in US livestock was

a single-base-change blaIMP-27 variant, identified as IMP-64 (Genbank accession number

KX949735.2),138 in the environment of a swine farrowing and nursery barn. Later found in fecal

samples from farrowing room sows and piglet fecal swabs, the IMP-64 was carried by a

promiscuous IncQ plasmids that appeared to easily move between multiple Enterobactertiaceae

species,139

The first acquired metallo-β-lactamase recognized, blaIMP has now been detected in numerous

Gram-negative bacterial strains isolated from at least eleven countries/regions.140 IMP has been

reported in human clinical infections, the environment, and was, surprisingly, the first carbapenemase gene reported in US livestock.139 But, while IMP has spread world-wide, this 25

genotype is reported far less frequently compared to other MβLs such as NDM and VIM and

appears to remain most problematic in Japan, Taiwan and eastern China where it was originally

reported.117

VIM

Verona integron-encoded MβL (VIM) were first cultured from clinical human isolates in Verona,

Italy in 1997. The newly described VIM-mediated outbreak at the Verona University Hospital began simultaneously with their identification of IMP-2. Between March, 1997 and February,

1998, ten ICU patients were involved in this outbreak of VIM P. aeruginosa isolates.124 A P. aeruginosa from the blood culture of a 39-year-old patient treated with imipenem in Marseilles,

France, in 1996 was identified with a carbapenemase closely related to VIM-1 in Italy. The resistance determinant, VIM-2, was on a 45 kb non-transmissible plasmid. This was the second report of a P. aeruginosa carbapenemase outside Japan.141

A VIM-2 P. aeruginosa-mediated outbreak also occurred in a hospital in Thessaloniki, Greece, in

1996.142 By 2001, the National Surveillance System for Antimicrobial Resistance (WHONET-

Greece) had reported 12% of P. aeruginosa isolates exhibited reduced-susceptibility to imipenem.

Further investigation found, out of fifteen hospitals, VIM-2 P. aeruginosa infections had been identified in nine.143 A survey of Enterobacteriaceae species with reduced susceptibility to carbapenems collected at the Division of Hygiene and Medical Microbiology, Innsbruck Medical

University, Tyro, Austria, between 2006 and 2010 was assessed for CPE using multiplex PCR. Of

the 28 E. cloacae collected, predominately from ICUs, over the 5 year study period, all had a VIM-

1 gene and may have later disseminated to the environment.144

Greece is now the epicenter for VIM-1-bearing Enterobacteriaceae infections with K. pneumoniae and E. coli as the most common bacterial hosts.145 VIM E. coli was first reported in 2001 in a

hospital in Piraeus with sporadic cases and hospital outbreaks reported thereafter.146 VIM-1- producing K. pneumoniae first appeared in ICU wards of three Athens teaching hospitals.147 Greek

System for the Surveillance of Antimicrobial Resistance (GSSAR) found the proportion of

imipenem-resistant clinical K. pneumoniae had climbed from <1% in 2001 to 20% in general

hospital wards and 50% in isolates from patients in ICU by 2006.148

VIM-7 was the first reported MβL detected in the US. The P. aeruginosa isolate was found as part

of the CANCER Antimicrobial Surveillance Program in North America. The isolate was cultured

from an invasive pulmonary sample collected from a 58-year-old cancer patient in Texas in May,

2001. The VIM-7 was located on a 24 kb plasmid that could be easily moved to Enterobacteriaceae

and other Pseudomonas species.149 Later, in May, 2003, a 71-year-old man with no international travel history was admitted to a Chicago public teaching hospital. Post-surgical ventilator- associated pneumonia was treated with imipenem and later blood cultures revealed P. aeruginosa that was only susceptible to aztreonam and later identified as carrying VIM-2. A review of the hospital’s clinical laboratory data detected eleven prior isolates with only aztreonam susceptibility, but the isolates were not preserved. Prospective surveillance detected five additional cases all of which were associated with severe critical illness and receiving IV antibiotics.150 27

Water samples were taken from 58 rivers and lakes in the German-speaking portion of

Switzerland between May and September of 2012 to screen for ESβLs and carbapenemases. In total, ESβLs were found in 21 (36%) of sampled rivers and lakes and a single river tested positive for K. pneumoniae producing VIM. Of note, all positive samples were confined to urban areas.151

E. coli isolates harboring VIM-1 and VIM-34 were detected along with IMP-8 harboring E.coli from

Portugal’s Ave River. Collected in 2015, VIM-1 was located on a mobile plasmid while VIM-34 was estimated to be chromosomally mediated. VIM-34 was identified in Portugal from K. pneumoniae in 2013 and was located on the chromosome.133 VIM-2 has also been reported in water from multiple locations along the Doura River and from sea water along the coast of Portugal (Cellio,

ECCMID 2014, poster, Barcelona, Spain). An investigation of presence and diversity of CPE from the River Mur which flows through the center of Graz, Austria was conducted in late 2015. Four surface water samples taken one month apart were screened on chromID™ CARBA (bioMérieux)

Agar. Two E. cloacae isolates with VIM-1 were grown from the November sampling. Both ST186 isolates contained an HI2 and an F plasmid although VIM-1 plasmid carriage was not noted.152

In 2011, as part of the German RESET project (www.reset-verbund.de), a Salmonella Infantis isolate and 2 E. coli isolates harboring blaVIM-1 on IncHI2 plasmids of ≈220 and 300 kb were cultured

153 from a German swine finishing barn. Two additional blaVIM-1 Salmonella Infantis isolates were also identified from a German poultry farm and a second swine facility in 2011 and 2012.154 Later,

two additional VIM-1 S. Infantis isolates were identified from 2015/2016 submissions to the

German National Reference Laboratory for Salmonella. These isolates, cultured from minced pork meat and a sick piglet, appeared clonally related based on pulsotypic analysis, suggesting vertical 28

155 transmission of the blaVIM-1 genotype. In 2015, another VIM-1-producing E. coli was isolated

from the colon contents of a pig at harvest as part of a German monitoring program. PFGE analysis

found the isolate was highly related to the E. coli isolates recovered from swine in 2011 although

the swine farms were geographically distant. This isolate did not appear to have the 220 kb VIM

plasmid reported earlier and gene carriage was therefore assumed chromosomal. To verify the

persistence of VIM E. coli in swine production, colon contents from an additional five pigs were

collected at harvest. One sample produced four carbapenem-resistant E. coli. These isolates were

also highly related to the 2011 isolates and VIM-1 was localized on ≈180-200 kb plasmids. All five of the 2015-16 E. coli were ST88 and had the VIM-1 gene on a class 1 integron with gene cassettes identical to those described in pigs previously.156

VIM-2-producing P. aeruginosa were detected in livestock fecal samples (pigs, poultry, and cattle)

collected from farms in North Lebanon in 2013. The four resulting isolates all had novel and

distinct sequence types but their geographic relatedness is not known.157 Reported in 2017, fecal

samples from chickens, flies, dogs, wild birds, farm workers as well as sewage were collected at a

commercial poultry farm in Shandong Province, China. A novel gene, VIM-48 with high similarity

to VIM-2 was found in both livestock and the environment. Of 98 non-duplicate samples, four

VIM-positive Pseudomonas isolates were recovered from a swallow, a fly, and two chickens.158

International travel has played a role in the dissemination of carbapenemases and the global food

economy may also have a role in the spread of CPE. A squid was purchased from a Chinese grocery

in Saskatoon, Canada, in January 2014 as part of a drug-resistance surveillance pilot study.

Although there was no country of origin label, it was reported that the squid was a product of 29

South Korea. P. fluorescens was cultured from the squid sample and sequencing confirmed the

isolate produced VIM-2 carbapenemase.159 Although P. fluorescens is not a pathogen, clinical

Salmonella Kentucky isolates producing VIM-1 from France have been hypothesized as foodborne

transmissions.160

As with IMP, blaVIM has also expanded globally, but causes far fewer infections when compared to

NDM. VIM maintains endemnicity in southern Europe and Southeast Asia with scattered reports

in other regions and outbreaks are often mediated by P. aeruginosa rather than

Enterobacteriaceae isolates.117 VIM may be the carbapenemase most frequently found in non- human isolates. The genotype has been cultured from waste and surface water and multiple livestock species – both healthy and morbid – as well as in wild animals and retail meats.68, 155, 160

OXA

The dissemination of OXA-type carbapenemase is primarily attributed to one sequence type, OXA-

48, and a point mutation analog, OXA-181, in some regions.65, 145 The mobile oxacillinases emerged in Turkey in 2001. An OXA-48-harboring K. pneumoniae isolate was cultured from a UTI of a burn patient at the Istanbul Faculty Hospital. The 54-year-old patient had been treated with meropenem and vancomycin for thirty days prior to the isolation of the carbapenemase.161 The first large OXA-48-mediated outbreak occurred from May 2006 to January, 2007 in Turkey. In total

39 carbapenem-resistant K. pneumoniae isolates – 27 from clinical samples and 12 from routine rectal screenings - were collected from patients at the University Hospital of Istanbul. The identified isolates were from two distinct Klebsiella clones. Both clones carried OXA-48, TEM-1 30

and a second ESβL-type OXA (OXA-9, clone A and OXA-1, clone B), but clone A carried SHV-12 while clone B had CTX-M-15. Characteristic of OXA-48 isolates, the carbapenemase gene in both clones was found on a ≈70 kb plasmid and the additional β-lactamase genes increased the carbapenem minimum inhibitory concentrations (MIC) at least 3-fold (≤0.5 to ≥4 μg/ml).162 Many

OXA-48 isolates additionally have ESβLs, but isolates without ESβLs may be susceptible to

65 extended spectrum cephalosporins. The predominant gene, blaOXA-48, has now been reported in

human clinical isolates from many parts of Europe,163, 164 India,73 and Africa.165, 166

OXA-48-production was first recognized in Morocco in 2009. K. pneumoniae bearing OXA-48 was culture from a complicated UTI that had been treated with ertapenem.166 In August 2010, OXA-

48-producing E. cloacae were cultured from two patients in two distinct French hospitals, both of which had been transferred from Moroccan hospitals. Both patients had recently been hospitalized in Morocco. The first patient had been transferred to University Hospital of Saint-

Etienne in southern France from the ICU of the Hospital of Fez in Morocco following an auto accident. No infection had been noted and she was not treated with antimicrobials. Rectal swabs and urine culture both identified E. cloacae with OXA-48. The second patient was admitted to

Morocco’s Hospital of Agadir after suffering a stroke. He was transferred to Bicêtre Hospital in

Paris and OXA-48-bearing Enterobacter was cultured from a fecal swab collected on arrival at the

French hospital’s ICU.167 As demonstrated by the two French patients arriving from Morocco, in

March 2012, high rates of OXA fecal carriage were noted in hospitalized patients in Morocco.

From a collected of 77 fecal swabs from randomly selected patients at the University Hospital of

Rabat, ten (12.8%) OXA-48-producing isolates were recovered. The seven K. pneumoniae and three E. cloacae OXA-bearing isolates were the only carbapenemases detected.168 In addition to 31

clinical isolates in Morocco, S. marcescens harboring OXA-48 was collected in water samples

swabbed from puddles in the city of Marrakech. Two of four water puddle environmental samples tested positive for only OXA carbapenemase genes.169

OXA-48 has also been reported in the community. A 3,200 employee meat processor in

Switzerland which operates 8 urban plants spread throughout the country routinely screens

employees annually for Salmonella fecal carriage. A subset of 1,086 random samples were also

tested for KPC-, NDM- VIM- and OXA-48-type carbapenemase-producing Enterobacteriaceae.

After incubation in Enterobacteriaceae Enrichment broth and inoculation to modified

SUPERCARBA agar, isolates resulting from eleven samples were screened for carbapenemase genes by PCR. One ST58 E. coli isolate was positive for blaOXA-48. The positive employee was a

Turkish citizen who was born and had always lived in Switzerland with no history of hospitalization

or antimicrobial therapy. However, the individual did report traveling to Turkey each year and a

recent trip to Italy less than one month before the sample was collected.170

OXA-producing bacteria have been recovered from livestock and companion animals. In 2010, carbapenamase-producing Acinetobacter genomospecies 15TU was cultured from bovine rectal swabs collected from a dairy cow in France. Resistance of this isolate was mediated by a plasmid- encoded blaOXA-23 gene. Of fifty samples collected, nine yielded Acinetobacter with OXA-23 and it was noted that most of those samples came from cows that had recently received antimicrobial therapy for mastitis.171 OXA-23 was detected from fecal samples collected from twenty horses hospitalized at the Faculty of Veterinary Medicine at Ghent University in Belgium in early 2012.

Two resistant Acinetobacter isolates were cultured from a horse that had been treated for five 32

days with intramuscular penicillin.172 Later that year, in Germany, between June and October, K. pneumoniae and E. coli from veterinary diagnostic submissions were screened from carbapenem- resistance. From this screening, an OXA-48 outbreak was observed at a small-animal veterinary clinic in Hessia, Germany. In total, five K. pneumoniae and three E. coli were cultured from six

dogs over the five month period. All eight isolates also expressed at least one ESβL including CTX-

M-15, CTX-M-1, SHV-12, and an AmpC, CMY-2 and all eight isolates carried the OXA-48 gene on a transferable IncL/M plasmid.173 In a study to detect carbapenemase-producing genes in poultry in

Lebanon, five cloacal swabs were collected from chickens on eight livestock farms and screened

on selective agar. From forty swabs, one resulted in an OXA-48-bearing ST38 E. coli isolate that additionally carried both TEM-1 and CTX-M-14. Mating experiments found the OXA and CTX genes on different mobile plasmids. The positive bird was reported to be alive and healthy and had not received antimicrobial treatment or been in contact with any other animals.174

There are many OXA variants, but few are carbapenemase-producers and even the OXA-48 and -

181 do not confer high-level resistance. Due to this minimum level of resistance, OXA carbapenemase are likely under-reported. Their known spread in humans, multiple animal species and the environment has been sustained by the promiscuity of a self-conjugative IncL/M plasmid that is by far the most reported OXA-48 plasmid and rarely carries any other resistance determinants. Although less prominent in clinical reports, this oxicillinase may have a propensity to spread among Enterobacteriaceae more readily than KPC or NDM.68, 117, 175

What the heck do we do now?

The current literature reveals the expansion of multiple carbapenemase genes from human

healthcare reservoirs, to the community, the environment, and, of most concern, livestock, as

foodborne carbapenemase transmission could potentially put a large portion of the global

population at increased risk. We, as humans, have created this escalating problem of carbapenem

resistance. The anthropogenic application of antibiotic drugs has selected for the movement of

resistance genes from chromosomes to mobile elements such as transposons and plasmids, the

exchange of these mobile resistance mechanisms between bacterial strains, and the

dissemination of these resistant bacteria strains to new host environments.176 We can now define

antimicrobial resistance in two eras: the ‘natural’, often mutation-driven, era occurring in microbes before the development of the first anti-infectives and the ‘acquired’ era of resistance driven by selection pressure provided by antimicrobial use.177 Historically, the β-lactams began the age of modern antibiotic use with Sir Alexander Fleming’s discovery of penicillin in 1928.

Penicillin saved millions of lives that previously would not have been, but even Fleming could forecast the crisis of resistance 100 years later.178 With the introduction of each new generation of antimicrobials, resistance has soon followed until we are now reaching for a new drug to treat complicated carbapenemase-mediated infections that does not exist.

Without the next new generation of β-lactams, human medicine is now forced to resort to older and, at times, ‘less friendly’ therapies to treat CPE infections. Luckily, CPE appear to have been an

‘eye opening’ resistance phenotype for human healthcare. Human hospitals have developed stewardship programs to insure appropriate and judicious antibiotic use and veterinary medicine 34

is following. Stewardship will play a pivotal role in curbing the further resistance evolution. Also,

additional precautions such as CPE fecal screening to identify colonized patients and isolation of

patients positive for CPE carriage is another step to slow CPE dissemination. However, the

movement of carbapenem resistance mechanisms into the environment has already been

demonstrated and CPE have been recovered from food animal populations. The global threat of

antimicrobial resistance in human pathogens is being addressed, but, while CPE in livestock is still

rare (we think), the potential avenue of foodborne transmission warrants concern and

investigation.

The Animal Medicinal Drug Use Clarification Act (AMDUCA) allows for the “extralabel” use of carbapenems in companion animals, but this provision is not extended to food animals.179

However, other powerful veterinary formulations of β-lactam drugs are commonly used in food

producing animals worldwide including the extended spectrum cephalosporin drugs, ceftiofur and

cefquinome. Antibiotic use and antibiotic resistance data collected from seven countries in the

European Union clearly shows a correlation between use and resistance prevalence in food

animals.180 While there remains a paucity of information regarding the exact relationship between

cephalosporin use and carbapenem resistance, the use of these drugs is likely to provide

significant selection pressure favoring bacterial strains expressing carbapenem resistance as they

are resistant to virtually all β-lactams. Therefore, once introduced into livestock animal

populations, the common use of ceftiofur or cefquinome could provide the selection pressure

required for CPE dissemination throughout large, intensively managed food animal populations

housed in animal-dense environments. CPE-harboring potential pathogens can then easily

contaminate carcasses at harvest, allowing contaminated fresh retail meat products to be

distributed over wide geographic areas.

Similar to human reports, CPE in food animal populations can demonstrate both clinical illness and colonization of healthy individuals. The finding of CPE in healthy and well-managed production systems indicates a clear need for remediation strategies for colonized farms. In healthy animals, carbapenemase-producer colonization prevalence has previously been depicted at the sample level found in humans, but true measures of resistant bacterial colony forming units

(cfu) in the enteric flora are not know. Given the dynamic nature of the intestinal flora of livestock, this prevalence of these resistance phenotypes would not remain static. A multitude of factors may impact CPE numbers with the application of antimicrobial therapy as a key concern. The use of extended spectrum cephalosporins in animals intended to enter the food chain has been controversial as long as animal application has been allowed. Despite the controversy, little progress has been made to find reliable and economical antimicrobial alternatives. These alternatives may be crucial to help reduce, if not eliminate, carbapenem resistance phenotypes once detected in livestock populations.181, 182

One alternative to reduce antimicrobial use in livestock is to reduce the need to treat by

preventing disease. Vaccines have been used in veterinary medicine for years to prevent disease,

but they may not be thought of as an alternative to antibiotics. Immunological protection

promoted by vaccination can prevent bacterial infections as well as viral infections. By reducing

the threat of infection, vaccines are a tool to reduce the need to therapeutically treat livestock.

Vaccines, however, are often highly specific, with little cross-protection against even closely

related strains, and can be costly to administer.183, 184 There remains a need for efficacious

vaccines against production-limiting diseases that can be easily administered.

Another group of agents to help keep animals healthy is the feed additives: probiotics, prebiotics,

synbiotics, and organic acids. The addition of exogenous bacteria and organic acids can be used

to modify the enteric microbiota, in turn, maintaining or even improving bacterial health and

deterring pathogen colonization. Numerous versions of exogenous bacteria have been explored

and range from the addition of a single strain to a complex microbiota, all with the goal of

improving the natural gut community. These feed additives are in commercial use currently, but

their true efficacy in livestock production appears inconsistent.185, 186

True antimicrobial alternatives for disease treatment are also needed to combat resistance.

Despite all good efforts to maintain livestock health, some portion of the animal population will still be susceptible to infection and require treatment. Potential antibiotic substitutes include: bacteriophage therapy, endo- and exolysins, bacteriocins, predatory bacteria, and others. Phage therapy has been in practice since the early 1900’s in some form and was extensively researched in the former Soviet Union, but unfortunately, much of that work was poorly documented.

Currently phage therapy research is experiencing a renewal. Lytic phages are most often targeted towards accessible topical infections with strategies aimed at reducing foodborne pathogens in food and the food production environment. Phage therapy is more target specific than antibiotic treatment, but there may still be a broad target range and a potential for resistance to develop.187-

189 Lysins, produced by bacteriophages, take target specific bacterial control farther. These

enzymes digest cell wall for, in nature, phage release, but in therapy, for pathogen destruction. 37

Current work focuses on the Gram-positive cocci and shows little effect on surrounding infected tissues and a low potential for resistance.190

A subcategory of antimicrobial peptides, bacteriocins, are produced by certain bacteria and have

potency against similar strains including resistant phenotypes. These peptides are non-toxic to mammalian cells while still able to inhibit bacterial growth. Bacteriocins can have a narrow or wide spectrum of activity and can be produced in the animal gut by probiotic bacteria. Similar to bacteriophage, there is the potential for resistant pathogens to develop.191

The most unconventional of the alternatives listed above, predatory bacteria also offer

possibilities. The motile Deltaproteobacteria Bdellovibrio and like organisms (BALOs) are the most

well-known and prey on Gram-negative bacteria, burrowing through cell walls to utilize all cell

contents for energy and nutrition. BALOs are able to gain entry into complex microbial

communities such as biofilms which are rarely sensitive to conventional antimicrobials. Predation

experiments have shown the ability of BALOs to predate clinical β-lactamase-producing MDR

strains. As of yet, little is known about the potential of BALOs to colonize the host or interactions

with the native commensal microbiota.192, 193

Both prudent antimicrobial use and effective alternatives to antibiotics are needed today in livestock production not only to preserve and maintain animal health, but also to ensure the safety of our food supply and reduce the risk of CPE colonization in the enteric flora of consumers.

“The challenge of the next few years will be the race between the creation of effective novel molecules and the spread of carbapenemases worldwide.”19

Chapter 3: Genotypic and epidemiologic characterization of extended-spectrum cephalosporin resistant Salmonella enterica from US beef feedlots

D. F. Mollenkopfa, D. A. Mathysa, D. A. Dargatzb, M. M. Erdmanc, G. G. Habinga, J. B. Danielsd, T.

E. Wittuma

a Dept. of Veterinary Preventive Medicine, College of Veterinary Medicine, The Ohio State

University, Columbus, Ohio, USA; b U.S. Department of Agriculture, Center for Epidemiology and

Animal Health, Fort Collins, Colorado, USA; c U.S. Department of Agriculture, National Veterinary

Services Laboratories, Ames, Iowa, USA; d Department of Veterinary Clinical Sciences, The Ohio

State University College of Veterinary Medicine, Columbus, Ohio, USA

Abstract

In the US, nontyphoidal Salmonellae are a common foodborne zoonotic pathogen causing gastroenteritis. Invasive Salmonella infections caused by extended-spectrum cephalosporin resistant (ESCR) phenotypes are more likely to result in treatment failure and adverse health outcomes, especially in severe pediatric Salmonella infections where the extended-spectrum β- lactams are the therapy of choice.

To examine the genetic and epidemiologic characteristics of ESCR Salmonellae which may enter the food chain, we characterized 44 ceftiofur–resistant Salmonella isolates from the National

Animal Health Monitoring System (NAHMS) 2011 beef cattle feedlot health and management study.

As part of the NAHMS Feedlot 2011 study, 5,050 individual fecal samples from 68 large (1,000+ head capacity) feedlots were cultured for Salmonella spp. The resulting 460 positive samples yielded 571 Salmonella isolates with 44 (8%) expressing an AmpC β-lactamase phenotype. These phenotypic blaCMY-2 Salmonella isolates represented 8 serotypes, most commonly S. Newport

(n=14, 32%), S. Typhimurium (n=13, 30%), and S. Reading (n=5, 11%), followed by S. Dublin, S.

Infantis, S. Montevideo, S. Rough O:i;v:1;7, and S. Uganda.

Carriage of the blaCMY-2 gene was confirmed for all isolates expressing an AmpC β-lactamase

phenotype by PCR. Additionally, all 44 isolates were PCR-positive for the presence of an IncA/C plasmid and were shown to carry the blaCMY-2 gene which has been previously reported in multiple species. Other plasmids, including IncN, FIC, and FIIA, were also detected in some isolates. Cattle 40

fed chlortetracycline were less likely to be positive for a blaCMY-2 Salmonella isolate in their enteric

flora compared to those not receiving chlortetracycline during the feeding period. Carriage of

blaCMY-2 was more prevalent in Salmonella isolates originating from lighter weight cattle, cattle fed tylosin and dairy breeds.

Our characterization of the NAHMS Feedlot 2011 study Salmonella isolates with ESCR phenotype shows that while other cephalosporin resistance mechanisms have been reported in US cattle, specific serotypes harboring blaCMY-2 on IncA/C plasmids may be the dominant resistance genotype.

Introduction

In the US, non-typhoidal Salmonella infections are the most physically and economically taxing of all human foodborne bacterial infections194 with direct medical cost associated with Salmonella

infections approaching $4 billion annually.195 Although many Salmonella infections are localized

and self-limiting, more severe invasive cases require antimicrobial therapy and hospitalization. In

such cases, antimicrobial resistance can lengthen the time to successful therapy.196 Extended-

spectrum cephalosporins are a common drug of choice to treat invasive salmonellosis, especially

in the most at-risk groups – children, the elderly and expectant mothers. It has been reported that

patients with cephalosporin-resistant bacterial infections received effective antimicrobial

therapies approximately 60 h later than patients with β-lactam susceptible infections.197

Considered critically important to human medicine by WHO,198 extended spectrum

cephalosporins are also labeled for use in food animal medicine. Intensively managed livestock

populations may play a role in the dissemination of cephalosporin resistance genetics, such as the 41

AmpC blaCMY-2 and the extended spectrum β-lactamase (ESβL) blaCTX-M, and serve as potential

reservoirs for these genes.199-201

Frequently foodborne in origin, Salmonellae can be present in the intestinal flora of all major livestock species – cattle, pigs, and poultry – lending to the possible contamination of fresh retail meat products at harvest.202 While post-harvest interventions can significantly lower the risk of

pathogens such as Salmonella entering the food chain, pre-harvest strategies to reduce

Salmonella prevalence in the enteric flora of livestock may play a significant role in food safety

and animal health. Problematically, the epidemiology of Salmonella in large production systems,

such as beef cattle feedlots, is not clearly understood. To gain a better understanding of the

prevalence and susceptibility profile of Salmonella isolates from beef feedlots, the USDA’s

National Animal Health Monitoring System (NAHMS) screened cattle fecal samples from a subset

of large (>1,000 head capacity) US feedlots participating in the 2011 beef feedlot study. For this

study, we further characterized all isolates with the ESCR phenotype in order to assess feedlot

factors which influenced the prevalence of these multidrug resistant (MDR) Salmonella.

Materials and methods

Study population

Initiated in 1983, NAHMS strives to fill information gaps regarding health, management, and

productivity in domestic livestock. Based on “Cattle on Feed” national population estimate

reports generated by the National Agricultural Statistics Service (NASS), NAHMS identified large

feedlots in 12 US states as their source population for the study, with a subset participating in the

Salmonella component. Feedlots in these 12 states accounted for 96.2% of cattle on feed and

86.1% of feedlots in the US. Therefore, our target population is the US beef herd.

As a component of the 2011 NAHMS beef feedlot study, from volunteering feed yards, 25 fresh

individual fecal samples were collected from the floors of 3 pens of cattle – the shortest time on

feed, longest time on feed, and a randomly selected pen ─ to screen for the presence of Salmonella

based on established NAHMS sampling criteria as previously described.203 As described in the

Fecal Collection Record included in each feedlot sampling kit, the shortest time on feed pen needed to be at the feedlot for a minimum of 48 hours and the randomly selected pen should be half way through the feeding period. A questionnaire to gain descriptive statistics regarding the cattle in each pen, recently included feed ingredients in diets, and antimicrobials or medications which had been added to feed or water since each pen’s arrival accompanied the samples.

Salmonella isolates resulting from the 2011 feedlot study were serotyped and characterized by minimum inhibitory concentrations (MIC) to a standard panel of 15 antimicrobial drugs using a semiautomated broth microdilution system (NARMS CMV2AGNF, Thermo Fisher Scientific,

Oakwood Village, OH) at the National Veterinary Services Laboratory (NVSL).

Resistance characterization

The presence of blaCMY-2 in isolates expressing extended-spectrum cephalosporin resistance was

confirmed by conventional PCR utilizing previously reported primers.204, 205 Sequence typing was

accomplished on a subset of isolates from each serotype using bidirectional sequencing with

corresponding PCR amplification primers, and analysis using BLAST

(http://blast.ncbi.nlm.nih.gov/). Further phenotypic characterization by MIC utilized a 43

combination of 16 β-lactams and β-lactamase inhibitors (ESB1F, Thermo Fisher Scientific,

Oakwood Village, OH).

Identifying blaCMY-2-harboring plasmids

The plasmid content of each isolate was visualized by electrophoresis using a standard plasmid profiling procedure206 as we have previously reported.207 Plasmids were classified into

incompatibility groups according to a plasmid PCR-based replicon typing procedure (PBRT)

detecting 18 replicon types based on incompatibility group loci.208-210 Conjugation experiments211

to establish plasmid carriage and transmissibility of blaCMY-2 utilized a subset of Salmonella isolates as donors with a rifampin- and sodium azide-resistant derivative of E. coli K-12 MG1655 as the recipient strain. Recipient acquisition of the expected plasmid/resistance gene combination was established with additional plasmid profiling followed by blaCMY-2 PCR and PBRT of the

transconjugants.

Describing Salmonella isolate relatedness

Pulsed-field gel electrophoresis (PFGE) genotyping (CHEF-DRIII; Bio-Rad Laboratories, Hercules,

CA), using total genomic DNA, examined the genetic similarity of the Salmonella isolates.

Salmonella embedded agarose plugs were digested using XbaI (Promega, Madison, WI) following standardized protocols212 we have previously utilized.213 After electrophoresis, banding patterns

were compared and levels of similarity assigned using generally accepted criteria.214 Pulsotypic isolate groups were compiled by using the Dice coefficient similarity index and the unweighted pair-group method with arithmetic averages (UPGMA) with clustering settings of 1.00%

44 optimization and 1.00% band position tolerance via Bionumerics software (Applied Maths,

Kortrijik, Belgium).

Assessing the probability of extended-spectrum cephalosporin resistant Salmonella

In total, 3 models were built to assess the relationship between the feedlot-reported descriptive data of the cattle in each sampled pen (including recently included feed ingredients, and antimicrobials or medications which had been added to feed or water since each pens arrival) and the probability of recovery of extended-spectrum cephalosporin resistant Salmonella from their enteric flora was investigated using multivariable logistic regression procedures (Proc GENMOD in SAS version 9.4 [2014]; SAS Institute Inc., Cary, North Carolina). Model 1 estimated the probability of cattle harboring blaCMY-2 Salmonella in their enteric flora compared to cattle that were Salmonella-negative or were Salmonella-positive without blaCMY-2. Generalized estimating equations utilizing an exchangeable working correlation structure and empirical standard errors were utilized to account for expected clustering within pens within feed yards. The questionnaire used to compile the data included in the models is available at: https://www.aphis.usda.gov/animal_health/nahms/feedlot/downloads/feedlot2011ques/fecal. pdf with a list of the included variables presented in Table 1.

Table 1:Feedlot-reported pen level descriptive data collected for each of the 202 pens of cattle on 68 US feedlots participating in the Salmonella prevalence component of the 2011 NAHMS beef feedlot study. These variables were used to address possible risk fact ors for the presence of Salmonella or extended-spectrum cephalosporin resistant Salmonella from the collected fecal samples.

Descriptive statistics Mean Range Std. Dev. Number of beef heifers 45.9 637 86.8 Number of beef steers 84.6 479 99.8 Number of dairy steers or heifers 18.9 319 57.2 Average pen weight at entry (lbs.) 654.4 781 185.3 Current average pen weight (lbs.) 994.6 1195 258.1 Days on feed 105 418 97.45 Number of sick animals since arrival 11.8 530 40.6 Number of deads since arrival 2 35 4.5 Distance shipped (miles) to feedlot 2304.2 10000 3833

Descriptive statistics n Percent Pen type Shortest time on feed 68 33.66 Longest time on feed 68 33.66 Randomly selected pen 66 32.67 Is this pen from a single herd? Yes 45 22.28 No 10 4.95 Don't know 130 64.36 No response 11 5.45 Is this pen drinking chlorinated water? Yes 27 13.37 No 0 0.00 Don't know 170 84.16 Were the animals in this pen vaccinated for Salmonella? Yes 18 8.91 No 183 90.59

Continued on next page

Descriptive statistics n Percent Was this pen mass treated with injectable antibiotic? 46

Table 1 continued:

Yes 29 14.36 Specified antibiotic used: Draxxin 11 5.45 Excede 4 1.98 Micotil 10 4.95 Zactran 4 1.98 No 0 Don't know 170 84.16

Antimicrobials added to feed or water at any time since arrival n Percent Amprolium 3 1.49 Chlortetracycline 68 33.64 Chlortetracycline/sulfamethazine 3 1.49 Decoquinate 10 4.95 Lasalocid 16 7.92 Monensin 127 62.83 Oxytetracycline 11 5.45 Sulfamethazine/sulfadmethoxine 3 1.49 Tylosin 62 30.67

Diet ingredients fed in the last 7 days - n percent Feed additives Probiotics (Lactobacillus acidophilus) 63 31.19 Beta-agonist 24 11.88 Roughage Alfalfa, clover, or sorghum hay 106 52.48 Corn silage 72 35.64 Cotton seed hulls 10 4.93 Alfalfa, clover, or sorghum silage 34 16.83 Other roughage 111 54.91 Concentrates Barley 8 3.96 Brewer's grains/malt - wet 8 3.96 Brewer's grains/malt - dry 5 2.48

Continued on next page

Diet ingredients fed in the last 7 days - n percent Corn 167 82.63

Table 1 continued:

Distiller grains - wet 104 51.47 Distiller grains - dry 51 25.25 Whole wheat 29 14.36 Other concentrates 26 12.85 Proteins Cotton seed - whole 9 4.46 Cotton seed meal 24 11.88 Soybean meal 34 16.83 Urea 83 41.07 Other proteins 29 14.34 Other by-products Corn gluten 23 11.39 Potato waste 4 1.98 Tallow 27 13.37 Other by-products 31 15.33

Any variable with a univariable model p-value of ≤ 0.2 was considered in the multivariable analysis using a forward model building process. Antimicrobials added to feed or water were entered into the models as dichotomous variables. Categorical variables for the type of cattle in each pen – beef steers, beef heifers, dairy steers, mixed – and mass treatment injectable antibiotic used –

Micotil, Draxxin, Excede, Zactran, none – were also tested in the models. Independent variables with p-values ≤ 0.05 based on likelihood ratio Chi squared test remained in the final multivariable analysis. Potential confounding was assessed by adding excluded variables back into the final models and comparing adjusted and un-adjusted odds ratios using a 15 to 20 % cut-off.

Results

A total of 68 large feedlots (≥ 1,000 head capacity) submitted 5,050 individual fecal samples representing 202 pens for Salmonella culture. Salmonella was cultured from samples from 72

pens (35.6%) on 41 feedlots (60.3%). The resulting set of 460 Salmonella positive fecal samples

yielded 44 (7.7%) Salmonella isolates which expressed AmpC-mediated extended-spectrum

cephalosporin resistance. Conventional PCR reactions confirmed the carriage of blaCMY-2 by all

isolates in this subset. No Salmonella isolates resistant to extended-spectrum cephalosporins expressed the blaCTX-M phenotype, with all cefepime MICs below the intermediate breakpoint.

These 44 blaCMY-2-bearing Salmonella isolates were of 8 serotypes collected from 13 (6.4%) pens

on 8 (11.8%) feedlots (Table 2). The most common serotypes were S. Newport (n=14, 32%), S.

Typhimurium (n=13, 30%), and S. Reading (n=5, 11%), followed by S. Dublin (n=4), S. Infantis (n=4),

S. Montevideo (n=2), S. Rough O:i;v:1;7 (n=1), and S. Uganda (n=1). The mean days on feed for

the 3 pen types – shortest time on feed, longest time on feed, and randomly selected – were 12,

228, and 60 days, respectively. A majority of the CMY-2 Salmonella isolates were from cattle in

the randomly selected (n=20, 45%) and shortest time on feed (n=18, 41%) pens, with the longest

time on feed pens contributing 6 isolates (14%).

Table 2:Serotypes and pen types of 44 blaCMY-2-bearing Salmonella isolates cultured from fecal samples collected in 13 (6.4%) pens on 8 (11.8%) US feedlots participating in the 2011 NAHMS beef feedlot study

Serotype n Feedlot # of Pens Pen type 9 A 1 Shortest time on feed Newport 5 E 3 All pen types Typhimurium 13 G 1 Randomly selected 3 D 1 Randomly selected Reading 2 B 2 Shortest & random Infantis 4 H 1 Shortest time on feed 3 F 1 Randomly selected Dublin 1 B 1 Longest time on feed 1 C 1 Shortest time on feed Montevideo 1 E 1 Longest time on feed Rough O:l;v:1;7 1 F 1 Longest time on feed Uganda 1 B 1 Shortest time on feed

Plasmid PCR-based replicon typing found all 44 isolates carried an IncA/C plasmid, with 80% of these carrying only a single large IncA/C plasmid. Conjugation experiments using a subset of wild- type isolates representing each identified serotype, including those carrying multiple plasmids, successfully moved the blaCMY-bearing IncA/C plasmid to E. coli recipients with confirmation of resistance gene and plasmid transfer by standard PCR reactions. Nine Salmonella isolates – 4 S.

Dublin, 2 S. Infantis, 2 S. Typhimurium, and 1 S. Reading – carried at least 1 additional plasmid representing the IncN, IncFIC and IncFIIA replicon types.

Susceptibility profiles found all CMY-2 Salmonella isolates expressed the characteristic CMY- mediated resistance pattern to narrow and extended-spectrum cephalosporins, cephamycins, and the beta-lactamase inhibitors (Figure 1). With the exception of two S. Newport (streptomycin

MIC =32 µg/ml), all isolates also displayed the ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, and tetracycline (ACSSuT) penta-resistance phenotype. Additionally, the 4 S.

Infantis isolates and the single S. Rough O:l;v:1;7 were resistant to aminoglycosides, while 3 S.

Reading and a single S. Dublin were fluoroquinolone resistant.

μg/ml 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 1024 Amoxicillin/ Clavulanic Acid 12 32 Ampicillin 44 Azithromycin 2 36 5 1 Cefazolin 44 Cefepime 44 Cefotaxime 12 23 7 2 Cefoxitin 25 19 Cefpodoxime 44 Ceftazidime 15 20 8 1 Ceftiofur 44 Ceftriaxone 6 22 12 4 Cephalothin 44 Chlorenphenicol 44 Ciprofloxicin 30 7 2 4 1 Gentamicin 1 34 4 4 1 Imipenem 44

52 Kanamycin 39 5

Meropenem 44 Nalidixic Acid 15 22 2 5 Piperacillin/tazobactam 11 15 9 6 3 Streptomycin 2 42 Sulfisoxazole 44 Cefotaxime/clavulanic acid 12 26 4 2 Ceftazidime/clavulanic acid 5 17 21 1 Tetracycline 44 Trimethoprim/ Sulfamethoxazole 23 17 3 1

Figure 1: Susceptibility profiles of 26 antimicrobial agents for 44 Salmonella isolates containing blaCMY-2 recovered from fecal samples collected in 13 (6.4%) pens on 8 (11.8%) US beef feedlots participating in the 2011 NAHMS beef feedlot study (numbers of isol ates are shown in the body of the table). Blue lines represent susceptible breakpoints and red lines represent resistant breakpoints where available. Corresponding to the concentration listed at the top of each column (µg/ml), the included range of each antimicrobial is shown in gray. 52

Dendrographic analysis resulting from PFGE DNA fingerprinting (Figure 2) of CMY-2 Salmonella isolate relatedness revealed an expected high degree of similarity within pens and serotypes.

Isolates from each serotype exhibited >90% homology regardless of feed yard or pen source with the exception of the S. Newport isolates, which represented 2 distinct clonal strains with 75% homology between feed yard sources.

Three logistic regression models (Table 3) assessed survey factors impacting blaCMY-2 Salmonella carriage compared to the following: cattle that did not harbor blaCMY-2 Salmonella (cattle that

were Salmonella-negative or were Salmonella-positive without blaCMY-2) (Model 1), cattle that were Salmonella negative (Model 2), and cattle harboring ESC susceptible Salmonella (Model 3).

When comparing the prevalence of blaCMY-2 Salmonella carriage compared to blaCMY-2 negative status, pens of cattle fed chlortetracycline in their diet at any time since their arrival at the feed yard were less likely to carry Salmonella with blaCMY-2 compared to cattle in pens not receiving

chlortetracycline (OR=0.05, 95% CI 0.01; 0.91, p=0.005). Similarly, the second model assessing

risk factors for blaCMY-2 Salmonella carriage compared to Salmonella negative cattle found that

pens of cattle fed chlortetracycline at any time since arrival were less likely to carry blaCMY-2

Salmonella (OR=0.04, 95% CI 0.004; 0.3, p=0.002). For the model comparing cattle with CMY- bearing Salmonella to cattle with ESC susceptible Salmonella (Model 3), pens of cattle fed tylosin were more likely to harbor blaCMY-2 Salmonella compared to cattle that did not receive tylosin at

any time while in the feed yard (OR=20.1, 95% CI 3.8; 106, p=0.0004). The continuous variables

number of dairy cattle in the pen and current average weight were also significant in this model.

As the number of dairy cattle in the pen increased, the probability of recovering Salmonella with

CMY-2 also increased (OR= 1.019, 95% CI 1.01; 1.028, p=<0.0001). Inversely, cattle in pens with 53

heavier average weights were less likely to have blaCMY-2 Salmonella, with each additional pound

of average pen weight making them 0.996 times as likely (95% CI, 0.993; 0.999, p=0.008) to

harbor Salmonella with CMY.

Table 3: Results of pen level logistic regression models generated assess survey factors impacting the carriage of blaCMY-2 Salmonella in the enteric flora of feedlot cattle compared with cattle that did not harbor blaCMY-2 Salmonella (cattle that were Salmonella-negative or were Salmonella-positive without blaCMY-2) (Model 1), cattle that were Salmonella negative (Model 2), and cattle harboring ESC susceptible Salmonella (Model 3). A total of 44 blaCMY-2-bearing Salmonella isolates were cultured from fecal samples collected in 13 (6.4%) pens on 8 (11.8%) US feedlots participating in the 2011 NAHMS beef feedlot study.

Variable OR 95% CI P-value Model 1 Chlortetracycline fed in diet 0.047 0.0058 0.9097 0.0045 Chlortetracycline not fed 1 - - -

Model 2 Chlortetracycline fed in diet 0.036 0.0043 0.3077 0.0024 Chlortetracycline not fed 1 - - -

Model 3 Number of dairy cattle in pen 1.019 1.01 1.028 <.0001 Current average weight (lbs.) 0.996 0.993 0.999 0.0078 Tylosin fed in diet 20.07 3.797 106.03 0.0004 Tylosin not fed 1 - - -

Discussion

In the US, the β-lactamase gene, blaCMY-2, is a frequent mediator of resistance to cephamycins and β-lactamase inhibitors in Salmonella isolates.215 While this genotype was found in less than

1% (0.87%) of collected fecal samples, nearly 1 of every 12 (7.7%) recovered Salmonella isolates

harbored the CMY-2 gene. The PFGE analysis of these blaCMY-2-bearing isolates shows the

Salmonella are primarily clonal or highly related within serotype, sharing greater than 90%

homology. These data reflect the clonal dissemination of resistant Salmonella strains within populations of feedlot cattle. S. Newport was an exception, showing 2 distinct clades related by only 75%, recovered from different feed yards. While not significant in the current analysis, when segregated by pen type – shortest time on feed, longest time on feed, and randomly selected –

Salmonella with this resistance genotype appear to be more prevalent in the enteric flora of cattle earlier in the feeding period. Antimicrobial use, more likely to occur early in the feeding period or prior to arrival at the feed yard, may provide an ecological niche allowing for the temporary amplification of this resistance phenotype to detectable levels.216 This ecological niche may still be reflected in the samples from cattle in the randomly selected pens which had been on feed for an average of only 60 days and provided nearly half (45.5%) of the blaCMY-2- bearing isolates.

blaCMY-2 can be encoded on a variety of plasmids associated with specific Salmonella serotypes and specific hosts.217 In cattle or beef retail products this gene is most often reported in serotypes

such as S. Newport and carried on an IncA/C plasmid along with a suite of other resistance genes

conveying the ACSSuT penta-resistance phenotype. This MDR-AmpC serotype/plasmid/gene

combination appears very stable in the bovine environment, having been reported in cattle

populations since the 1990’s.205 Since then, plasmid mobility and possible antimicrobial selection pressure may have contributed to the dissemination of CMY-2-encoding IncA/C plasmids between multiple Salmonella serotypes and Enterobacteriaceae species in North American cattle populations.218 55

Ceftiofur, the veterinary extended-spectrum cephalosporin, is used in feedlot cattle for the treatment of bovine respiratory disease and infectious pododermatitis. Ceftiofur can only be used by injection in feedlot cattle and cannot be used in feed or water. While pododermatitis can affect animals at any time, respiratory disease generally occurs in the first 4 to 6 weeks after arrival at the feed yard.219 Therefore, we would expect more cattle to receive ceftiofur early in

the finishing period. The use of ceftiofur in food animal medicine has been previously associated

with Salmonella and other Enterobacteriaceae expressing blaCMY-2 mediated resistance recovered

220, 221 222 from bovine enteric flora. blaCMY-2 isolates can contaminate beef carcasses at harvest and have been reported in fresh retail meat products.215, 223 Resistant to both ceftiofur and the human-medicine counterpart, ceftriaxone, invasive foodborne CMY-bearing Salmonella infections can be especially threatening in pediatric cases.224 In the current study, injectable

antimicrobial use was reported as ‘Don’t know’ for 170 (84.16%) of the collected pens and could therefore be under reported. Only 100 samples (2%) were from pens where cattle were reported to have been treated with ceftiofur during the finishing period, these cattle were from 4 pens in

4 different feed yards. Of these 100 samples, only 9 were positive for Salmonella and none carried the AmpC phenotype.

The feed-grade antimicrobial, chlortetracycline, is often used for the treatment and control of respiratory disease in feedlot cattle. When fed to feedlot steers, chlortetracycline has been found to increase the proportion of tetracycline-resistant E. coli in the enteric flora while decreasing the proportion of AmpC E. coli coresistant to tetracycline.225 In the current study, chlortetracycline was fed in pens where 1624 of the samples were collected (32.2%), and of 56

these, only 1 (2.3%) fecal sample carried Salmonella with blaCMY-2. Identified in two of our models

(Table 3, Models 1 and 2), including chlortetracycline in the diet reduced the likelihood of cattle

harboring blaCMY-2 Salmonella in their enteric flora. The addition of chlortetracycline was a protective factor against CMY-2 when comparing CMY-2 Salmonella harboring cattle to

Salmonella negative cattle as well as to Salmonella-positive cattle without blaCMY-2. However,

chlortetracycline fed following ceftiofur therapy has been shown to increase the time required

226 for blaCMY-2 E. coli prevalence to return to baseline and increase blaCMY-2 and blaCTX-M

prevalences in the enteric metagenome.227 In our study, only a single mixed pen of steers and heifers was reported to have received both chlortetracycline and ceftiofur. All individual pen floor samples (n=25) collected from this pen were Salmonella negative.

Tylosin, a macrolide feed additive, has broad spectrum Gram-positive and limited Gram-negative activity and is often continuously fed in feedlot cattle to reduce the incidence of liver abscesses.228 A study of the effects of feeding feedlot heifers distillers grains alone, with monensin, or with monensin and tylosin found no difference in Salmonella prevalence or antimicrobial susceptibilities.229 Another study using real-time PCR to quantify the abundance of genes conveying resistance to macrolides, lincosamides and streptogramin B (erm genes) and tetracyclines (tet genes) in the enteric flora of crossbred steers fed tylosin found an increase in erm and tet gene occurrence.230 In our study, tylosin was fed in pens that accounted for 1549 of the total samples (30.7%), with samples from tylosin-fed pens accounting for 27 (61.4%) of the

44 recovered blaCMY-2-bearing isolates. These 27 CMY-2 isolates were cultured from samples collected from 8 pens within 5 feed yards. When comparing blaCMY-2-bearing isolates to ESC

susceptible Salmonella (Table 3, Model 3), isolates from pens fed tylosin were more likely to 57

harbor CMY-2 Salmonella compared to isolates from pens that did not receive the macrolide.

Due to their molecular structure being too large to penetrate the outer membrane of Gram-

negative bacteria231 there is a paucity of information regarding the role of macrolides on the

prevalence of β-lactam resistant Gram-negative bacteria.

As the number of dairy cattle in a pen increased, the probability of a Salmonella isolate recovered

from that pen harboring the AmpC genotype increased. The total number of cattle in the pen

was subsequently tested as a possible confounder but was not associated with the outcome.

NAHMS Dairy 2007 reported Salmonella was cultured from healthy cows on 39.7% of US

dairies232 whereas only 9.2% of US beef cow herds were Salmonella positive.233 The within herd

Salmonella prevalence on Ohio dairies has been reported to be as high as 97% of lactating

cows.234 Also, conventional dairy operations frequently include ceftiofur as a therapeutic option

for the treatment of sick animals.207 High prevalences of ceftiofur-resistance in Salmonella

isolates have been reported in young dairy calves intended to enter the food chain and may lend

to dairy steers entering feed yards with this ceftiofur-resistant pathogen in their enteric flora.235

Salmonella isolates from heavier cattle were less likely to have the blaCMY-2 genotype, and this association was not confounded by time on feed. It would be expected that the heaviest cattle have been in the feed yard for the longest time and are well past the 4 to 6 week early transition period where cattle are most likely to receive antimicrobial therapies, such as ceftiofur, which could select for the AmpC genotype. Following ceftiofur therapy, it has been demonstrated that the bacterial fitness cost of resistant E. coli phenotypes reduced their prevalence to pre- therapeutic baseline levels within approximately two weeks after treatment216 We would expect 58

that without selection pressure, even in previously treated cattle where resistant phenotypes

may be amplified, the prevalence of blaCMY-2 Salmonella isolates would have returned to a

baseline level below detectable limits in older, heavier cattle.

Most human Salmonella infections are the result of zoonotic foodborne transmission from

livestock and poultry reservoirs where extended-spectrum cephalosporins are commonly

236 220 used. Reported over two decades ago in US cattle, in this 2011 study, blaCMY-2 remains the

dominant ESCR Salmonella genotype and appears exclusively carried on an IncA/C plasmid in

isolates recovered from US feedlot cattle. Associated with the penta-resistance ACSSuT phenotypes, CMY-bearing Salmonella isolates appear to be more prevalent earlier in the feeding

period when cattle are more likely to have recently received antimicrobial therapies such as

ceftiofur, although we were unable to statistically detect this difference. While E. coli isolates

237 bearing blaCTX-M have been cultured from the enteric flora of US feedlot cattle, we did not recover any Salmonella isolates with this genotype from these 2011 study samples although the same selection pressures would be expected to apply to both the blaCMY-2 and blaCTX-M genotypes.

Due to the dynamic nature of both the US beef feedlot industry238 and enteric flora of beef

cattle,239 we would expect to see some variability regarding the distribution of Salmonella strains and antimicrobial resistance mechanisms across feedlots and over time.203 However, this MDR-

AmpC plasmid/gene combination has remained the dominant resistance genotype.240

Chapter 4: Surveillance and characterization of carbapenemase-producing Klebsiella pneumoniae recovered from patient stool samples at a tertiary care medical center

Dixie F. Mollenkopfa, Roger L. Faubelb, Preeti Pancholib, Timothy F. Landersc, Matthew M.

Erdmand, Joshua B. Danielse, Thomas E. Wittuma

a Department of Veterinary Preventive Medicine, The Ohio State University College of Veterinary

Medicine, Columbus, OH, USA; bClinical Microbiology Laboratory, University Hospital East, The

Ohio State University Wexner Medical Center, Columbus, OH, USA; cThe Ohio State University

College of Nursing, Columbus, OH, USA; dDiagnostic Bacteriology Laboratory, National Veterinary

Services Laboratories (NVSL), USDA, Ames, Iowa, USA; eDepartment of Veterinary Clinical

Sciences, The Ohio State University College of Veterinary Medicine, Columbus, OH, USA

The enteric microbiota of hospitalized patients serves as one reservoir for resistant

Enterobacteriaceae infections, although it has not been well characterized. To better understand

this potential reservoir of nosocomial carbapenem-resistant organisms, we estimated the

frequency of carriage of coliform bacteria harboring carbapenemase resistance genes in patient

enteric flora.

We screened patient diarrheic stool samples submitted for Clostridium difficle culture from

patients of The Ohio State University Wexner Medical Center (OSUWMC) to estimate the

frequency of carriage of carbapenemase-producing enteric bacteria. Submissions (n=692)

received at the OSUWMC Clinical Diagnostic Laboratory between July and December 2013 were

deidentified and aliquoted to a transport swab and couriered to our laboratory. Initially, each

sample swab was inoculated to MacConkey broth modified with 2 μg/ml cefotaxime, incubated overnight at 37°C, and subsequently inoculated to MacConkey agar supplemented with meropenem 2 µg/ml. Resulting lactose (+) Enterobacteriaceae isolates were tested for their ability to reduce carbapenem antimicrobials using Modified Hodge241 and Carba NP tests.242

Speciation was performed via MALDI-TOF mass spectrometry (Bruker, Billerca, MA) and

carbapenemase carriage was confirmed by both PCR and whole genome sequencing (Illuminia

MiSeq, San Diego, CA).

From our selective culture, 13 samples (1.9 %) produced Enterobacteriaceae or Pseudomonas

spp. resistant to meropenem from the 692 total stool submissions (Table 1). Of these, two K.

pneumoniae (0.3%) produced positive Modified Hodge and Carba NP test results, respectively.

Standard PCR confirmed one K. pneumoniae, CRE-185, to harbor bla KPC-3 while the second, CRE-

626, carried bla NDM-1.

Submission a Cephalosporinase Isolate ID Bacterial Species Resistance Phenotype date genes

Carbapenemase-producing Enterobacteriaceae Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 8/5/2013 CRE-185 Klebsiella pneumoniae KPC-3, LEN11 Cip, Fis, Gen, Imi, Mer, Nal, Pod, P/T4, Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Fis, NDM-1, CTX-M-15, 11/1/2013 CRE-626 Klebsiella pneumoniae Gen, Imi, Mer, Nal, Pod, P/T4, Str, Sxt, Tet, Xnl TEM-1A, OKP-B-3

Enterobacteriaceae with reduced susceptibility to carbapenems 7/8/2013 CRE-4b Not determined Not determined CTX-M Group 1 Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 7/15/2013 CRE-53 Klebsiella pneumoniae CTX-M Group 1 Cip, Fis, Imi, Mer, Nal, Pod, P/T4, Str, Sxt, Tet, Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 7/24/2013 CRE-123 Klebsiella pneumoniae CTX-M Group 1 Cip, Fis, Imi, Mer, Nal, Pod, P/T4, Str, Sxt, Tet, Xnl Amp, Aug2, Axo, Cep, Faz, Fot, Fox, Caz, Pod, P/T4, 7/25/2013 CRE-126 Enterobacter cloacae Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 7/31/2013 CRE-150 Enterobacter cloacae Imi, Mer, Pod, P/T4, Xnl Amp, Aug2, Axo, Cep, Faz, Fot, Fox, Caz, Imi, Mer, 8/7/2013 CRE-209 Enterobacter aerogenes Pod, P/T4, Xnl Amp, Aug2, Axo, Cep, Faz, Fot, Fox, Caz, Pod, P/T4, 8/8/2013 CRE-222 Enterobacter aerogenes Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 8/19/2013 CRE-266 Enterobacter cloacae Cip, Fis, Imi, Mer, Nal, Pod, P/T4, Tet, Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, 8/19/2013 CRE-279 Klebsiella pneumoniae CMY Cip, Fis, Gen, , Mer, Nal, Pod, P/T4, Str, Sxt, Tet, Xnl Amp, Aug2, Axo, Cep, Faz, Fep, Fot, Fox, Caz, Chl, Fis, 9/16/2013 CRE-438 Pseudomonas aeruginosa CTX-M Group 1 Imi, Mer, Pod, P/T4, Sxt, Tet, Xnl Amp, Aug2, Axo, Cep, Faz, Fot, Fox, Caz, Chl, Pod, 9/16/2013 CRE-447 Enterobacter cloacae P/T4, Tet, Xnl

a Amp (Ampicillin), Aug2 (Amoxicillin/clavulanic acid 2:1 ratio), Axo (Ceftriaxone), Azi (Azithromycin), Cep (Cephalothin), Faz (Cefazolin), Fep (Cefepime), Fot (Cefotaxime), Fox (Cefoxitin), Caz (Ceftazidime),Chl (Chloramphenicol), Cip (Ciprofloxicin), Fis (Sulfisoxazole), Gen (Gentamicin), Imi (Imipenem), Mer (Meropenem), Nal (Nalidixic acid), Pod (Cefpodoxime), P/T4 (Pipercillin/tazobactam constant 4), Str (Streptomycin), Sxt (Trimethoprim/sulfamethoxazole), Taz (Ceftazidime), Tet (Tetracycline), T/C (Ceftazidime-Clavulanic Acid), F/C (Cefotaxime-Clavulanic Acid), Xnl (Ceftiofur)

Whole genome sequencing identified CRE-185 as MLST sequence type ST258 and CRE-626 as

ST1602. K. pneumoniae ST258 harboring blaKPC-3 is a prominent CRE strain in the US and worldwide

64 . K. pneumoniae ST1602 carrying blaNDM-1 have not been previously reported.

Table 5: Dendrographic relatedness of K. penumoniae CRE-185 recovered from an OSUWMC patient stool sample and 5 blaKPC-bearing K. pneunomiae isolates recovered from OSUMC patient clinical diagnostic submissions during the same month. After electrophoresis, ban ding patterns were compared and levels of 214 similarity assigned using generally accepted criteria. blaKPC-bearing K. pneumoniae isolates were assessed using the Dice coefficient similarity index and the unweighted pair-ŐƌŽƵƉ ŵĞƚŚŽĚ ǁŝƚŚ ĂƌŝƚŚŵĞƚŝĐ ĂǀĞƌĂŐĞƐ ;hW'DͿ ǁŝƚŚ ĐůƵƐƚĞƌŝŶŐ ƐĞƚƚŝŶŐƐ ŽĨ 1.00% optimization and 1.00% band position tolerance via Bionumerics software (Applied MatŚƐ͕<ŽƌƚƌŝũŝŬ͕ĞůŐŝƵŵͿ͘

K. pneumoniae harboring blaKPC have been previously recovered from patients of the OSUWMC

ďǇ ƚŚĞ ůŝŶŝĐĂů ŝĂŐŶŽƐƚŝĐ >ĂďŽƌĂƚŽƌǇ͘ /ůůƵƐƚƌĂƚĞĚ ŝŶ ƚŚĞ ĚĞŶĚƌŽŐƌĂŵ ;&ŝŐƵƌĞ ϭͿ͕ ŝŽŶƵŵĞƌŝĐƐ

;ƉƉůŝĞĚDĂƚŚƐ͕<ŽƌƚƌŝũŝŬ͕ĞůŐŝƵŵͿĂŶĂůǇƐŝƐof PFGE banding patterns of CRE-185 and five blaKPC

K. pneumoniae isolates recovered from OSUWMC patient clinical diagnostic submissions during

the two months prior to our recovery of CRE-185 revealed highly dissimilar strains, suggesting a

diverse reservoir.

63 In addition to blaKPC-3, K. pneumoniae CRE-185, carried a second β-lactam resistance gene, blaLEN-

11. Multiple aminoglycoside and quinolone resistance genes, and single fosfomycin, phenicol,

and sulphonamide resistance genes were also detected. Four plasmid replicon types were

identified - FIB(K), FII(K), R, and ColE. K. pneumoniae ST258 with similar plasmid content and

243 harboring blaKPC-3 have been previously recovered in Italy.

Sequencing of CRE-626 harboring blaNDM-1 identified 3 additional β-lactam resistance genes –

blaCTX-M-15, blaTEM-1A, and blaOKP-B-3. Multiple aminoglycoside and sulphonamide resistance genes

were detected as well as individual genes conveying resistance to quinolones, tetracycline, and

trimethoprim. CRE-626 carried the NDM-MAR plasmid which represents incompatibility groups

FIB(Mar) and HI1B. This plasmid with a highly similar resistance genotype was originally identified in K. pneumoniae recovered from hospitalized patients in Morocco and has been subsequently

fully sequenced.244 Additionally, CRE-626 carried incompatibility group FIA(HI1), FII(K), and ColE

plasmids.

We did not detect carbapenemase production by the remaining 11 meropenem-resistant

isolates. This subset included 4 Enterobacter cloacae, 3 K. pneumoniae, 2 E. aerogenes, 1

Pseudomonas aeruginosa and a single unspeciated isolate that could not be recovered from storage. Carbapenem resistance in these isolates may be due to several factors including: increased expression of efflux systems, reduced porin expression, increased chromosomal cephalosporinase activity, or some combination of these.

Although we know very little about the deidentified patient population from which these

samples were obtained, it is reasonable to assume that these carbapenem-resistant isolates were recovered from antimicrobial-associated diarrhea cases because it is standard practice at the OSUWMC to test for opportunistic C. difficile infection in patients that develop diarrhea while receiving antibiotics. Our results indicate that while the prevalence of CRE is very low in patient fecal flora, even in this high-risk population, the threat of nosocomial CRE infections disseminated from an enteric flora reservoir exists in healthcare settings.

blaNDM-1 has only been detected in a clinical diagnostic submission to the OSUWMC Clinical

Diagnostic Laboratory once subsequent to our study (K. pneumoniae, December 2014), from a patient referred to the OSUWMC who likely acquired the infection prior to admission. Our detection of carbapenemase-producing enteric bacteria in this population emphasizes the need for CRE surveillance and patient risk assessment in order to prevent the nosocomial dissemination of this important resistance genotype.

Acknowledgements

This work was supported in part by the USDA National Institute of Food and Agriculture, AFRI project 1000839.

Chapter 5: Extended Spectrum β-lactam Resistance in the Enteric Flora of Healthcare Patients

T. F. Landersa, D. F. Mollenkopfb, R. L. Faubelc, A. Denta, P. Pancholic, J. B. Danielsd and T. E.

Wittumb

aThe Ohio State University College of Nursing, Columbus, Ohio, USA; bDepartment of Veterinary

Preventive Medicine, The Ohio State University College of Veterinary Medicine, Columbus, Ohio,

USA; cDepartment of Pathology, The Ohio State University Wexner Medical Center, Columbus,

Ohio, USA; dDepartment of Veterinary Clinical Sciences, The Ohio State University College of

Veterinary Medicine, Columbus, Ohio, USA

Summary

The dissemination of Enterobacteriaceae expressing resistance to extended-spectrum cephalosporins, which are therapeutically used in both human and veterinary medicine, is of critical concern. The normal commensal flora of food animals may serve as an important reservoir for the zoonotic food-borne transmission of Enterobacteriaceae harboring β-lactam resistance. We hypothesized that the predominant AmpC and ESBL genes reported in US livestock and fresh retail meat products, blaCMY-2 and blaCTX-M, would also be predominant in human enteric flora.

We recovered enteric flora from a convenience sample of patients included in a large tertiary medical center’s Clostridium difficle surveillance program in order to screen for and estimate the frequency of carriage of AmpC and ESBL resistance genes. In- and outpatient diarrheic submissions (n=692) received for C. difficle testing at the medical center’s clinical diagnostic laboratory from July to December, 2013 were included. Aliquoted to a transport swab, each submission was inoculated to MacConkey broth with cefotaxime, incubated at 37°C, then inoculated to MacConkey agars supplemented with cefepime and cefoxitin in order to select for the ESBL and AmpC phenotypes, with blaCMY and blaCTX-M genotypes confirmed by PCR and sequencing.

Our selective culture yielded 184 isolates (26.6 %) with reduced susceptibility to cefotaxime. Of these, 46 (6.7%) samples harbored commensal isolates carrying the AmpC blaCMY. Another 21

(3.0%) samples produced isolates harboring the ESBL blaCTX-M: 19 carrying CTX-M-15 and 2 with

CTX-M-27. 67

Our results indicate that β-lactamase resistance genes likely acquired through zoonotic foodborne transmission are present in the enteric flora of this hospital-associated population at lower levels than reported in livestock and fresh food products.

Impacts

• β-lactamase resistance genes likely acquired through zoonotic food-borne transmission are present in the enteric flora of this hospital-associated population, but at lower levels than reported in livestock and fresh food products.

• The presence of blaCTX-M-15 but not blaCTX-M-1 in this patient population suggests an alternative reservoir, such as the healthcare or community environment, may be the source of

ESBL genes not prevalent in food animal flora.

• Our results suggest that food-borne transmission may be one of the multiple sources for

AmpC- and ESBL-harboring Enterobacteriaceae in the enteric flora of patients receiving antimicrobial therapy.

Introduction

Extended-spectrum cephalosporins (ESC) are widely used to treat a myriad of invasive Gram negative bacterial infections. Patients with Gram negative β-lactam resistant infections are more likely to incur negative treatment outcomes including prolonged hospitalizations, increased treatment costs, and higher mortality rates compared to patients with ESC susceptible infections.245

Rapidly metabolized, the veterinary ESC formulation, ceftiofur, is used for the treatment of

production-limiting infections in most food animal species due to its low risk of antimicrobial

246 tissue residues. The AmpC blaCMY-2 and the ESBL blaCTX-M each confer resistance to ESCs including ceftiofur247 and are frequently carried on mobile plasmids which can be readily transmitted between bacterial species.205 The common use of ceftiofur in livestock populations

has been associated with the widespread dissemination of these ESC resistance genes in the fecal

flora of livestock248-250 and in fresh retail meat products.213, 223

Commensal Enterobacteriaceae harboring blaCMY-2 and blaCTX-M can be transmitted through the food chain and may colonize the enteric flora of healthy consumers, serving as a reservoir of resistance genes for the emergence of resistant pathogens. However, the importance of this reservoir has not been established.

To address this information gap, we tested the hypothesis that these AmpC and ESBL resistance genes commonly present in food animals and retail meats will also predominate the enteric flora of patients receiving antimicrobial therapy, representing a population perceived at higher risk for the emergence of resistant pathogens.

Materials and methods

All stool samples submitted to The Ohio State University Wexner Medical Center clinical microbiology laboratory Clostridium difficile nosocomial infection surveillance program over a 6- month period between July and December, 2013, were included in the study. Samples were received from hospitalized or outpatients of OSUWMC who developed diarrhea while receiving 69

antimicrobials. To maintain patient privacy, we did not obtain additional clinical or epidemiologic

data about patients or their history of antimicrobial exposure.

A transport swab was used to collect approximately 1 g of stool from each patient sample. Swabs

were placed into 9 ml of MacConkey broth modified with 2 ug/ml of cefotaxime. After overnight

incubation, samples were streaked to MacConkey agar with 8 ug/ml cefoxitin to identify isolates

with the blaCMY phenotype, and MacConkey agar with 4 ug/ml cefepime for the blaCTX-M

phenotype. A single lactose-positive isolate representing each phenotype for which growth was

observed was selected for further characterization. Bacterial species was confirmed using standard biochemical assays or MALDI-TOF mass spectrometry. The presence of the blaCMY and blaCTX-M resistance genes was confirmed using PCR and sequencing.

Results

Among 692 patient stool samples, 184 (26.6%) exhibited reduced susceptibility to 3rd generation

cephalosporins (Table 1). Of these, 153 (22%) resulting isolates displayed the blaCMY phenotype.

Confirmatory PCR reactions revealed 69 of those isolates harbored blaCMY, including 24 (3.5%)

Escherichia coli, 20 (2.9%) Enterobacter spp., and 2 (0.3%) Klebsiella spp (Table 1). The remaining

23 isolates were Citrobacter spp. or other organisms likely to harbor an intrinsic chromosomal

blaCMY.

Additionally, 31 samples (4.5%) yielded an isolate with the blaCTX-M phenotype. PCR and gene sequencing found 19 (2.7%) isolates - 13 (1.9%) Escherichia coli, 1 (0.1%) Enterobacter spp., and

7 (1%) Klebsiella spp. – carrying blaCTX-M-15 as well as 2 (0.3%) Escherichia coli isolates with blaCTX-

M-27 (Table 1).

Table 6: Phenotypic and genotypic prevalences of ESC resistant isolates recovered using selective media from stool samples of 692 healthcare patients of The Ohio State University Wexner Medical Center between July and December, 2013

Genotypic prevalence Phenotypica Enterobacter Klebsiella prevalence Overall E. coli spp. spp.

b AmpC 153 (22%) blaCMY 69 (10%) 24 (3.5%) 20 (2.9%) 2 (0.3%)

blaCTX-M 21 (3%) 13 (1.9%) 1 (0.1%) 7 (1%) ESBL 31 (4.5%) CTX-M-15 11 1 7 CTX-M-27 2

Discussion

The AmpC blaCMY is highly prevalent in the enteric flora of food animal populations with animal-

207,250 level prevalence approaching 100% using selective media. blaCMY-bearing

Enterobacteriaceae also frequently contaminate fresh meat products with package-level prevalence greater than 50% reported using selective media.213, 223 Perceptively, food-borne transmission could provide an important vehicle for the introduction of ESC resistance into the human enteric flora. Our observed blaCMY prevalence in patients receiving antimicrobial therapy suggests that the zoonotic food-borne transmission of this gene may result in low-level patient colonization following direct antimicrobial selection pressure, with other resistance mechanisms also filling this phenotypic niche.

Similarly, our observed prevalence of blaCTX-M isolates in patient flora suggests that patients experiencing antimicrobial selection pressure are not commonly colonized with coliform bacteria harboring this ESBL. In US livestock populations, CTX-M-1 is the predominate ESBL reported from fecal E. coli and K. pneumoniae,207, 250 from livestock Salmonella isolates,249 and from fresh retail meat products.213, 223 CTX-M-15 is the most frequently identified CTX-M enzyme in both human clinical isolates and companion animals in the US,251 but only rarely reported in food animals.207,

250 This observation suggests that blaCTX-M colonization of patients receiving selective

antimicrobial therapy may not be the result of zoonotic food-borne transmission.

While our study is limited by the lack of patient antimicrobial exposure history, it has been

reported that a majority of US hospitalized patients receive an antibiotic during their

hospitalization.252 The US Centers for Disease Control and Prevention reported that 55.7% of patients discharged from 323 hospitals had received antimicrobials.253 In addition, antimicrobial therapy is an important C. difficile risk factor, increasing the likelihood that a high proportion of patients in this study were exposed to antimicrobial selection pressure. We also did not measure the dietary preferences of these patients, and so do not know their history of exposure to fresh meat products.

Conclusion

These results suggest that food-borne transmission is only one of the sources for AmpC- and

ESBL-harboring Enterobacteriaceae in the enteric flora of patients receiving antimicrobial therapy. While our results identify β-lactamase resistance genes that may have been acquired through zoonotic food-borne transmission in the flora of healthcare patients likely receiving 72

antimicrobial therapy, the prevalence distribution of blaCMY and blaCTX-M in this patient population suggests an alternative resistance reservoir, such as the healthcare or community environment, may also be providing resistance genes not prevalent in food animal flora which can emerge in healthcare patients.

Chapter 6: Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States

Dixie F. Mollenkopf,a Jason W. Stull,a Dimitria A. Mathys,a Andrew S. Bowman,a Sydnee M.

Feicht,a Joshua B. Daniels,b Thomas E. Wittuma

a Department of Veterinary Preventive Medicine, The Ohio State University College of Veterinary

Medicine, Columbus, Ohio, USA; b Department of Veterinary Clinical Sciences, The Ohio State

University College of Veterinary Medicine, Columbus, Ohio, USA

Abstract

Carbapenem-resistant Enterobacteriaceae (CRE) present an urgent threat to public health. While

carbapenem antimicrobials are restricted in food-producing animals, other β-lactams, such as ceftiofur, are used in livestock. This use may provide selection pressure favoring the amplification of carbapenem resistance but this relationship has not been established. Previously unreported from US livestock, plasmid-mediated CREs have been reported from livestock in Europe and Asia.

Environmental and fecal samples were collected from a 1,500 sow, US farrow-to-finish operation during 4 visits over a 5 month period, 2015. Samples were screened using selective media for the presence of CRE, with resulting carbapenemase-producing isolates further characterized. Of 30 environmental samples collected from a nursery room on our initial visit, 2 (7%) samples yielded

3 isolates: 2 ST 218 Escherichia coli and 1 Proteus mirabilis, carrying the metallo-β-lactamase gene blaIMP-27 on an IncQ1 plasmid. We recovered 15 IMP-27-bearing isolates of multiple

Enterobacteriaceae species from 11 of 24 (46%) environmental samples from 2 farrowing rooms collected on our third visit. These blaIMP-27 isolates were also carried on IncQ1 plasmids. No CRE

isolates were recovered from fecal swabs or samples.

As is common in US swine production, piglets on this farm receive ceftiofur at birth, with males

receiving a second dose at castration (≈day 6). This selection pressure may favor the

dissemination of blaIMP-27-bearing Enterobacteriaceae in this farrowing barn. The absence of this selection pressure in the nursery and finisher barns likely resulted in the loss of the ecological niche needed for maintenance of this carbapenem resistance gene.

Introduction

The emergence of carbapenem-resistant Enterobacteriaceae (CRE) have been described as

heralding the end of the antibiotic era4 with their global expansion presenting an urgent threat to public health.254 These potential pathogens can harbor highly-mobile genes that confer resistance to the most critically important, live-saving antimicrobial drugs. The plasmid-mediated class A (KPC), class B (NDM, IMP, VIM), and class D (OXA-48, OXA-181) carbapenemase genes have disseminated beyond the realm of hospitals, nursing homes, and other human healthcare settings, to now cause critical community-acquired infections.96 Often by acquiring mobile

resistance elements through horizontal gene transfer, CRE infections are especially threatening

because they approach pan-resistance, frequently delaying and greatly reducing successful therapeutic treatment options for invasive infections. These bacteria, harboring mobile carbapenemase genes are now identified with some regularity from both hospital- and community-acquired human infections255 and have been recovered from healthcare environments,256 waste and surface water flows, soil, and companion animals.68, 257

While they are considered “Last Line of Defense” drugs in human medicine, carbapenem antimicrobials are not approved for use in food animal veterinary medicine. However, other β- lactams are commonly used in almost all food animal species worldwide including ceftiofur and cefquinome extended-spectrum cephalosporin drugs. While the exact relationship between extended-spectrum cephalosporin use and carbapenem resistance has not yet been established, use of these drugs is likely to provide significant selection pressure favoring organisms expressing carbapenem resistance because they will also be resistant to all extended-spectrum cephalosporins. While most people today do not have direct livestock exposure, enteric flora 76

from livestock commonly contaminate fresh retail meat products that are distributed over wide

geographic areas.213, 223 Thus, if CREs are present in food animal populations, a large number of

consumers may be exposed through the food chain, resulting in a critically important emerging

food safety issue.

While bacteria harboring plasmid-borne carbapenemase genes have never been recovered from

livestock in the US, CREs have been reported in multiple bacterial species recovered from

livestock in Europe and Asia. In France, Acinetobacter spp. cultured from dairy cattle rectal

171 swabs harbored blaOXA-23. Salmonella spp. and Escherichia coli isolates from two German swine

153, 258 farms and a poultry farm were found to carry blaVIM-1. Lung samples from diseased pigs in

China were reported to have E. coli, A. baumannii, and A. calcoaeticus isolates producing blaNDM-

105 1-mediated carbapenem resistance. Pseudomonas aeruginosa producing blaVIM-2 and A.

baumannii with blaOXA-23 and blaOXA-58 have been reported in cattle, swine, and poultry in

Lebanon.157 This report documents the dissemination of CREs in the environment of a single

swine farrow-to-finish operation in the US, including its observed relationship with ceftiofur use on the farm.

Materials and methods

Sampling was conducted at a single swine farrow-to-finish operation in the US that followed typical US production practices. Sterile gauze, electrostatic clothes, fecal swabs and fecal samples were collected and transported at ambient temperature from the farrowing, nursery, and finishing barns during four visits, July, August, October, and November of 2015. On the initial and second visit, environmental and fecal samples were collected from floors and upright swine- 77

contact surfaces in the farrowing and nursery barns using sterile gauze sponges. Electrostatic

clothes were used to collect environmental samples in the human contact areas of the barns

such as door knobs and break rooms. On the third visit, 50 rectal swabs were collected from

piglets and 24 environmental electrostatic clothes were collected from surfaces in both the

farrowing and nursery barns. On the fourth visit, 72 fresh fecal samples and 36 electrostatic

cloth samples were collected from harvest-ready pigs and the environment of a single finishing barn in the same production flow.

In the laboratory, sterile gauze and electrostatic cloth samples were added to buffered peptone water (BPW) in volumes of 36 ml and 90 ml, respectively. After incubation, 1 ml of each was inoculated to nutrient broth modified with 2 μg/ml cefotaxime. After overnight incubation, samples were streaked to MacConkey agar modified with 1 μg/ml meropenem (initial visit) or

0.5 μg/ml meropenem and 70 μg/ml zinc sulfate heptahydrate (2nd, 3rd, and 4th visits) to identify isolates with the CRE phenotype. Rectal swabs were added to 9 ml MacConkey broth supplemented with 2 μg/ml cefotaxime. Fecal samples were reduced to 4 g and homogenized with MacConkey/cefotaxime broth. Rectal swab and homogenate fecal samples were streaked to MacConkey agar containing 0.5 μg/ml meropenem and 70 μg/ml zinc sulfate heptahydrate to identify isolates with a CRE phenotype. All samples were incubated overnight at 37oC.

For resulting isolates with reduced susceptibility to meropenem, bacterial speciation was accomplished using biochemical assays – Indole, Methyl Red- Voges-Proskauer, Simmon’s citrate, motility – with ambiguous species identified using MALDI-TOF mass spectrometry.

Isolates were tested for carbapenemase production using Carba NP,242 with Carba NP positive 78

isolates accessed using multiple previously reported PCR assays and Sanger sequencing to

identify an array of possible carbapenemase genes including blaKPC, blaNDM, blaIMP, blaVIM, and

28,259-261 blaOXA. Specific blaIMP-27 forward (5’ CGCAGGTGAGACTTTGCCTA) and reverse (3’

GCTTAACAAAGCAACCGCCA) primers were designed with NCBI Primer-BLAST

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) from sequence results of PCR reactions using

IMP-1 primers.259 Five resulting isolates including the 3 E. coli, P. mirabilis, and Klebsiella oxytoca

were additionally characterized with whole-genome sequencing (WGS, Illumina MiSeq; San

Diego, CA). Prior to WGS, the plasmid content and plasmid size carried by each isolate was

visualized by electrophoresis using a standard plasmid profiling procedure 206. Plasmid incompatibility groups were codified according to a plasmid PCR-based replicon typing procedure (PBRT) detecting 18 replicon types based on incompatibility group loci 208-210.

Incompatibility results were confirmed by sequence data using PlasmidFinder 1.3

(https://cge.cbs.dtu.dk/services/PlasmidFinder/). Susceptibility profiles were generated using a

semiautomated broth microdilution system (NARMS CMV3AGNF and ESβL ESB1F panels,

(Thermo Fisher Scientific, Oakwood Village, OH) following Clinical and Laboratory Standards

Institute (CLSI) guidelines.262

Results

This operation farrows approximately 1500 sows in one farrowing barn with 11 rooms containing 16 to 24 individual-sow farrowing crates in each room. All piglets in the farrowing barn receive a prophylactic ceftiofur (ceftiofur crystalline free acid, Excede™, Zoetis, Florham

Park NJ) treatment at 0-1 d of age, and males receive a second prophylactic ceftiofur treatment when they are castrated at 5-7 d of age. Sows in the farrowing barn receive therapeutic ceftiofur 79

(ceftiofur hydrochloride, Excenel™, Zoetis) as needed for treatment of metritis and other bacterial infections. Piglets are weaned at 21 days of age into 1 of 2 enclosed nursery barns located at a single site. The nursery barns have 12 rooms each with 8 pens per room and approximately 25 piglets are housed in each pen until 10 weeks of age. From the nursery, pigs are moved to finishing barns where they are housed until approximately 6 months of age when they are sold for harvest. In this production system, piglets do not normally receive ceftiofur in

the nursery or finishing barns. In addition to these typical swine production and marketing

practices, this operation also markets some individual piglets at approximately 10 weeks of age

for youth 4-H and FFA livestock projects as well as some older animals sold as breeding stock.

This has been a closed herd since the 1960’s.

As part of another project, our initial sampling at the farm included 30 environmental gauze

samples of animal contact surfaces, with 15 collected from both the farrowing room crates and

nursery barn pens, and 10 human-contact electrostatic cloth samples. These samples yielded 3 isolates from 2 animal-environment samples (7%) expressing the CRE phenotype from the upright pen surface and floor gauze sponge samples collected in room A of the nursery barn

(Table 1). One gauze sponge sample taken from the floor of a nursery pen harbored two carbapenemase producing isolates, an E. coli and a Proteus mirabilis, both of which carried the metallo-β-lactamase gene, blaIMP-27 on an IncQ1 plasmid. The third isolate was also an IMP-27-

bearing E. coli recovered from a nursery pen gate using a gauze sponge. Both E. coli isolates,

MLST type 218 (MLST 1.8, https://cge.cbs.dtu.dk/services/MLST/), were resistant to multiple

antimicrobial classes and carried multiple incompatibility group plasmids. In addition to blaIMP-27,

these E. coli both carried the AmpC blaCMY-2. The P. mirabilis carried only a single IncQ1 plasmid, 80

similar to the E. coli isolates, suggesting that the plasmid may have been transferred in vitro

among the organisms during selective enrichment.

To gain a better understanding of the prevalence of this rare genotype, we sampled the same

nursery barn again, including the same pens of piglets, approximately one month later in August

of 2015. We collected 15 sterile gauze sponges from floor and upright surfaces and 4 electrostatic

clothes from human-contact surfaces in the 2 nursery rooms previously sampled on our initial visit. Additionally, we collected a total of 54 fecal samples, with 4 to 5 convenience samples collected from random pens in each of the 12 rooms. To optimize our recovery of these metallo-

β-lactamase-bearing Enterbacteriaceae, we reduced the meropenem concentration from 1

μg/ml to 0.5 μg/ml and included 70 μg/ml zinc sulfate heptahydrate to our MacConkey agar

media. However, these samples did not produce isolates expressing the CRE phenotype.

We did not follow the same cohort of piglets as previously sampled for visit three, but rather re-

sampled the nursery and farrowing barns, focusing on the most recently weaned pens of nursery

piglets and crates of piglets in the farrowing barn which had received ceftiofur selection pressure

within the past 7 to 10 days. At this visit in October of 2015, 12 environmental samples were

collected using electrostatic clothes from floor and upright surfaces in 2 farrowing rooms and 2

nursery rooms, the same nursery rooms sampled in July and August. A convenience sample of

100 rectal swabs were also collected from 25 piglets in each of the 4 rooms. We recovered 15

IMP-27-bearing isolates of multiple bacterial species from both farrowing room environments with multiple morphologies recovered from samples in both rooms (Table 1). In 1 farrowing room

(room A), 5 environmental samples (42%) produced isolates harboring blaIMP-27, and 7 samples 81

(58%) were positive from the second farrowing room (room B). With the exception of the exhaust

fan vent covers, all carbapenemase-positive isolates were from pig-contact surfaces – farrowing crate bars, side panels, and floor mats, and sow feeders (Table 1). We did not recover isolates expressing the CRE phenotype from any environmental samples in the nursery barn or piglet rectal swabs collected in either barn. No isolates were recovered from the human-contact door knobs or feed scoop handles.

The following month, we collected 72 fresh fecal samples from market-ready finishing pigs from the same pig flow, along with 36 samples of the finishing barn environment using electrostatic cloths. Sampled pigs were housed in a three-room finishing barn in close proximity to the nursery barn. In each room, 2 fresh fecal samples were collected from each of 12 pens with care taken to avoid sampling the same animal more than once. Environmental samples included pen gates, feeders, alley and pen floors, window ledges, and door knobs. No isolates with reduced susceptibility to carbapenems were recovered from these 108 samples.

Of the 18 IMP-27-bearing isolates from environmental samples collected on our initial and third farm visit, all carried an IncQ1 plasmid of approximately 10 Kb as confirmed by plasmid profiling and replicon typing. To confirm the location of IMP-27 on the IncQ plasmid, plasmid DNA was extracted (QIAfilter plasmid midi kit, Qiagen, Hilden, Germany) from the P. mirabilis isolate 13-

19B, which carried only the IncQ, and transformed (Electroporator 2510, Eppendorf, Hamburg,

Germany) to an electrocompetant E. coli strain (MegaX DH10B, Invitrogen, Carlsbad, CA).

Confirmation of the IMP-27 gene in the resulting transformants was accomplished using conventional PCR with IMP-27 specific primers. Individual replicon type PCR reactions revealed 82 carriage of additional self-transmissible helper plasmid replicons including: IncP, IncF, IncI, IncX, and IncW, by 13 of these isolates (Table 1).208 While the presence of the IncQ1 plasmids in multiple bacterial host backgrounds strongly suggests that they are mobilizable, conjugation experiments using the E. coli ST 218 (Isolate 13-19A) or ST 101 (Isolate S23) donors and an E. coli

K-12 MG 1655 recipient in vitro using broth or filter mating methodologies were unsuccessful.211,

263 No helper plasmids were detected in the remaining 5 isolates, suggesting an inability of those isolates to successfully mobilize the IncQ1 plasmid.

Table 7: Conjugative plasmid content of 18 environmental isolates harboring blaIMP-27 on an IncQ1 plasmid recovered from the nursery and farrowing barns of a single swine production system

Isolate Recovery Date Location Barn Sample type Species Conjugative plasmid content 13-19A 7/25/2015 Floor Nursery Rm A Gauze sponge Escherichia coli a IncX, IncI1, IncF 13-19B 7/25/2016 Floor Nursery Rm A Gauze sponge Proteus mirabilis 13-28A 7/25/2017 Pen gate Nursery Rm A Gauze sponge Escherichia coli a IncX, IncI1, IncF S4 - A 10/2/2015 Crate floor mats Farrowing Rm A Electrostatic cloth Morganella morganii S4 - B 10/2/2015 Crate floor mats Farrowing Rm A Electrostatic cloth Providencia rettgeri S5 - A 10/2/2015 Sow feeders Farrowing Rm A Electrostatic cloth Proteus vulgaris IncP S8 - A 10/2/2015 Crate bars Farrowing Rm A Electrostatic cloth Enterobacter cancerogenus IncP S8 - B 10/2/2015 Crate bars Farrowing Rm A Electrostatic cloth Citrobacter braakii IncP, IncW S11 10/2/2015 Exhaust vent cover Farrowing Rm A Electrostatic cloth Enterobacter cloacae IncP 84 S13 - A 10/2/2015 Crate dividers Farrowing Rm B Electrostatic cloth Citrobacter sp. IncP, IncI1 S13 - B 10/2/2015 Crate dividers Farrowing Rm B Electrostatic cloth Enterobacter cancerogenus IncP S14 10/2/2015 Crate dividers Farrowing Rm B Electrostatic cloth Citrobacter farmeri IncP S15 - A 10/2/2015 Crate floor mats Farrowing Rm B Electrostatic cloth Citrobacter koseri IncP S15 - B 10/2/2015 Crate floor mats Farrowing Rm B Electrostatic cloth Morganella morganii S17 10/2/2015 Sow feeders Farrowing Rm B Electrostatic cloth Citrobacter farmeri IncP S18 10/2/2015 Sow feeders Farrowing Rm B Electrostatic cloth Klebsiella oxytoca S19 10/2/2015 Crate bars Farrowing Rm B Electrostatic cloth Citrobacter koseri IncP a S23 10/2/2015 Exhaust vent cover Farrowing Rm B Electrostatic cloth Escherichia coli IncX, IncI1, IncF, IncW

a Escherichia coli isolates from the nursery barn floor and pen gate are sequence type 218 while the E. coli from the farrowing room exhaust fan is sequence type 101.

Each isolate expressed reduced susceptibility to meropenem while minimum inhibitory

concentrations (MIC) for imipenem ranged from <= 0.5 to 8 μg/ml. Most isolates showed reduced

susceptibility to 1st, 2nd, and 3rd generation cephalosporins, sulfonamides, and tetracyclines, but

were susceptible to aminoglycosides and fluoroquinolones.Resistance to cefepime and

ceftazidime was inconsistent (Table 2). Whole-genome sequencing (WGS) identified additional antimicrobial resistance genes located on the IncQ1 plasmid, including sul-2, sat-1, and aph(3’)-Ia. All functional alleles located on the IncQ1 plasmid (GenBank accession no. KY126032) are presented in Figure. 1.

a Table 8: Minimum inhibitiory concentration of 24 antimicrobials for 18 blaIMP-harboring environmental isolates recovered from the nursery and farrowing barns of a single swine production systemb

Isolate AMC AMP AZM CFZ FEP CTX FOX CPD CAZ CTF CRO CHL CIP GEN IPM MEM NAL TZP STR SFZ TXC TZC TET SXT 13-19A > 32 > 32 8 > 16 16 64 > 64 > 32 128 > 8 > 64 8 ≤ 1 > 16 ≤ 0.5 4 4 8 > 64 >256 64 128 ≤ 4 0.25 13-19B 16 > 32 > 16 > 16 > 16 > 64 > 64 > 32 8 > 8 > 64 4 ≤ 1 ≤ 4 4 8 4 ≤ 4 8 >256 64 8 32 > 4 13-28A > 32 > 32 8 > 16 16 64 > 64 > 32 128 > 8 > 64 8 ≤ 1 > 16 ≤ 0.5 4 4 8 > 64 >256 64 128 ≤ 4 0.25 S4 - A > 32 > 32 > 16 > 16 > 16 > 64 > 64 > 32 8 > 8 >64 16 ≤ 1 ≤ 4 4 4 4 ≤ 4 > 64 >256 > 64 16 > 32 0.5 S4 - B 4 ≤ 8 > 16 > 16 2 16 > 64 16 8 > 8 16 16 ≤ 1 4 4 8 2 ≤ 4 8 >256 16 4 32 1 S5 - A 8 > 32 > 16 > 16 > 16 > 64 > 64 > 32 32 > 8 >64 4 ≤ 1 ≤ 4 4 8 4 ≤ 4 8 >256 > 64 32 > 32 > 4 S8 - A 8 8 8 > 16 > 16 > 64 > 64 > 32 128 > 8 >64 16 ≤ 1 ≤ 4 ≤ 0.5 8 4 ≤ 4 ≤ 2 >256 64 64 > 32 0.5 S8 - B > 32 > 32 8 > 16 16 > 64 > 64 > 32 64 > 8 > 64 8 ≤ 1 ≤ 4 1 8 4 ≤ 4 > 64 >256 > 64 32 > 32 ≤ 0.12 S11 > 32 > 32 > 16 > 16 8 64 > 64 > 32 32 > 8 > 64 8 ≤ 1 ≤ 4 ≤ 0.5 4 4 ≤ 4 64 >256 64 32 > 32 > 4 S13 - A > 32 > 32 8 > 16 > 16 > 64 > 64 > 32 >128 > 8 >64 8 ≤ 1 ≤ 4 ≤ 0.5 8 4 64 ≤ 2 >256 > 64 >128 > 32 0.5 S13 - B 8 16 8 > 16 > 16 > 64 > 64 > 32 128 > 8 > 64 16 ≤ 1 ≤ 4 ≤ 0.5 8 4 ≤ 4 ≤ 2 >256 > 64 128 > 32 0.5 S14 8 8 8 > 16 > 16 > 64 > 64 > 32 64 > 8 > 64 16 ≤ 1 ≤ 4 ≤ 0.5 8 4 ≤ 4 ≤ 2 >256 64 64 > 32 0.25 S15 - A 16 8 8 > 16 16 > 64 > 64 > 32 64 > 8 > 64 16 ≤ 1 ≤ 4 ≤ 0.5 8 4 ≤ 4 ≤ 2 >256 64 64 > 32 0.5 86 S15 - B > 32 > 32 > 16 > 16 > 16 > 64 > 64 > 32 16 > 8 >64 32 ≤ 1 ≤ 4 4 4 4 ≤ 4 16 >256 > 64 16 > 32 0.5

S17 8 16 8 > 16 > 16 > 64 > 64 > 32 64 > 8 > 64 16 ≤ 1 ≤ 4 1 8 4 ≤ 4 ≤ 2 >256 64 64 > 32 0.5 S18 8 32 8 > 16 4 32 > 64 > 32 32 > 8 64 4 ≤ 1 ≤ 4 ≤ 0.5 2 1 ≤ 4 > 64 >256 32 32 > 32 ≤ 0.12 S19 16 16 8 > 16 > 16 > 64 > 64 > 32 64 > 8 > 64 16 ≤ 1 ≤ 4 ≤ 0.5 8 4 ≤ 4 ≤ 2 >256 64 64 > 32 0.5 S23 > 32 > 32 2 > 16 > 16 > 64 > 64 > 32 128 > 8 >64 4 ≤ 1 ≤ 4 ≤ 0.5 8 2 ≤ 4 8 >256 > 64 64 > 32 ≤ 0.12

a Antimicrobials tested and resistant MIC cut-off value (R): AMC (Amoxicillin/clavulanic acid 2:1 ratio) R: ≥ 32, AMP (Ampicillin) R: ≥ 32, AZM (Azithromycin) R: >16, CFZ (Cefazolin) R: ≥ 8, FEP (Cefepime) R: ≥ 32, CTX (Cefotaxime) R: ≥ 4, FOX (Cefoxitin) R: ≥ 32, CPD (Cefpodoxime) R: ≥ 8, CAZ (Ceftazidime) R: ≥ 16, CTF (Ceftiofur) R: ≥ 8, CRO (Ceftriaxone) R: ≥ 4, CHL (Chloramphenicol) R: ≥ 32, CIP (Ciprofloxicin) R: ≥ 4, GEN (Gentamicin) R: ≥ 16, IPM (Imipenem) R: ≥ 4, MEM (Meropenem) R: ≥ 4, NAL (Nalidixic acid) R: ≥32, TZP (Pipercillin/tazobactam) R: ≥ 128/4, STR (Streptomycin) R: ≥ 64, SFZ (Sulfisoxazole) R: >256, TXC (Cefotaxime-Clavulanic Acid), TZC (Ceftazidime-Clavulanic Acid), TET (Tetracycline) R: ≥ 16, SXT (Trimethoprim/sulfamethoxazole) R: ≥ 4/76 b Resistance indicated in bold text

Figure 2͗DĂƉŽĨĨƵŶĐƚŝŽŶĂůŐĞŶĞƐĂŶĚƚƌƵŶĐĂƚĞĚŽƉĞŶƌĞĂĚŝŶŐĨƌĂŵĞƐ;ΎͿŽŶĂŶ/ŶĐYϭƉůĂƐŵŝĚ;'ĞŶĂŶŬĂĐĐĞƐƐŝŽŶŶŽ͘

Discussion

Carbapenem-resistant Enterobacteriaceae harboring plasmid-borne carbapenemase genes have not previously been reported in US livestock populations. Although not detected in sampled piglets, environmental samples from the swine farrowing and nursery barns at this farm yielded multiple bacterial species expressing carbapenem resistance, each isolate carried the metallo β- lactamase gene blaIMP-27 located on an IncQ1 plasmid. Unlike blaKPC, which has become endemic in human healthcare in some parts of the US,264 IMP variants have been infrequently reported in

North America. Originally identified in 1988 in a Pseudomonas aeruginosa isolate collected in

Japan and in Enterobacteriaceae collected in a Japanese hospital 5 years later, IMP variants are

now the most prevalent transmissible carbapenemase genes in Japan and found in multiple

species of gram-negative bacteria internationally.265 In the US, the first occurrence of the IMP

gene was reported in a P. aeruginosa isolate recovered from a tracheal aspirate of a trauma

patient in the southwestern US in 2006.134 The first detection of IMP-producing

Enterobacteriaceae strains was reported in Klebsiella pneumoniae isolates collected from urine samples of three infants in the pediatric intensive care unit of a single heath care facility.135 These

closely related isolates each carried an IMP-4 gene harbored on a common transferrable plasmid

of approximately 100 Kb. While the early detection of metallo β-lactamases in the US was often

associated with a history of international travel, these pediatric patients had no travel history and,

in fact, one patient had never been outside the hospital setting.135

The IMP-27 gene is rare even in the realm of the metallo β-lactamases in North America. blaIMP-27

has only been reported twice previously from human cases. The first, reported in 2011, described

266 the recovery of a Proteus mirabilis harboring blaIMP-27 which was cultured from a patient in Iowa. 88

The second report, from 2012 in Toronto, described the recovery of another P. mirabilis harboring

137 blaIMP-27 from a urine culture of a patient with no history of international travel. blaIMP-27 differs from the first reported IMP-1 by 50 amino acid substitutions 267 and from its closest relative, IMP-

8 by 31 amino acid substitutions.266

We detected isolates carrying blaIMP-27 in multiple bacterial species. The dissemination of this

resistance determinant across a broad host range can likely be attributed to the highly mobilizable

nature of the IncQ1 plasmid harboring this gene. IncQ plasmids have the broadest host range of

any known replicating elements in bacteria and have been found in gram-negative, gram-positive,

and cyanobacteria.268 These small (5.1 – 14.0 kb) plasmids replicate host-independently, allowing for IncQ to be found in high copy-numbers.269 While IncQ plasmids are not self-transmissible, they

can be mobilized at high frequency by a variety of type IV transporters provided by larger, self-

transmissible, co-resident helper plasmids from incompatibility groups including: IncP, IncF, IncI,

IncM, IncX, IncN, and IncW.270 IncQ’s combination of high copy-number, broad host range, and ease of mobilization make this plasmid extremely promiscuous, being found in a vast variety of environments.268 Our inability to conjugate the IncQ plasmid to a recipient strain may have been hampered by our use of the IncQ-bearing strain acting as both donor and helper plasmid.

Triparental mating with donor, recipient, and helper strains may help overcome any plasmid mobilization barriers.

While carbapenem antimicrobial drugs are not approved for use in food animals, other β-lactam antimicrobials are formulated, labeled, and frequently applied in a variety of food animal species worldwide including both ceftiofur and cefquinome extended-spectrum cephalosporin drugs. 89

While the exact relationship between cephalosporin use and carbapenem resistance has not yet

been established, use of these drugs may provide significant selection pressure favoring organisms expressing carbapenem resistance because they will also be resistant to all extended-

spectrum cephalosporins. However, selection pressure favoring carbapenem-resistant strains provided by extended-spectrum cephalosporin use has not been established. In the swine production system we sampled, all piglets receive ceftiofur at 0 to 1 day after birth, with males receiving a second dose of ceftiofur at castration (day 5 to 7). Our observation that environmental recovery of isolates with blaIMP-27 was highest in the farrowing barn where ceftiofur was frequently

used, but much lower in the nursery and finishing barns where ceftiofur is only used for the

treatment of sick individual animals, is consistent with the hypothesis that ceftiofur use in

livestock can result in the expansion of bacterial strains harboring mobile carbapenemase genes.

While we initially detected 3 blaIMP-27-bearing Enterobacteriaceae from the nursery barn environment and later readily recovered this genotype from the farrowing barn environment, we did not recover IMP-27 from pig fecal swabs or fecal samples collected on visits 2, 3, and 4. The fecal samples or swabs collected at visits 2 and 3 were taken in both the farrowing and nursery from piglets ranging in age from 8 to 16 days in farrowing and 4 to 10 weeks in the nursery. Given our frequency of recovery of isolates harboring blaIMP-27 in the farrowing barn environment, we

expected to recover similar isolates from fecal swabs of piglets in the same barn recently treated

with ceftiofur. Our inability to detect those isolates suggests that the small mass of feces that can

be collected from a piglet may not be a sensitive sampling method to detect a rare bacterial

genotype in the fecal flora, even with selective enrichment. However, we have since recovered

fecal isolates from sows and piglets in the farrowing barn harboring blaIMP-27 (data not shown). 90

We sampled harvest-ready pigs in a single finisher barn on visit 4 and were not able to recover isolates harboring blaIMP-27. This result suggests that enteric bacteria harboring blaIMP-27 are unlikely to have entered the food supply through contamination of fresh pork products. The absence of ceftiofur use in the nursery and finisher barns likely removed antimicrobial selection pressure on the enteric flora of the pigs, resulting in the loss of the ecological niche allowing the maintenance of blaIMP-27-bearing Enterobacteriaceae in the farrowing barn.

Carbapenem-resistant and carbapenemase-producing bacteria have previously been reported from feces of dairy cattle in the US.271 They reported Enterobacteriaceae, Aeromonas spp., and

Pseudomonas spp. with chromosomal elements conferring carbapenem resistance or reduced

susceptibility. Chromosomally-mediated resistance is vertically transmitted to daughter cells, and

these bacteria can be clinically relevant if they produce invasive infections requiring antimicrobial

therapy. Bacterial carbapenemase genes located on mobile plasmids, reported here, pose a far

greater health threat because they may be transmitted horizontally among commensal bacterial

and potential pathogens.205 The implication of our finding is that there is a real risk that CREs may

disseminate in food animal populations and eventually contaminate fresh retail meat products.

Food-borne transmission may then produce a reservoir of mobile carbapenemase genes in the enteric flora of consumers.

Chapter 7: Maintenance of carbapenemase-producing Enterobacteriaceae in a farrow- to-finish swine production system

Dixie F. Mollenkopf,a Dimitria A. Mathys,a Sydnee M. Feicht,a Jason W. Stull,a Andrew S.

Bowman,a Joshua B. Daniels,b Thomas E. Wittuma

a Department of Veterinary Preventive Medicine, The Ohio State University College of Veterinary

Medicine, Columbus, Ohio, USA; b Department of Veterinary Clinical Sciences, The Ohio State

University College of Veterinary Medicine, Columbus, Ohio, USA

Abstract

Carbapenemase-producing Enterobacteriaceae (CPE) threaten both agriculture and public health.

While carbapenems are restricted in food-producing animals, other β-lactams, such as ceftiofur, are frequently applied in livestock. This use may select for the amplification of carbapenem resistance, but this relationship has not been established. Recently reported in US livestock, plasmid-mediated CPE are also present in livestock in Europe and Asia.

We previously reported the rare carbapenemase gene, blaIMP-64, in the environment of a large

farrow-to-finish swine operation. To better understand CPE in this swine production system, we followed a cohort of 350+ pigs from late sow gestation to the final finishing phase. Environmental and fecal samples were collected during 8 visits over 5 months in 2016. Samples were screened for CPE using selective media, with carbapenemase-producing isolates further characterized.

Of 55 environmental and 109 sow fecal samples collected from a farrowing barn on our initial visit, 35 (64%) environmental and 15 (14%) sow fecal samples yielded isolates of multiple

Enterobacteriaceae species carrying the metallo-β-lactamase gene blaIMP-64 on an IncQ plasmid.

The frequency of IMP-64-positive environmental (n=32), sow fecal (n=30), and piglet fecal swab

(120) samples was highest for all groups when the market pig cohort was between 1 and 10 d, with observed prevalence of 97%, 28%, and 18%, respectively. After weaning, blaIMP-64 was detected in a single environmental sample from a nursery pen, with no CPE recovered in the finishing phase.

Used in US swine production to treat and control disease, ceftiofur is administered to piglets on

this farm at birth, with males receiving a second dose at castration (≈day 6). This selection

pressure may favor the dissemination of blaIMP-64-bearing Enterobacteriaceae. The absence of this selection pressure in the nursery and finishing barns likely resulted in the loss of the ecological niche needed for maintenance of this carbapenem resistance gene.

Introduction

The global prevalence of carbapenemase-producing Enterobacteriaceae (CPE) is increasing. This expansion of this phenotype threatens the efficacy of multiple drug classes including the critically important carbapenems. Both the CDC and WHO have listed carbapenem resistant infections as highest level concerns to human health.6, 7

Problematically, plasmid-mediated CPE are often highly mobile, able to disseminate beyond the realm of human healthcare and have been reported to cause community-acquired infections.16, 17

14, 15, 18 CPE have also been reported in both companion animals and in livestock. Nine blaOXA-23-

harboring Acinetobacter genomospecies 15TU have been recovered from the enteric flora of dairy

cattle in France.171 A screening of animal diagnostic submissions at the Foshan University,

Guangdong Province, China, revealed six Enterobacteriaceae isolates carrying blaNDM-1 from diseased pig lung samples and included one ST48 Escherichia coli isolate which is a common

sequence type associated with human infection.106 VIM-2-producing Pseudomonas aeruginosa and OXA-48-producing Acinetobacter baumannii have been detected in livestock fecal samples

157 collected from farms in North Lebanon. Salmonella Infantis with blaVIM-1 was found in both

environment and fecal samples from three swine farms and a poultry farm in Germany in 2011 94

and 2012. Later, two additional VIM-1 S. Infantis isolates were identified from 2015/2016 submissions to the German National Reference Laboratory for Salmonella. These isolates, cultured from minced pork meat and a sick piglet, appeared clonally related based on pulsotypic

155 analysis, suggesting vertical transmission of the blaVIM-1 genotype. In 2016, we reported a highly mobile IncQ1 plasmid carrying blaIMP-64 in multiple Enterobacteriaceae species from the environment of a US swine production system.139 Recently, 8 fecal samples from a sampling of

673 diarrheic and non-diarrheic piglets from 10 government pig farms in India were found to carry

107 E. coli with blaNDM.

Although still rare, CPE are now reported in livestock populations worldwide, but little is known

about the epidemiology of carbapenemase-producing bacteria in these food animal settings. Here we describe the dissemination and sample-level prevalence of Enterobacteriaceae harboring blaIMP-64, from fecal and environmental samples in a cohort of market pigs we followed through a swine production flow.

Materials and methods

All sampling occurred at a single multi-site swine farrow-to-finish production operation located in the US. We previously reported the presence of CPE harboring the single-base-change blaIMP-27

variant, identified as IMP-64 (Genbank accession number KX949735.2),138 in the environment of the farrowing and nursery barns at this farm.139 However, CPE were not reported from pig fecal samples at that time. Subsequent to the previous report, we identified a cohort of market pigs housed in the same barns to sample repeatedly over the entire production cycle.

On our initial visit, composite environmental and convenience sow fecal samples were collected

from all rooms in a single farrowing barn to confirm the presence of Enterobacteriaceae carrying

blaIMP-64 on an IncQ1 mobile plasmid. From each room, five composite environmental samples

were collected representing the exhaust fans, farrowing crate walls, mats, and overhead bars, and

sow feeders using electrostatic clothes placed in sterile Whirl-paks.

After our initial visit in May, 2016, two farrowing rooms in the same barn with a total of 30 bred sows were identified and sampled on the day the rooms were filled (visit 2, July 5). Fecal samples were collected from these late-gestation sows. Environmental samples were collected with each electrostatic cloth representing an individual farrowing crate and an additional cloth used to sample the exhaust fans in each room. The progeny of these 30 sows were followed through the production flow to the finishing phase. For visits 3, 4, and 5 (July 15, 22, and 29), fecal samples were collected from the individual sows. Environmental samples of each farrowing crate and the barn exhaust fans were also collected as well as 120 piglet fecal swabs, with 2 gilts and 2 boars/barrows sampled from each crate.

At weaning the piglets were moved to 15 pens in 2 rooms of a single nursery barn. We sampled the pigs and their environment on August 9 and September 6 (visits 6 and 7), collecting 8 individual fecal swabs and 2 environmental cloth samples per pen. Sampled pigs were marked with paint sticks to prevent sample duplication. Exhaust fans in both rooms were also sampled with electrostatic cloths. In the finishing phase, the market pigs were housed in three consecutive pens of 100+ pigs each in a single finishing barn. Twenty-five individual fecal samples and nine environmental electrostatic cloth samples were collected from each pen on September 28, 2016. 96

For the recovery of blaIMP-64-harboring Enterobacteriaceae, all samples were processed in our laboratory on the day of sampling, with fecal samples reduced to 4 g and homogenized 1:9 with

36 ml MacConkey broth modified with 2 μg/ml cefotaxime. Fecal swabs were added to 9 ml

MacConkey broth modified with 2 μg/ml cefotaxime and 90 ml nutrient broth modified with 2

μg/ml cefotaxime was added to each environmental electrostatic cloth sample. All samples were incubated overnight at 37°C and inoculated to MacConkey agar supplemented with 0.05 μg/ml meropenem and 70 μg/ml zinc sulfate to identify the metallo-β-lactamase phenotype. After overnight incubation, up to three isolates representing unique morphologies from each plate were conserved for further characterization, with preference given to lactose positive isolates.

Conventional PCR of boiled lysate template, utilizing previously reported primers,139 was used to detect blaIMP-64 and IncQ alleles.

Results

We have previously reported the presence of the rare metallo-β-lactamase gene, blaIMP-64, carried by multiple Enterobacteriaceae species, in the environment of this farm. For this study, we

followed a cohort of 350+ market pigs from late sow gestation to the final finishing phase. We

collected over 1,100 samples (n=1,178) from pigs and their environment over the 5 months of this

project. These samples comprised 274 environmental samples, 229 sow fecal samples, 600 pig

fecal swabs, and 75 finisher pig fecal samples collect from the farrowing, nursery and finishing

barns over 8 farm visits (Figure 1). From the 1,178 samples collected from this swine production

system, 301 carbapenem-resistant isolates were further characterized to determine their

resistance genotype. After characterization, 286 Enterobacteriaceae isolates were confirmed to 97

harbor the blaIMP-64/IncQ gene/plasmid resistance genotype. These CPE were cultured from 195 positive samples (16.5%). Of these, the majority were recovered from environmental samples

(n=142), with an additional 30 positive samples from sows and 23 positive samples from the pig cohort. These blaIMP-64/IncQ-harboring isolates were composed of multiple unique morphologies suggestive of different Enterobacteriaceae species, with the majority, 99 environmental, 13 sow fecal, and 3 pig fecal swab isolates, being lactose positive. We did not further identify the species of bacteria recovered.

Figure 3:Sample prevalence of blaIMP-64-harboring Enterobacteriaceae from sow fecal samples, piglet fecal swabs, finisher pig fecal samples, and electrostatic cloth environmental samples collected from a farrowing, nursery, and finishing barn of a single swine production flow over a five month period.

Our initial visit, in May, 2016, confirmed that Enterobacteriaceae harboring blaIMP-64 was present in the environment of the farrowing barn and in the fecal flora of the sows (Figure 1). Of the 55 electrostatic cloth samples collected from throughout the farrowing environment, 60% were positive for isolates with IMP-64. Our convenience sampling of 109 sows, which ranged from late gestation to 26 days post farrowing, yielded 15 samples (14%) with IMP-64 isolates.

After confirming the presence of IMP-64-bearing Enterobacteriaceae throughout the farrowing barn, we identified 30 late gestation sows housed in two adjacent rooms (Rooms A and B) of the same barn. On Visit 2 (July 5, 2016), fecal samples were collect from sows within a few hours of

being moved into the barn and loaded into farrowing crates with the exception of one farrowing

sow which was not sampled. All sow fecal samples were negative for the presence of CPE. We

were however able to detect blaIMP-64 isolates in 28 of 32 (88%) electrostatic cloth samples

collected, with 2 environmental samples from farrowing crates in Room A and a single crate in

Room B negative.

All sows had farrowed by Visit 3 (July, 15, 2016), with the last litter born on the day of sampling.

Of the 30 lactating sows, we collected fecal samples from 25, but were unable to collect a sample

from 1 sow in Room A and 4 sows in Room B. Of the 25 sampled sows, 7 (28%) harbored blaIMP-64

in their enteric flora. Additionally, 21 of 120 (18%) piglet fecal swabs and 31 of 32 (97%)

environmental cloths were positive for bacterial isolates carrying blaIMP-64. Positive piglet swabs

were originally collected from 5 litters in Room A and 8 litters in Room B, which included samples

from the piglets farrowed earlier on the morning of sampling.

100

The following week, July 22, 2016 (Visit 4), we again sampled sows, piglets and their environment

with similar results for the sows and their environment. On this visit we collected 30 sow fecal

samples with 7 (23%) of those positive for bacteria with blaIMP-64. Of the environmental cloth

samples, 28 of 32 (88%) yielded IMP-64-bearing Enterobacteriaceae. However, we only cultured isolates with blaIMP-64 from 1 of 120 (0.8%) piglet fecal swabs.

Our last farrowing barn sampling, Visit 5, (July 29, 2016), found only 1 sow fecal and 1 piglet fecal swab collected from that sow’s litter carrying bacteria with blaIMP-64. We also collected fewer

positive environmental samples, with 22 of 32 (69%) electrostatic clothes positive. Interestingly,

while no fecal samples or fecal swabs from Room A were found to carry IMP-64, the majority of positive environmental samples (64%) were collected in that room.

At weaning (August 8, 2016), the cohort of 350+ pigs was moved to 2 rooms in a single nursery barn. On visits 6 and 7 (August 9 and September 6, 2016), we collected 55 individual fecal swabs from pigs in Room A and 65 from pigs in Room B, along with 16 environmental samples from each room. Of these, only a single electrostatic clothe sample from the back wall of a pen in Room B

(Visit 6) yielded Enterobacteriaceae with blaIMP-64.

Our final visit was September 28, 2016, approximately 3 weeks after the pigs were moved to 3

pens in a single finishing barn. We collected 25 fresh fecal samples and 9 environmental samples

from upright surfaces in each pen. Of these 75 fecal and 27 electrostatic clothe samples we did

not recover any CPE isolates. Our study design included plans for one additional sampling of pigs

101

and the environment in the finishing barn in December 2016 just prior to harvest, but the farm

withdrew from the study before that final sampling was completed.

Discussion

Although believed to be extremely rare, the presence of CPE in intensively-managed food animal populations is not surprising. The population-dense environments of modern livestock production systems lend to the dissemination of enteric flora from one animal to another, with each herd, barn or flock essentially developing common flora. Once carbapenemase-producing bacteria are introduced into a livestock population, it can be hypothesized that the use of antimicrobials such as the veterinary extended-spectrum cephalosporin, ceftiofur, may help create an ecological niche favoring the maintenance of this β-lactamase mediated resistance phenotype.

Piglets in this production system are treated for respiratory disease with ceftiofur at processing

(≈1d) with males treated again at castration (≈7d) with veterinary oversight under the control label. We collected fecal swabs from four piglets in each farrowing crate on July 15, 2016 (visit 3).

The piglets were 1 to 10 days old and all litters had been processed and received ceftiofur with the exception of the litter farrowed early that day. Of the 120 piglet fecal swabs, 21 (17.5%) produced blaIMP-64 positive isolates, including 2 samples from the piglets that had not yet received antimicrobial therapy. In contrast, fecal swabs again collected from 120 piglets one week and two weeks later (7/22 and 7/29, visits 4 and 5), after boar castration and ceftiofur therapy on July 19,

2016, yielded only single IMP-64 positive samples (0.83%) at each visit. Although we do not know which animals were re-sampled from visit to visit, we would expect antimicrobial selection

102

pressure to impact our ability to recover CPE from the enteric flora of these piglets on both

sampling days. We did not recover CPE from fecal swabs or samples after visit 5. These

observations suggest transient carriage and shedding of IMP-64 Enterobacteriaceae in these

piglets rather than colonization.

The ability of ceftiofur selection pressure to amplify CPE has been hypothesized,139 but has not been established. Our observation that CPE were frequently present in sow fecal samples and common in the environment of this farrowing barn where ceftiour was routinely used, but not present in barns where ceftiofur use was rare, is consistent with the hypothesis that ceftiofur selection pressure can both maintain and amplify CPE. Conversely, our relatively low recovery of

CPE from piglet samples following ceftiofur therapy suggests that other environmental factors present in this farrowing barn may be important in the maintenance of these CPE.

Transient carriage of IMP-64 could be a function of age as neonates have been shown to maintain unique microflora compared to older pigs272 and are at higher risk for carriage of some resistant

Enterobacteriaceae species.273 The use of ceftiofur in piglets has been demonstrated to impact

extended spectrum cephalosporin resistance in E. coli recovered from the enteric flora of suckling piglets.274 However, applied studies in swine populations have demonstrated a rapid increase in

resistant bacterial prevalence following antimicrobial therapy as well as a rapid decrease in

resistance following drug withdrawal.275 In the case of IMP-64, this rapid decrease may be further

heightened by the dynamic nature of the neonatal intestinal microbiota and the maintenance of

specific bacterial phenotypes such as found in E. coli for a few days to weeks.276

103

In this swine population, we found CPE throughout the farrowing barn environment with the

exception of a single empty room sampled on Visit 1. This room had been recently cleaned and

disinfected on the day of sampling and filled with bred sows later that day. Environmental samples

collected from the farrowing crate walls, mats, and overhead bars, and sow feeders in this room

were all found to be negative for the presence of IMP-64. However, we cultured IMP-64

Enterobacteriaceae from the vents of the electric exhaust fans, which were not washed or disinfected.

If the farm’s cleaning and disinfection routine consistently removes viable CPE from the pig environment, the IMP-64 isolates may be disseminated through the farrowing barn by air circulation or by the sows acting as either biological or mechanical vectors. In this study, we did not collect samples from the sow gestation barns, but these environments could serve as potential CPE reservoirs for this farm. Some proportion of the sow herd may be colonized with this resistance genotype and others may transiently harbor these CPE and be intermittently re- infected by the contaminated gestation barn environment.

After identifying the bred dams of the pig cohort to be followed, we sampled these bred sows and the farrowing room environment a few hours after the rooms were filled. All but four environmental samples (28/32) were IMP-64 positive, but we did not recover CPE from any sow fecal samples (n=29). We sampled the sows again 10 days later when they were 1 to 10 days post- farrowing with 28% (7/25) of fecal samples IMP-64 positive. While we did not measure stress

104

indicators such a cortisol levels in the sows, parturition and the transition to a farrowing crate

environment may play a role in our ability to detect carbapenemase producers in this

population.277, 278

The finding of CPE in a healthy and well-managed pig production system indicates a clear need for remediation strategies for colonized farms. Reliable and economical antimicrobial alternatives may help reduce, if not eliminate, carbapenem resistance phenotypes from livestock populations.

While there are still relatively few reports of CPE in livestock populations worldwide, the increased prevalence of CPE in community-associated human infections,16, 17 companion animals14, 15, 68 and in the environment65, 68 should signal that the prevalence of CPE in food-producing animals may

be underestimated.

105

Chapter 8: Conclusions

Chapter 3: Genotypic and epidemiologic characterization of extended-spectrum cephalosporin resistant Salmonella enterica from US beef feedlots

• First reported in 2000, the 2011 NAHMS Beef Feedlot study shows, in US feedlot cattle,

extended spectrum cephalosporin resistance in Salmonella remains predominantly

mediated by the blaCMY-2 gene carried on a large IncA/C plasmid. While this genotype was

found in less than 1% (0.87%) of 5,050 collected fecal samples from 68 large (1000+ head)

feedlots, nearly 1 of every 12 (7.7%) recovered Salmonella (n=571) isolates harbored the

CMY-2 gene. These blaCMY-2 Salmonella isolates represented 8 serotypes, most commonly

S. Newport (n=14, 32%), S. Typhimurium (n=13, 30%), and S. Reading (n=5, 11%), followed

by S. Dublin, S. Infantis, S. Montevideo, S. Rough O:i;v:1;7, and S. Uganda collected from

fecal samples in 13 (6.4%) pens on 8 (11.8%) feedlots.

• With the exception of two S. Newport (streptomycin MIC =32 µg/ml), the NAHMS CMY-

2-bearing Salmonella isolates displayed the ampicillin, chloramphenicol, streptomycin,

sulfamethoxazole, and tetracycline (ACSSuT) penta-resistance phenotype. These isolates

were highly related within serotype. Each serotype exhibited >90% homology regardless

of feed yard or pen source with the exception of the S. Newport isolates, which

represented 2 distinct clonal strains with 75% homology between feed yard sources.

106

• The feed-grade antimicrobial, chlortetracycline, is often used for the treatment and

control of respiratory disease in feedlot cattle. Including chlortetracycline in the diet of

US feedlot cattle reduced the likelihood of cattle harboring blaCMY-2 Salmonella in their

enteric flora. The addition of chlortetracycline was a protective factor against CMY-2

when comparing CMY-2 Salmonella harboring cattle to Salmonella negative cattle

(OR=0.04, 95% CI 0.004; 0.3, p=0.002) as well as to Salmonella-positive cattle without

blaCMY-2 (OR=0.05, 95% CI 0.01; 0.91, p=0.005). In the NAHMS Beef Feedlot study,

chlortetracycline was fed in pens where 1624 of the fecal samples were collected (32.2%),

and of these, only 1 (2.3%) fecal sample carried Salmonella with blaCMY-2.

• Salmonella from feedlot pens fed tylosin were more likely to harbor CMY-2 Salmonella

compared to isolates from pens that did not receive the macrolide when comparing

blaCMY-2-bearing isolates to ESC susceptible Salmonella. A macrolide feed additive, tylosin

has broad spectrum Gram-positive and limited Gram-negative activity and is often

continuously fed in feedlot cattle to reduce the incidence of liver abscesses. Tylosin was

fed in pens that accounted for 1549 of the total samples (30.7%), with samples from

tylosin-fed pens accounting for 27 (61.4%) of the 44 recovered blaCMY-2-bearing isolates.

These 27 CMY-2 isolates were cultured from samples collected from 8 pens within 5 feed

yards.

• As the number of dairy cattle in a feedlot pen increased, the probability of a Salmonella

isolate recovered from that pen harboring the AmpC genotype increased (OR= 1.019, 95%

CI 1.01; 1.028, p=<0.0001). Conventional high animal density dairy operations frequently 107

include the veterinary extended spectrum cephalosporin, ceftiofur, as a therapeutic

option for the treatment of sick animals. High prevalences of ceftiofur-resistance in

Salmonella isolates have been previously reported in young dairy calves intended to enter

the food chain and may lend to dairy steers entering feed yards with this ceftiofur-

resistant pathogen in their enteric flora.

• Salmonella isolates from heavier cattle were less likely to have the blaCMY-2 genotype (95%

CI, 0.993; 0.999, p=0.008), and this association was not confounded by time on feed. It

would be expected that the heaviest cattle have been in the feed yard for the longest

time and are well past the 4 to 6 week early transition period where cattle are most likely

to receive antimicrobial therapies, such as ceftiofur, which could select for the AmpC

genotype. We would expect that without selection pressure, even in previously treated

cattle where resistant phenotypes may be amplified, the prevalence of blaCMY-2

Salmonella isolates would have returned to a baseline level below detectable limits in

older, heavier cattle.

Chapter 4: Surveillance and characterization of carbapenemase-producing Klebsiella pneumoniae recovered from patient stool samples at a tertiary care medical center

• The enteric flora of hospitalized patients serves as potential reservoir for carbapenem-

resistant Enterobacteriaceae infections. Two K. pneumoniae isolates –one carring blaKPC-4

and the second with blaNDM-1 - were identified in diarrheic stool samples submitted for

Clostridium difficle culture (n=692) from patients of The Ohio State University Wexner

Medical Center in 2013. Although the patient population was deidentified, we can assume 108

some had previously received antimicrobial therapy that would impact our ability to

detect this rare resistance genotypes.

Chapter 5: Extended Spectrum β-lactam Resistance in the Enteric Flora of Healthcare Patients

• β-lactamase resistance genes likely acquired through zoonotic foodborne transmission

are present in the enteric flora of a hospital-associated human population at lower levels

than reported in livestock and fresh food products. Our selective culture yielded 184

isolates (26.6 %) with reduced susceptibility to extended spectrum cephalosporins from

diarrheic stool samples of patients of The Ohio State University Wexner Medical Center

in 2013. Of these, 46 (6.7%) samples harbored commensal isolates carrying the AmpC

blaCMY. Another 21 (3.0%) samples produced isolates harboring the ESBL blaCTX-M: 19

carrying CTX-M-15 and 2 with CTX-M-27. In this human population, cephalosporin

resistance mechanisms from a non-foodborne source reservoir may provide β-lactamase

resistance genes.

Chapter 6: Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States

• Plasmid-mediated carbapenemase genes are present in the environment of a large US

livestock production system. While chromosomal elements conferring carbapenem

resistance or reduced susceptibility have previously been reported from feces of food

animals in the US, mobilizable carbapenemases pose a far greater health threat because

109

they may be transmitted horizontally among commensal bacterial and potential

pathogens.

• In this swine environment, carbapenem resistance was mediated by the blaIMP-64 gene

which had only been cultured twice from human clinical infections in North America at

that time. This metallo-β-lactamase was harbored by multiple bacterial species with its

dissemination owing to the highly promiscuous IncQ1 plasmid. IncQ plasmids have the

broadest host range of any known replicating elements in bacteria and have been found

in Gram-negative, Gram-positive, and cyanobacteria.

• Our environmental recovery of Enterobacteriaceae with blaIMP-64 was highest in the

farrowing barn where ceftiofur was frequently used with all piglets receiving ceftiofur at

0 to 1 day after birth and males receiving a second dose of ceftiofur at castration (day 5

to 7). blaIMP-64 recovery was much lower in the nursery and finishing barns where ceftiofur

is only used for the treatment of sick individual animals. While carbapenem antimicrobial

drugs are not approved for use in food animals, this finding is consistent with the

hypothesis that ceftiofur use in livestock can result in the expansion of bacterial strains

harboring mobile carbapenemase genes.

Chapter 7: Maintenance of carbapenemase-producing Enterobacteriaceae in a farrow-to-finish swine production system

• In this swine production system, bacteria harboring the blaIMP-64/IncQ1 gene/plasmid

genotype were recovered most frequently from the farrowing barn environment. The 110

farm’s cleaning and disinfection routine appears to remove viable CPE from the pig

environment; therefore, the IMP-64 isolates may be disseminated through the farrowing

barn by air circulation or by the sows acting as either biological or mechanical vectors,

moving these genes into sanitized rooms. In this study, we did not collect samples from

the sow gestation barns, but these environments could serve as the true CPE reservoirs

for this farm.

• IMP-64 prevalence was highest in sow fecal samples within approximately one week post-

farrowing. After recovering no IMP-64-bearing isolates from the 30 identified bred sows,

28% (7/25) of the fecal samples collected ten days later (0 to 10 days post-farrowing) were

IMP positive. Some proportion of the sow herd may be colonized with this resistance

genotype and others may transiently harbor these CPE and be intermittently re-infected

by the contaminated gestation barn environment. While we did not measure stress

indicators such a cortisol levels in the sows, parturition and the transition to a farrowing

crate environment may play a role in our ability to detect carbapenemase producers in

this population.

• IMP-64 prevalence was highest (18%) in piglets one to ten days of age. Piglets in this

production system are treated for respiratory disease with ceftiofur at processing (≈1d)

with males treated again at castration (≈7d) with veterinary oversight under the control

label. Fecal swabs collected one week and two weeks later yielded only single positive

samples with no IMP-bearing bacteria detected in the piglets after they transitioned from

the farrowing barn. Transient carriage of IMP-64 could be a function of age as neonates 111

have been shown to maintain unique microflora compared to older pigs. Also, the use of

ceftiofur in piglets has been demonstrated to impact extended spectrum cephalosporin

resistance in E. coli recovered from the enteric flora of suckling piglets.

• The finding of CPE in a healthy and well-managed pig production system indicates a clear

need for remediation strategies for colonized farms. Reliable and economical

antimicrobial alternatives may help reduce, if not eliminate, carbapenem resistance

phenotypes from livestock populations. There are still relatively few reports of CPE in

livestock populations worldwide, however, CPE prevalences are increasing in other

aspects of the community and the environment, potentially signaling that the prevalence

of CPE in food-producing animals may be underestimated.

112

References 1. Bonfiglio G, Russo G, Nicoletti G. Recent developments in carbapenems. Expert Opin Investig Drugs 2002;11(4):529-544. 2. Ventola CL. The antibiotic resistance crisis: part 1: causes and threats. P T 2015;40(4):277-283. 3. Naas T, Nordmann P. Analysis of a carbapenem-hydrolyzing class A beta-lactamase from Enterobacter cloacae and of its LysR-type regulatory protein. Proc Natl Acad Sci U S A 1994;91(16):7693-7697. 4. Nordmann P, Poirel L, Toleman MA, et al. Does broad-spectrum β-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother 2011;66(4):689-692. 5. Thomson KS. Extended-spectrum-β-lactamase, AmpC, and carbapenemase issues. J Clin Microbiol 2010;48(4):1019-1025. 6. Centers for Disease Control and Prevention. Antibiotic Resistance Threats in the United States, 2013. Available at: http://www.cdc.gov/drugresistance/pdf/ar-threats-2013-508.pdf. Accessed 6/8/2016, 2016. 7. World Health Organization. Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. Available at: http://www.who.int/medicines/publications/WHO-PPL- Short_Summary_25FebET_NM_WHO.pdf?ua=1. Accessed 4/25/2017, 2017. 8. Lee C, Lee JH, Park KS, et al. Global dissemination of carbapenemase-producing Klebsiella pneumoniae: epidemiology, genetic context, treatment options, and detection methods. Front Microbiol 2016;7:895. 9. Nordmann P, Poirel L, Walsh TR, et al. The emerging NDM carbapenemases. Trends Microbiol 2011;19(12):588-595. 10. Gould CV, Rothenberg R, Steinberg JP. Antibiotic Resistance in Long-Term Acute Care Hospitals The Perfect Storm. Infect Cont Hosp Ep 2006;27(9):920-925. 11. Kelly AM, Mathema B, Larson EL. Carbapenem-resistant Enterobacteriaceae in the community: a scoping review. Int J Antimicrob Agents 2017;50:127-134. 12. Tischendorf J, de Avila RA, Safdar N. Risk of infection following colonization with carbapenem- resistant Enterobactericeae: A systematic review. Am J Infect Control 2016;44(5):539-543. 13. Guh AY, Bulens SN, Mu Y, et al. Epidemiology of Carbapenem-Resistant Enterobacteriaceae in 7 US Communities, 2012-2013. JAMA 2015;314(14):1479-1487. 14. Abraham S, O'Dea M, Trott DJ, et al. Isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from cats. Sci Rep 2016;6:35527.

113

15. Liu X, Thungrat K, Boothe DM. Occurrence of OXA-48 Carbapenemase and Other β-Lactamase Genes in ESBL-Producing Multidrug Resistant Escherichia coli from Dogs and Cats in the United States, 2009–2013. Front Microbiol 2016;7:1057. 16. Khatri A, Naeger Murphy N, Wiest P, et al. Community-Acquired Pyelonephritis in Pregnancy Caused by KPC-Producing Klebsiella pneumoniae. Antimicrob Agents Chemother 2015;59(8):4375- 4378. 17. Dortet L, Poirel L, Nordmann P. Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. Biomed Res Int 2014;2014:249856. 18. Shaheen BW, Nayak R, Boothe DM. Emergence of a New Delhi metallo-beta-lactamase (NDM- 1)-encoding gene in clinical Escherichia coli isolates recovered from companion animals in the United States. Antimicrob Agents Chemother 2013;57(6):2902-2903. 19. Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol Med 2012;18(5):263-272. 20. Walther-Rasmussen J, Høiby N. Class A carbapenemases. J Antimicrob Chemother 2007;60(3):470-482. 21. Fridkin SK, Steward CD, Edwards JR, et al. Surveillance of Antimicrobial Use and Antimicrobial Resistance in United States Hospitals: Project ICARE Phase 2. Clin Infect Dis 1999;29(2):245-252. 22. Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 2001;45(4):1151-1161. 23. Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 2008;52(2):809. 24. Bradford PA, Bratu S, Urban C, et al. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 β- lactamases in New York City. Clin Infect Dis 2004;39(1):55-60. 25. Chiang T, Mariano N, Urban C, et al. Identification of carbapenem-resistant Klebsiella pneumoniae harboring KPC enzymes in New Jersey. Microb Drug Resist 2007;13(4):235-240. 26. Pope J, Adams J, Doi Y, et al. KPC type beta-lactamase, rural Pennsylvania. Emerg Infect Dis 2006;12(10):1613-1614. 27. Miriagou V, Tzouvelekis LS, Rossiter S, et al. Imipenem resistance in a Salmonella clinical strain due to plasmid-mediated class A carbapenemase KPC-2. Antimicrob Agents Chemother 2003;47(4):1297-1300. 28. Smith Moland E, Hanson ND, Herrera VL, et al. Plasmid-mediated, carbapenem-hydrolysing beta-lactamase, KPC-2, in Klebsiella pneumoniae isolates. J Antimicrob Chemother 2003;51(3):711-714. 29. Hossain A, Ferraro MJ, Pino RM, et al. Plasmid-mediated carbapenem-hydrolyzing enzyme KPC-2 in an Enterobacter sp. Antimicrob Agents Chemother 2004;48(11):4438-4440.

114

30. Bratu S, Brooks S, Burney S, et al. Detection and spread of Escherichia coli possessing the plasmid-borne carbapenemase KPC-2 in Brooklyn, New York. Clin Infect Dis 2007;44(7):972-975. 31. Woodford N, Tierno PM,Jr, Young K, et al. Outbreak of Klebsiella pneumoniae producing a new carbapenem-hydrolyzing class A beta-lactamase, KPC-3, in a New York Medical Center. Antimicrob Agents Chemother 2004;48(12):4793-4799. 32. Leavitt A, Navon-Venezia S, Chmelnitsky I, et al. Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrob Agents Chemother 2007;51(8):3026-3029. 33. Gasink LB, Edelstein PH, Lautenbach E, et al. Risk factors and clinical impact of Klebsiella pneumoniae carbapenemase–producing K. pneumoniae. Infect Cont Hosp Ep 2009;30(12):1180. 34. Patel G, Huprikar S, Factor SH, et al. Outcomes of carbapenem‐resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect Control Hosp Epidemiol 2008;29(12):1099-1106. 35. Dortet L, Radu I, Gautier V, et al. Intercontinental travels of patients and dissemination of plasmid-mediated carbapenemase KPC-3 associated with OXA-9 and TEM-1. J Antimicrob Chemother 2007;61(2):455-457. 36. Naas T, Nordmann P, Vedel G, et al. Plasmid-mediated carbapenem-hydrolyzing beta- lactamase KPC in a Klebsiella pneumoniae isolate from France. Antimicrob Agents Chemother 2005;49(10):4423-4424. 37. Navon-Venezia S, Leavitt A, Schwaber MJ, et al. First report on a hyperepidemic clone of KPC- 3-producing Klebsiella pneumoniae in Israel genetically related to a strain causing outbreaks in the United States. Antimicrob Agents Chemother 2009;53(2):818-820. 38. Maltezou H, Giakkoupi P, Maragos A, et al. Outbreak of infections due to KPC-2-producing Klebsiella pneumoniae in a hospital in Crete (Greece). J Infect 2009;58(3):213-219. 39. Naas T, Cuzon G, Villegas MV, et al. Genetic structures at the origin of acquisition of the beta- lactamase bla KPC gene. Antimicrob Agents Chemother 2008;52(4):1257-1263. 40. Woodford N, Zhang J, Warner M, et al. Arrival of Klebsiella pneumoniae producing KPC carbapenemase in the United Kingdom. J Antimicrob Chemother 2008;62(6):1261-1264. 41. Livermore DM, Hope R, Brick G, et al. Non-susceptibility trends among Pseudomonas aeruginosa and other non-fermentative Gram-negative bacteria from bacteraemias in the UK and Ireland, 2001–06. J Antimicrob Chemother 2008;62(suppl_2):ii55-ii63. 42. Roche C, Cotter M, O Connell N, et al. First identification of class A carbapenemase-producing Klebsiella pneumoniae in the Republic of Ireland. Euro surveillance: bulletin europÈen sur les maladies transmissibles= European communicable disease bulletin 2009. 43. Wei ZQ, Du XX, Yu YS, et al. Plasmid-mediated KPC-2 in a Klebsiella pneumoniae isolate from China. Antimicrob Agents Chemother 2007;51(2):763-765. 44. Lopez J, Correa A, Navon‐Venezia S, et al. Intercontinental spread from Israel to Colombia of a KPC‐3‐producing Klebsiella pneumoniae strain. Clin Microbiol Infect 2011;17(1):52-56.

115

45. Villegas MV, Lolans K, Correa A, et al. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrob Agents Chemother 2006;50(8):2880-2882. 46. Goldfarb D, Harvey SB, Jessamine K, et al. Detection of plasmid-mediated KPC-producing Klebsiella pneumoniae in Ottawa, Canada: evidence of intrahospital transmission. J Clin Microbiol 2009;47(6):1920-1922. 47. Pillai DR, Melano R, Rawte P, et al. Klebsiella pneumoniae Carbapenemase, Canada. Emerg Infect Dis 2009;15(5):827-829. 48. Centers for Disease Control and Prevention (CDC). Tracking CRE. July, 18, 2017. 49. Wang Q, Mao D, Mu Q, et al. Enhanced horizontal transfer of antibiotic resistance genes in freshwater microcosms induced by an ionic liquid. PloS one 2015;10(5):e0126784. 50. Chagas TP, Seki LM, da Silva DM, et al. Occurrence of KPC-2-producing Klebsiella pneumoniae strains in hospital wastewater. J Hosp Infect 2011;77(3):281. 51. de Araujo CF, Silva DM, Carneiro MT, et al. Detection of Carbapenemase Genes in Aquatic Environments in Rio de Janeiro, Brazil. Antimicrob Agents Chemother 2016;60(7):4380-4383. 52. Montezzi LF, Campana EH, Corrêa LL, et al. Occurrence of carbapenemase-producing bacteria in coastal recreational waters. Int J Antimicrob Agents 2015;45(2):174-177. 53. Poirel L, Barbosa-Vasconcelos A, Simoes RR, et al. Environmental KPC-producing Escherichia coli isolates in Portugal. Antimicrob Agents Chemother 2012;56(3):1662-1663. 54. Piedra-Carrasco N, Fàbrega A, Calero-Cáceres W, et al. Carbapenemase-producing Enterobacteriaceae recovered from a Spanish river ecosystem. PloS one 2017;12(4):e0175246. 55. Subirats J, Royo E, Balcázar JL, et al. Real-time PCR assays for the detection and quantification of carbapenemase genes (blaKPC, blaNDM, and blaOXA-48) in environmental samples. Environ Sci Pollut R 2017;24(7):6710-6714. 56. Zhang X, Lü X, Zong Z. Enterobacteriaceae producing the KPC-2 carbapenemase from hospital sewage. Diagn Microbiol Infect Dis 2012;73(2):204-206. 57. Yang F, Mao D, Zhou H, et al. Prevalence and fate of carbapenemase genes in a wastewater treatment plant in northern China. PloS one 2016;11(5):e0156383. 58. Yang F, Huang L, Li L, et al. Discharge of KPC-2 genes from the WWTPs contributed to their enriched abundance in the receiving river. Sci Total Environ 2017;581:136-143. 59. Pecora ND, Li N, Allard M, et al. Genomically Informed Surveillance for Carbapenem-Resistant Enterobacteriaceae in a Health Care System. MBio 2015;6(4):e01030-15. 60. Wilson BM, El Chakhtoura NG, Patel S, et al. Carbapenem-Resistant Enterobacter cloacae in Patients from the US Veterans Health Administration, 2006-2015. Emerg Infect Dis 2017;23(5):878-880. 61. Benson DA, Cavanaugh M, Clark K, et al. GenBank. Nucleic Acids Res 2012;41(D1):D36-D42.

116

62. Woodford N, Turton JF, Livermore DM. Multiresistant Gram‐negative bacteria: the role of high‐risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev 2011;35(5):736- 755. 63. Cuzon G, Naas T, Truong H, et al. Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase blaKPC-2 gene. Emerg Infect Dis 2010;16(9):1349-1356. 64. Kitchel B, Rasheed JK, Patel JB, et al. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrob Agents Chemother 2009;53(8):3365-3370. 65. Nordmann P, Naas T, Poirel L. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2011;17(10):1791-1798. 66. Shen P, Zhang Y, Li G, et al. Characterization of the genetic environment of the blaKPC-2 gene among Klebsiella pneumoniae isolates from a Chinese Hospital. Braz J Infect Dis 2016;20(4):384- 388. 67. Arnold RS, Thom KA, Sharma S, et al. Emergence of Klebsiella pneumoniae carbapenemase- producing bacteria. South Med J 2011;104(1):40-45. 68. Woodford N, Wareham DW, Guerra B, et al. Carbapenemase-producing Enterobacteriaceae and non-Enterobacteriaceae from animals and the environment: an emerging public health risk of our own making? J Antimicrob Chemother 2014;69(2):287-291. 69. Fuursted K, Schøler L, Hansen F, et al. Virulence of a Klebsiella pneumoniae strain carrying the New Delhi metallo-beta-lactamase-1 (NDM-1). Microb Infect 2012;14(2):155-158. 70. Kumarasamy KK, Toleman MA, Walsh TR, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis 2010;10(5):597-602. 71. Walsh TR, Weeks J, Livermore DM, et al. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. The Lancet Infectious Diseases 2011;11(5):355-362. 72. Yong D, Toleman MA, Giske CG, et al. Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 2009;53(12):5046-5054. 73. Castanheira M, Deshpande LM, Mathai D, et al. Early dissemination of NDM-1- and OXA-181- producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006-2007. Antimicrob Agents Chemother 2011;55(3):1274-1278. 74. Perry JD, Naqvi SH, Mirza IA, et al. Prevalence of faecal carriage of Enterobacteriaceae with NDM-1 carbapenemase at military hospitals in Pakistan, and evaluation of two chromogenic media. J Antimicrob Chemother 2011;66(10):2288-2294. 75. Seema K, Ranjan Sen M, Upadhyay S, et al. Dissemination of the New Delhi metallo-β- lactamase-1 (NDM-1) among Enterobacteriaceae in a tertiary referral hospital in north India. J Antimicrob Chemother 2011;66(7):1646-1647.

117

76. Mazzariol A, Bošnjak Z, Ballarini P, et al. Another NDM-1 from the Balkans: unveiling a second reservoir? Emerg Infect Dis 2012;18(3):532-534. 77. Livermore DM, Walsh TR, Toleman M, et al. Balkan NDM-1: escape or transplant. Lancet Infect Dis 2011;11(3):164. 78. Ivanovski N, Masin J, Rambabova‐Busljetic I, et al. The outcome of commercial kidney transplant tourism in Pakistan. Clin Transplant 2011;25(1):171-173. 79. Poirel L, Al Maskari Z, Al Rashdi F, et al. NDM-1-producing Klebsiella pneumoniae isolated in the Sultanate of Oman. J Antimicrob Chemother 2010;66(2):304-306. 80. Jamal W, Rotimi VO, Albert MJ, et al. Emergence of nosocomial New Delhi metallo-β- lactamase-1 (NDM-1)-producing Klebsiella pneumoniae in patients admitted to a tertiary care hospital in Kuwait. Int J Antimicrob Agents 2012;39(2):183-184. 81. Wu H, Chen T, Chen IC, et al. First identification of a patient colonized with Klebsiella pneumoniae carrying blaNDM-1 in Taiwan. Journal of the Chinese Medical Association 2010;73(11):596-598. 82. Huo T. The First Case of Multidrug-resistant NDM-1-harboring Enterobacteriaceae in Taiwan: Here Comes the Superbacteria! J Chin Med Assoc 2010;73(11):557. 83. Chen Y, Zhou Z, Jiang Y, et al. Emergence of NDM-1-producing Acinetobacter baumannii in China. J Antimicrob Chemother 2011;66(6):1255-1259. 84. Rimrang B, Chanawong A, Lulitanond A, et al. Emergence of NDM-1-and IMP-14a-producing Enterobacteriaceae in Thailand. J Antimicrob Chemother 2012;67(11):2626-2630. 85. Centers for Disease Control and Prevention (CDC). Detection of Enterobacteriaceae isolates carrying metallo-beta-lactamase - United States, 2010. MMWR Morb Mortal Wkly Rep 2010;59(24):750. 86. Mochon AB, Garner OB, Hindler JA, et al. New Delhi metallo-β-lactamase (NDM-1)-producing Klebsiella pneumoniae: case report and laboratory detection strategies. J Clin Microbiol 2011;49(4):1667-1670. 87. Savard P, Gopinath R, Zhu W, et al. First NDM-positive Salmonella sp. strain identified in the United States. Antimicrob Agents Chemother 2011;55(12):5957-5958. 88. Rasheed JK, Kitchel B, Zhu W, et al. New Delhi metallo-beta-lactamase-producing Enterobacteriaceae, United States. Emerg Infect Dis 2013;19(6):870-878. 89. Peirano G, Schreckenberger PC, Pitout JDD. Characteristics of NDM-1-producing Escherichia coli isolates that belong to the successful and virulent clone ST131. Antimicrob Agents Chemother 2011;55(6):2986-2988. 90. Centers for Disease Control and Prevention (CDC). Notes from the Field: New Delhi metallo- beta-lactamase-producing Escherichia coli associated with endoscopic retrograde cholangiopancreatography - Illinois, 2013. MMWR Morb Mortal Wkly Rep 2014;62(51-52):1051.

118

91. Epstein L, Hunter JC, Arwady MA, et al. New Delhi metallo-β-lactamase–producing carbapenem-resistant Escherichia coli associated with exposure to duodenoscopes. JAMA 2014;312(14):1447-1455. 92. Pfeiffer CD, Cunningham MC, Poissant T, et al. Establishment of a statewide network for carbapenem-resistant Enterobacteriaceae prevention in a low-incidence region. Infect Control Hosp Epidemiol 2014;35(4):356-361. 93. Buser GL, Cassidy PM, Pfeiffer CD, et al. New Delhi Metallo-β-lactamase-1 (NDM-1) Escherichia coli isolated from household vacuum cleaner—Oregon, 2013. IDCases 2017;. 94. Haysom I, Sharp K. The survival and recovery of bacteria in vacuum cleaner dust. J Roy Soc Health 2003;123(1):39-45. 95. Kus JV, Tadros M, Simor A, et al. New Delhi metallo-beta-lactamase-1: local acquisition in Ontario, Canada, and challenges in detection. CMAJ 2011;183(11):1257-1261. 96. Nordmann P, Couard JP, Sansot D, et al. Emergence of an autochthonous and community- acquired NDM-1-producing Klebsiella pneumoniae in Europe. Clin Infect Dis 2012;54(1):150-151. 97. Arpin C, Noury P, Boraud D, et al. NDM-1-Producing Klebsiella pneumoniae Resistant to Colistin in a French Community Patient without History of Foreign Travel. Antimicrob Agents Chemother 2012;56(6):3432-3434. 98. Isozumi R, Yoshimatsu K, Yamashiro T, et al. bla(NDM-1)-positive Klebsiella pneumoniae from environment, Vietnam. Emerg Infect Dis 2012;18(8):1383-1385. 99. Zong Z, Zhang X. bla NDM-1-carrying Acinetobacter johnsonii detected in hospital sewage. J Antimicrob Chemother 2013;68(5):1007-1010. 100. Zhang C, Qiu S, Wang Y, et al. Higher isolation of NDM-1 producing Acinetobacter baumannii from the sewage of the hospitals in Beijing. PLoS One 2013;8(6):e64857. 101. Luo Y, Yang F, Mathieu J, et al. Proliferation of multidrug-resistant New Delhi metallo-β- lactamase genes in municipal wastewater treatment plants in northern China. Environ Sci Tech Let 2013;1(1):26-30. 102. Forsberg KJ, Reyes A, Wang B, et al. The shared antibiotic resistome of soil bacteria and human pathogens. Science 2012;337(6098):1107-1111. 103. Wang B, Sun D. Detection of NDM-1 carbapenemase-producing Acinetobacter calcoaceticus and Acinetobacter junii in environmental samples from livestock farms. J Antimicrob Chemother 2014;70(2):611-613. 104. Wang Y, Wu C, Zhang Q, et al. Identification of New Delhi metallo-β-lactamase 1 in Acinetobacter lwoffii of food animal origin. PloS one 2012;7(5):e37152. 105. Zhang WJ, Lu Z, Schwarz S, et al. Complete sequence of the bla(NDM-1)-carrying plasmid pNDM-AB from Acinetobacter baumannii of food animal origin. J Antimicrob Chemother 2013;68(7):1681-1682. 106. Zhang R, Yang W, Zhihai L, et al. Characterization of NDM-1-producing carbapenemase in Acinetobacter spp. and E. coli isolates from diseased pigs. Front Agr Sci Eng 2015;2(3):223-229.

119

107. Pruthvishree B, Vinodh Kumar O, Sinha D, et al. Spatial molecular epidemiology of carbapenem‐resistant and New Delhi metallo beta‐lactamase blaNDM‐producing Escherichia coli in the piglets of organized farms in India. J Appl Microbiol 2017;122:1537-1546. 108. Yao X, Doi Y, Zeng L, et al. Carbapenem-resistant and colistin-resistant Escherichia coli co- producing NDM-9 and MCR-1. The Lancet infectious diseases 2016;16(3):288-289. 109. Ghatak S, Singha A, Sen A, et al. Detection of New Delhi Metallo‐beta‐Lactamase and Extended‐Spectrum beta‐Lactamase Genes in Escherichia coli Isolated from Mastitic Milk Samples. Transboundary and emerging diseases 2013;60(5):385-389. 110. Chen D, Gong L, Walsh TR, et al. Infection by and dissemination of NDM-5-producing Escherichia coli in China. J Antimicrob Chemother 2015;71(2):563-565. 111. Wailan AM, Paterson DL, Kennedy K, et al. Genomic Characteristics of NDM-Producing Enterobacteriaceae Isolates in Australia and Their blaNDM Genetic Contexts. Antimicrob Agents Chemother 2015;60(1):136-141. 112. Fischer J, Schmoger S, Jahn S, et al. NDM-1 carbapenemase-producing Salmonella enterica subsp. enterica serovar Corvallis isolated from a wild bird in Germany. J Antimicrob Chemother 2013;68:2954-2956. 113. Guenther S, Ewers C, Wieler LH. Extended-Spectrum Beta-Lactamases Producing E. coli in Wildlife, yet Another Form of Environmental Pollution? Front Microbiol 2011;2:246. 114. Shaheen BW, Nayak R, Boothe DM. First Reported Case of New Delhi Metallo (NDM) Carbapenem-Positive Gene in Escherichia coli from Companion Animals in the United States, in ICAAC. 2012;2012(10/30/2012). 115. Yousfi M, Mairi A, Bakour S, et al. First report of NDM-5-producing Escherichia coli ST1284 isolated from dog in Bejaia, Algeria. New Microbes and New Infections 2015;8:17-18. 116. Yousfi M, Touati A, Mairi A, et al. Emergence of carbapenemase-producing Escherichia coli isolated from companion animals in Algeria. Microbial drug resistance 2016;22(4):342-346. 117. Nordmann P, Poirel L. The difficult‐to‐control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin Microbiol Infect 2014;20(9):821-830. 118. Watanabe M, Iyobe S, Inoue M, et al. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991;35(1):147-151. 119. Osano E, Arakawa Y, Wacharotayankun R, et al. Molecular characterization of an enterobacterial metallo beta-lactamase found in a clinical isolate of Serratia marcescens that shows imipenem resistance. Antimicrob Agents Chemother 1994;38(1):71-78. 120. Ito H, Arakawa Y, Ohsuka S, et al. Plasmid-mediated dissemination of the metallo-beta- lactamase gene blaIMP among clinically isolated strains of Serratia marcescens. Antimicrob Agents Chemother 1995;39(4):824-829. 121. Senda K, Arakawa Y, Nakashima K, et al. Multifocal outbreaks of metallo-beta-lactamase- producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems. Antimicrob Agents Chemother 1996;40(2):349-353.

120

122. Koh TH, Babini GS, Woodford N, et al. Carbapenem-hydrolysing IMP-1 beta-lactamase in Klebsiella pneumoniae from Singapore. Lancet 1999;353(9170):2162. 123. Lee K, Lee WG, Uh Y, et al. VIM- and IMP-type metallo-beta-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis 2003;9(7):868- 871. 124. Mazzariol A, Cornaglia G, Piccoli P, et al. Carbapenem-hydrolyzing metallo-beta-lactamases in Pseudomonas aeruginosa. Eur J Clin Microbiol Infect Dis 1999;18(6):455-456. 125. Riccio ML, Franceschini N, Boschi L, et al. Characterization of the metallo-beta-lactamase determinant of Acinetobacter baumannii AC-54/97 reveals the existence of bla(IMP) allelic variants carried by gene cassettes of different phylogeny. Antimicrob Agents Chemother 2000;44(5):1229-1235. 126. Gibb AP, Tribuddharat C, Moore RA, et al. Nosocomial outbreak of carbapenem-resistant Pseudomonas aeruginosa with a new bla(IMP) allele, bla(IMP-7). Antimicrob Agents Chemother 2002;46(1):255-258. 127. Gales AC, Tognim MC, Reis AO, et al. Emergence of an IMP-like metallo-enzyme in an Acinetobacter baumannii clinical strain from a Brazilian teaching hospital. Diagn Microbiol Infect Dis 2003;45(1):77-79. 128. Peleg AY, Franklin C, Bell J, et al. Emergence of IMP-4 metallo-β-lactamase in a clinical isolate from Australia. J Antimicrob Chemother 2004;54(3):699-700. 129. Shet V, Gouliouris T, Brown N, et al. IMP metallo-β-lactamase-producing clinical isolates of Enterobacter cloacae in the UK. J Antimicrob Chemother 2011;66(6):1408-1409. 130. Pellegrini C, Mercuri PS, Celenza G, et al. Identification of bla IMP-22 in Pseudomonas spp. in urban wastewater and nosocomial environments: biochemical characterization of a new IMP metallo-enzyme variant and its genetic location. J Antimicrob Chemother 2009;63(5):901-908. 131. Szczepanowski R, Linke B, Krahn I, et al. Detection of 140 clinically relevant antibiotic- resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 2009;155(7):2306-2319. 132. Chouchani C, Marrakchi R, Henriques I, et al. Occurrence of IMP-8, IMP-10, and IMP-13 metallo-β-lactamases located on class 1 integrons and other extended-spectrum β-lactamases in bacterial isolates from Tunisian rivers. Scand J Infect Dis 2013;45(2):95-103. 133. Kieffer N, Poirel L, Bessa LJ, et al. VIM-1, VIM-34, and IMP-8 Carbapenemase-Producing Escherichia coli Strains Recovered from a Portuguese River. Antimicrob Agents Chemother 2016;60(4):2585-2586. 134. Hanson ND, Hossain A, Buck L, et al. First occurrence of a Pseudomonas aeruginosa isolate in the United States producing an IMP metallo-beta-lactamase, IMP-18. Antimicrob Agents Chemother 2006;50(6):2272-2273. 135. Limbago BM, Rasheed JK, Anderson KF, et al. IMP-producing carbapenem-resistant Klebsiella pneumoniae in the United States. J Clin Microbiol 2011;49(12):4239-4245.

121

136. Dixon N, Fowler RC, Yoshizumi A, et al. IMP-27, a Unique Metallo-beta-Lactamase Identified in Geographically Distinct Isolates of Proteus mirabilis. Antimicrob Agents Chemother 2016;60(10):6418-6421. 137. Tijet N, Lo S, Siebert H, et al. Detection of IMP-27 metallo-ß-lactamase in Proteus mirabilis, ON, Canada [abstract]. In: Proceedings of the 52nd Annual Interscience Conference on Antimicrobial Agents and Chemotherapy ; 2012 Spt 9-12; San Francisco, CA: ICAAC; 2012. Abstract C2-090. 2012. 138. Benson DA, Cavanaugh M, Clark K, et al. GenBank. Nucleic Acids Res 2017;45(D1):D37-D42. 139. Mollenkopf DF, Stull JW, Mathys DA, et al. Carbapenemase-producing Enterobacteriaceae recovered from the environment of a swine farrow-to-finish operation in the United States. Antimicrob Agents Chemother 2016;:AAC. 01298-16. 140. Zhao W, Hu Z. IMP-type metallo-β-lactamases in Gram-negative bacilli: distribution, phylogeny, and association with integrons. Crit Rev Microbiol 2011;37(3):214-226. 141. Poirel L, Naas T, Nicolas D, et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother 2000;44(4):891-897. 142. Mavroidi A, Tsakris A, Tzelepi E, et al. Carbapenem-hydrolysing VIM-2 metallo-β-lactamase in Pseudomonas aeruginosa from Greece. J Antimicrob Chemother 2000;46(6):1041-1043. 143. Giakkoupi P, Petrikkos G, Tzouvelekis LS, et al. Spread of integron-associated VIM-type metallo-beta-lactamase genes among imipenem-nonsusceptible Pseudomonas aeruginosa strains in Greek hospitals. J Clin Microbiol 2003;41(2):822-825. 144. Heller I, Grif K, Orth D. Emergence of VIM-1-carbapenemase-producing Enterobacter cloacae in Tyrol, Austria. J Med Microbiol 2012;61(4):567-571. 145. Logan LK, Weinstein RA. The Epidemiology of Carbapenem-Resistant Enterobacteriaceae: The Impact and Evolution of a Global Menace. J Infect Dis 2017;215(suppl_1):S28-S36. 146. Miriagou V, Tzelepi E, Gianneli D, et al. Escherichia coli with a self-transferable, multiresistant plasmid coding for metallo-beta-lactamase VIM-1. Antimicrob Agents Chemother 2003;47(1):395- 397. 147. Giakkoupi P, Xanthaki A, Kanelopoulou M, et al. VIM-1 Metallo-beta-lactamase-producing Klebsiella pneumoniae strains in Greek hospitals. J Clin Microbiol 2003;41(8):3893-3896. 148. Vatopoulos A. High rates of metallo-beta-lactamase-producing Klebsiella pneumoniae in Greece--a review of the current evidence. Euro Surveill 2008;13(4):8023. 149. Toleman MA, Rolston K, Jones RN, et al. blaVIM-7, an evolutionarily distinct metallo-beta- lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrob Agents Chemother 2004;48(1):329-332. 150. Lolans K, Queenan AM, Bush K, et al. First nosocomial outbreak of Pseudomonas aeruginosa producing an integron-borne metallo-beta-lactamase (VIM-2) in the United States. Antimicrob Agents Chemother 2005;49(8):3538-3540.

122

151. Zurfluh K, Hächler H, Nüesch-Inderbinen M, et al. Characteristics of Extended-Spectrum ß- Lactamase- and Carbapenemase-Producing Enterobacteriaceae Isolates from Rivers and Lakes in Switzerland. Applied and Environmental Microbiology 2013;79(9):3021-3026. 152. Zarfel G, Lipp M, Gürtl E, et al. Troubled water under the bridge: Screening of River Mur water reveals dominance of CTX-M harboring Escherichia coli and for the first time an environmental VIM-1 producer in Austria. Sci Total Environ 2017;593:399-405. 153. Fischer J, Rodríguez I, Schmoger S, et al. Escherichia coli producing VIM-1 carbapenemase isolated on a pig farm. J Antimicrob Chemother 2012;67(7):1793-1795. 154. Fischer J, Rodríguez I, Schmoger S, et al. Salmonella enterica subsp. enterica producing VIM- 1 carbapenemase isolated from livestock farms. J Antimicrob Chemother 2012;. 155. Borowiak M, Szabo I, Baumann B, et al. VIM-1-producing Salmonella Infantis isolated from swine and minced pork meat in Germany. J Antimicrob Chemother 2017;:dkx101. 156. Irrgang A, Fischer J, Grobbel M, et al. Recurrent detection of VIM-1-producing Escherichia coli clone in German pig production. J Antimicrob Chemother 2016;72(3):944-946. 157. Al Bayssari C, Dabboussi F, Hamze M, et al. Emergence of carbapenemase-producing Pseudomonas aeruginosa and Acinetobacter baumannii in livestock animals in Lebanon. J Antimicrob Chemother 2015;70(3):950-951. 158. Zhang R, Liu Z, Li J, et al. Presence of VIM-Positive Pseudomonas Species in Chickens and Their Surrounding Environment. Antimicrob Agents Chemother 2017;61(7):10.1128/AAC.00167- 17. Print 2017 Jul. 159. Rubin JE, Ekanayake S, Fernando C. Carbapenemase-producing organism in food, 2014. Emerg Infect Dis 2014;20(7):1264-1265. 160. Le Hello S, Harrois D, Bouchrif B, et al. Highly drug-resistant Salmonella enterica serotype Kentucky ST198-X1: a microbiological study. The Lancet infectious diseases 2013;13(8):672-679. 161. Poirel L, Heritier C, Tolun V, et al. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 2004;48(1):15-22. 162. Carrer A, Poirel L, Eraksoy H, et al. Spread of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in Istanbul, Turkey. Antimicrob Agents Chemother 2008;52(8):2950-2954. 163. Cuzon G, Ouanich J, Gondret R, et al. Outbreak of OXA-48-Positive Carbapenem-Resistant Klebsiella pneumoniae Isolates in France. Antimicrob Agents Chemother 2011;55(5):2420-2423. 164. Kalpoe JS, Al Naiemi N, Poirel L, et al. Detection of an Ambler class D OXA-48-type β- lactamase in a Klebsiella pneumoniae strain in The Netherlands. J Med Microbiol 2011;60(5):677- 678. 165. Cuzon G, Bentchouala C, Vogel A, et al. First outbreak of OXA-48-positive carbapenem- resistant Klebsiella pneumoniae isolates in Constantine, Algeria. Int J Antimicrob Agents 2015;46(6):725-727.

123

166. Benouda A, Touzani O, Khairallah M, et al. First detection of oxacillinase-mediated resistance to carbapenems in Klebsiella pneumoniae from Morocco. Annals of Tropical Medicine & Parasitology 2010;104(4):327-330. 167. Poirel L, Ros A, Carrër A, et al. Cross-border transmission of OXA-48-producing Enterobacter cloacae from Morocco to France. J Antimicrob Chemother 2011;66(5):1181-1182. 168. Girlich D, Bouihat N, Poirel L, et al. High rate of faecal carriage of extended‐spectrum β‐ lactamase and OXA‐48 carbapenemase‐producing Enterobacteriaceae at a University hospital in Morocco. Clinical Microbiology and Infection 2014;20(4):350-354. 169. Potron A, Poirel L, Bussy F, et al. Occurrence of the carbapenem-hydrolyzing beta-lactamase gene blaOXA-48 in the environment in Morocco. Antimicrob Agents Chemother 2011;55(11):5413- 5414. 170. Zurfluh K, Nüesch-Inderbinen MT, Poirel L, et al. Emergence of Escherichia coli producing OXA-48 β-lactamase in the community in Switzerland. anti 2015;4(1):9. 171. Poirel L, Bercot B, Millemann Y, et al. Carbapenemase-producing Acinetobacter spp. in Cattle, France. Emerg Infect Dis 2012;18(3):523-525. 172. Smet A, Boyen F, Pasmans F, et al. OXA-23-producing Acinetobacter species from horses: a public health hazard? J Antimicrob Chemother 2012;67(12):3009-3010. 173. Stolle I, Prenger-Berninghoff E, Stamm I, et al. Emergence of OXA-48 carbapenemase- producing Escherichia coli and Klebsiella pneumoniae in dogs. J Antimicrob Chemother 2013;68(12):2802-2808. 174. Al Bayssari C, Olaitan AO, Dabboussi F, et al. Emergence of OXA-48-producing Escherichia coli clone ST38 in fowl. Antimicrob Agents Chemother 2015;59(1):745-746. 175. Poirel L, Bonnin RA, Nordmann P. Genetic Features of the Widespread Plasmid Coding for the Carbapenemase OXA-48. Antimicrob Agents Chemother 2012;56(1):559-562. 176. Stokes HW, Gillings MR. Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into Gram-negative pathogens. FEMS Microbiol Rev 2011;35(5):790- 819. 177. Martinez JL. Natural antibiotic resistance and contamination by antibiotic resistance determinants: the two ages in the evolution of resistance to antimicrobials. Front Microbiol 2012;3:1. 178. Fleming A. Penicillin. Its practical application. Penicillin.Its practical application. 1946;. 179. Act, Animal Medicinal Drug Use Clarification. of 1994. Public Law 1994;:103-355. 180. Chantziaras I, Boyen F, Callens B, et al. Correlation between veterinary antimicrobial use and antimicrobial resistance in food-producing animals: a report on seven countries. J Antimicrob Chemother 2013;69(3):827-834. 181. Allen HK, Trachsel J, Looft T, et al. Finding alternatives to antibiotics. Ann N Y Acad Sci 2014;1323(1):91-100.

124

182. Allen HK, Levine UY, Looft T, et al. Treatment, promotion, commotion: antibiotic alternatives in food-producing animals. Trends Microbiol 2013;21(3):114-119. 183. Ruan X, Liu M, Casey TA, et al. A tripartite fusion, FaeG-FedF-LT(192)A2:B, of enterotoxigenic Escherichia coli (ETEC) elicits antibodies that neutralize cholera toxin, inhibit adherence of K88 (F4) and F18 fimbriae, and protect pigs against K88ac/heat-labile toxin infection. Clin Vaccine Immunol 2011;18(10):1593-1599. 184. Kroll JJ, Roof MB, McOrist S. Evaluation of protective immunity in pigs following oral administration of an avirulent live vaccine of Lawsonia intracellularis. Am J Vet Res 2004;65(5):559-565. 185. Gaggìa F, Mattarelli P, Biavati B. Probiotics and prebiotics in animal feeding for safe food production. Int J Food Microbiol 2010;141:S15-S28. 186. Vondruskova H, Slamova R, Trckova M, et al. Alternatives to antibiotic growth promoters in prevention of diarrhoea in weaned piglets: a review. Vet Med 2010;55(5):199-224. 187. Chan BK, Abedon ST, Loc-Carrillo C. Phage cocktails and the future of phage therapy. Future microbiology 2013;8(6):769-783. 188. Goodridge LD, Bisha B. Phage-based biocontrol strategies to reduce foodborne pathogens in foods. Bacteriophage 2011;1(3):130-137. 189. Brüssow H, Mcgrath S, Van Sinderen D. Phage therapy: the Western perspective. Norfolk, UK: Caister Acad. Press, 2007. 190. Fischetti VA. Bacteriophage lysins as effective antibacterials. Curr Opin Microbiol 2008;11(5):393-400. 191. Cotter PD, Ross RP, Hill C. Bacteriocins--a viable alternative to antibiotics? Nature reviews.Microbiology 2013;11(2):95. 192. Kadouri DE, To K, Shanks RM, et al. Predatory bacteria: a potential ally against multidrug- resistant Gram-negative pathogens. PloS one 2013;8(5):e63397. 193. Lambert C, Sockett RE. Nucleases in Bdellovibrio bacteriovorus contribute towards efficient self-biofilm formation and eradication of preformed prey biofilms. FEMS Microbiol Lett 2013;340(2):109-116. 194. Scallan E, Hoekstra RM, Angulo FJ, et al. Foodborne illness acquired in the United States— major pathogens. Emerging Infect Dis 2011;17:7-15. 195. Hoffmann S, Maculloch B, Batz M. Economic Burden of Major Foodborne Illnesses Acquired in the United States. USDA, ERS 2015;EIB-140. 196. Schwaber MJ, Carmeli Y. Mortality and delay in effective therapy associated with extended- spectrum beta-lactamase production in Enterobacteriaceae bacteraemia: a systematic review and meta-analysis. J Antimicrob Chemother 2007;60(5):913-920. 197. Lautenbach E, Patel JB, Bilker WB, et al. Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae: risk factors for infection and impact of resistance on outcomes. Clin Infect Dis 2001;32(8):1162-1171.

125

198. World Health Organization. Critically important antimicrobials for human medicine. World Health Organization, 2012. 199. Hammerum AM, Heuer OE. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin Infect Dis 2009;48(7):916-921. 200. Prescott JF. Antimicrobial use in food and companion animals. Anim Health Res Rev 2008;9(2):127-133. 201. van den Bogaard AE, Stobberingh EE. Epidemiology of resistance to antibiotics. Links between animals and humans. Int J Antimicrob Agents 2000;14(4):327-335. 202. Newell DG, Koopmans M, Verhoef L, et al. Food-borne diseases—the challenges of 20years ago still persist while new ones continue to emerge. Int J Food Microbiol 2010;139:S3-S15. 203. Dargatz DA, Kopral CA, Erdman MM, et al. Prevalence and Antimicrobial Resistance of Salmonella Isolated from Cattle Feces in United States Feedlots in 2011. Foodborne Pathog Dis 2016;13(9):483-489. 204. Alali WQ, Scott HM, Norby B, et al. Quantification of the bla(CMY-2) in feces from beef feedlot cattle administered three different doses of ceftiofur in a longitudinal controlled field trial. Foodborne Pathog Dis 2009;6(8):917-924. 205. Winokur PL, Vonstein DL, Hoffman LJ, et al. Evidence for transfer of CMY-2 AmpC beta- lactamase plasmids between Escherichia coli and Salmonella isolates from food animals and humans. Antimicrob Agents Chemother 2001;45(10):2716-2722. 206. Kado CI, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol 1981;145(3):1365-1373. 207. Mollenkopf DF, Weeman MF, Daniels JB, et al. Variable within- and between-herd diversity of CTX-M cephalosporinase-bearing Escherichia coli isolates from dairy cattle. Appl Environ Microbiol 2012;78(13):4552-4560. 208. Carattoli A, Bertini A, Villa L, et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 2005;63(3):219-228. 209. Carattoli A, Miriagou V, Bertini A, et al. Replicon typing of plasmids encoding resistance to newer beta-lactams. Emerg Infect Dis 2006;12(7):1145-1148. 210. Johnson TJ, Wannemuehler YM, Johnson SJ, et al. Plasmid replicon typing of commensal and pathogenic types of Escherichia coli. Appl Environ Microbiol 2007;73(6):1976-1983. 211. Gebreyes WA, Thakur S. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential interserovar transfer of antimicrobial resistance. Antimicrob Agents Chemother 2005;49(2):503-511. 212. Ribot EM, Fair M, Gautom R, et al. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157: H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis 2006;3(1):59-67.

126

213. Mollenkopf DF, Cenera JK, Bryant EM, et al. Organic or Antibiotic-Free Labeling Does Not Impact the Recovery of Enteric Pathogens and Antimicrobial-Resistant Escherichia coli from Fresh Retail Chicken. Foodborne Pathog Dis 2014;11(- 12):920-929. 214. Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33(9):2233-2239. 215. Zhao S, White DG, McDermott PF, et al. Identification and expression of cephamycinase bla(CMY) genes in Escherichia coli and Salmonella isolates from food animals and ground meat. Antimicrob Agents Chemother 2001;45(12):3647-3650. 216. Lowrance TC, Loneragan GH, Kunze DJ, et al. Changes in antimicrobial susceptibility in a population of Escherichia coli isolated from feedlot cattle administered ceftiofur crystalline-free acid. Am J Vet Res 2007;68(5):501-507.

217. Folster JP, Pecic G, McCullough A, et al. Characterization of blaCMY-encoding plasmids among Salmonella isolated in the United States in 2007. Foodborne Pathog Dis 2011;8(12):1289-1294. 218. Li X, Mehrotra M, Ghimire S, et al. β-Lactam resistance and β-lactamases in bacteria of animal origin. Vet Microbiol 2007;121(3-4):197-214. 219. Schmidt JW, Griffin D, Kuehn LA, et al. Influence of therapeutic ceftiofur treatments of feedlot cattle on fecal and hide prevalences of commensal Escherichia coli resistant to expanded- spectrum cephalosporins, and molecular characterization of resistant isolates. Appl Environ Microbiol 2013;79(7):2273-2283. 220. Fey PD, Safranek TJ, Rupp ME, et al. Ceftriaxone-resistant Salmonella infection acquired by a child from cattle. N Engl J Med 2000;342(17):1242-1249. 221. Tragesser LA, Wittum TE, Funk JA, et al. Association between ceftiofur use and isolation of Escherichia coli with reduced susceptibility to ceftriaxone from fecal samples of dairy cows. Am J Vet Res 2006;67(10):1696-1700. 222. Schmidt JW, Agga GE, Bosilevac JM, et al. Occurrence of Antimicrobial-Resistant Escherichia coli and Salmonella enterica in the Beef Cattle Production and Processing Continuum. Appl Environ Microbiol 2015;81(2):713-725. 223. Mollenkopf DF, Kleinhenz KE, Funk JA, et al. Salmonella enterica and Escherichia coli Harboring blaCMY in Retail Beef and Pork Products. Foodborne Pathog Dis 2011;8(2):333-336. 224. Lamb HM, Ormrod D, Scott LJ, et al. Ceftriaxone. Drugs 2002;62(7):1041-1089. 225. Platt TM, Loneragan GH, Scott HM, et al. Antimicrobial susceptibility of enteric bacteria recovered from feedlot cattle administered chlortetracycline in feed. Am J Vet Res 2008;69(8):988-996. 226. Kanwar N, Scott HM, Norby B, et al. Effects of ceftiofur and chlortetracycline treatment strategies on antimicrobial susceptibility and on tet (A), tet (B), and blaCMY-2 resistance genes among E. coli isolated from the feces of feedlot cattle. PLoS One 2013;8(11):e80575.

127

227. Kanwar N, Scott HM, Norby B, et al. Impact of treatment strategies on cephalosporin and tetracycline resistance gene quantities in the bovine fecal metagenome. Scientific reports 2014;4:5100. 228. Nagaraja T, Lechtenberg KF. Liver abscesses in feedlot cattle. Vet Clin North Am Food Anim Pract 2007;23(2):351-369. 229. Jacob M, Fox J, Narayanan S, et al. Effects of feeding wet corn distillers grains with solubles with or without monensin and tylosin on the prevalence and antimicrobial susceptibilities of fecal foodborne pathogenic and commensal bacteria in feedlot cattle. J Anim Sci 2008;86(5):1182- 1190. 230. Chen J, Fluharty F, St-Pierre N, et al. Technical note: Occurrence in fecal microbiota of genes conferring resistance to both macrolide-lincosamide-streptogramin B and tetracyclines concomitant with feeding of beef cattle with tylosin. J Anim Sci 2008;86(9):2385-2391. 231. Poole T, Sheffield C. Use and misuse of antimicrobial drugs in poultry and livestock: mechanisms of antimicrobial resistance. Pak Vet J 2013;33:266-271. 232. USDA. Salmonella and Campylobacter on U.S. dairy operations, 1996–2007. USDA–APHIS– VS, CEAH. Fort Collins, CO. Available at: http://nahms.aphis.usda.gov/dairy/index.htm. 2009;. 233. USDA/APHIS/NAHMS. Antimicrobial Drug Use and Antimicrobial Resistance on U.S. Cow-calf Operations, 2007–08 USDA–APHIS–VS, CEAH. Fort Collins, CO. Available at: https://www.aphis.usda.gov/animal_health/nahms/beefcowcalf/downloads/beef0708/Beef070 8_ir_Antimicrobial.pdf. 2012. 234. Huston CL, Wittum TE, Love BC, et al. Prevalence of fecal shedding of Salmonella spp in dairy herds. J Am Vet Med Assoc 2002;220(5):645-649. 235. Bischoff KM, Edrington TS, Callaway TR, et al. Characterization of antimicrobial resistant Salmonella Kinshasa from dairy calves in Texas. Lett Appl Microbiol 2004;38(2):140-145. 236. Iwamoto M, Reynolds J, Karp BE, et al. Ceftriaxone-Resistant Nontyphoidal Salmonella from Humans, Retail Meats, and Food Animals in the United States, 1996–2013. Foodborne Pathog Dis 2016;14:74-83.

237. Cottell JL, Kanwar N, Castillo-Courtade L, et al. blaCTX-M-32 on an IncN plasmid in Escherichia coli from beef cattle in the United States. Antimicrob Agents Chemother 2013;57(2):1096-1097. 238. Schumm P, Scoglio C, Scott HM. An estimation of cattle movement parameters in the Central States of the US. Comput Electron Agric 2015;116:191-200. 239. Noyes NR, Yang X, Linke LM, et al. Resistome diversity in cattle and the environment decreases during beef production. Elife 2016;5:e13195. 240. Sjölund-Karlsson M, Howie RL, Blickenstaff K, et al. Occurrence of β-lactamase genes among non-Typhi Salmonella enterica isolated from humans, food animals, and retail meats in the United States and Canada. Microb Drug Resist 2013;19(3):191-197. 241. Jesudason MV, Kandathil A, Balaji V. Comparison of two methods to detect carbapenemase & metallo-beta-lactamase production in clinical isolates. Indian J Med Res 2005;121(6):780-783.

128

242. Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2012;18(9):1503-1507. 243. Garcia-Fernandez A, Villa L, Carta C, et al. Klebsiella pneumoniae ST258 producing KPC-3 identified in italy carries novel plasmids and OmpK36/OmpK35 porin variants. Antimicrob Agents Chemother 2012;56(4):2143-2145. 244. Villa L, Poirel L, Nordmann P, et al. Complete sequencing of an IncH plasmid carrying the blaNDM-1, blaCTX-M-15 and qnrB1 genes. J Antimicrob Chemother 2012;67(7):1645-1650. 245. Schwaber MJ, Carmeli Y. Mortality and delay in effective therapy associated with extended- spectrum ß-lactamase production in Enterobacteriaceae bacteraemia: a systematic review and meta-analysis. J Antimicrob Chemother 2007;60(5):913-920. 246. Hornish RE, Kotarski SF. Cephalosporins in veterinary medicine - ceftiofur use in food animals. Curr Top Med Chem 2002;2(7):717-731. 247. Ewers C, Bethe A, Semmler T, et al. Extended-spectrum beta-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Foodborne Pathog Dis 2012;18(7):646-655. 248. Heider LC, Funk JA, Hoet AE, et al. Identification of Escherichia coli and Salmonella enterica organisms with reduced susceptibility to ceftriaxone from fecal samples of cows in dairy herds. Am J Vet Res 2009;70(3):389-393. 249. Wittum TE, Mollenkopf DF, Erdman MM. Detection of Salmonella enterica Isolates Producing CTX-M Cephalosporinase in US Livestock Populations. Appl Environ Microbiol 2012;78(20):7487- 7491. 250. Mollenkopf DF, Mirecki JM, Daniels JB, et al. Escherichia coli and Klebsiella pneumoniae producing CTX-M cephalosporinase from swine finishing barns and their association with antimicrobial use. Appl Environ Microbiol 2013;79(3):1052-1054. 251. Canton R, Gonzalez-Alba JM, Galan JC. CTX-M Enzymes: Origin and Diffusion. Front Microbiol 2012;3:110. 252. Reddy SC, Jacob JT, Varkey JB, et al. Antibiotic use in US hospitals: quantification, quality measures and stewardship. Expert Rev Anti Infect Ther 2015;13(7):843-854. 253. Fridkin S, Baggs J, Fagan R, et al. Vital signs: improving antibiotic use among hospitalized patients. MMWR Morb Mortal Wkly Rep 2014;63(9):194-200. 254. CDC. Antibiotic Resistance Threats in the United States, 2013 (2013) http://www.cdc.gov/drugresistance/pdf/ar-threats-2013-508.pdf [Accessed 3/1/2016]. 255. Nordmann P, Cornaglia G. Carbapenemase-producing Enterobacteriaceae: a call for action! Clin Microbiol Infect 2012;18(5):411-412. 256. Rock C, Thom KA, Masnick M, et al. Frequency of Klebsiella pneumoniae Carbapenemase (KPC)–Producing and Non-KPC-Producing Klebsiella Species Contamination of Healthcare Workers and the Environment. Infect Control Hosp Epidemiol 2014;35(04):426-429.

129

257. Wang B, Sun D. Detection of NDM-1 carbapenemase-producing Acinetobacter calcoaceticus and Acinetobacter junii in environmental samples from livestock farms. J Antimicrob Chemother 2015;70:611-613. 258. Fischer J, Rodriguez I, Schmoger S, et al. Salmonella enterica subsp. enterica producing VIM- 1 carbapenemase isolated from livestock farms. J Antimicrob Chemother 2013;68(2):478-480.

259. Senda K, Arakawa Y, Ichiyama S, et al. PCR detection of metallo-beta-lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum beta-lactams. J Clin Microbiol 1996;34(12):2909-2913. 260. Gröbner S, Linke D, Schütz W, et al. Emergence of carbapenem-non-susceptible extended- spectrum β-lactamase-producing Klebsiella pneumoniae isolates at the University Hospital of Tübingen, Germany. J Med Microbiol 2009;58(7):912-922. 261. Peirano G, Ahmed-Bentley J, Woodford N, et al. New Delhi metallo-beta-lactamase from traveler returning to Canada. Emerging Infect Dis 2011;17(2):242-244. 262. CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard-Ninth Edition. Clinical and Laboratory Standards Institute Document M07-A9. 2014. 263. Zhang H, Shi L, Li L, et al. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Microbiol Immunol 2004;48(9):639-645. 264. Mathers AJ, Stoesser N, Sheppard AE, et al. Klebsiella pneumoniae carbapenemase (KPC)- producing K. pneumoniae at a single institution: insights into endemicity from whole-genome sequencing. Antimicrob Agents Chemother 2015;59(3):1656-1663. 265. Notake S, Matsuda M, Tamai K, et al. Detection of IMP metallo-beta-lactamase in carbapenem-nonsusceptible Enterobacteriaceae and non-glucose-fermenting Gram-negative rods by immunochromatography assay. J Clin Microbiol 2013;51(6):1762-1768. 266. Moulds NM, Thomson KS, Hanson ND. IMP-27, a Novel Metallo-β-Lactamase (MBL) Associated with a Class II Integron Identified in an Isolate of Proteus mirabilis [abstract]. In: Proceedings of the 51st Annual Interscience Conference on Antimicrobial Agents and Chemotherapy ; 2011 Spt 17-20; Chicago, IL: ICAAC; 2011. Abstract C1-1212. 2011 . 267. Widmann M, Pleiss J, Oelschlaeger P. Systematic analysis of metallo-beta-lactamases using an automated database. Antimicrob Agents Chemother 2012;56(7):3481-3491. 268. Rawlings DE, Tietze E. Comparative biology of IncQ and IncQ-like plasmids. Microbiol Mol Biol Rev 2001;65(4):481-96. 269. Meyer R. Replication and conjugative mobilization of broad host-range IncQ plasmids. Plasmid 2009;62(2):57-70. 270. Loftie-Eaton W, Rawlings DE. Diversity, biology and evolution of IncQ-family plasmids. Plasmid 2012;67(1):15-34. 271. Webb HE, Bugarel M, den Bakker HC, et al. Carbapenem-Resistant Bacteria Recovered from Faeces of Dairy Cattle in the High Plains Region of the USA. PloS one 2016;11(1):e0147363. 130

272. Mathew AG, Upchurch WG, Chattin SE. Incidence of antibiotic resistance in fecal Escherichia coli isolated from commercial swine farms. J Anim Sci 1998;76(2):429-434. 273. Scott H, Campbell L, Harvey R, et al. Patterns of antimicrobial resistance among commensal Escherichia coli isolated from integrated multi-site housing and worker cohorts of humans and swine. Foodborne Pathog Dis 2005;2(1):24-37. 274. Callens B, Faes C, Maes D, et al. Presence of antimicrobial resistance and antimicrobial use in sows are risk factors for antimicrobial resistance in their offspring. Microb Drug Resist 2015;21(1):50-58. 275. Mathew AG, Cissell R, Liamthong S. Antibiotic resistance in bacteria associated with food animals: a United States perspective of livestock production. Foodborne Pathog Dis 2007;4(2):115-133. 276. Katouli M, Lund A, Wallgren P, et al. Phenotypic characterization of intestinal Escherichia coli of pigs during suckling, postweaning, and fattening periods. Appl Environ Microbiol 1995;61(2):778-783. 277. Isaacson R, Kim HB. The intestinal microbiome of the pig. Anim Health Res Rev 2012;13(1):100-109. 278. Lawrence AB, Petherick J, McLean K, et al. The effect of environment on behaviour, plasma cortisol and prolactin in parturient sows. Appl Anim Behav Sci 1994;39(3-4):313-330.

131