Trpv4 Mechanotransduction in Vascular Growth And

TRPV4 MECHANOTRANSDUCTION IN VASCULAR

GROWTH AND INTEGRITY

A dissertation submitted to Kent State University in collaboration with

Northeast Ohio Medical University in partial fulfillment of the requirements

for the degree of Doctor of Philosophy

Dissertation written by

Holly C. Cappelli

B.S., University of Mount Union, 2012

Ph.D, Kent State University, 2017

Approved by

______, Chair, Doctoral Dissertation Committee Charles K. Thodeti, Ph.D.

______, Members, Doctoral Dissertation Committee William M. Chilian, Ph.D.

______, Liya Yin, M.D., Ph.D.

______, Moses O. Oyewumi, Ph.D.

______Derek S. Damron, Ph.D.

Accepted by

______, Director, School of Biomedical Sciences Ernest J. Freeman, Ph.D.

______Dean, College of Arts and Sciences James L. Blank, Ph.D.

TABLE OF CONTENTS

LIST OF FIGURES ...... v

LIST OF TABLES ...... vii

LIST OF ABBREVIATIONS ...... viii

ACKNOWLEDGEMENTS ...... xi

CHAPTER I: INTRODUCTION ...... 1

1.1 The Significance of Angiogenesis Research...... 1 1.2 Angiogenesis ...... 1 1.2.1 Sprouting versus Non-Sprouting Angiogenesis ...... 2 1.2.2 Molecular Mechanisms ...... 5 1.2.2.1 Biochemical Factors...... 5 1.2.2.2 Mechanical Factors ...... 6 1.2.2.3. ECM, Integrins, and Matrix Proteases ...... 7 1.2.2.4 Cell Junction Proteins ...... 8 1.2.3 Vessel Remodeling: The Final Step of Angiogenesis ...... 10 1.3 Pathological Angiogenesis ...... 11 1.3.1 Tumor Angiogenesis ...... 12 1.3.2 Pathological Retinal Angiogenesis ...... 13 1.3.3 Current Therapies...... 16 1.4. TRPV4 ...... 17 1.4.1 TRPV4 in Normal Endothelium ...... 20 1.4.2 TRPV4 in Diseased Endothelium ...... 25 1.5 Significance of the Present Study ...... 29

iii

TABLE OF CONTENTS (continued)

CHAPTER II: MATERIALS AND METHODS ...... 35

CHAPTER III: RESULTS ...... 48 1. TRPV4-dependent mechanotransduction mediates angiogenesis and vessel integrity in vivo ...... 48 2. The functional significance of TRPV4 in pathological retinal angiogenesis ..57

CHAPTER IV: DISCUSSION ...... 77 Conclusions ...... 92 Future Directions ...... 93

REFERENCES ...... 96

LIST OF FIGURES

Figure 1. Angiogenic cascade of events...... 3

Figure 2. Sprouting angiogenesis ...... 4

Figure 3. Retinopathy of prematurity ...... 15

Figure 4. TRPV4 mediated mechanotransduction in endothelial cells ...... 22

Figure 5. TRPV4-dependent mechanotransduction during angiogenesis ...... 27

Figure 6. TRPV4 in angiogenic processes ...... 31

Figure 7. Schematic representation of oxygen-induced retinopathy ...... 45

Figure 8. Absence of TRPV4 results in abnormal angiogenesis with poor vessel integrity in response to varying matrix stiffness in vivo...... 51

Figure 9. TRPV4 modulates VE-cadherin localization at cell-cell junctions ...... 53

Figure 10. TRPV4 deletion destabilizes tumor vessel integrity, promoting vascular permeability and metastasis ...... 56

Figure 11. TRPV4 is functionally expressed in retinal endothelial cells ...... 58

Figure 12. TRPV4 is mechanosensitive in the retinal endothelium ...... 60

Figure 13. TRPV4 knockdown induces abnormal tube formation in HuRMECs ...... 62

Figure 14. TRPV4KO P5 retinas exhibit no vascular differences ...... 65

Figure 15. P7 retinas are comparable between WT and TRPV4KO mice ...... 67

Figure 16. TRPV4KO mice display increased vaso-obliteration ...... 70

Figure 17. TRPV4KO mice exhibit unproductive angiogenesis following OIR ...... 73

LIST OF FIGURES (continued)

Figure 18. TRPV4KO P17 OIR retinas exhibit poor vessel integrity ...... 74

Figure 19. TRPV4 is required for VE-cadherin junctions in retinal endothelial cells ...... 76

Figure 20. Schematic showing TRPV4-mediated tumor vessel integrity...... 80

Figure 21. Proposed mechanism by which TRPV4 mediates VE-cadherin junctions through expression of VEGFR2...... 95

LIST OF TABLES

Table 1. List of human primers used to assess TRPV4 expression...... 47

vii

LIST OF ABBREVIATIONS

4-PDD – 4alpha-phorbol-didecanoate

AA - Arachidonic acid

ACh – Acetylcholine

Ang-1 – Angiopoietin-1

Ang-2 – Angiopoietin-2

ANOVA – Analysis of variance

ARD – Ankyrin rich domain

Asp – Aspartic acid

ATP – Adenosine triphosphate bFGF – Basic fibroblast growth factor

CD31 – Cluster of differentiation 31

EC – Endothelial cell

ECM – Extracellular matrix

EDHF – Endothelium-derived hyperpolarizing factor

EET – Epoxyeicosatrienoic acid eNOS – Endothelial nitric oxide synthase

ERK1/2 – Extracellular regulated kinase 1/2

FGF – Fibroblast growth factor

FGFR – Fibroblast growth factor receptor

GSK – GSK1016790A

GSK2 – GSK2913874

viii

H&E – Hematoxylin and Eosin

HIF-1 – Hypoxia-inducible factor 1-alpha

HuRMEC – Human retinal microvascular endothelial cell

HUVEC – Human umbilical vein endothelial cell

IB4 - Isolectin

IGF – Insulin growth factor

LLC – Lewis lung carcinoma cell

MAP7 - Microtubule-associated protein 7

Met – Methionine

MMP – Matrix metalloproteinases

N-cadherin – Neural cadherin

NEC – Normal endothelial cell

NO – Nitric oxide

OIR – Oxygen-induced retinopathy

OTRPC4 – Osmosensitive transient receptor potential channel 4

PA – Plasminogen activator

PAI – Plasminogen activator inhibitor

PDGF – Platelet-derived growth factor

PDGFR – Platelet-derived growth factor receptor

PECAM – Platelet endothelial cell adhesion molecule

PGI2 – Prostacyclin

PI(4,5)P2 – Phosphatidylinositol 3,5-bisphosphate

PKC – Protein kinase C

PlGF – Placental growth factor

PRD – Proline rich domain

ROP – Retinopathy of prematurity

SMA – Smooth muscle actin

TAF – Tumor associated fibroblast

TAM – Tumor associate macrophage

TEC - Tumor endothelial cell

TEM – Tumor endothelial marker

TIMP – Tissue inhibitors of metalloproteinases

TRP – Transient receptor potential

TRP12 – Transient receptor potential channel 12

TRPV4 – Transient receptor potential vanilloid 4

TRPV4KO – Transient receptor potential vanilloid 4 knockout

TRPV4KOEC – Transient receptor potential vanilloid 4 knockout endothelial cell

VE-cadherin – Vascular endothelial-cadherin

VEGF – Vascular endothelial growth factor

VEGFR2 – Vascular endothelial growth factor receptor 2

VRAC – Volume-regulated anion channel

VR-OAC – Vanilloid receptor-related osmotically activated channel

WT – Wild-type

ACKNOWLEDGEMENTS

There are so many people who I want to thank for their help throughout my graduate career because they made it possible for me to achieve this goal of completing my dissertation and Ph.D. First and foremost I would like to express my gratitude and appreciation for my graduate mentor, Dr. Charles Thodeti. He took the time and effort to build trust and establish rapport beyond the usual mentor-mentee relationship, treating me more like a colleague while still providing excellent mentorship. His constant encouragement has been invaluable to my growth in this program and he instilled confidence in me to cultivate my own passion for research.

I am incredibly grateful for my dissertation committee members, Dr. William

Chilian, Dr. Liya Yin, and Dr. Moses Oyewumi. I am very appreciative of their time, guidance, and insight. Additionally, I would like to thank Dr. Derek Damron for serving as my graduate faculty representative and Dr. J. Gary Meszaros for serving as moderator and for graciously welcoming me when I arrived at NEOMED and encouraging me to pursue a doctoral degree.

The Department of Integrative Medical Sciences as a whole, and especially our chairman Dr. William Chilian who provided weekly opportunities for graduate students to present their research, gain valuable feedback from other faculty members, and inspiring us to come up with crazy ideas. In addition, I received excellent administrative assistance from Karen Greene, Carolyn Miller, Ileen Ciccozzi, Margaret Weakland, and

Nona Hose at NEOMED as well as Judy Wearden and Donna Warner at KSU. All of

xi these individuals made my graduate life a little easier by providing prompt and helpful support.

I would like to thank staff members at NEOMED for their help on a daily basis.

Sharon Usip and Denise McBurney never hesitated when I needed help in the Histology lab and provided useful tips and tricks from their many years of experience. Cheryl

Hodnichak who was of great help when I began my rotations at NEOMED. The CMU staff, especially Dr. Stanley Dannemiller, Linda McCort, Lora Nicholson, Cindy Fobes,

John Ryznar, John Gape, and Greg Ferrar, who help our lab take such good care of the animals.

The Infection and Immunity group of faculty, staff, and students for providing me an opportunity to get a break from the lab and have some “infectious” fun. Nicole

Smallwood, thank you for everything you have done throughout my graduate career. You have always been there to help, listen, and encourage, and I am grateful and lucky to call you my friend. Dr. Mistry and Dr. Sobecki, thank you for tolerating my over-excitement when it came to teaching the I&I lab.

Our collaborators at The University of Akron and Dr. Sailaja Paruchuri’s lab.

Throughout my graduate career you have provided lab space, materials, and assistance

(sometimes on a moments notice) and I am grateful for all that you have done. Thank you to my lab cousins, Dr. Vinay Kondeti, Dr. Ernest Duah, Farai Gombedza, and Nosayba

Al-Azzam for your continuous help and encouragement.

I made it through this experience with the support of some very close friends, including Kaleigh Hallahan, Nicholas Boyde, Dr. Nicole Johnson, Jesse Cunion, and

Patrick Yackmack. Thank you for your support and for your understanding of the

xii craziness that is graduate school. Dr. Roslin Thoppil for being my lab sister through and through and for her invaluable friendship, advice, and silliness. Ravi Adapala, my lab brother, who never hesitated to lend a helping hand and is one of the kindest people I know. I would like to thank Dr. Anantha Kanugula and Dr. Ashot Minasyan for providing support and unique outside perspectives when I became immersed with my project. A big shout out to my lab kids, Vibhatsu Amin and Priya Sharma, you came to the CKT lab at just the right time and I want to thank you for your assistance when I had long to-do lists. Thank you to Matthew Kiedrowski for your help both scientifically and personally. Dr. Patricia Shamhart and Dr. Danielle Janota have been my rocks and I am very grateful for your help, especially as I approached the end of my graduate career.

Thank you to the graduate students of the past and present, your friendship has made coming to lab everyday worthwhile, especially Rebecca Curry, Lola DiVincenzo, Dr.

Rituparna Ganguly, Kavita Jadhav, Dr. Fouad Moussa, and Soumyadip Sahu.

Lastly, I would like to thank my family, who raised me with the motivation and perseverance to pursue and complete my doctorate. Thank you to my parents, Tony and

Tina Cappelli, my sister Christy, and my brother Nicholas for your love and understanding. Also, the encouragement of my grandparents has been equally as important to me. Finally, I would like to thank Justin (LOML) who never wavered in his support and never let a day pass by without making me laugh.

xiii

CHAPTER 1

INTRODUCTION

1.1 The Significance of Angiogenesis Research

Angiogenesis is a determining pathophysiological factor for more than 70 major health conditions, including proliferative vascular diseases, arthritis, heart disease, and cancer. Affecting more than one billion people worldwide, these diseases are derived from excessive outgrowth of blood vessels or insufficient blood vessel formation. The study of angiogenesis and angiogenesis-based therapies began in 1971 when Judah

Folkman revolutionized the treatment of solid tumors through his discovery that targeting angiogenesis could be used as an anti-cancer therapy (Folkman, 1971). This further led to the development of angiogenesis inhibitors, anti-angiogenic therapy, and vascular normalization strategies. While these therapies have become promising for some patients, the use of angiogenic inhibitors is still riddled with challenges, such as lack of response or acquired resistance. Therefore, there is still a need to expand upon existing targets of pathological angiogenesis.

1.2 Angiogenesis

The term angiogenesis comes from the Greek roots “angio” and “genesis,” with angio meaning “vessel, usually a blood vessel” and genesis meaning “to originate or create.” Scientifically defined as the formation of new blood vessels from pre-existing ones, angiogenesis is distinctive from vasculogenesis, or the de novo blood vessel

1 formation by angioblastic precursor cells which predominantly occurs in the developing embryo (Risau, 1997). The importance of angiogenesis comes from its involvement during times of both health and disease, as it is the blood and lymphatic vasculature that is responsible for delivering oxygen and nutrients to organ systems as well as for clearance of toxins and wastes.

1.2.1 Sprouting versus Non-Sprouting Angiogenesis

Sprouting angiogenesis is the dynamic process by which blood vessels, comprised of a single layer of endothelium, sprout from the pre-existing vessel through changes in inter-endothelial junctions and the sub-endothelial basement membrane (Eilken &

Adams, 2010). Identified over 200 years ago, sprouting angiogenesis is executed through several well-characterized steps (Figure 1) (Adair & Montani, 2010). In response to angiogenic stimuli, sprouting angiogenesis begins with the detachment of support cells, known as pericytes, from the pre-existing capillary, along with an increase in vascular permeability, loosening of inter-endothelial junctions, and vasodilation. The surrounding basement membrane is then proteolytically degraded to allow the leading endothelial cell

(EC), known as the tip cell, to migrate towards the chemotactic angiogenic signal, which is guided by elongating filopodia (Figure 2). The ECs neighboring the tip cell are known as stalk cells, which proliferate to elongate the stalk and then establish the lumen to create a functional capillary that can be integrated into the existing vascular network (Adair &

Montani, 2010; Ausprunk & Folkman, 1977; Ribatti & Crivellato, 2012; Risau, 1997).

While this invasive form of angiogenesis occurs at a relatively slow rate, it is able to bridge vascular gaps such as found during wound healing (Burri et al., 2004).

Figure 1. Angiogenic cascade of events. Stimuli such as hypoxia and inflammation can trigger angiogenesis through the production and release of pro-angiogenic growth factors. These growth factors bind to their respective receptors to activate endothelial cells, which then proliferate into the surrounding matrix and form a solid sprout. These sprouts extend in the direction of the chemotactic gradient through directional migration. After remodeling of the surrounding extracellular matrix (ECM), sprouts form a tube and loop of vessel lumen which connects to the existing vasculature. Angiogenesis is completed when newly formed capillaries become stable and mature, which includes support from pericytes. [Adapted from The Angiogenesis Foundation, Inc.]

Figure 2. Sprouting angiogenesis. Schematic representation of sprout growth during angiogenesis. Sprouts are directed by the tip cell (blue), which is guided by filopodia to sense the direction of pro-angiogenic signals. Stalk cells (orange) take on a more proliferative phenotype to aid in lumen formation, deposition of basement membrane (red), and attract supporting pericytes (green). [Adapted from Geudens, I and Gerhardt, H. Coordinating cell behaviour during blood vessel formation. Development.2011 Nov;138(21):4569-83. doi: 10.1242/dev.062323.]

Non-sprouting or intussusceptive angiogenesis is an intravascular process in which pre-existing vessels internally divide while maintaining an intact basement membrane (Mentzer & Konerding, 2014). Formally identified in the embryonic lung in

1986, intussusceptive angiogenesis was discovered when alveolar microvasculature displayed “pillars” or “posts” that spanned the blood vessel lumen as the microcirculation expanded (Caduff et al., 1986). This process occurs in four consecutive steps which include the creation of a zone between opposite capillary walls, reorganization of endothelial junctions and perforation of the endothelial bilayer, followed by the formation of an interstitial pillar core and ending with two parallel capillaries that have been elongated in the direction of the vessel axis (Burri et al., 2004; Burri & Tarek, 1990).

This form of angiogenesis is an effective way to modify the microcirculatory structure, such as duplicating existing vessels, pruning energetically inefficient or redundant vessels, as well as modifying the branch angles of bifurcating vessels (Mentzer &

Konerding, 2014). This process is very efficient due to the fact that it occurs quickly, in hours or even minutes, there is no requirement for extra-luminal growth factors or a growth factor diffusion gradient, and it is not reliant on EC proliferation (Burri et al.,

2004).

1.2.2 Molecular Mechanisms

1.2.2.1 Biochemical Factors

Angiogenesis is a highly synchronized process that can be “turned on” and

“turned off” within a brief period of time (Folkman, 1995) which is due, in part, to soluble growth factors. The most common pro-angiogenic molecule is vascular endothelial growth factor (VEGF). VEGF is a critical vascular regulator that increases

EC permeability (Kevil et al., 1998), proliferation (Connolly et al., 1989), migration

(Dimmeler et al., 2000), production of matrix proteases (Pepper et al., 1991), and the activity of endothelial nitric oxide synthase (eNOS) (Ziche et al., 1997). There are three tyrosine kinase receptors with which VEGF can bind to (VEGFR1-3) but it has been found that VEGFR2 mediates the pro-angiogenic actions of VEGF. Angiopoietins are another vascular-specific growth factor which bind to the Tie-2 receptor. Ang-1, secreted by supporting pericytes, act on the non-activated ECs to maintain the overall phenotype of the quiescent cell (Saharinen et al., 2010). Ang-2, secreted by the endothelium, is stimulated by factors such as thrombin, VEGF, histamine, and hypoxia (Moss, 2013) to act on activated ECs to induce vascular destabilization and vessel sprouting (Saharinen et al., 2010). Basic fibroblast growth factor (bFGF) is a non-endothelial specific growth factor that binds to its receptor FGFR, found on ECs and smooth muscle cells, that can act synergistically with VEGF (Przybylski, 2009) to stimulate EC proliferation

(Gospodarowicz et al., 1987), migration, and the production of matrix proteases (Presta et al., 1986). Platelet-derived growth factor (PDGF) is also secreted by the endothelium and binds to the receptor PDGFR to promote pericyte proliferation (D'Amore & Smith, 1993) and increase capillary wall stability (Leveen et al., 1994) to aid in blood vessel maturation.

1.2.2.2. Mechanical Factors

Although soluble growth factors may be essential over long distances to stimulate angiogenesis, it is the cooperation of these chemotransductive signals with local mechanical forces that together mediate the angiogenic process (Ingber et al., 1995).

Mechanotransduction is the process by which the local environment surrounding an

6 individual cell transduces a physical signal to create a biochemical response (Ingber,

1997; Ingber & Folkman, 1989). Because of the contraction of the heart, blood is circulated throughout the vasculature in a pulsatile fashion, exposing the endothelium to hemodynamic forces, including shear stress, cyclic strain, and/or stretch (Chien, 2007).

Furthermore, variations in external stimuli can also cause changes to the intracellular mechanics of the cell due to the expression of mechanosensors such as integrins, cell adhesion molecules, and mechanosensitive ion channels (Ingber, 1997). These mechanotransducers are further able to promote second messenger activation, protein phosphorylation, cytokine-growth factor production, cell shape changes, cytoskeletal reorganization, nuclear transcription factor activation, and changes in gene expression

(Skalak & Price, 1996). Overall, it is the simultaneous input of chemical and local physical signals that coordinate the homeostasis of ECs (H. Zhang & Labouesse, 2012), although the primary mechanosensor for which mechanical stimuli are converted into biochemical signals remains elusive.

1.2.2.3 ECM, Integrins, and Matrix Proteases

Soluble growth factors and the hemodynamic forces acting upon the vessel are not the only ways that the endothelium and angiogenesis can be regulated. The surrounding

ECM provides an interconnected network of proteins and proteoglycans that can regulate cell function both biochemically and mechanically. ECs are directly surrounded by a sheet-like basement membrane, consisting of laminin, type IV collagen, and proteoglycans, which forms a continuous bond with the underlying connective tissue, mainly made up of type I collagen (Adams & Watt, 1993; Juliano & Haskill, 1993;

Yurchenco & O'Rear, 1993). Together, these ECM components can undergo remodeling

7 during the angiogenic process. However, integrin receptors, as well as other mechanosensors, must be present on the cell surface to sense changes in the ECM and have an effect on the cell. Integrins are heterodimers comprised of an  and  subunit which span the membrane (Hynes, 1992), interacting with cytoskeletal proteins and focal adhesion sites to mediate bidirectional signaling (Cary et al., 1999; Hynes, 1992; Sastry

& Horwitz, 1993; Schwartz et al., 1995).

During angiogenesis, the ECM must be degraded in order for activated ECs to migrate and proliferate for sprout formation. Therefore, the ECM is proteolytically cleaved through matrix metalloproteinases (MMPs) and/or serine proteases, such as the plasminogen activator (PA)-plasmin system (Liekens et al., 2001; Mignatti & Rifkin,

1996a, 1996b). While these proteases are important for ECM degradation, they also help in the release of pro-angiogenic stimuli, such as VEGF and FGF (Carmeliet, 2000;

Conway et al., 2001). Furthermore, their activity is tightly regulated in order to prevent excessive ECM breakdown as well as protect uninvolved matrices via tissue inhibitors of metalloproteinases (TIMPs) and PA inhibitors (PAIs) (Liekens et al., 2001; Mignatti &

Rifkin, 1996a, 1996b).

1.2.2.4 Cell Junction Proteins

In the vessel, ECs are arranged in a tight monolayer connected via junctional proteins. Cell-to-cell communication becomes fundamental within the vasculature in order for the cells to remain synchronized, and regulate cell processes such as vascular permeability. Not only do junctions exist between the ECs themselves, but also between the ECs and the surrounding pericytes. During the quiescent state, these junctions remain

8 interconnected, but become transiently dissociated in the presence of angiogenic stimuli

(Carmeliet & Jain, 2011).

There are two predominant families of junctional proteins that are important in the vasculature: tight junctions and adherens junctions. Tight junctions, such as occludins and claudins, are important for creating a barrier, while adherens junctions regulate cell- cell adhesion, cytoskeletal remodeling, and intracellular signaling (Dejana et al., 2009).

Vascular endothelial (VE)-cadherin is an endothelial specific adherens junction protein that interacts intracellularly with catenins, can bind to actin, and modulate several signaling pathways. VE-cadherin promotes vessel stabilization by inhibiting VEGFR2 signaling (Carmeliet & Jain, 2011). However, during the angiogenic process, VE- cadherin adhesive function is decreased due to endocytosis but is still prevalent among the filopodia in the tips cells for contacts to be made on outreaching sprouts (Dejana et al., 2009). Furthermore, N-cadherin is an important adherens junction protein among ECs and pericytes (Carmeliet & Jain, 2011).

Another molecule important for EC junctional integrity is platelet endothelial cell adhesion molecule (PECAM), also known as cluster of differentiation 31 (CD31), a junctional protein that belongs to the immunoglobulin superfamily. Highly expressed on the surface of EC intracellular junctions, PECAM can also interact with catenins, and has been shown to mediate the localization of VE-cadherin and -catenin (Biswas et al.,

2006; Park et al., 2010). Moreover, PECAM has been found to form a mechanosensory complex with VE-cadherin and VEGFR2 as well as 3-integrins to mediate the EC response to fluid shear stress (Collins et al., 2012; Feaver et al., 2010; Tzima et al., 2005).

This translates to the role of PECAM in angiogenesis, which facilitates EC migration,

9 cell-matrix interactions, morphogenesis of capillaries, and junctional development (Cao et al., 2002; DeLisser et al., 1997; Kondo et al., 2007; RayChaudhury et al., 2001; Wu &

Sheibani, 2003). Further, PECAM can regulate adhesion during angiogenesis by mediating EC adherence to the ECM as well as the activation of integrins, to maintain efficient junctional function for cell-cell and cell-matrix turnover (O'Brien et al., 2004;

Park et al., 2010; Wang & Sheibani, 2006).

1.2.3 Vessel Remodeling: The Final Step of Angiogenesis

The homogenous plexus of ECs generated during angiogenesis is created in excess. Therefore, the newly formed tubes and sacs that are to become vessels must undergo remodeling and pruning in order to form a mature, structured network of vessels

(Carmeliet, 2000; Risau, 1997). However, not all of the newly formed vessels will become stable and functional as they undergo remodeling. Remodeling determines which vessels become large or small, regulating vascular density depending on the nutritional demands of the tissue as well as establishing directional blood flow and the association of pericytes with the existing native capillaries. Vessel pruning, which was first described in the retina, is regulated by both tissue-derived signaling molecules and blood flow conditions and predominantly affects excess ECs that create redundant channels (Ribatti

& Crivellato, 2012). However, blood flow plays an important role when it comes to determining the fate of each vessel. Non-perfused vessels are the most susceptible to vessel pruning while changes in blood flow influence the regulation of vessel regression

(Ando & Yamamoto, 2009). Moreover, the vessels with the highest blood flow will expand while the vessels with the least blood flow will regress (Thoma, 1893). Once vessel pruning and remodeling is complete and blood flow has been introduced to the

10 endothelium, the vasculature is able to resume its quiescent state, mature, and stabilize.

Furthermore, cell-cell junctions are re-established, protease inhibitors aid in the deposition of a new basement membrane, and pericytes ensheath the native capillaries

(Carmeliet & Jain, 2011).

1.3 Pathological Angiogenesis

Pathological angiogenesis contributes to a multitude of diseases that collectively affects 10% of the global population (De Falco, 2014). Among these diseases, malignant, ocular, and inflammatory disorders are the most well-known. Driven by angiogenic cues, pathologic blood vessels often present with a destabilized structure. Not only are these vessels disorganized and leaky, but they display a lack of pericyte support, thin ECM, and poor inter-endothelial junctions. Hypoxic conditions, such as present in diseases like cancer and retinopathies, create an environment in which the endothelium requires continuous stimulation with pro-angiogenic factors in order to meet the oxygen and nutrient demands. There also becomes an increase in interstitial fluid pressure in this microenvironment (Boucher et al., 1990), creating turbid blood flow due to the atypical basement membrane (Baluk et al., 2005), disproportionate branching, and varying regions of vessel density (Less et al., 1991). These factors prevent vessel maturation, a necessary component for the establishment of a functional vascular network, which can further increase the ability for immune and/or tumor cells to extravagate and contribute to disease progression. Overall, this aberrant regulation of angiogenesis leads to vasculature that is structurally and functionally abnormal.

1.3.1 Tumor Angiogenesis

Tumor angiogenesis is similar to physiological angiogenesis in that both processes follow a cascade of tightly regulated angiogenic events to meet the growing needs of the surrounding tissue. In the case of tumor angiogenesis, when solid tumors reach a diameter of 1-2 mm in humans, their demands begin to exceed the local supply

(Chung & Ferrara, 2011). This results in a hypoxic environment that is integrated with an oncogenic transformation that alters the pro-/anti-angiogenic equilibrium towards a pro- angiogenic phenotype (Mazure et al., 1996). Within this microenvironment there is continuous stimulation of chemoattractants, which include fibroblasts and inflammatory cells (Chung & Ferrara, 2011). Often times these cell types retain their physiological function but adopt a pro-tumorigenic and pro-angiogenic phenotype once recruited to the tumor microenvironment. Such is the case for tumor associated fibroblasts (TAFs), which can secrete VEGF and FGF (Dong et al., 2004; Hlatky et al., 1994), as well as tumor associated macrophages (TAMs), which accumulate in poorly vascularized areas within the tumor and cooperate with tumor cells to upregulate various factors regulated by hypoxia-inducible factor-1 (HIF-1 (Mantovani et al., 2002).

Comparable to the phenotypic change seen in TAFs and TAMs, perhaps the most affected cell type within the tumor is the vasculature. Tumor endothelial cells (TECs) differ morphologically from their normal counterparts, exhibiting long cytoplasmic projections that extend across the lumen (Dudley, 2012; Dudley et al., 2008; Hida et al.,

2016). Moreover, tumor vessels themselves have been designated as portraying a

“mosaic” in that the expression of certain EC markers is heterogeneous among individual

TECs (di Tomaso et al., 2005). These atypical physical observations continue at the

12 molecular and functional level, with altered gene expression which includes the identification of several genes known as tumor endothelial markers (TEM) (Hida et al.,

2016; St Croix et al., 2000). Taken together, these uncharacteristic features may be attributed to the imbalance in angiogenic stimulant and inhibitor expression and result in some of the following abnormalities: failure to form monolayers, dysfunctional barrier function (Hashizume et al., 2000), varied support from basement membrane and pericytes

(Baluk et al., 2005; Kalluri, 2003), disproportionate vessel diameters, compression of the immature vessel wall, and chaotic blood flow (McDonald & Baluk, 2002).

1.3.2 Pathological Retinal Angiogenesis

Like all developing tissue, the retinal vasculature first develops by vasculogenesis and then by angiogenesis. After de novo blood vessel formation at about 16 weeks’ gestation, angiogenesis proceeds to vascularize the peripheral retina and increase overall retina vessel density until 36-40 weeks’ gestation. During this time, relative hypoxia is the primary stimulant for retinal development, driven by HIF-1 and VEGF signaling.

Infants born prematurely, at a weight less than 2.75 pounds, are at higher risk for retinopathy of prematurity (ROP), a sight-threatening disease that affects more than

15,000 premature infants per year in the United States. Premature infants are customarily provided oxygen supplementation for respiratory support; however, it was not until 1951 when Campbell suggested that a correlation existed between oxygen therapy and the epidemic of severe ROP cases (Campbell, 1951). Under these high oxygen conditions, the still developing retina persists in an altered environment, increasing the risk of ROP.

Historically, ROP has been characterized as a biphasic disease that initially begins with vaso-obliteration followed by neovascularization (Figure 3) (Smith, 2003).

Triggered by hyperoxia- and inflammation-induced retinal damage, vaso-obliteration transpires when normal retinal development is interrupted at birth. Resulting primarily from the downregulation of VEGF, there is a halt in retinal development between the vascular and avascular regions of the retina (Niranjan et al., 2012). Decreased VEGF expression also leads to termination and obliteration of new immature vessels, resulting in vascular endothelial cell death (Ashton et al., 1953; Friddle, 2013; Patz et al., 1953;

Patz et al., 1952; Pierce et al., 1996; Reynolds, 2001). Further, downregulation of insulin growth factor-1 (IGF-1) also contributes to cessation of normally developed vessels which results from the previously high in utero levels provided by the placenta and amniotic fluid (Smith, 2003). Increased metabolic demands of the non-vascularized retina proceed as the infant matures, promoting tissue hypoxia and the upregulation of both

VEGF and IGF-1 to critical levels in order to promote the retina to vascularize. This becomes the second phase of ROP termed neovascularization, which guides the avascular retina into a proliferative state caused by the aforementioned hypoxia, inadequate capillary circulation, and increased metabolic demands of the retina. The neovascularization phase is further exacerbated as the infant is weaned from oxygen supplementation. Ensuing neovessels are persistent, creating an abnormal capillary vascular network that is fragile, permeable, and poorly perfused, which can cause hemorrhage, exudates, retinal detachment, and irreversible blindness (M. Dorrell,

Uusitalo-Jarvinen, et al., 2007; M. I. Dorrell, Aguilar, et al., 2007).

Figure 3. Retinopathy of prematurity. Normal vessel growth of the retina takes place in utero during gestation. However, when normal retinal development is interrupted at premature birth, vessel growth stops. This marks phase I of retinopathy of prematurity, which stimulates the loss of immature vessels and creates a central zone of vaso- obliteration. Increasing metabolic needs and the resulting hypoxia promotes retinal neovascularization, or phase II. This phase can result in the regrowth of normal vessels as well as pathological extra-retinal neovascularization. [Adapted from Connor, KM et al. Quantification of oxygen-induced retinopathy in the mouse: a model of vessel loss, vessel regrowth and pathological angiogenesis. Nat. Protoc. 2009;4(11)1565-73. Doi: 10.1038/nprot.2009.187.]

1.3.3 Current Therapies

In 1971, Folkman discovered that targeting angiogenesis could be a form of an anti-cancer therapy, which led to the development of angiogenesis inhibitors (Folkman &

Ingber, 1992). Many angiogenesis inhibitors focus primarily on growth factor signaling, such as VEGF, placental growth factor (PlGF), FGF, and Ang-2 and their corresponding signaling pathways (Stewart, 2012; Y. Zhao & Adjei, 2015). Further, most of the current clinically approved anti-angiogenic therapies focus on inhibiting VEGF or its receptor

VEGFR2 in efforts to inhibit their broad downstream signaling pathways, through neutralizing monoclonal antibodies such as Avastin (Ferrara, 2004; Jain et al., 2006;

Rabinowitz et al., 2012) and Lucentis (Ferrara et al., 2006; Rosenfeld et al., 2006) or receptor tyrosine kinase inhibitors. These therapies have been shown to help decrease overall tumor size as well as provide a straightforward and rapidly responsive treatment in cases of ROP. However, the use of angiogenic inhibitors are still riddled with challenges such as lack of response, adaptive resistance, recurrence due to compensatory mechanisms, and adverse effects on the normal vasculature (Shojaei, 2012; Stewart,

2012).

A recent approach to tackle the ineffective means of targeting the pathological vasculature involves the novel concept of vascular normalization in which correcting or restoring the abnormal vasculature to resemble physiological vessels may lead to improved delivery of chemotherapeutic agents (Jain, 2005, 2013). However, many of these vascular normalization techniques still focus on VEGF with limited success. In fact, a recent study by Van der Veldt et al found that PET-imaging showed anti-VEGF therapy inhibited perfusion to the tumor just hours after treatment delivery (Van der Veldt et al.,

2012). These findings exemplify the need to uncover potential targets of pathological angiogenesis beyond VEGF and its signaling pathway. While many of the current investigations emphasize growth factor signaling, few have focused on the changes in the mechanical environment and mechanotransduction pathways. The mechanical aspect of angiogenesis as well as the surrounding microenvironment in angiogenesis-dependent diseases plays an equally important role in disease progression. Thus, concentrating on mechanical factors may bestow an entirely new perception in the identification of new targets.

1.4 TRPV4

The transient receptor potential (TRP) family of ion channels are putative candidates involved in mechanotransduction (Yin & Kuebler, 2010). When looking specifically at the vascular tissue, recent investigations have focused on the vanilloid subfamily, specifically TRPV4 due to its remarkable range of expression. TRPV4 is expressed in the vasculature (Earley et al., 2005; Earley et al., 2009; Hatano et al., 2013;

Watanabe, Vriens, et al., 2002), as well as throughout the nervous system (Vennekens et al., 2012), eye (Mergler et al., 2011; Pan et al., 2008; Ryskamp et al., 2011; Shahidullah et al., 2012; P. Y. Zhao et al., 2015), heart (Adapala et al., 2013; Hatano et al., 2009;

Strotmann et al., 2000), digestive system (Egbuniwe et al., 2014; Skrzypski et al., 2013;

Yamawaki et al., 2014; L. P. Zhang et al., 2013), respiratory system (Alvarez et al., 2006;

Andrade et al., 2007; Dahan et al., 2012; Fernandez-Fernandez et al., 2008; Hamanaka et al., 2007; Jia et al., 2004), and urinary system (Berrout et al., 2014; Birder et al., 2007;

Janssen et al., 2011).

First identified as the volume-regulated anion channel (VRAC) (Nilius et al.,

2001), TRPV4 was known to scientists by many different names as key features were observed. Previously recognized as the vanilloid receptor-related osmotically activated channel (VR-OAC) (Liedtke et al., 2000), the osmosensitive transient receptor potential channel 4 (OTRPC4) (Strotmann et al., 2000), and the transient receptor potential channel 12 (TRP12) (Wissenbach et al., 2000), it was not until 2002 that all of these well- described channels was identified to be one channel, TRPV4, which portrayed numerous modes of behavior. In fact, activation of TRPV4 can occur through a variety of both physical and chemical stimuli, such as heat, hypotonicity, phorbol esters, arachidonic acid (AA), and epoxyeicosatrienoic acids (EETs) (Vriens et al., 2004). Based on these characteristics, TRPV4 is now recognized as a fundamental cationic ion channel required for regulating human physiology (Everaerts et al., 2010; Liedtke et al., 2000; Strotmann et al., 2000).

Comprised of 871 amino acids (Strotmann et al., 2000), the protein structure of

TRPV4 is primarily assembled into homotetramers (Shigematsu et al., 2010). Each monomer of TRPV4 is comprised of six transmembrane -helices and can be broken down into three components: the NH2 terminus, the COOH terminus, and the pore region

(Shigematsu et al., 2010). The NH2 terminus resides in the cytoplasm, and includes six ankyrin repeats (ARD) and a proline rich domain (PRD). The ARDs are comprised of 33- residue sequence motifs that are commonly involved in protein to protein interactions, providing binding sites for ATP, calmodulin, and phosphatidylinositol 3,5-bisphosphate

(PI(4,5)P2) (Phelps et al., 2010; Takahashi et al., 2014). Moreover, ARDs become important during channel synthesis and assembly, such as glycosylation and

18 oligomerization (Arniges et al., 2004). The PRD is upstream of the first ARD and is the binding site for cytoskeletal protein PASCIN3, which is able to mediate the response of

TRPV4 to hypotonicity and warm temperature (Cuajungco et al., 2006). PACSIN3 also interacts with TRPV4 through the Src homology 3 domain on the COOH terminus

(Cuajungco et al., 2006; D'Hoedt et al., 2008).

The COOH terminus resides in the cytoplasm, although close to the surface

(Shigematsu et al., 2010), and contains the highly conserved TRP domain. The TRP domain, located after the sixth transmembrane segment of the channel, is required for functional tetramerization of the channel subunits (Garcia-Sanz et al., 2007). The COOH terminus can also interact with microtubule-associated protein 7 (MAP7), which assists in

TRPV4 membrane expression and potentially participates in cytoskeletal linkage (Suzuki et al., 2003). Moreover, the structural component that permits calcium influx during the activation of TRPV4 is the calmodulin binding domain on the COOH terminus

(Strotmann et al., 2003). As a result, the COOH terminus is an essential component for normal channel activity, as subsequent damage to the COOH terminus can result in functional defects (Brauchi et al., 2006).

The third characteristic of the TRPV4 protein is the pore region, which is made of the S5 and S6 transmembrane domains as well as the connecting loop between them

(Salazar et al., 2009). Major residues of the pore region include Asp672, Asp682, and

Met680 (White et al., 2016). Neutralization of the aspartic acid to alanine can result in decreased permeability to divalent cations while mutations in methionine can reduce calcium permeability as well as whole cell current amplitude (Voets et al., 2002; White et

19 al., 2016). Furthermore, the loop of the pore region contains the N-linked glycosylation motif (Xu et al., 2006).

1.4.1 TRPV4 in Normal Endothelium

The expression of TRPV4 in the endothelium was first discovered by the Nilius group in mouse aortic endothelium (Watanabe, Davis, et al., 2002). Later confirmed in rat carotid arteries and human lung arteries (Fantozzi et al., 2003; Kohler et al., 2006),

TRPV4 is now known as a unique and attractive mechanosensor in ECs due to its moderately high permeability to calcium (Strotmann et al., 2000; Watanabe, Davis, et al.,

2002) as well as its mechano- and osmo-sensitivity. Further, the diverse gating behavior of TRPV4, and corresponding calcium influx that follows activation, can be prominently coupled to vascular responses. TRPV4 has been found to be important in overall EC homeostasis by regulating mechanosensing, vascular tone, and vascular permeability.

The endothelium that makes up the vasculature experiences a multitude of mechanical forces such as shear stress as a result of blood flow and cyclic strain, or stretch, which acts along the vessel wall parameter (Chien, 2007). These forces are sensed primarily by integrins and mechanosensitive ion channels (Ingber, 1997). Many of the subsequent downstream signaling pathways are a result of increased intracellular calcium in response to mechanical forces. TRPV4 has become an important mechanosensor in the endothelium and many in vitro studies have corroborated TRPV4 activation by shear stress. Kohler and colleagues were the first to report that TRPV4 mediated shear stress-induced calcium influx in rat carotid artery ECs (Kohler et al.,

2006) which was supported by a later studying showing that knockdown or inhibition of

TRPV4 diminished shear stress-induced calcium influx in murine carotid arteries (Loot et

20 al., 2008) and confirmed in TRPV4KO mice (Hartmannsgruber et al., 2007). TRPV4 is also required for cytoskeletal remodeling and cell reorientation in response to mechanical stimulation. Thodeti et al elucidated one such mechanism by which bovine capillary ECs subjected to cyclic strain induced TRPV4-mediated calcium influx. This further led to phosphatidylinositol 3-kinase (PI3K) activation followed by the binding of additional 1 integrins that may mediate Rho/Rac signaling necessary for remodeling of the cytoskeleton and EC reorientation (Figure 4) (Thodeti et al., 2009). In a follow up study by Matthews, Thodeti et al, it was discovered that direct forces applied to 1 integrins can activate TRPV4 via its interaction with integrin-associated transmembrane CD98 protein found in focal adhesions (Matthews et al., 2010). These in vitro studies confirm that TPRV4 is a mechanosensitive ion channel in ECs, however, direct verification of

TRPV4 mechanosensitivity in vivo remains unknown. Nevertheless, many reports have implicated a role for TRPV4 in other endothelial functions, such as vascular tone.

Figure 4. TRPV4 mediated mechanotransduction in endothelial cells. Schematic model showing TRPV4-dependent mechanical signaling in normal endothelial cells. Application of mechanical forces (cyclic stretch or ECM stiffness) to integrins activates ultra-rapid calcium influx through TRPV4 via interaction with a transmembrane protein CD98. The released Ca2+ activates additional integrins via phosphatidylinositol 3-kinase (PI3K). This integrin-to-integrin signaling may further regulate downstream Rho/Rac pathways necessary for reorganization of the actin cytoskeleton and reorientation of EC (Thodeti et al., 2009). [Figure used with permission (License Number 4035000583202) from Cappelli, HC et al (2016). Role of Mechanosensitive TRP Channels in Abnormal Vasculature of Tumors. In Vascular Ion Channels in Physiology and Disease (pp. 255-273). Spring International Publishing.]

Bradykinin, ATP, and acetylcholine (ACh) are well known vasoactive agents that increase intracellular calcium in the endothelium to mediate vascular tone. Recent evidence has uncovered the involvement of TRP channels in this response, including

TRPV4. TRPV4 activation via 4-PDD or AA elicits endothelium-dependent relaxation in rat coronary and cerebral arteries (Kohler et al., 2006; Marrelli et al., 2007). Prominent dilation also occurs in mouse small mesenteric arteries upon stimulation with TRPV4 activator, GSK1016790A (GSK), a response which is absent in TRPV4 null mice

(Mendoza et al., 2010). Vasorelaxation or vasodilation usually occurs as a result of calcium, which acts a second messenger for the production and release of vasodilators, such as prostacyclin (PGI2), endothelium-dependent hyperpolarizing factor (EDHF),

EETs, and nitric oxide (NO) (G. Chen et al., 1988; Earley et al., 2009; Furchgott, 1996;

Ingber, 1997; Moncada et al., 1976; P. Zhang et al., 2014). Studies in TRPV4 knockout

(TRPV4KO) mice have confirmed the importance of TRPV4 in mediating vasodilation, although there is no change in basal blood pressure (Earley et al., 2009). One study reported that mice lacking TRPV4 exhibit a reduction in the production of NO and EDHF following luminal flow (Mendoza et al., 2010) while another group revealed that

TRPV4KO mice demonstrate a reduction in flow-induced vasodilation only when NOS and cyclooxygenases were blocked in mouse carotid arteries (Loot et al., 2008). Several studies have also linked TRPV4 to ACh-induced vasodilation, dependent and independent of NO (D. X. Zhang et al., 2009). In fact, our lab found that PKC- mediates the vasodilation response through ACh-induced TRPV4 activation (Adapala et al., 2011).

TRPV4 is also an attractive target in the regulation of vascular tone due to its activation

23 through EETs, which can mediate vasorelaxation through endothelium-dependent and independent mechanisms (Nilius et al., 2004).

Vascular permeability to proteins and other solutes is another process regulated by changes in EC calcium. Thrombin and histamine are two known inflammatory mediators that induce vascular leakage by increasing intracellular calcium levels in the endothelium. This calcium elevation activates cell contractility resulting in cell retraction as well as the disruption of cell-cell junctions, including VE-cadherin at adherens junctions. As a calcium permeable channel and known regulator of cytoskeletal remodeling, TRPV4 has also been active player in the regulation of vascular permeability, particularly in the lungs. One of the first studies implicating a role for

TRPV4 in vascular permeability was when Alvarez et al found TRPV4 to mediate alveolar septal barrier permeability through activation of large-conductance calcium- activated potassium channels (BKCa) both in vitro and in vivo (Alvarez et al., 2006).

TRPV4 was also found to facilitate increased pulmonary vascular permeability in a mouse model of ventilator-induced lung injury. This study further revealed that TRPV4 activation also promotes pulmonary edema due to increased pulmonary venous pressure.

Notably, inhibition of AA, a known activator of TRPV4, was able to attenuate these effects (Hamanaka et al., 2007). A more recent study using human lung microvascular

ECs demonstrated that treatment with a TRPV4 agonist was adequate to induce disruption of the barrier, although they defined a role for TRPV4 in the calcium and permeability responses mediated through H2O2 (Suresh et al., 2015). In correlation with

MMPs, it was found that TRPV4 provides the calcium source required for activation of

MMPs in a lung injury model. As a result, TRPV4-injured lungs presented with increased

24 active isoforms of MMP2 and MMP9 as well as a decrease in TIMP2 levels, suggesting that increased septal barrier permeability during lung injury is necessitated by TRPV4- mediated MMP activation (Villalta et al., 2014).

1.4.2 TRPV4 in Diseased Endothelium

Given the diverse range of stimuli that activate TRPV4 as well as the consequential signaling cascades following activation, TRPV4 has become a well known mechanosensor involved in the regulation endothelial homeostasis. Therefore, it is not surprising that changes in TRPV4 expression can affect or contribute to angiogenic diseases and disorders. Several studies, including several from our lab, have begun to eludicate the role of TRPV4 in the pathological endothelium. Many studies focus on tumor-derived endothelial cells (TECs) and the involvement of TRPV4 in tumor angiogenesis and one study has addressed endothelial TRPV4 in the retina during hyperglycemia and diabetes.

Investigations into the properties of TECs have helped characterize this atypical cell type and recent studies have implicated a role for TRPV4. When mouse dermal ECs, designated normal ECs (NECs), and ECs derived from transgenic adenocarcinoma of the mouse prostate, designated tumor ECs (TECs), were challenged with cyclic strain, NECs were found to reorient perpendicular to the direction of cyclic strain while TECs did not optimally reorient. Additional inquiry into the mechanosensitivity of these cells found that TECs exhibited increased cell spreading with increasing substrate stiffness, atypical of the plateau effect seen in NECs. TECs also displayed abnormal angiogenesis in vitro, forming tubes more readily and then collapsing in 2D angiogenesis assays and forming dilated and nonuniform vessels in 3D angiogenesis assays. This abnormal

25 mechanosensitivity and angiognenesis was initally found to be attributed to high basal

Rho activity (Ghosh et al., 2008). However, further investigation by our lab into the mechanism involved revealed that TECs also expressed low functional levels of mechanosensor, TRPV4. We were able to confirm that these abnormal effects were, in part, due to TRPV4 (Figure 5) (Adapala et al., 2016). Using ECs isolated from

TRPV4KO mice, we found that proliferation, migration, and basal Rho activity were significantly increased. In addition, abnormal angiogenesis ensued in the absence of

TRPV4 in 2D angiogenesis, aortic ring, and in vivo Matrigel Plug assays (Thoppil,

Cappelli et al., 2016).

Figure 5. TRPV4-dependent mechanotransduction during angiogenesis. A schematic representation of TRPV4-mediated mechanical signaling in normal and TRPV4KO/TRPV4-deficient (tumor) endothelial cells. In normal endothelial cells, TRPV4 senses mechanical force (ECM stiffness) and induces optimal Rho/Rho kinase activation necessary for endothelial migration and contraction which is required for partial cell rounding and angiogenesis. However, absence of TRPV4 (TRPV4KO EC) or reduction (Tumor EC) in TRPV4 expression and function results in high basal Rho/Rho kinase activation, leading to abnormal (tumor) angiogenesis. This abnormal tumor vasculature can be normalized by restoring mechanosensitivity through pharmacological activation of TRPV4 in tumor endothelial cells (TRPV4-deficient) with GSK1016790A or inhibition of Rho kinase in TRPV4KO EC with Y-27632. Overall, these findings suggest that targeting TRPV4/Rho kinase-mediated mechanotransduction may be a novel therapy for tumor vascular normalization and improving anti-cancer drug delivery. [Figure used with permission from Thoppil RJ, Cappelli, HC et al. TRPV4 channels regulate tumor angiogenesis via modulation of Rho/Rho kinase pathway. Oncotarget. 2016 May 3;7(18):25849-61. doi: 10.18632/oncotarget.8405.]

To further corroborate the potential involvement of TRPV4 in the abnormal features of TECs, we found that targeting TRPV4 via overexpression or pharmacological activation restored abnormal mechanosensitiy and angiogenesis as well as abnormal migration and high active Rho activity. In vivo, WT and TRPV4KO mice challenged with tumors uncovered TRPV4KO mice to present with 2-3X larger tumors and vasculature that was malformed with increased vessel density, vessel diameter, and decreased pericyte coverage. Targeting TRPV4 with TRPV4 agonist, GSK1016790A (GSK), in WT mice revealed a significant decrease in tumor volume when used in conjunction with a chemotherapeutic agent, as well as a significant increase in pericyte covered vessels

(Adapala et al., 2016). We then considered the mechanism by which GSK improves tumor vasculature. Considering EC proliferation is one of the most important steps in angiogenesis, TEC proliferation was assesed. We discovered that TECs express increased

ERK1/2 phosphorylation as well as proliferative genes in the cell cyle. When targeted with TRPV4 activator GSK, TEC proliferation was significantly decreased. Finally, using

Ki-67 as a proliferative marker, tumors from WT mice treated with GSK showed that indeed, the proliferation of the ECs within the tumor was decreased. Taken together, these findings verified that GSK selectively inhibits TEC proliferation (Thoppil et al.,

2015).

In 1991, Puro identified stretch-activated channels in human retinal glial cells.

Moreover, he found that not only were these channels permeable to monovalent and divalent cations, but hypothesized that they facilitated a compensatory response of the glia to swelling (Puro, 1991). Twenty years later, it was found that TRPV4 is clearly expressed in the mouse retina (Gilliam & Wensel, 2011) and identified as a

28 mechanosensor in the adult zebrafish (Amato et al., 2012). Later, TRPV4 was observed to play a role in pressure-induced apoptosis in mouse retinal ganglion cells (Ryskamp et al., 2011), and this group went on report a role for TRPV4 via AA in mouse retinal neurons and glial cells. More specifically, they identied TRPV4 as a primary osmosensor in Müller cells, which aid in ion and water transport among retinal neurons and vascular

ECs (Ryskamp et al., 2014). These studies have begun to establish a role for TRPV4 as a mechanosensor in the retina, however, little has been investigated regarding the role of endothelial TRPV4 or of the pathological implications.

One study has started to elucidate a role for TRPV4 in the retinal microvasculature as well as make a correlation between TRPV4 and diabetic retinopathy.

Monaghan et al first confirmed that TRPV4 is functional expressed in bovine retinal microvascular ECs. More importantly, it was found that both TRPV4 expression and function is downregulated in hyperglycemic conditions in vitro. Confirmatory studies were performed in a streptozotocin-induced diabetes rat model which found a reduction in retinal vascular TRPV4 molecular expression. Overall, these findings suggest a role for

TRPV4 as a potential therapeutic target in the retinal microvasculature during diabetic retinopathy (Monaghan et al., 2015).

1.5 Significance of the Present Study

Most studies pursuing pathological angiogenesis focus on targeting growth factor signaling, but have only shown modest success. Over 60 anti-angiogenic compounds have been evaluated in cancer patients, most of them targeting VEGF signaling, however, acquired resistance (evasive or intrinsic) to VEGF blockade remains a significant obstacle. Although vascular normalization strategies, used in combination with

29 chemotherapy, have been transiently beneficial, they still fail to demonstrate long-term benefits. This is, in part, due to a primary focus on VEGF-targeted therapies. In fact, a recent PET-imaging study found decreased perfusion of treatment to the tumor just hours after anti-VEGF therapy (Van der Veldt et al., 2012). Thus, exploring alternative mechanisms may be a more productive approach. Mechanotransduction-mediated signaling is equally as important when it comes to vascular homeostasis, considering the constant exposure to hemodynamic forces and changes in ECM as a result of continuous blood flow.

Our most recent studies have demonstrated that TRPV4, a mechanosensitive ion channel expressed in the endothelium, acts as a mechanosensor. Further, we have demonstrated that TRPV4 is involved in endothelial proliferation, migration, and tube formation (Adapala et al., 2016; Thoppil et al., 2015; Thoppil et al., 2016). In addition, targeting TRPV4 via pharmacological activation with GSK1016790A was able to restore

TEC mechanosensitivity and promote tumor vessel maturation for improved cancer therapy (Adapala et al., 2016). However, the molecular mechanism by which TRPV4 regulates vascular integrity is not known (Figure 6). Investigating this potential role of

TRPV4 will provide novel exploration into the mechanism by which TRPV4 independently or dependently affects the integrity of the vasculature and how regulation

(or deregulation) of this channel may contribute to other disease models of angiogenesis.

Overall, this may ultimately lead to the development of better therapeutic targets in vascular pathologies.

Figure 6. TRPV4 in angiogenic processes. We have previously demonstrated that in the angiogenic cascade of events, TRPV4 plays a role in the processes of endothelial cell proliferation, migration, and tube formation. However, little has been found regarding the role of TRPV4 in vessel stabilization during the final step of angiogenesis.

We hypothesize that mechanosensitive TRPV4 channels are critical regulators of angiogenesis as well as vascular integrity and that deregulation of TRPV4 signaling can lead to pathological angiogenesis. To test this hypothesis, we propose the following specific aims:

1) Determine if TRPV4-dependent mechanotransduction mediates angiogenesis

and vessel integrity in vivo

2) Determine the functional significance of TRPV4 in pathological retinal

angiogenesis

Specific Aim 1. Determine if TRPV4-dependent mechanotransduction mediates angiogenesis and vessel integrity in vivo. We hypothesize that TRPV4 is an endogenous mechanosensor in endothelial cells which is required for vessel integrity.

1a. Absence of TRPV4 induces abnormal angiogenesis in Matrigel Plugs of varying stiffness in vivo. Matrigel plugs of varying stiffness were injected into WT and

TRPV4KO mice to analyze in vivo angiogenesis in response to different stiffness. After two weeks, Matrigel plugs were excised and assessed for various parameters.

1b. TRPV4 is required to maintain vessel integrity. Previous studies from our lab have shown that tumor vessels formed in the absence of TRPV4 exhibit decreased support by pericytes as well as increased diameter, suggesting a role for TRPV4 in vessel integrity.

To investigate if TRPV4 is required for endothelial junctions, immunocytochemistry was performed to evaluate VE-cadherin, a known endothelial specific junctional protein, in normal (NEC), TRPV4-deficient (TEC), and TRPV4 knockout (TRPV4KO) ECs.

Moreover, tumors isolated from WT and TRPV4KO mice were examined for endothelial junctions, permeability, and metastasis.

Specific Aim 2. Determine the functional significance of TRPV4 in pathological retinal angiogenesis. Our lab has shown that TRPV4 plays an important mechanosensor role in the tumor endothelium and recently, one study found TRPV4 to be a factor in retinal ECs, specifically hyperglycemia and diabetes (Monaghan et al., 2015). Therefore, we hypothesize that deregulation of TRPV4 exacerbates angiogenesis in a mouse model of proliferative retinopathy. However, to investigate this aim, it was necessary to first confirm the functional mechanosensor role of TRPV4 in the retinal endothelium.

Experiments were conducted using retinal ECs to measure TRPV4 expression and function as well as challenge these cells to cyclic strain and assess tube formation.

2a. TRPV4 in retinal vascular development. P5 and P7 retinas collected from WT and

TRPV4KO mice were dissected to assess baseline conditions and parameters of the developing retina.

2b. Absence of TRPV4 leads to unproductive angiogenesis following oxygen-induced retinopathy. To investigate a secondary model of pathological angiogenesis, a mouse model of oxygen-induced retinopathy (OIR) was first optimized. Vaso-obliteration of the retina was induced at P12 after mouse pups were subjected to 5 days of hyperoxia.

Retinal neovascularization followed at P17 when mouse pups were then subjected to 5 days at room temperature. Retinas from WT and TRPV4KO mouse pups were collected at the abovementioned time points, and various parameters were assessed.

2c. TRPV4 is necessary for VE-cadherin localization at cell-cell junctions in retinal endothelial cells. Human retinal ECs were evaluated for VE-cadherin localization when

TRPV4 was silenced or inhibited.

CHAPTER II

MATERIALS AND METHODS

Cell Culture

Normal and tumor-derived endothelial cells

Normal endothelial cells (NECs) were obtained from murine dermal microvasculature and tumor endothelial cells (TECs) were isolated from transgenic adenocarcinoma of the mouse prostate, as previously described (Ghosh et al., 2008).

Cells were grown on gelatin-coated culture dishes and incubated at 37°C with 5% CO2.

Cells were grown in DMEM low glucose based media (Hyclone) supplemented with

10% fetal bovine serum (Atlanta Biologicals), 10% Nu Serum IV (Corning), antibiotic/antimycotic mix (Hyclone), 1% insulin-transferrin-selenium (Lonza), bFGF (3 ng/mL) (Corning), VEGF (0.08 ng/mL) (R&D Systems), and heparin (0.1 mg/mL)

(Sigma Aldrich). Cells were split at 90-95% confluency and used between passages 11-

22. As previously described, the expression of endothelial cell markers and absence of mesenchymal cell markers was confirmed prior to the use of these cells for experimentation (Adapala et al., 2016; Dudley et al., 2008).

Wild-type and TRPV4 knockout endothelial cells

Wild-type (WT) and TRPV4 knockout (TRPV4KO) endothelial cells were isolated using the aortic ring assay, as previously described (Baker et al., 2011;

Mahabeleshwar et al., 2006; Thoppil et al., 2016). Briefly, ECs sprouting from aortic

35 explants, which were cultured from WT and TRPV4KO mice, were isolated, washed, and seeded on gelatin-coated culture dishes. These primary cells were used between passages

1-8 and cultured in the abovementioned endothelial media.

Human retinal microvascular endothelial cells

Human retinal microvascular endothelial cells (HuRMECs) were purchased from

Cell Systems. HuRMECs were cultured on CSC Attachment Factor-, fibronectin-, or gelatin-coated culture dishes in CSC Complete Medium with Serum and Cultureboost-R.

HuRMECs were used between passages 3-12.

Lewis lung carcinoma cells

Lewis lung carcinoma cells (LLCs) were derived from murine lung cancer cells.

LLCs were plated directly onto culture dishes and grown in DMEM high glucose based media (Hyclone) supplemented with 10% fetal bovine serum (Atlanta Biologicals) and antibiotic/antimycotic mix (Hyclone).

Calcium Imaging

NECs, TECs, TRPV4KOECs, and HuRMECs were cultured on coated MatTek glass bottom dishes. Upon confluency, Fluo-4/AM (3 M) (Invitrogen) was loaded for

20-30 minutes, followed by 3 washes in calcium media (136 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 1.1 mM CaCl2, 1.2 mM KH2PO4, 5 mM NaHCO3, 5.5 mM glucose, and 20 mM Hepes. pH 7.4). TRPV4 agonist, GSK1016790A (GSK) (Sigma Aldrich), was prepared in calcium media and used to stimulate calcium influx. 100 nM was used for mouse ECs and 1 nM was used for human ECs. When TRPV4 antagonist, GSK2193874

(GSK2; 50 nM) (Tocris) was used, cells were incubated for 20 minutes prior to

GSK1016790A stimulation. Calcium imaging was performed on the Olympus IX81 microscope using Metamorph software or Olympus IX70 Confocal microscope using

Fluoview software and all data was analyzed in Microsoft Excel. Data are reported as

F/F0, or the ratio of normalized Fluo-4 fluorescence intensity relative to time 0.

Cyclic Strain

HuRMECs were seeded and cultured on fibronectin-coated Uniflex 6 well-plates

(Flex Cell International) and grown to ~95% confluency. Cells were subjected to 18 hours of uniaxial cyclic strain using the Flexercell® Tension Plus™ System (Flex Cell

International). When TRPV4 antagonist, GSK2193874 (GSK2; 10 nM) (Tocris) was used, cells were pretreated for 30 minutes prior to starting the stretch application. Control cells were subjected to identical conditions in the absence of stretch. Cell orientation was calculated following immunocytochemistry with Phalloidin conjugated to Alexa-Fluor

488 (Molecular Probes) using images from at least 5 different fields per condition. Cell angle was measured by tracing the cells using ImageJ software (NIH). The data are reported as the percent of realigned cells at 90° ± 30°.

Immunocytochemistry

Once cells reached confluency and/or the desired assay was complete, cells were fixed in 4% PFA for a minimum of 20 minutes. Fixed cells were washed 3 times in

Phosphate Buffered Saline (PBS) followed by permeabilization with 0.25% Triton X-100 in PBS. After washing, cells were blocked in 5% bovine serum albumin (BSA) or serum containing media for 30-60 minutes. Incubation with primary antibodies lasted 60 minutes at room temperature using the following antibodies: VE-cadherin (1:100) (Santa

Cruz) and Vinculin (1:150) (Sigma Aldrich). Cells were washed and secondary antibodies conjugated to Alexa-Fluor 488 and Alexa-Fluor 594 (Invitrogen), including phalloidin conjugated to Alexa-Fluor 488 (Molecular Probes), were added to the cells for

60 minutes at room temperature. Following the last round of washes, cells were mounted with hard set mounting medium with DAPI (Vector Lab). Images were captured using the

Olympus IX81 Microscope at 20X, 40X, and 60X with FITC/Texas Red filters.

PCR

RNA was isolated from cells using the RNeasy Mini Kit (Qiagen) and concentration was measured with the NanoDrop 2000 UV-Vis Spectrophotometer. Using qscript cDNA SuperMix (Quanta Biosciences), cDNA was synthesized and PCR was carried out with GoTaq Green Master Mix (Promega) using the Bio-Rad PCR machine to amplify the product. The PCR reaction program ran as follows: 94°C – 5 minutes, 94°C –

1 minute, 57°C – 15 seconds, 72°C – 15 seconds, 72°C – 5 minutes, and 4°C – α.

Samples were run on 2.5% agarose gels containing ethidium bromide in 1X TAE buffer

(pH 8.0) (Boston Bioproducts) at 120V for 25 minutes and visualized under a UV trans- illuminator to view the DNA bands. The Quick-Load® 100 bp DNA Ladder (New

England Biolabs) was used to identify the amplified product length. qPCR

RNA was isolated from cells using the RNeasy Mini Kit (Qiagen) and concentration was measured with the NanoDrop 2000 UV-Vis Spectrophotometer. Using qscript cDNA SuperMix (Quanta Biosciences), cDNA was synthesized and qPCR was carried out with the Fast SYBR green master mix (Applied Biosystems) using the Fast

Real-Time PCR system (Applied Biosystems). Real time primers for GAPDH and

TRPV4, were purchased from IDT technologies. Gene expression was analyzed relative to GAPDH values and the ΔΔCT values are expressed as a fold change.

Transfection

HuRMECs were seeded at 70% confluency and transfected using siLentFect

Reagent (Bio-Rad). Briefly, non-target smartpool siRNA (50 nM) (Dharmacon), human

TRPV4 smartpool siRNAs (50 nM) (Dharmacon), and siLentFect reagent was added to individual micro-centrifuge tubes with Opti-MEM media (Gibco) and incubated at room temperature for 5 minutes. The siLentFect Reagent mix was then added into respective siRNA micro-centrifuge tubes and further incubated for 25 minutes. After rinsing

HuRMECs with Opti-MEM media, the transfection mixture was added and cells were incubated for 6-8 hours at 37°C with 5% CO2. After incubation, complete HuRMEC media was added to the cells, making up half of the total volume. After 24 hours of transfection, media was aspirated and replaced with 100% complete HuRMEC media.

Knockdown of TRPV4 channel expression was assessed after 24 and 48 hours using qPCR with specific TRPV4 primers. Once TRPV4 knockdown was confirmed, cells were then used for immunocytochemistry or 2D angiogenesis assays.

2D Angiogenesis Assays

In a 48 well-plate, growth factor-reduced Matrigel (Corning) was plated in the desired wells and incubated at 37°C for a minimum of 30 minutes. Cells were counted and seeded at high density and incubated for up to 24 hours. When TRPV4 siRNA cells

39 were used, cells were transfected 48 hours prior to seeding. 4X images were obtained using the Olympus IX51 BrightField microscope.

Animals

The experimental design(s) with the use of animals was approved by the Internal

Animal Care and Use Committee (IACUC) at Northeast Ohio Medical University. All animals in this study were of C57BL/6 background (WT and TRPV4-/-).

Matrigel Plug Assay

Mice were anesthetized with Ketamine/Xylazine cocktail according to their body weight. Using Nair to remove the hair from the hind limbs, phenol red free Matrigel

(Corning) supplemented with basic FGF (0.25 g/mL) (Corning), VEGF (0.2 ng/mL)

(R&D Systems), and heparin sulfate (0.5 g/mL) (Sigma Aldrich) were subcutaneously injected into each flank. As previously described, various concentrations of microbial transglutaminase were added to alter stiffness (Mammoto et al., 2009). Matrigel plugs were excised after 2 weeks and processed for immunohistochemistry. Hematoxylin and

Eosin (H&E) stained tissue was used to calculate the average number of nuclei per plug, using 10X images taken from 5 different fields of the Matrigel Plug. 20X images taken from 10-20 different fields were used to measure the area of the vessels following CD31 staining by tracing the vessels using ImageJ software. The data are reported as the area of endothelium per vessel in microns. VE-cadherin staining was used in conjunction with

CD31 to visualize endothelial cell junctions. 40X images were used to measure the percentage of VE-cadherin staining per vessel area. The data are reported as the percentage of VE-cadherin covered vessels.

Immunohistochemistry

Frozen

Collected tumor tissue and Matrigel plugs were embedded in OCT (Tissue-Tek) and tissue was cryosectioned at 7-10 M thickness on coated slides. Prior to staining, frozen sections were brought to room temperature for 10-20 minutes, fixed in ice cold acetone for 15 minutes, and washed 3 times with Tris Buffered Saline (TBS). Sections were blocked in 5% BSA or serum-containing media for 30-60 minutes. Using a hydrophobic pap pen to create a border around the tissue, the following primary antibodies were added to the sections: CD31 (1:50) (Invitrogen), NG2 (1:200)

(Millipore), and VE-cadherin (1:100) (Santa Cruz) and incubated in a humidified chamber overnight at 4°C. The next day, sections were washed 3 times with TBS followed by the addition of the corresponding secondary antibody conjugated with

Alexa-Fluor 488 or Alexa-Fluor 594 (Invitrogen) for 60 minutes at room temperature.

Following the last round of washes, sections were mounted with hard set mounting medium with DAPI (Vector Lab). Images were captured using the Olympus IX81

Microscope at 20X, 40X, and 60X with FITC/Texas Red filters.

Paraffin

Lung and eye tissue was processed and embedded in paraffin and cut using a

Leica microtome (Leica Biosystems) at 7-10 M thickness on coated slides. Prior to staining, sections were deparaffinized in a 60°C oven and rehydrated in xylene and varying percentages of alcohol and then stained for Hematoxylin and Eosin (H&E).

Slides were then dehydrated in varying percentages of alcohol and xylene followed by

41 mounting with DPX Mountant (Sigma Aldrich). Images were captured using the

Olympus BX40 Microscope at 2X, 4X, 10X, and 20X.

Retinal Vasculature

Whole eyes were fixed in 4% PFA in 2X PBS followed by retina dissection.

Retinas were stored in methanol at -20°C until staining, in which retinas were briefly rinsed in 2X PBS. Retinas were then covered with 100 L of Perm/Block solution (PBS

+ 0.3% Triton X-100 + 0.2% BSA + 5% FBS) for 60 minutes on an orbital shaker. If an unconjugated antibody was used, Perm/Block solution was removed and retinas were incubated with NG2 (1:50) (Millipore) overnight at 4°C on an orbital shaker. The next day, antibody was removed, retinas were washed 4 times in PBSTX (PSB + 0.3% Triton

X-100) for 10 minutes each. Retinas were then incubated with secondary antibody conjugated to Alexa-Fluor 488 (Invitrogen) and Isolectin conjugated to Alexa-Fluor 594

(Invitrogen) overnight at 4°C with gentle shaking. The next day, antibody was removed and retinas were washed 4 times in PBSTX for 15 minutes each followed by mounting with hard set mounting medium with DAPI (Vector Labs). Images were obtained using the Olympus IX80 Microscope at 4X, 20X, 40X, and 60X with FITC/Texas Red filters.

Vascular area and tip cells were calculated for P5 and P7 retinas using Adobe Photoshop and ImageJ (NIH) software respectively. The data are reported as the percentage of vascular retina compared to the total retina area or the average number of tip cells along the vascular front per field, taken from a minimum of 5 different fields.

Syngeneic Tumor Model

Mice were anesthetized with Ketamine/Xylazine cocktail according to their body weight. Using Nair to remove the hair from the hind limbs, 2 million LLCs were subcutaneously injected into each flank. After 21 days, mice were euthanized with Fatal

Plus or anesthetized with Ketamine/Xylazine cocktail for tail veil perfusion of Dextran,

Texas Red at 3000 MW (100 mM) (Molecular Probes). After extraction, tumor tissue was embedded in OCT (Tissue Tek) for immunohistochemistry.

Lung Metastasis

On day 21 following tumor injection, the lung tissue was also collected and fixed in 4% PFA for immunohistochemistry. H&E staining was performed and the total number of metastasis was calculated per lung. The data are reported as average number of metastases per lung.

Oxygen-Induced Retinopathy

The mouse model of oxygen-induced retinopathy (OIR) was conducted as previously described (Connor et al., 2009; Smith et al., 1994). Briefly, WT and

TRPV4KO mouse pups (P7), with nursing mothers, were placed into a hyperoxia chamber containing 75% oxygen for 5 days (until P12) before returning the mice to room air. Exposure to hyperoxia results in the regression of the central retinal vasculature, suspending normal radial vessel growth. This effect is termed vaso-obliteration, which can be quantified at P12. Vaso-obliteration was measured using Adobe Photoshop and is reported as percentage of avascular retina area compared to the total retina area.

Returning the pups to room air causes the avascular areas of the retina to become hypoxic, stimulating pro-angiogenic factors in order to regrow the retinal vessels, i.e. neovascularization. Neovascularization is maximal at P17 and is evaluated by calculating areas of intense IB4 staining. Neovascularization was measured using the Magic Wand tool function in Adobe Photoshop and is reported as percentage of neovascularized area compared to the total retina area.

Figure 7. Schematic representation of oxygen-induced retinopathy. Oxygen-induced retinopathy (OIR) is an established model in the mouse to observe pathological neovascularization. The day that litters are born is depicted as P0. Pups remain at room air with their nursing mother until P7. From P7 to P12, pups are exposed to hyperoxic conditions of 75% oxygen in an oxygen chamber, imitating phase I vaso-obliteration. At P12, pups return to room air from until P17, to mimic phase II neovascularization.

Statistical Analysis

Statistical analyses were carried out using Microsoft Excel. Analyses were completed using Student’s t-test or two-way ANOVA with Tukey’s post-hoc testing. A value of p ≤ 0.05 was considered significant.

Gene Primer Sequence

Forward (5’-3’) – ACGTTGCTATCCAGGCTGTG Beta-Actin Reverse (5’-3’) – GAGGGCATACCCCTCGTAGA

Forward (5’-3’) – CTCCCACTCTTCCACCTTCG GAPDH Reverse (5’-3’) – CCACCACCCTGTTGCTGTAG

Forward (5’-3’) – TCACTCTCACCGCCTACTACCA TRPV4 Reverse (5’-3’) – CCCAGTGAAGAGCGTAATGACC

Table 1. List of human primers used to assess TRPV4 expression.

CHAPTER III

RESULTS

1. Determine if TRPV4-dependent mechanotransduction mediates angiogenesis and vessel integrity in vivo

1a. Absence of TRPV4 induces abnormal angiogenesis in Matrigel Plugs of varying stiffness in vivo

Cells sense and respond to variations in mechanical forces by orchestrating changes inside and outside of the cell to modulate their form and/or function (Chicurel et al.,

1998). We and others have shown that when TRPV4 expression and function is deregulated in ECs, such as in tumor-derived ECs (or using siRNA knockdown), these cells respond abnormally to cyclic strain and ECM elasticity (Ghosh et al., 2008; Thodeti et al., 2009). Recently, we observed abnormal mechanosensitivity exhibited by

TRPV4KOECs when plated on gelatin gels of varying stiffness and allowed to spread

(Thoppil, Cappelli et al., 2016).

Our in vitro studies have confirmed the mechanosensitive nature of TRPV4 (Adapala et al., 2011; Adapala et al., 2016; Matthews et al., 2010; Thodeti et al., 2009; Thoppil et al., 2016), however, these findings have not been directly verified in vivo. Therefore, to unequivocally confirm that TRPV4-dependent mechanosensitivity mediates angiogenesis in vivo, we employed a modified Matrigel plug implant assay, adding various concentrations of microbial transglutaminase to create Matrigel plugs of low,

48 intermediate, and high stiffness (700 Pa, 800 Pa, and 900 Pa). Matrigel plugs were subcutaneously injected into the hind limbs of WT and TRPV4KO mice and excised after two weeks for immunohistochemical analysis. Hematoxylin and Eosin (H&E) staining was initially performed to measure cell infiltration and recruitment into the plugs (Figure

8A). Quantitative analysis revealed that the number of nuclei in Matrigel plugs isolated from WT mice remained unchanged at low (700 Pa) and intermediate (800 Pa) stiffness, but significantly increased at high stiffness (900 Pa). Importantly, plugs isolated from

TRPV4KO mice displayed a stiffness-dependent increase in nuclei infiltration compared to WT (Figure 8B).

To evaluate the newly formed capillary vessels, Matrigel plugs were then immunostained for EC marker, CD31 (Figure 8C). We traced the vessels to analyze the area of endothelium per vessel (Figure 8D). In WT Matrigel plugs, the area of endothelium per vessel increased from low to intermediate stiffness, reaching a plateau at the highest stiffness, while TRPV4KO Matrigel plugs exhibited an increase in the area of endothelium per vessel with increasing stiffness. These findings indicate that vascular growth reached a maximum at intermediate stiffness (800 Pa) but remained unchanged at the highest stiffness in WT mice. However, the absence of TRPV4 resulted in continued

(unregulated) vascular growth with increasing stiffness. These results confirm our previous in vitro findings that TRPV4-dependent mechanotransduction is an important regulator of angiogenesis, which we have now shown to be true in vivo. To our knowledge, this is the first report to show a direct mechanosensitive role for TRPV4 in in vivo angiogenesis.

Next, to determine if TRPV4 also plays a role in the final step of angiogenesis i.e. vessel maturation and stability, we evaluated EC junctional integrity in the Matrigel plugs by visualizing VE-cadherin (Figure 8E). WT Matrigel plug vasculature displayed VE- cadherin that co-localized with CD31 along the majority of the newly formed vessels

(>73%), indicating matured vascular networks. However, TRPVKO plugs exhibited many vessels with gaps or weak VE-cadherin staining. Quantitative analysis of the percentage of VE-cadherin co-localization with CD31 revealed that the absence of

TRPV4 resulted in a significant reduction at low, intermediate, and high stiffness in comparison to WT (Figure 8F). Taken together, these results suggest that TRPV4 regulates physiological angiogenesis by stabilizing VE-cadherin-dependent cell-cell contacts and that absence of TRPV4 may lead to disruption of EC-junctional integrity that promotes abnormal angiogenesis.

Figure 8. Absence of TRPV4 results in abnormal angiogenesis with poor vessel integrity in response to varying matrix stiffness in vivo. A) Representative Brightfield images of H&E stained Matrigel plugs of varying stiffness excised from WT and TRPV4KO mice. B) Quantitative analysis of the average number of nuclei per field in Matrigel plugs showing a significant (p≤0.05) stiffness-dependent increase of nuclei in TRPV4KO plugs in comparison to WT. C) Representative immunofluorescence images (20X) showing CD31 (red) to visualize angiogenesis in response to changing stiffness in WT and TRPV4KO mice. D) Quantitative analysis of the area of endothelium per vessel (M2) showing a significant (p≤0.05) stiffness-dependent increase in vessel area in TRPV4KO Matrigel plugs. E) Representative immunofluorescence images (40X) of CD31 (red) co-localized with adherens junction protein, VE-cadherin (green), in Matrigel plugs of different stiffness among WT and TRPV4KO mice. F) Quantitative analysis of VE-cadherin covered vessels showing a significant (p≤0.05) reduction in endothelial junctions in TRPV4KO Matrigel plugs in comparison to WT Matrigel plugs. [n=3 for all Matrigel plugs except TRPV4KO 900 Pa where n=2]

1b. TRPV4 is required to maintain vessel integrity

VE-cadherin is responsible for mediating calcium dependent cell-cell interactions

(Gavard, 2009), adherens junctions assembly, and barrier maintenance (Gavard &

Gutkind, 2006; Hebda et al., 2013; Heupel et al., 2009; Taddei et al., 2008). Moreover,

VE-cadherin interacts with vascular endothelial growth factor receptor 2 (VEGFR2) and

CD31 in a mechanosensory complex, to integrate mechanical signaling with soluble signaling at cell-cell junctions. In addition, Rho-dependent reorganization of the cytoskeleton may mediate disassembly of VE-cadherin cell junctions. Since the absence of TRPV4 resulted in the formation of immature vessels, characterized by poor VE- cadherin expression in Matrigel plugs, we next examined VE-cadherin localization in normal ECs (NECs), TRPV4-deficient tumor-derived ECs (TECs), and TRPV4KOECs.

First, we confirmed the functional expression of TRPV4 in these cells by measuring calcium influx in response to TRPV4 agonist, GSK1016790A (Figure 9A). VE-cadherin staining in the NECs was localized in the cell membrane and at the cell-cell contacts. In

TECs, VE-cadherin staining was weaker, displaying less VE-cadherin along the junctions and more internalized VE-cadherin. Importantly, TRPV4KOECs exhibited poor VE- cadherin staining at the cell-cell contacts and along the plasma membrane, with most of the staining internalized in the cytoplasm (Figure 9B). These results, in conjunction with our findings in in vivo Matrigel plugs, suggest that TRPV4 modulates VE-cadherin localization at endothelial junctions.

Figure 9. TRPV4 modulates VE-cadherin localization at cell-cell junctions. A) Representative calcium traces showing substantial TRPV4-mediated calcium influx in NECs, which is reduced and abolished in TECs and TRPV4KOECs respectively [n≥3]. Note: arrow denotes the time when the cells were stimulated with TRPV4 agonist, GSK1016790A (100 nM). B) Representative immunofluorescence images (60X) of VE- cadherin staining in normal ECs (NEC), tumor-derived ECs (TEC), and TRPV4KOECs [n≥3].

To further confirm the role of TRPV4 in the regulation of vascular integrity, we employed a model of tumor angiogenesis. One of the distinctive features of the tumor vasculature are vessels that are leaky, permeable, and lack structural integrity. Thus far, our lab has previously shown that tumors grown in TRPV4KO mice exhibit increased vessel density and diameter with decreased pericyte coverage (Adapala et al., 2016).

Using the syngeneic tumor model in WT and TRPV4KO mice, we confirmed the previously reported significant increase in tumor volumes from TRPV4KO mice, and excised tumor tissue after 21 days. We first examined cell-cell junctions in the tumor vasculature and found that indeed TRPV4KO mice exhibit decreased VE-cadherin expression (Figure 10A). Next, we stained WT and TRPV4KO tumor tissue with a more specific pericyte marker, NG2, which showed decreased pericyte coverage in the absence of TRPV4 (Figure 10B). Finally, we measured vascular leakage in the tumor using

Dextran-Texas Red (MW 3000) delivered via tail vein injection, a widely used method to analyze microvascular leakage in tissue (Yuan & Rigor, 2010). We collected and fixed tumor tissue following ~30 minutes of dextran perfusion and stained tumor sections with

CD31. As expected, we found robust leakage of dextran into TRPV4KO tumor tissue, confirming that the absence of TRPV4 resulted in tumor vessels that were leakier than their WT counterparts (Figure 10C).

Since the absence of TRPV4 induces vessel destabilization and leakiness in tumors, to understand the pathological significance we next asked if these tumor vessels facilitate metastasis of tumor cells. Therefore, we collected and analyzed lung tissue at the endpoint of the tumor experiments. Visualization with the naked eye revealed a few secondary tumors that could be seen in TRPV4KO lungs (not shown). Histological

54 examination of the lung with H&E staining confirmed this observation (Figure 10D).

While a few small secondary lung tumors were observed in WT mice following tumor growth, there was six times the amount of secondary lung tumors in the TRPV4KO mice

(Figure 10E). Taken together, these findings establish a role for TRPV4 in maintaining vascular integrity and that absence of TRPV4 may lead to vessel disruption and abnormal angiogenesis that together promotes metastasis.

Figure 10. TRPV4 deletion destabilizes tumor vessel integrity, promoting vascular permeability and metastasis. A) Vessel integrity was assessed with immunofluorescence in tumor sections from WT and TRPV4KO mice. Vessels were visualized with CD31 (red) and cell junctions were stained with VE-cadherin (green) [n≥3]. B) Pericyte coverage was evaluated in WT and TRPV4KO tumors that were co- stained to visualize vessels (CD31; red) and pericytes (NG2; green) [n≥3]. C) Representative immunofluorescence images (20X) of Dextran-Texas Red perfused tumors stained with CD31 (green) to visualize vessel leakiness [n≥2]. D) Brightfield images of H&E stained lung tissue collected from tumor bearing WT and TRPV4KO mice to visualize metastases (secondary tumor growth) in the lung. E) Quantitative analysis of average number of lung metastasis from WT and TRPV4KO mice with LLC tumors [n≥4].

2. Determine the functional significance of TRPV4 in pathological retinal angiogenesis

TRPV4 is functionally expressed and mechanosensitive in the retinal endothelium

In recent years, TRPV4 expression has been identified to be present in the retina and has started to gain attention as a regulator of cell volume and calcium homeostasis

(Ryskamp et al., 2016). While few studies found TRPV4 to contribute to roles in retinal ganglion, neuron, and Müller cells (Jo et al., 2015; Ryskamp et al., 2014; Taylor et al.,

2016), little has been reported on TRPV4 in the retinal endothelium. Therefore, we investigated if TRPV4 is functionally expressed in retinal ECs. Human retinal microvascular ECs (HuRMECs) were used to measure TRPV4 expression and activity.

First, we used PCR to confirm TRPV4 gene expression in HuRMECs (Figure 11A). We then verified TRPV4 function by performing calcium experiments in Fluo-4/AM loaded

HuRMECs. We found that stimulation with TRPV4 agonist, GSK1016790A induced calcium influx, which was significantly attenuated when we initially blocked the channel with TRPV4 antagonist, GSK2193874 (Figure 11B, C, D).

Figure 11. TRPV4 is functionally expressed in retinal endothelial cells. A) PCR revealed TRPV4 gene expression in HuRMECs. HUVECs were used as a positive control [n≥2]. B) Representative calcium traces of HuRMECs, which exhibited substantial TRPV4-mediated calcium influx upon stimulation with GSK1016790A (GSK; 1 nM) that was attenuated in the presence of GSK2193874 (GSK2; 50 nM). Note: arrow denotes the time when the cells were stimulated with TRPV4 agonist, GSK. C) Quantitative analysis of relative changes (ΔF/F0) in calcium influx, in the presence or absence of TRPV4 inhibitor GSK2, revealed a significant (p≤0.05) decrease in calcium influx when TRPV4 was inhibited [n=100 cells]. D) Ratiometric images (20X) depict TRPV4-mediated calcium influx that was inhibited when GSK2 was present.

Next, to establish TRPV4-mediated mechanosensitivity in HuRMECs, we exposed these cells to cyclic strain in the presence and absence of pharmacological inhibitor, GSK2193874. HuRMECs were treated for 30 minutes prior to the application of cyclic strain for 18 hours, after which cells were fixed and immunostained with phalloidin conjugated to Alexa Fluor-488 to visualize realignment (Figure 12A). We found that cyclic strain induced robust reorientation of HuRMECs (~90%) perpendicular to the direction of strain. However, treatment with TRPV4 antagonist GSK2193874 significantly inhibited cyclic strain-induced reorientation of HuRMECs (Figure 12B).

Visualization of stress fiber reorientation and focal adhesion redistribution by phalloidin co-stained with vinculin revealed that un-strained cells exhibited uniform vinculin distribution along the stress fibers and exposure to cyclic strain induced strong co- localization of vinculin at the ends of newly formed stress fibers (Figure 12C). In contrast, inhibition of TRPV4 with GSK2193874 resulted in stress fibers that not only failed to reorient, but with vinculin localized in the cytoplasm and plasma membrane, with no specific localization to the stress fibers. Taken together, these findings reinforce the importance of TRPV4 as a mechanosensor in ECs, including HuRMECs.

Figure 12. TRPV4 is mechanosensitive in the retinal endothelium. A) HuRMECs were exposed to cyclic strain for 18 hours, fixed and stained. Immunofluorescence images (20X) of phalloidin stained HuRMECs showing cell reorientation in the presence or absence of TRPV4 antagonist, GSK2193874 (GSK2; 10 nM). B) Quantitative analysis of the percentage of cells that realigned perpendicular to the direction of strain. Note that GSK2 treated HuRMECs significantly (p≤0.05) reduced the reorientation response [n≥3]. C) Immunofluorescence images (60X) of HuRMECs exposed to cyclic strain and co- stained for phalloidin (green) and vinculin (red) showing focal adhesions (vinculin) recruitment at the ends of stress fibers in control cells (arrows), which were absent in GSK2 treated cells.

We next performed 2D angiogenesis assays to evaluate if TRPV4 modulates angiogenesis by retinal ECs. Previously, we found that when plated at high density,

TRPV4-deficient TECs or TRPV4KOECs formed tubes that collapsed after 8 hours, suggesting that these ECs exhibit aberrant mechanosensitivity when TRPV4 is reduced or absent. To determine if TRPV4 modulates tube formation by HuRMEC via its mechanosensitivity, we knocked-down TRPV4 using siRNAs (Figure 13A). TRPV4 specific siRNA treatment significantly downregulated TRPV4 expression in HuRMECs compared to control siRNA treated cells after 48 hours. When we plated these cells at high density on Matrigel, we found that control siRNA treated cells formed robust tubes which stayed intact for 24 hours. In contrast, TRPV4 knockdown HuRMECs formed intact tubes until 8 hours when we started to observed some of the networks beginning to retract, which collapsed by 24 hours (Figure 13B). These findings confirm that TRPV4 modulates retinal endothelial angiogenesis in vitro via mechanosensing and decreased functional expression of TRPV4 (due to siRNA) may impart aberrant mechanosensitivity, leading to abnormal tube formation by HuRMECs.

Figure 13. TRPV4 knockdown induces abnormal tube formation in HuRMECs. A) TRPV4 gene expression was measured with qPCR 24 and 48 hours after knockdown, showing a significant (p≤0.05) reduction in TRPV4 gene expression after 48 hours [n=1 for 24 HR; n≥3 for 48 HR]. B) 2D angiogenesis assays were performed using HuRMECs transfected with Control siRNA or TRPV4 siRNA 48 hours after transfection. Brightfield images (4X) of tube formation revealed tubular retraction after 8 hours and collapsing after 24 hours in TRPV4 siRNA HuRMECs [n≥3].

2a. TRPV4 in retinal vascular development

Our data thus far has indicated that TRPV4 is functionally expressed in the retinal endothelium. In conjunction with our findings in a model of tumor angiogenesis, we next asked if TRPV4 played a similar role in retinal angiogenesis. The retinal vasculature begins to develop around 16 week’s gestation in humans and is fully vascularized at full term, or approximately 40 weeks (Stahl et al., 2010). However, the mouse model of retinal angiogenesis differs from humans in that rodent pups are born with an immature, undeveloped retinal vasculature (Gyllensten & Hellstrom, 1954). As a result, postnatal vascularization of the retina, occurring in a tightly regulated fashion, is accessible and can be monitored throughout development. C57Bl/6 mice are the most commonly used mouse strain (Aguilar et al., 2008), with consistent observation of developmental retinal angiogenesis. Further, developmental malformations can be more easily detected in studies with transgenic mice and treatments with pharmacologic agents (M. I. Dorrell,

Aguilar, et al., 2007).

After pups are born, the blood vessels in the retina grow radially outward from the optic nerve, reaching the periphery around P8 (Stahl et al., 2010). To determine if the absence of TRPV4 affected developmental retinal angiogenesis, we isolated retinas from

WT and TRPV4KO at two time-points, P5 and P7, to assess if there were any baseline differences. Immunohistochemical staining of Isolectin (IB4) was used to visualize the blood vessels on P5 retinal wholemounts, which indicated no significant difference in the outward growth of the retinal vasculature (47% in WT vs 51% in TRPV4KO; Figure

14A, B). We also analyzed tip cell formation on the vascular front, and found a small, but not significant, increase in average tip cells per field in TRPV4KO retinas (10.0 in WT vs

1.5 in TRPV4KO; Figure 14C, D). H&E staining was also performed on paraffin embedded whole eye tissue to observe retinal morphological differences, but revealed no observable difference between WT and TRPV4KO (Figure 14E).

Figure 14. TRPV4KO P5 retinas exhibit no vascular differences. A) Isolectin stained retinal wholemounts (4X) from WT and TRPV4KO P5 retinas. B) Quantification of the percent vascular area in WT and TRPV4KO P5 retinas [n≥3]. (N.S. = Not Significant). C) Immunofluorescence images (60X) of tips cells along the vascular front in WT and TRPV4KO P5 retinas. D). Quantification of the average number of tip cells per field showing no significant (p≤0.05) difference in TRPV4KO P5 retinas compared to WT P5 retinas [n≥3]. E). H&E stained eye tissue (10X) representing retinal morphology at P5.

To ascertain whether the retina is similar at a later time-point, when the vasculature has almost reached the periphery, we examined the retina at P7. Initial IB4 staining on retinal wholemounts presented with no significant difference in the outward growth of the retinal vasculature (62% in WT vs 64% in TRPV4KO; Figure 15A, B).

Quantitative analysis of tip cell formation also revealed no significant difference between

WT and TRPV4KO (11.8 in WT vs 11.1 in TRPV4KO; Figure 15C, D). Finally, H&E staining confirmed that no apparent difference exists in WT and TRPV4KO retinal structure (Figure 15E). Overall, no notable differences occur between WT and

TRPV4KO developing retinas at P5 or P7. This establishment of baseline conditions in

WT and TRPV4KO is important prior to subjecting these animals to a pathological model.

Figure 15. P7 retinas are comparable between WT and TRPV4KO mice. A) Isolectin stained retinal wholemounts (4X) from WT and TRPV4KO P7 retinas. B) Quantification of the percent vascular area in WT and TRPV4KO P7 retinas [n≥4]. (N.S. = Not Significant). C) Immunofluorescence images (60X) of tips cells along the vascular front in WT and TRPV4KO P5 retinas. D). Quantification of the average number of tip cells per field showing no significant difference between WT and TRPV4KO [n≥4]. E). H&E stained eye tissue (20X) representing retina morphology at P7.

2b. Absence of TRPV4 leads to unproductive angiogenesis in oxygen-induced retinopathy

Retinopathy of prematurity (ROP) is the leading cause of blindness in infants

(Petersen et al., 1994) and compares to the established mouse model of oxygen-induced retinopathy (OIR). OIR has been used for over 20 years to investigate mechanisms involved in ROP as well as other pathological retinal angiogenesis diseases (Smith et al.,

1994). Briefly, inducing OIR involves exposure of mouse neonates to 75% oxygen from

P7 to P12 followed by a return to room air (~21% oxygen) from P12 to P17. These two time-points are characterized as 1) vaso-obliteration and 2) neovascularization. Vaso- obliteration results from exposure to high oxygen (hyperoxic) conditions, in which the existing retinal vessels will constrict in order to regulate PO2 levels (Wangsa-Wirawan &

Linsenmeier, 2003) and capillaries regress in the central retina. Neovascularization begins when neonates return to room air, which creates a low oxygen (hypoxic) environment, stimulating pro-angiogenic pathways. While this second phase of OIR involves the stimulation of angiogenic growth factors triggered via hypoxia to promote revascularization, this pathway can also induce pathologic neovascularization, or unproductive angiogenesis. Unproductive angiogenesis can result in the formation of neovascular tufts, which is the formation of vessels in the superficial layer of the retina that extend into the avascular vitreous cavity. Of note, P17 marks the point at which maximum severity of the proliferative phase of OIR is reached (Stahl et al., 2010).

The importance of TRPV4 in regulating angiogenesis and vascular integrity using

Matrigel plugs and tumor angiogenesis has been demonstrated in Aim 1. Further, our experiments with P5 and P7 retinas showed that TRPV4 does not play a significant role in developmental angiogenesis. Therefore, we investigated if TRPV4 modulates

68 pathological retinal angiogenesis, similar to tumor angiogenesis. To achieve this, we subjected WT and TRPV4KO mice to OIR. We first collected retinas and whole eye tissue at P12, the endpoint for vaso-obliteration observation. Initially, retinal wholemounts were immunostained for IB4 to visualize the obliterated area (Figure 16A).

Quantitative analysis revealed that there was a significant increase in the percentage of vaso-obliteration in the TRPV4KO retinas (33.8% in WT vs 43.3% in TRPV4KO;

Figure 16B). However, H&E staining of whole eye tissue showed that the retina morphology remained unchanged (Figure 16C). These findings demonstrate that while there was no difference in the developing at P7, TRPV4KO mice are more susceptible to vaso-obliteration.

Figure 16. TRPV4KO mice display increased vaso-obliteration. A) WT and TRPV4KO mice were subjected to oxygen-induced retinopathy. Following 5 days in high oxygen conditions, P12 retinas were isolated and stained for Isolectin to visualize retinal vasculature (4X). B) The percentage of vaso-obliteration was quantified and revealed TRPV4KO mice to exhibit a significant (p≤0.05) increase in obliteration [n≥6]. C) H&E stained eye tissue (20X) representing no observable changes in retinal morphology at P12 [n≥3].

Next, we observed neovascularization at P17, once mouse neonates had returned to room air for 5 days. Retinal wholemounts immunostained for IB4 revealed a considerable difference between WT and TRPV4KO retinas (Figure 17A). The quantified percentage of neovascularized area further confirmed this difference with

TRPV4KO retinas exhibiting a significant increase in vascularization (23.3% in WT vs

37.2% in TRPV4KO; Figure 17B). Next, we performed H&E staining on whole eye tissue to determine if this increase in TRPV4KO neovascularization resulted in the formation of neovascular tufts. Neovascular tufts occur when there is excessive regrowth of the vessels resulting in the abnormal sprouting into the vitreous of the eye.

Examination of P17 retinas revealed that indeed, TRPV4KO retinas exhibited an increase in neovascular tufts (Figure 17C). To further examine how this aberrant regrowth in

TRPV4KO retinas affects retinal vascular growth and remodeling, we used confocal microscopy to visualize the complex vascular networks in the superficial, intermediate, and deep retinal layers (Figure 18A). As expected, the erratic neovascularization is present in all three layers of the TRPV4KO retinas. These findings suggest that

TRPV4KO retinas subjected to OIR exhibit unproductive angiogenesis, which we use to define the excessive formation of neovascular tufts into the avascular vitreous cavity and disorganized vascular networks that contributes to increased neovascularization. Overall, these results are indicative of the phenotype we observe in the tumor angiogenesis model.

Next, we asked if vessel integrity is also compromised in this pathological retinal angiogenesis model which involves several key factors such as pericyte coverage and stable VE-cadherin at EC junctions. We have previously shown in Aim 1 that TRPV4 is required for pericyte coverage on the vessels and VE-cadherin expression at the EC cell-

71 cell contacts and that absence of TRPV4 reduces both. To determine if vessel integrity is compromised in TRPV4KO P17 retinas following OIR, we immunostained for pericyte marker, NG2 as well as VE-cadherin. As expected, absence of TRPV4 resulted in retinal vasculature with a considerable decrease in pericyte covered vessels (Figure 18B).

However, VE-cadherin staining in the intact retina did not work in our hands; therefore, we investigated VE-cadherin expression in cultured HuRMECs.

Figure 17. TRPV4KO mice exhibit unproductive angiogenesis following OIR. A) Representative retinal wholemounts stained for Isolectin isolated from WT and TRPV4KO at P17 following OIR (4X). B) Quantification of the percentage of neovascularization showed that absence of TRPV4 results in a significant (p≤0.05) increase in new vessel growth [n≥5]. C) H&E stained eye tissue (20X) representing neovascular tufts in TRPV4KO P17 retinas [n≥2].

Figure 18. TRPV4KO P17 OIR retinas exhibit poor vessel integrity. A) Representative immunofluorescence images (20X) of Isolectin stained retinas from WT and TRPV4KO at P17. Confocal microscopy was used to visualize the superficial, intermediate, and deep layers of the retina [n≥3]. B) Pericyte coverage was evaluated in WT and TRPV4KO retinas that were co-stained to visualize vessels (IB4; red) and pericytes (NG2; green). Arrows denote areas of unsupported vessels [n≥3].

2c. TRPV4 is necessary for VE-cadherin localization at cell-cell junctions in retinal endothelial cells

In order to determine if TRPV4 modulates vessel integrity via VE-cadherin localization at the cell-cell contacts and to understand the molecular mechanism, we knocked-down TRPV4 using specific siRNAs in HuRMECs and measured VE-cadherin expression at cell-cell contacts. As shown in Figure 13A, siRNA treatment significantly knocked-down TRPV4 expression, as evidenced by qPCR analysis. We then visualized

VE-cadherin expression at cell-cell contacts by immunostaining in control and TRPV4 siRNA knocked-down cells. We found that control siRNA-treated cells exhibited strong

VE-cadherin localization at the cell-cell contacts, which was drastically reduced in

TRPV4 knock-down cells (Figure 19A). Further, we found that TRPV4 antagonist,

GSK2193874, also considerably reduced VE-cadherin localization at cell-cell contacts

(Figure 19B). Overall, our results confirm that TRPV4 mediates retinal vascular stability through the modulation of VE-cadherin-dependent cell-cell contacts as well as pericyte coverage.

Figure 19. TRPV4 is required for VE-cadherin junctions in retinal endothelial cells. A) Representative immunofluorescence images (60X) of VE-cadherin staining in HuRMEC Control siRNA and TRPV4 siRNA 48 hours after transfection [n≥3]. B) Immunofluorescence images (60X) of VE-cadherin in HuRMECs treated for 24 hours with TRPV4 antagonist, GSK2193874 (GSK2; 10 nM) [n≥3].

CHAPTER IV

DISCUSSION

The data presented in this dissertation demonstrates that TRPV4 channels play an important role in the regulation of vascular growth and integrity. We conclude this based on three novel findings. First, we found that TRPV4 is required for ECM stiffness- dependent formation of uniform vascular networks in vivo. Second, absence of TRPV4 induced abnormal vascular growth displaying immature, leaky vessels that increased metastasis in a tumor angiogenesis model and resulted in unproductive neovascular growth in the retina in a model of oxygen-induced retinopathy. Third, TRPV4 deletion or deficiency promoted the reduction of VE-cadherin localization at endothelial cell-cell contacts and vasculature that was inadequately supported by pericytes. Taken together, our data indicate that TRPV4-dependent mechanotransduction regulates vascular growth and integrity.

Deregulation of angiogenesis and/or endothelial dysfunction participates in a host of cardiovascular diseases, such as atherosclerosis, hypertension, cancer, and retinopathy

(Ferrara et al., 2003; Ferrara et al., 2007; Hahn & Schwartz, 2009). Many existing therapies of pathological angiogenesis focus on the influences of soluble growth factors.

However, mechanical forces generated by hemodynamics play a crucial role in endothelial homeostasis and angiogenesis as these forces not only determine EC shape, but also modulate EC sensitivity to soluble factors (Ingber & Folkman, 1989; Ingber et al., 1995; Matthews et al., 2006; Parker et al., 2002). Sensed primarily through

77 mechanosensitive receptors, such as integrins, ion channels, and components of the cytoskeleton (Mammoto et al., 2008), micromechanical cues can stimulate vessel development and neovascularization (Mammoto et al., 2009; Moore et al., 2005) rendering mechanotransduction pathways an innovative avenue to explore for new angiogenic therapies.

Among these mechanosensors, TRPV4 has recently become a well-established mechanosensitive ion channel involved in the endothelium and angiogenesis. Further, the activation of TRPV4 by mechanical stimuli, such as shear stress, cyclic strain, and ECM stiffness, makes it an attractive target for investigation due to the presence of continuous mechanical forces acting along the endothelium (Baratchi et al., 2016; Hartmannsgruber et al., 2007; Kohler et al., 2006; Loot et al., 2008; Matthews et al., 2010; Mendoza et al.,

2010; Schierling et al., 2011; Thodeti et al., 2009; Thoppil et al., 2016). We recently demonstrated that TRPV4 is a negative regulator of angiogenesis, in that TRPV4KOECs exhibited significantly increased proliferation and migration as well as aberrant tube formation (Thoppil, Cappelli et al., 2016). These findings have established a role for

TRPV4 in the initial processes of angiogenesis; however the impact of TRPV4 on vessel stabilization remains elusive. In addition, we previously demonstrated that pharmacological activation of TRPV4 normalized tumor vasculature, improved cancer therapy, and reduced tumor growth in WT mice (Adapala et al., 2016). However, the participation of TRPV4 in other pathological angiogenesis models has yet to be shown.

TRPV4-dependent mechanotransduction mediates angiogenesis and vessel integrity in vivo

The regulation of angiogenesis by mechanotransduction mechanisms is starting to receive greater attention with the recognition of the role mechanical factors play in cell physiology and pathology, including EC proliferation, migration, and lumen formation.

In fact, many in vitro studies have revealed the importance of TRPV4-mediated endothelial mechanosensing in angiogenesis. In the present study, we confirmed, for the first time, that TRPV4 is undeniably mechanosensitive in vivo. We demonstrated that

TRPV4 is a required mechanosensor for angiogenesis, in that TRPV4KO mice lacking this mechanosensor exhibit vessel malformations characterized by increased vascular growth and vessel area in response to changes in ECM stiffness. Importantly, we have begun to delineate a role for TRPV4 in vessel maturation by revealing a connection between TRPV4 and VE-cadherin. We found that when TRPV4 expression is deficient or absent, VE-cadherin accumulation at cell-cell contacts is reduced which led to increased permeability and metastasis in a model of tumor angiogenesis (Figure 20).

Figure 20. Schematic showing TRPV4-mediated tumor vessel integrity. In Aim 1, we demonstrated that TRPV4 serves as a critical regulator of tumor vessel integrity. This schematic representation of our results revealed that WT tumors exhibit VE-cadherin stabilized cell-cell junctions (orange) among endothelial cells (white) and the majority of the vessels are supported by pericytes (green). As a result, there is minimal metastasis (red) to the lung (pink). In contrast, TRPV4KO tumors presented with weak VE-cadherin stabilized junctions and poor pericyte coverage, allowing for extravasation of tumor cells into the blood stream, and increased metastasis to the lungs.

The majority of studies investigating the influence of ECM stiffness on EC growth and angiogenesis have focused on two- and three-dimensional culture systems.

These reports have been valuable to characterize mechanisms by which mechanical cues, i.e. ECM, can influence EC behavior and angiogenesis. In fact, stiffer matrices can cause an increase in angiogenic sprouts that are able to deeply invade into a 3D collagen matrix

(Lee et al., 2013) and in an organ culture model of sprouting angiogenesis, high collagen density ECM produced neovessels with shorter vessel lengths exhibiting reduced branching and network interconnectivity (Edgar et al., 2014). Overall, stiffness can act as a powerful mechanical stimulus modulating pro-angiogenic effects through the regulation of growth factor protein expression, VEGF in particular (Sack et al., 2016; Santos et al.,

2015). While exact mechanosensitive receptors regulating this process are not well studied, TRPV4 is an appealing candidate and we have recently substantiated its role during angiogenesis, mainly in vitro.

To better understand and confirm TRPV4-mediated mechanosensing in angiogenesis to variations in ECM substrates in vivo, we examined Matrigel plugs of different stiffness grown in WT and TRPV4KO mice. We found that the intermediate substrate (800 Pa) is the optimum stiffness for vascular growth in WT mice. We base this conclusion on the formation and area of the newly formed vessels, which remained unchanged from intermediate to high stiffness. Although vascular growth reached its peak at the highest stiffness (900 Pa), this could be due to increased EC proliferation, as changes in ECM stiffness have been found to alter EC cell growth (Ghajar et al., 2008;

Sieminski et al., 2004; Sieminski et al., 2007; Yamamura et al., 2007). These findings correlate with previous work by Mammoto et al who also demonstrated that the

81 intermediate stiffness (800 Pa) Matrigel plug is optimal for in vivo angiogenesis. They further established a mechanosensitive signaling mechanism by which ECM stiffness governs VEGFR2 gene promoter activity and expression to stimulate angiogenesis

(Mammoto et al., 2009); however, the identity of the proximal mechanosensor(s) involved remains unknown. The findings in this study clearly demonstrate that mechanosensitive TRPV4 is required for physiological angiogenesis in that the absence of TRPV4 results in stiffness-dependent increases in both vascular growth and area of the endothelium. The enhanced vascular growth and malformed vascular network in

TRPV4KO Matrigel plugs substantiates the previously identified role of TRPV4 as a negative regulator of angiogenesis since the absence of TRPV4 promotes proliferation and abnormal angiogenesis. We can further propose that TRPV4 may be the mechanosensor involved in mediating the mechanosensitive VEGFR2 pathway in the regulation of angiogenesis, although further investigation is needed to elucidate the potential participation of TRPV4. Taken together, this is the first report, to our knowledge, that establishes the mechanosensitive angiogenic role of TRPV4 in vivo.

Several studies have also shown that stiffening ECM can contribute to angiogenesis by disrupting the EC monolayer as well as promoting permeability and EC sprouting (Huynh et al., 2011; Krishnan et al., 2011; Lee et al., 2013). Moreover, when angiogenesis is in the final steps, vascular integrity must be achieved to ensure the stabilization and maintenance of the newly formed vasculature, thus, any malfunction in this process can result in serious outcomes, including tissue ischemia, edema, and hemorrhage (Murakami & Simons, 2009). Since TRPV4KO Matrigel plugs exhibited enhanced vascular growth in conjunction with malformed vascular architecture, we

82 examined VE-cadherin vessel coverage. In connection with our findings, the absence of

TRPV4 resulted in a significant decrease in VE-cadherin/CD31 co-localization at low, intermediate, and high stiffness, while WT Matrigel plugs presented with intact vessels at every stiffness. These findings could explain the increased vascular growth in TRPV4KO

Matrigel plugs, not only because TRPV4KOECs display increased proliferation (Thoppil,

Cappelli et al., 2016), but also due to the fact that disrupted VE-cadherin can promote EC proliferation through VEGFR2 activation (Murakami & Simons, 2009). Overall, WT mice expressing TRPV4 are able to sense changes in substrate stiffness and ensure vessel stabilization throughout vascularization of the Matrigel plug. In contrast, TRPV4KO vessels exhibit weak VE-cadherin coverage, indicative of immature vessels, which suggests a role for TRPV4 in vascular integrity via VE-cadherin junctions.

VE-cadherin adherens junctions are a critical component for vascular permeability and integrity, localizing at cell-cell contacts and mediating endothelial quiescence via contact inhibition (Murakami & Simons, 2009). Based on our in vivo results, we further investigated the role of TRPV4 in vascular integrity by examining VE- cadherin localization to cell-cell contacts in vitro. We revealed that decreased or absent functional expression of TRPV4, in TECs and TRPV4KOECs respectively, inhibited VE- cadherin at cell-cell contacts. Internalization of VE-cadherin has been previously shown to influence EC behavior, including migration and permeability (Gavard & Gutkind,

2006; Li et al., 2012; Troyanovsky et al., 2006). As a result, decreased membrane localization in cells where TRPV4 is deregulated suggests that these ECs lack viable connections with neighboring cells and their immediate environment, which may contribute to abnormal mechanosensing and angiogenesis. Taken together, our results

83 strongly support our hypothesis that TRPV4 is required for VE-cadherin-mediated cell- cell contacts and overall EC stability.

The association between TRPV4 and cell junctions is a relatively new but expanding field of study. As an established mechanosensor in the epidermis, TRPV4 activation in human epidermal keratinocytes was found to strengthen tight-junction barrier function (Akazawa et al., 2013). Martinez-Rendon et al confirmed these findings in the corneal epithelium, reporting that TRPV4 activity regulates barrier function through tight junction formation (Martinez-Rendon et al., 2016). TRPV4 also cooperates with gap junctions, acting with connexins in the endothelium to preserve vasodilation during hypoxia (Rath et al., 2012). More importantly, only a few studies have revealed a relationship between TRPV4 and adherens junctions. In the bladder urothelium where

TRPV4 can be activated via bladder stretch, TRPV4 is connected to adherens junctions in the urothelial cell membrane via -catenin, an adherens junction component which connects E-cadherin to actin-microfilaments (Janssen et al., 2011). In a follow up study,

Janssen et al found disrupted adherens junctions and poor epithelial integrity in TRPV4 null mice bladder, ureter, and kidneys (Janssen et al., 2016). TRPV4 was also found to interact with -catenin, another component of adherens junctions that links cell-cell junctions to the actin cytoskeleton to maintain a tight barrier, in skin keratinocytes.

Investigation of TRPV4-deficient skin keratinocytes revealed compromised barrier function and cell-cell junctions which increased intercellular permeability (Sokabe et al.,

2010). Collectively, it is clear that TRPV4 plays a role in the modulation of cell-cell junctions, most likely acting through catenins to fine-tune the dynamics of the

84 cytoskeleton. However, our findings are the first to show a relationship between TRPV4 and VE-cadherin junctions in the endothelium.

Solid tumor tissue is known to be stiffer than healthy tissue which has recently been found to directly affect the tumor vasculature (Bordeleau et al., 2016; Levental et al., 2009; Tredan et al., 2007). The disruption of VE-cadherin at cell junctions can contribute to the abnormal vascular phenotype observed in solid tumors and has been identified as a major player in the stability of the tumor vasculature (Corada et al., 1999).

Moreover, downstream signaling of VE-cadherin has also been shown to mediate interactions between ECs and pericytes (Dejana & Giampietro, 2012) and tumor vessels often exhibit discontinuous coverage of pericytes (Hashizume et al., 2000). As a result, several studies have begun to target VE-cadherin for anti-angiogenesis therapies (Corada et al., 2002; Liao et al., 2000); however, hemorrhage and tumor growth can become exaggerated when VE-cadherin is downregulated (Zanetta et al., 2005). This result is mostly likely due to increased vascular permeability which can also provide a path for tumor cells to infiltrate normal, healthy tissue and promote metastasis and secondary tumor growth (Goel et al., 2011; Le Guelte et al., 2011). To date, only a few studies have identified targets that direct the maturation process to establish functional vessels, including apoptosis inhibitor Birc2 (Santoro et al., 2007), miR-126 (Fish et al., 2008), small GTPase R-Ras (Sawada et al., 2012), and the endothelial adrenomedullin-RAMP2 system (Tanaka et al., 2016). However, none of these targets directly involve mechanotransduction mechanisms, which is particularly important in the stiff tumor tissue. Here, we demonstrate the involvement of mechanosensor TRPV4 in the integrity of the tumor vasculature. More specifically, we demonstrated that the absence of TRPV4

85 resulted in reduced VE-cadherin stabilized junctions, poor pericyte coverage, and enhanced vascular permeability, the combination of which promoted the growth of secondary tumors, or metastasis, to the lung.

Many of the existing anti-angiogenesis therapies focusing on VEGF encounter modest clinical benefits due inactivation over time. This is predominantly due to acquired resistance, wherein tumors develop VEGF-independent growth factor pathways to promote tumor growth (Jain, 1989), or intrinsic resistance, where tumors are able to circumvent drug penetration, for example, due to high interstitial pressure (Kerbel, 2000).

Vascular normalization approaches recognize that vessel maturation and the prevention of vessel regression is an equally necessary objective for tumor vasculature, although there is still a need to identify specific targets (Simons, 2005). In this study, we show that mechanosensitive ion channel TRPV4 plays a role in vascular integrity and functionality in both physiological and pathological angiogenesis and most importantly, confirmed the mechanosensitive nature of TRPV4 in vivo for the first time. Additionally, malformations of newly formed vessels in Matrigel plugs challenged with varying stiffness were found in TRPV4KO mice. Decreased VE-cadherin coverage in TRPV4KO mice as well as in

TRPV4-deficient TECs and TRPV4KOECs support the role of TRPV4 in mediating vessel integrity via VE-cadherin localization. A similar effect was seen in pathological angiogenesis, as tumors grown in TRPV4KO mice exhibited tumor vasculature with reduced VE-cadherin and NG2 covered vessels. Vascular permeability and increased lung tumor metastasis further support TRPV4 as a regulator of barrier function, vessel maturation, and overall vessel integrity. These findings suggest the significance of

TRPV4 as a novel mechanosensitive target for a broad range of clinical vascular challenges, from cancer to therapeutic angiogenesis.

The functional significance of TRPV4 in pathological retinal angiogenesis

Proliferative neovascularization contributes to a host of vascular eye diseases, including retinopathy of prematurity (ROP) (J. Chen & Smith, 2007; Friedman et al.,

2004; Kempen et al., 2004). However, adverse effects and/or limitations of laser coagulation and VEGF-neutralizing antibodies still exist (Al-Latayfeh et al., 2012; Avery et al., 2006; Shahar et al., 2006), creating the need to elucidate the underlying mechanism(s) as well as novel targets involved in pathological ocular neovascularization.

Moreover, vessel stabilization plays a key role in this process and provides a realistic approach that can be explored. TRPV4, a mechanosensitive ion channel, has previously been reported to negatively regulate angiogenesis both physiologically and pathologically

(Adapala et al., 2016; Thoppil et al., 2016) and our results from Aim 1 propose a role for

TRPV4 in the regulation of vascular integrity via VE-cadherin stability. In order to determine if TRPV4 mediates pathological neovessel proliferation in the retina, we confirmed that TRPV4 is expressed, functional, and mechanosensitive in retinal ECs. We further assessed retinal vasculature and morphology at the basal level in the developing retina of WT and TRPV4KO mice before employing the mouse model of oxygen-induced retinopathy (OIR). Altogether, our results suggest that TRPV4 is functional expressed in the retinal vasculature and represents a novel target for pathological retinal angiogenesis that is required for vessel integrity.

The investigation of TRPV4 in the eye tissue is a fairly recent field and expression in the retina, in particular, was only revealed six years ago (Gilliam &

Wensel, 2011). Shortly after, Ryskamp et al reported TRPV4 to be functionally expressed in retinal ganglion cells, mediating calcium influx to membrane stretch as well as calcium-dependent pro-apoptotic pathways (Ryskamp et al., 2011). Subsequent studies observed known activators of TRPV4, cell swelling and AA metabolites, to stimulate

TRPV4 activity in retinal neurons and glia (Ryskamp et al., 2014) while another finding identified a synergistic connection between TRPV4 and aquaporin 4 (AQP4) in the regulation of calcium homeostasis, osmosensing, and water transport in retinal glia (Jo et al., 2015). Moreover, the role of endothelial TRPV4 in the eye has mainly been limited to the corneal endothelium. TRPV4 was found to be functionally expressed in human corneal ECs, responding to pharmacological activators as well as moderate heat and hypotonicity (Mergler et al., 2011). In this aim, we found that TRPV4 is functionally expressed in human microvascular retinal ECs (HuRMECs), consistent with a previous study in bovine retinal ECs (Monaghan et al., 2015). More importantly, we verified that

TRPV4 is mechanosensitive in the retinal endothelium, which had not been previously reported. A recent study showed TRPV4 to be a critical mechanosensor in the trabecular meshwork (TM) of the eye, mediating cytoskeletal remodeling to regulate TM stiffness and outflow in a TRPV4-dependent manner (Ryskamp et al., 2016). Other studies specifically investigating retinal ECs evaluated the effects of pulsatile flow as well as shear stress, but did not identify mechanosensitive specific mechanisms that mediated the response (Lakshminarayanan et al., 2000; Walshe et al., 2011). Our study further confirms that mechanosensitive TRPV4 plays an important in the eye tissue; however, our findings are the first to show that TRPV4 mediates the response of the retinal endothelium to mechanical forces.

TRPV4 has been shown to contribute to angiogenesis in a variety of vascular beds, but the role of TRPV4 in the retinal vasculature has yet to be thoroughly studied.

Here, we show that siRNA knockdown of TRPV4 in HuRMECs resulted in abnormal tube formation in vitro. However, assessment of the developing retina in vivo, isolated from WT and TRPV4KO mice collected at P5 and P7, revealed no differences in vascular area and retinal morphology. Therefore, although TRPV4 does not appear to influence angiogenesis in retinal development in vivo, our in vitro data still indicates a potential role for TRPV4 in retinal angiogenesis. Thus, these findings suggest that compensatory mechanisms may be at play in the global knockout mouse model and the importance of vascular TRPV4 will be revealed in a pathological retinal model.

Emerging evidence has demonstrated TRPV4 to participate in ocular pathologies, such as glaucoma as well as hyperglycemia and diabetes. Since glaucoma is linked to increased intraocular pressure which can lead to vision loss, many implications of

TRPV4 as a therapeutic target are a result of the ability to sense changes in pressure. In fact, TRPV4-mediated mechanotransduction in the primary cilia of the trabecular meshwork of the eye was found to sense and respond to intraocular pressure (Luo et al.,

2014). Moreover, retinal ganglion cells often degenerate or die in many blinding diseases, and mechanosensitive TRPV4 was suggested to mediate calcium-dependent dendritic and axonal remodeling during glaucoma (Krizaj et al., 2014). In pigmented and nonpigmented epithelial cell types in the mouse ciliary body, TRPV4 was also found to regulate the response to cell swelling by mediating calcium and cell volume (Jo et al.,

2016), confirming the capability of TRPV4 to sense pressure in the eye and as a target for anti-glaucoma treatments. Regarding another pathology, one group showed that TRPV4

89 expression and function in retinal microvascular ECs is downregulated following 72 hours in hyperglycemic conditions. They also assessed TRPV4 expression in the retinal vasculature of stretptozotocin-induced diabetic rats, confirming that TRPV4 expression was reduced (Monaghan et al., 2015). Although these studies did not employ TRPV4 null mice, they support a role for TRPV4 as a therapeutic target in ocular pathologies. In fact, our findings demonstrated that the absence of TRPV4 exacerbates retinal angiogenesis in a mouse model of proliferative retinopathy, further supporting a role for TRPV4 in pathological remodeling of retinal vasculature. During the first phase of oxygen-induced retinopathy, the developing retinal vasculature from P7 to P12 must adapt to a new hyperoxic environment by trimming the vascular tree in order to balance the new metabolic supply and demand. However, our results indicated that TRPV4KO retinas displayed increased sensitivity to oxygen-induced vessel damage due to a significant increase in vaso-obliteration in TRPV4KO P12 retinas, suggesting increased dependence of growth factors sensitive to oxygen or decreased tolerance towards oxidative tissue damage. In rats, hyperoxia leads to considerable apoptosis in retinal cells, which was attributed to downregulation of VEGF, suggesting that the susceptibility to increased oxygen may also be contingent on the maturation of the vasculature (Alon et al., 1995).

We found TRPV4KO P17 retinas also exhibited a significant increase in neovascularization. Visual assessment revealed that the majority of the neovascularization remains close to the periphery, signifying persistence of central vaso- obliteration. Previous studies have suggested that excessive VEGF production can result in aberrant vaso-proliferation (Alon et al., 1995), another indication that there might be a correlation between TRPV4 and VEGF signaling. Moreover, increased proliferation can

90 lead to excessive neovessel regrowth in the form of neovascular tufts. This effect was seen in TRPV4KO retinas through visualization of neovascular tufts extending from the retina into the vitreous.

Confocal microscopy allowed for the assessment of the superficial, intermediate, and deep layers the neovascularized retina. We found TRPV4KO retinal vasculature at

P17 resulted in what we deem unproductive angiogenesis, exhibiting abnormal vascular growth throughout all three layers. Vessel integrity was assessed by visualizing pericyte coverage, which can be particularly indicative of vascular stability in the retina due to the fact that it has the most extensive pericyte-covered vessels (Murakami & Simons, 2009).

Consistent with our observations and with our findings in tumor angiogenesis in Aim 1,

TRPV4KO P17 retinas exhibited a decrease in pericyte covered vessels. Further, since

VE-cadherin immunostaining was not able to be performed in vivo, we performed immunocytochemistry using retinal ECs to visualize VE-cadherin localization with siRNA knockdown or pharmacological inhibition of TRPV4. As hypothesized, knockdown and/or inhibition revealed compromised VE-cadherin localization at the cell- cell contacts.

In this study, we confirmed that TRPV4 is not only functionally expressed in the retinal endothelium, but is also mechanosensitive, which has not been verified before.

Additionally, the loss of TRPV4 does not affect developmental vascularization of the retina. However, employing a model of OIR revealed that TRPV4KO mice are more susceptible to oxidative insult at P12, which led to unproductive angiogenesis at P17. The formation of neovascular tufts and abnormal vascular remodeling throughout the retinal layers supported this conclusion. Assessment of vascular integrity demonstrated that

91 absence of TRPV4 resulted in poor pericyte coverage in the P17 OIR retina in vivo and decreased VE-cadherin localization at cell-cell contacts in vitro. Taken together, not only do these findings indicate that TRPV4 facilitates vascular recovery and vessel maturation in OIR, we also demonstrated for the first time, that TRPV4 is a regulator of retinal angiogenesis, mediating vessel integrity.

Conclusions

Described in this dissertation was the examination of the hypothesis that TRPV4 is required for endothelial homeostasis as well as for vessel integrity in response to altered microenvironments. The aims were 1) to determine if TRPV4-dependent mechanotransduction mediates angiogenesis and vessel integrity in vivo and 2) to determine the functional significance of TRPV4 in pathological retinal angiogenesis.

Overall, we have identified TRPV4 as a mechanosensor that regulates vascular integrity, directly or indirectly mediating VE-cadherin stability in both physiological and pathological contexts. Models of cancer and proliferative retinopathy exhibiting high angiogenic stimulation revealed that deregulation of TRPV4 signaling contributed to unproductive angiogenesis with compromised vessel integrity. While our results provided a novel target for the exploration of therapeutic strategies for the abovementioned diseases, the underlying mechanism has yet to be fully explored. Our results suggest that

TRPV4 is able to mediate the localization of VE-cadherin at the cell-cell contacts and to a lesser degree, pericyte coverage, to promote vessel maturation. Due to several signaling molecules/pathways that are involved in this process, multiple avenues can be explored.

First, previous studies have reported that VEGFR2 expression is regulated by a mechanosensitive pathway via p190RhoGAP (Mammoto et al., 2009) and our recently

92 published findings discovered TRPV4 to be an upstream regulator of Rho (Thoppil,

Cappelli et al., 2016). Because Rho activity is regulated by p190RhoGAP, it can be suggested that deregulation of TRPV4 resulting in abnormal high Rho activity, could be mediated through decreased p190RhoGAP resulting in increased VEGFR2 expression to promote aberrant angiogenesis. Moreover, VEGFR2 has been shown to form a mechanosensory complex with VE-cadherin to mediate EC junctions to influence vascular permeability. Secondly, the Rho/Rho kinase pathway is also involved in the regulation of EC structure and function, including proliferation, migration, survival, and permeability. Therefore, another inference could be that TRPV4 acts through the Rho pathway to mediate VE-cadherin at the cell-cell contacts. Third, another avenue to investigate is hypoxia, given that both the tumor microenvironment and ROP take place during times when oxygen levels are altered. HIF-1 is already a known mediator of

VEGF expression in ECs, however, TRPV4 may also connect with this pathway given our results in the TRPV4KO P12 OIR retina. Lastly, some evidence has revealed an association between TRPV4 and apoptosis, thus exploration of the apoptotic pathway could reveal a new role for TRPV4. Taken together, TRPV4 presents as a novel target for pathological angiogenesis, in both the tumor and the retina, and as a result, TRPV4- mediated mechanotransduction pathways show potential for anti- and/or pro-therapies, where soluble factors deem ineffective.

Future directions

Additional experiments are required to fully elucidate the mechanism by which

TRPV4 mediates VE-cadherin cell junctions. It is important to know whether or not a direct or indirect connection exists between these two molecules, mainly because several 93 different pathways could be involved. Moreover, because VE-cadherin works in a mechanosensory complex with VEGFR2, it would also beneficial to determine if a direct connection exists between TRPV4 and VEGFR2 (Figure 20).

Figure 21. Proposed mechanism by which TRPV4 mediates VE-cadherin junctions through expression of VEGFR2. TRPV4 expressing normal endothelial cells allow for an appropriate influx of calcium upon TRPV4 stimulation. Normal TRPV4 activity thus inhibits VEGFR2 gene expression and maintains VE-cadherin junctions in the quiescent, non-activated endothelium. In endothelial cells where TRPV4 is deregulated, such as in TECs or TRPV4KOECs, VEGFR2 gene expression is increased, promoting VEGFR2 receptor dimerization in response to VEGF and internalization of VE-cadherin.

In addition, further investigation into the role that TRPV4 plays in the retinal endothelium would be of great value. More specifically, assessment of TRPV4 expression in the WT retina throughout development as well as P12 and P17 in the OIR model would give greater indication of whether or not TRPV4 is important during these time-points. Exploration of additional parameters in WT and TRPV4KO mice following

OIR, such as permeability and hypoxia probe in OIR retinas would also be contributory.

Lastly, repeating these OIR experiments in WT mice treated with TRPV4 activator,

GSK1016709A, and/or a TRPV4 endothelial-specific knockout would unequivocally confirm the role of TRPV4 in pathological retinal angiogenesis.

REFERENCES

Adair, T. H., & Montani, J.-P. (2010). Overview of angiogenesis.

Adams, J. C., & Watt, F. M. (1993). Regulation of development and differentiation by the

extracellular matrix. Development, 117(4), 1183-1198.

Adapala, R. K., Talasila, P. K., Bratz, I. N., Zhang, D. X., Suzuki, M., Meszaros, J. G., &

Thodeti, C. K. (2011). PKCalpha mediates acetylcholine-induced activation of

TRPV4-dependent calcium influx in endothelial cells. Am J Physiol Heart Circ

Physiol, 301(3), H757-765. doi:10.1152/ajpheart.00142.2011

Adapala, R. K., Thoppil, R. J., Ghosh, K., Cappelli, H. C., Dudley, A. C., Paruchuri, S.,

Keshamouni, V., Klagsbrun, M., Meszaros, J. G., Chilian, W. M., Ingber, D. E.,

& Thodeti, C. K. (2016). Activation of mechanosensitive ion channel TRPV4

normalizes tumor vasculature and improves cancer therapy. Oncogene, 35(3),

314-322. doi:10.1038/onc.2015.83

Adapala, R. K., Thoppil, R. J., Luther, D. J., Paruchuri, S., Meszaros, J. G., Chilian, W.

M., & Thodeti, C. K. (2013). TRPV4 channels mediate cardiac fibroblast

differentiation by integrating mechanical and soluble signals. J Mol Cell Cardiol,

54, 45-52. doi:10.1016/j.yjmcc.2012.10.016

Aguilar, E., Dorrell, M. I., Friedlander, D., Jacobson, R. A., Johnson, A., Marchetti, V.,

Moreno, S. K., Ritter, M. R., & Friedlander, M. (2008). Chapter 6. Ocular models

of angiogenesis. Methods Enzymol, 444, 115-158. doi:10.1016/S0076-

6879(08)02806-1

Akazawa, Y., Yuki, T., Yoshida, H., Sugiyama, Y., & Inoue, S. (2013). Activation of

TRPV4 strengthens the tight-junction barrier in human epidermal keratinocytes.

Skin Pharmacol Physiol, 26(1), 15-21. doi:10.1159/000343173

Al-Latayfeh, M., Silva, P. S., Sun, J. K., & Aiello, L. P. (2012). Antiangiogenic therapy

for ischemic retinopathies. Cold Spring Harb Perspect Med, 2(6), a006411.

doi:10.1101/cshperspect.a006411

Alon, T., Hemo, I., Itin, A., Pe'er, J., Stone, J., & Keshet, E. (1995). Vascular endothelial

growth factor acts as a survival factor for newly formed retinal vessels and has

implications for retinopathy of prematurity. Nat Med, 1(10), 1024-1028.

Alvarez, D. F., King, J. A., Weber, D., Addison, E., Liedtke, W., & Townsley, M. I.

(2006). Transient receptor potential vanilloid 4-mediated disruption of the

alveolar septal barrier: a novel mechanism of acute lung injury. Circ Res, 99(9),

988-995. doi:10.1161/01.RES.0000247065.11756.19

Amato, V., Vina, E., Calavia, M. G., Guerrera, M. C., Laura, R., Navarro, M., De Carlos,

F., Cobo, J., Germana, A., & Vega, J. A. (2012). TRPV4 in the sensory organs of

adult zebrafish. Microsc Res Tech, 75(1), 89-96. doi:10.1002/jemt.21029

Ando, J., & Yamamoto, K. (2009). Vascular mechanobiology: endothelial cell responses

to fluid shear stress. Circ J, 73(11), 1983-1992.

Andrade, Y. N., Fernandes, J., Lorenzo, I. M., Arniges, M., & Valverde, M. A. (2007).

The TRPV4 Channel in Ciliated Epithelia. In W. B. Liedtke & S. Heller (Eds.),

TRP Ion Channel Function in Sensory Transduction and Cellular Signaling

Cascades. Boca Raton (FL).

Arniges, M., Vazquez, E., Fernandez-Fernandez, J. M., & Valverde, M. A. (2004).

Swelling-activated Ca2+ entry via TRPV4 channel is defective in cystic fibrosis

airway epithelia. J Biol Chem, 279(52), 54062-54068.

doi:10.1074/jbc.M409708200

Ashton, N., Ward, B., & Serpell, G. (1953). Role of oxygen in the genesis of retrolental

fibroplasia; a preliminary report. Br J Ophthalmol, 37(9), 513-520.

Ausprunk, D. H., & Folkman, J. (1977). Migration and proliferation of endothelial cells

in preformed and newly formed blood vessels during tumor angiogenesis.

Microvasc Res, 14(1), 53-65.

Avery, R. L., Pearlman, J., Pieramici, D. J., Rabena, M. D., Castellarin, A. A., Nasir, M.

A., Giust, M. J., Wendel, R., & Patel, A. (2006). Intravitreal bevacizumab

(Avastin) in the treatment of proliferative diabetic retinopathy. Ophthalmology,

113(10), 1695 e1691-1615. doi:10.1016/j.ophtha.2006.05.064

Baker, M., Robinson, S. D., Lechertier, T., Barber, P. R., Tavora, B., D'Amico, G., Jones,

D. T., Vojnovic, B., & Hodivala-Dilke, K. (2011). Use of the mouse aortic ring

assay to study angiogenesis. Nat Protoc, 7(1), 89-104.

doi:10.1038/nprot.2011.435

Baluk, P., Hashizume, H., & McDonald, D. M. (2005). Cellular abnormalities of blood

vessels as targets in cancer. Curr Opin Genet Dev, 15(1), 102-111.

doi:10.1016/j.gde.2004.12.005

Baratchi, S., Almazi, J. G., Darby, W., Tovar-Lopez, F. J., Mitchell, A., & McIntyre, P.

(2016). Shear stress mediates exocytosis of functional TRPV4 channels in

endothelial cells. Cell Mol Life Sci, 73(3), 649-666. doi:10.1007/s00018-015-

2018-8

Berrout, J., Mamenko, M., Zaika, O. L., Chen, L., Zang, W., Pochynyuk, O., & O'Neil,

R. G. (2014). Emerging role of the calcium-activated, small conductance, SK3 K+

channel in distal tubule function: regulation by TRPV4. PLoS One, 9(4), e95149.

doi:10.1371/journal.pone.0095149

Birder, L., Kullmann, F. A., Lee, H., Barrick, S., de Groat, W., Kanai, A., & Caterina, M.

(2007). Activation of urothelial transient receptor potential vanilloid 4 by 4alpha-

phorbol 12,13-didecanoate contributes to altered bladder reflexes in the rat. J

Pharmacol Exp Ther, 323(1), 227-235. doi:10.1124/jpet.107.125435

Biswas, P., Canosa, S., Schoenfeld, D., Schoenfeld, J., Li, P., Cheas, L. C., Zhang, J.,

Cordova, A., Sumpio, B., & Madri, J. A. (2006). PECAM-1 affects GSK-3beta-

mediated beta-catenin phosphorylation and degradation. Am J Pathol, 169(1),

314-324.

Bordeleau, F., Mason, B. N., Lollis, E. M., Mazzola, M., Zanotelli, M. R., Somasegar, S.,

Califano, J. P., Montague, C., LaValley, D. J., Huynh, J., Mencia-Trinchant, N.,

Negron Abril, Y. L., Hassane, D. C., Bonassar, L. J., Butcher, J. T., Weiss, R. S.,

& Reinhart-King, C. A. (2016). Matrix stiffening promotes a tumor vasculature

phenotype. Proc Natl Acad Sci U S A. doi:10.1073/pnas.1613855114

Boucher, Y., Baxter, L. T., & Jain, R. K. (1990). Interstitial pressure gradients in tissue-

isolated and subcutaneous tumors: implications for therapy. Cancer Res, 50(15),

4478-4484.

100

Brauchi, S., Orta, G., Salazar, M., Rosenmann, E., & Latorre, R. (2006). A hot-sensing

cold receptor: C-terminal domain determines thermosensation in transient

receptor potential channels. J Neurosci, 26(18), 4835-4840.

doi:10.1523/JNEUROSCI.5080-05.2006

Burri, P. H., Hlushchuk, R., & Djonov, V. (2004). Intussusceptive angiogenesis: its

emergence, its characteristics, and its significance. Dev Dyn, 231(3), 474-488.

doi:10.1002/dvdy.20184

Burri, P. H., & Tarek, M. R. (1990). A novel mechanism of capillary growth in the rat

pulmonary microcirculation. Anat Rec, 228(1), 35-45. doi:10.1002/ar.1092280107

Caduff, J. H., Fischer, L. C., & Burri, P. H. (1986). Scanning electron microscope study

of the developing microvasculature in the postnatal rat lung. Anat Rec, 216(2),

154-164. doi:10.1002/ar.1092160207

Campbell, K. (1951). Intensive oxygen therapy as a possible cause of retrolental

fibroplasia; a clinical approach. Med J Aust, 2(2), 48-50.

Cao, G., O'Brien, C. D., Zhou, Z., Sanders, S. M., Greenbaum, J. N., Makrigiannakis, A.,

& DeLisser, H. M. (2002). Involvement of human PECAM-1 in angiogenesis and

in vitro endothelial cell migration. Am J Physiol Cell Physiol, 282(5), C1181-

1190. doi:10.1152/ajpcell.00524.2001

Cappelli, H. C., Thoppil, R. J., Adapala, R. K., Meszaros, J. G., Paruchuri, S., & Thodeti,

C. K. (2016). Role of Mechanosensitive TRP Channels in Abnormal Vasculature

of Tumors Vascular Ion Channels in Physiology and Disease (pp. 255-273):

Springer.

101

Carmeliet, P. (2000). Mechanisms of angiogenesis and arteriogenesis. Nat Med, 6(4),

389-395. doi:10.1038/74651

Carmeliet, P., & Jain, R. K. (2011). Molecular mechanisms and clinical applications of

angiogenesis. Nature, 473(7347), 298-307. doi:10.1038/nature10144

Cary, L. A., Han, D. C., & Guan, J. L. (1999). Integrin-mediated signal transduction

pathways. Histol Histopathol, 14(3), 1001-1009.

Chen, G., Suzuki, H., & Weston, A. H. (1988). Acetylcholine releases endothelium-

derived hyperpolarizing factor and EDRF from rat blood vessels. Br J Pharmacol,

95(4), 1165-1174.

Chen, J., & Smith, L. E. (2007). Retinopathy of prematurity. Angiogenesis, 10(2), 133-

140. doi:10.1007/s10456-007-9066-0

Chicurel, M. E., Chen, C. S., & Ingber, D. E. (1998). Cellular control lies in the balance

of forces. Curr Opin Cell Biol, 10(2), 232-239.

Chien, S. (2007). Mechanotransduction and endothelial cell homeostasis: the wisdom of

the cell. Am J Physiol Heart Circ Physiol, 292(3), H1209-1224.

doi:10.1152/ajpheart.01047.2006

Chung, A. S., & Ferrara, N. (2011). Developmental and pathological angiogenesis. Annu

Rev Cell Dev Biol, 27, 563-584. doi:10.1146/annurev-cellbio-092910-154002

Collins, C., Guilluy, C., Welch, C., O'Brien, E. T., Hahn, K., Superfine, R., Burridge, K.,

& Tzima, E. (2012). Localized tensional forces on PECAM-1 elicit a global

mechanotransduction response via the integrin-RhoA pathway. Curr Biol, 22(22),

2087-2094. doi:10.1016/j.cub.2012.08.051

102

Connolly, D. T., Heuvelman, D. M., Nelson, R., Olander, J. V., Eppley, B. L., Delfino, J.

J., Siegel, N. R., Leimgruber, R. M., & Feder, J. (1989). Tumor vascular

permeability factor stimulates endothelial cell growth and angiogenesis. J Clin

Invest, 84(5), 1470-1478. doi:10.1172/JCI114322

Connor, K. M., Krah, N. M., Dennison, R. J., Aderman, C. M., Chen, J., Guerin, K. I.,

Sapieha, P., Stahl, A., Willett, K. L., & Smith, L. E. (2009). Quantification of

oxygen-induced retinopathy in the mouse: a model of vessel loss, vessel regrowth

and pathological angiogenesis. Nat Protoc, 4(11), 1565-1573.

doi:10.1038/nprot.2009.187

Conway, E. M., Collen, D., & Carmeliet, P. (2001). Molecular mechanisms of blood

vessel growth. Cardiovasc Res, 49(3), 507-521.

Corada, M., Mariotti, M., Thurston, G., Smith, K., Kunkel, R., Brockhaus, M.,

Lampugnani, M. G., Martin-Padura, I., Stoppacciaro, A., Ruco, L., McDonald, D.

M., Ward, P. A., & Dejana, E. (1999). Vascular endothelial-cadherin is an

important determinant of microvascular integrity in vivo. Proc Natl Acad Sci U S

A, 96(17), 9815-9820.

Corada, M., Zanetta, L., Orsenigo, F., Breviario, F., Lampugnani, M. G., Bernasconi, S.,

Liao, F., Hicklin, D. J., Bohlen, P., & Dejana, E. (2002). A monoclonal antibody

to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects

on endothelial permeability. Blood, 100(3), 905-911.

Cuajungco, M. P., Grimm, C., Oshima, K., D'Hoedt, D., Nilius, B., Mensenkamp, A. R.,

Bindels, R. J., Plomann, M., & Heller, S. (2006). PACSINs bind to the TRPV4

103

cation channel. PACSIN 3 modulates the subcellular localization of TRPV4. J

Biol Chem, 281(27), 18753-18762. doi:10.1074/jbc.M602452200

D'Amore, P. A., & Smith, S. R. (1993). Growth factor effects on cells of the vascular

wall: a survey. Growth Factors, 8(1), 61-75.

D'Hoedt, D., Owsianik, G., Prenen, J., Cuajungco, M. P., Grimm, C., Heller, S., Voets,

T., & Nilius, B. (2008). Stimulus-specific modulation of the cation channel

TRPV4 by PACSIN 3. J Biol Chem, 283(10), 6272-6280.

doi:10.1074/jbc.M706386200

Dahan, D., Ducret, T., Quignard, J. F., Marthan, R., Savineau, J. P., & Esteve, E. (2012).

Implication of the ryanodine receptor in TRPV4-induced calcium response in

pulmonary arterial smooth muscle cells from normoxic and chronically hypoxic

rats. Am J Physiol Lung Cell Mol Physiol, 303(9), L824-833.

doi:10.1152/ajplung.00244.2011

De Falco, S. (2014). Antiangiogenesis therapy: an update after the first decade. Korean J

Intern Med, 29(1), 1-11. doi:10.3904/kjim.2014.29.1.1

Dejana, E., & Giampietro, C. (2012). Vascular endothelial-cadherin and vascular

stability. Curr Opin Hematol, 19(3), 218-223.

doi:10.1097/MOH.0b013e3283523e1c

Dejana, E., Tournier-Lasserve, E., & Weinstein, B. M. (2009). The control of vascular

integrity by endothelial cell junctions: molecular basis and pathological

implications. Dev Cell, 16(2), 209-221. doi:10.1016/j.devcel.2009.01.004

DeLisser, H. M., Christofidou-Solomidou, M., Strieter, R. M., Burdick, M. D., Robinson,

C. S., Wexler, R. S., Kerr, J. S., Garlanda, C., Merwin, J. R., Madri, J. A., &

104

Albelda, S. M. (1997). Involvement of endothelial PECAM-1/CD31 in

angiogenesis. Am J Pathol, 151(3), 671-677. di Tomaso, E., Capen, D., Haskell, A., Hart, J., Logie, J. J., Jain, R. K., McDonald, D.

M., Jones, R., & Munn, L. L. (2005). Mosaic tumor vessels: cellular basis and

ultrastructure of focal regions lacking endothelial cell markers. Cancer Res,

65(13), 5740-5749. doi:10.1158/0008-5472.CAN-04-4552

Dimmeler, S., Dernbach, E., & Zeiher, A. M. (2000). Phosphorylation of the endothelial

nitric oxide synthase at ser-1177 is required for VEGF-induced endothelial cell

migration. FEBS Lett, 477(3), 258-262.

Dong, J., Grunstein, J., Tejada, M., Peale, F., Frantz, G., Liang, W. C., Bai, W., Yu, L.,

Kowalski, J., Liang, X., Fuh, G., Gerber, H. P., & Ferrara, N. (2004). VEGF-null

cells require PDGFR alpha signaling-mediated stromal fibroblast recruitment for

tumorigenesis. EMBO J, 23(14), 2800-2810. doi:10.1038/sj.emboj.7600289

Dorrell, M., Uusitalo-Jarvinen, H., Aguilar, E., & Friedlander, M. (2007). Ocular

neovascularization: basic mechanisms and therapeutic advances. Surv

Ophthalmol, 52 Suppl 1, S3-19. doi:10.1016/j.survophthal.2006.10.017

Dorrell, M. I., Aguilar, E., Scheppke, L., Barnett, F. H., & Friedlander, M. (2007).

Combination angiostatic therapy completely inhibits ocular and tumor

angiogenesis. Proc Natl Acad Sci U S A, 104(3), 967-972.

doi:10.1073/pnas.0607542104

Dudley, A. C. (2012). Tumor endothelial cells. Cold Spring Harb Perspect Med, 2(3),

a006536. doi:10.1101/cshperspect.a006536

105

Dudley, A. C., Khan, Z. A., Shih, S. C., Kang, S. Y., Zwaans, B. M., Bischoff, J., &

Klagsbrun, M. (2008). Calcification of multipotent prostate tumor endothelium.

Cancer Cell, 14(3), 201-211. doi:10.1016/j.ccr.2008.06.017

Earley, S., Heppner, T. J., Nelson, M. T., & Brayden, J. E. (2005). TRPV4 forms a novel

Ca2+ signaling complex with ryanodine receptors and BKCa channels. Circ Res,

97(12), 1270-1279. doi:10.1161/01.RES.0000194321.60300.d6

Earley, S., Pauyo, T., Drapp, R., Tavares, M. J., Liedtke, W., & Brayden, J. E. (2009).

TRPV4-dependent dilation of peripheral resistance arteries influences arterial

pressure. Am J Physiol Heart Circ Physiol, 297(3), H1096-1102.

doi:10.1152/ajpheart.00241.2009

Edgar, L. T., Underwood, C. J., Guilkey, J. E., Hoying, J. B., & Weiss, J. A. (2014).

Extracellular matrix density regulates the rate of neovessel growth and branching

in sprouting angiogenesis. PLoS One, 9(1), e85178.

doi:10.1371/journal.pone.0085178

Egbuniwe, O., Grover, S., Duggal, A. K., Mavroudis, A., Yazdi, M., Renton, T., Di

Silvio, L., & Grant, A. D. (2014). TRPA1 and TRPV4 activation in human

odontoblasts stimulates ATP release. J Dent Res, 93(9), 911-917.

doi:10.1177/0022034514544507

Eilken, H. M., & Adams, R. H. (2010). Dynamics of endothelial cell behavior in

sprouting angiogenesis. Curr Opin Cell Biol, 22(5), 617-625.

doi:10.1016/j.ceb.2010.08.010

106

Everaerts, W., Nilius, B., & Owsianik, G. (2010). The vanilloid transient receptor

potential channel TRPV4: from structure to disease. Prog Biophys Mol Biol,

103(1), 2-17. doi:10.1016/j.pbiomolbio.2009.10.002

Fantozzi, I., Zhang, S., Platoshyn, O., Remillard, C. V., Cowling, R. T., & Yuan, J. X.

(2003). Hypoxia increases AP-1 binding activity by enhancing capacitative Ca2+

entry in human pulmonary artery endothelial cells. Am J Physiol Lung Cell Mol

Physiol, 285(6), L1233-1245. doi:10.1152/ajplung.00445.2002

Feaver, R. E., Gelfand, B. D., Wang, C., Schwartz, M. A., & Blackman, B. R. (2010).

Atheroprone hemodynamics regulate fibronectin deposition to create positive

feedback that sustains endothelial inflammation. Circ Res, 106(11), 1703-1711.

doi:10.1161/CIRCRESAHA.109.216283

Fernandez-Fernandez, J. M., Andrade, Y. N., Arniges, M., Fernandes, J., Plata, C.,

Rubio-Moscardo, F., Vazquez, E., & Valverde, M. A. (2008). Functional coupling

of TRPV4 cationic channel and large conductance, calcium-dependent potassium

channel in human bronchial epithelial cell lines. Pflugers Arch, 457(1), 149-159.

doi:10.1007/s00424-008-0516-3

Ferrara, N. (2004). Vascular endothelial growth factor: basic science and clinical

progress. Endocr Rev, 25(4), 581-611. doi:10.1210/er.2003-0027

Ferrara, N., Damico, L., Shams, N., Lowman, H., & Kim, R. (2006). Development of

ranibizumab, an anti-vascular endothelial growth factor antigen binding fragment,

as therapy for neovascular age-related macular degeneration. Retina, 26(8), 859-

870. doi:10.1097/01.iae.0000242842.14624.e7

107

Ferrara, N., Gerber, H. P., & LeCouter, J. (2003). The biology of VEGF and its receptors.

Nat Med, 9(6), 669-676. doi:10.1038/nm0603-669

Ferrara, N., Mass, R. D., Campa, C., & Kim, R. (2007). Targeting VEGF-A to treat

cancer and age-related macular degeneration. Annu Rev Med, 58, 491-504.

doi:10.1146/annurev.med.58.061705.145635

Fish, J. E., Santoro, M. M., Morton, S. U., Yu, S., Yeh, R. F., Wythe, J. D., Ivey, K. N.,

Bruneau, B. G., Stainier, D. Y., & Srivastava, D. (2008). miR-126 regulates

angiogenic signaling and vascular integrity. Dev Cell, 15(2), 272-284.

doi:10.1016/j.devcel.2008.07.008

Folkman, J. (1971). Tumor angiogenesis: therapeutic implications. N Engl J Med,

285(21), 1182-1186. doi:10.1056/NEJM197111182852108

Folkman, J. (1995). Seminars in Medicine of the Beth Israel Hospital, Boston. Clinical

applications of research on angiogenesis. N Engl J Med, 333(26), 1757-1763.

doi:10.1056/NEJM199512283332608

Folkman, J., & Ingber, D. (1992). Inhibition of angiogenesis. Semin Cancer Biol, 3(2),

89-96.

Friddle, K. (2013). Pathogenesis of Retinopathy of Prematurity: Does Inflammation Play

a Role? Newborn and Infant Nursing Reviews, 13(4), 161-165.

Friedman, D. S., O'Colmain, B. J., Munoz, B., Tomany, S. C., McCarty, C., de Jong, P.

T., Nemesure, B., Mitchell, P., Kempen, J., & Eye Diseases Prevalence Research,

G. (2004). Prevalence of age-related macular degeneration in the United States.

Arch Ophthalmol, 122(4), 564-572. doi:10.1001/archopht.122.4.564

108

Furchgott, R. F. (1996). The 1996 Albert Lasker Medical Research Awards. The

discovery of endothelium-derived relaxing factor and its importance in the

identification of nitric oxide. JAMA, 276(14), 1186-1188.

Garcia-Sanz, N., Valente, P., Gomis, A., Fernandez-Carvajal, A., Fernandez-Ballester,

G., Viana, F., Belmonte, C., & Ferrer-Montiel, A. (2007). A role of the transient

receptor potential domain of vanilloid receptor I in channel gating. J Neurosci,

27(43), 11641-11650. doi:10.1523/JNEUROSCI.2457-07.2007

Gavard, J. (2009). Breaking the VE-cadherin bonds. FEBS Lett, 583(1), 1-6.

doi:10.1016/j.febslet.2008.11.032

Gavard, J., & Gutkind, J. S. (2006). VEGF controls endothelial-cell permeability by

promoting the beta-arrestin-dependent endocytosis of VE-cadherin. Nat Cell Biol,

8(11), 1223-1234. doi:10.1038/ncb1486

Geudens, I., & Gerhardt, H. (2011). Coordinating cell behaviour during blood vessel

formation. Development, 138(21), 4569-4583. doi:10.1242/dev.062323

Ghajar, C. M., Chen, X., Harris, J. W., Suresh, V., Hughes, C. C., Jeon, N. L., Putnam, A.

J., & George, S. C. (2008). The effect of matrix density on the regulation of 3-D

capillary morphogenesis. Biophys J, 94(5), 1930-1941.

doi:10.1529/biophysj.107.120774

Ghosh, K., Thodeti, C. K., Dudley, A. C., Mammoto, A., Klagsbrun, M., & Ingber, D. E.

(2008). Tumor-derived endothelial cells exhibit aberrant Rho-mediated

mechanosensing and abnormal angiogenesis in vitro. Proc Natl Acad Sci U S A,

105(32), 11305-11310. doi:10.1073/pnas.0800835105

109

Gilliam, J. C., & Wensel, T. G. (2011). TRP channel gene expression in the mouse retina.

Vision Res, 51(23-24), 2440-2452. doi:10.1016/j.visres.2011.10.009

Goel, S., Duda, D. G., Xu, L., Munn, L. L., Boucher, Y., Fukumura, D., & Jain, R. K.

(2011). Normalization of the vasculature for treatment of cancer and other

diseases. Physiol Rev, 91(3), 1071-1121. doi:10.1152/physrev.00038.2010

Gospodarowicz, D., Ferrara, N., Schweigerer, L., & Neufeld, G. (1987). Structural

characterization and biological functions of fibroblast growth factor. Endocr Rev,

8(2), 95-114. doi:10.1210/edrv-8-2-95

Gyllensten, L. J., & Hellstrom, B. E. (1954). Experimental approach to the pathogenesis

of retrolental fibroplasia. I. Changes of the eye induced by exposure of newborn

mice to concentrated oxygen. Acta Paediatr Suppl, 43(100), 131-148.

Hahn, C., & Schwartz, M. A. (2009). Mechanotransduction in vascular physiology and

atherogenesis. Nat Rev Mol Cell Biol, 10(1), 53-62. doi:10.1038/nrm2596

Hamanaka, K., Jian, M. Y., Weber, D. S., Alvarez, D. F., Townsley, M. I., Al-Mehdi, A.

B., King, J. A., Liedtke, W., & Parker, J. C. (2007). TRPV4 initiates the acute

calcium-dependent permeability increase during ventilator-induced lung injury in

isolated mouse lungs. Am J Physiol Lung Cell Mol Physiol, 293(4), L923-932.

doi:10.1152/ajplung.00221.2007

Hartmannsgruber, V., Heyken, W. T., Kacik, M., Kaistha, A., Grgic, I., Harteneck, C.,

Liedtke, W., Hoyer, J., & Kohler, R. (2007). Arterial response to shear stress

critically depends on endothelial TRPV4 expression. PLoS One, 2(9), e827.

doi:10.1371/journal.pone.0000827

110

Hashizume, H., Baluk, P., Morikawa, S., McLean, J. W., Thurston, G., Roberge, S., Jain,

R. K., & McDonald, D. M. (2000). Openings between defective endothelial cells

explain tumor vessel leakiness. Am J Pathol, 156(4), 1363-1380.

doi:10.1016/S0002-9440(10)65006-7

Hatano, N., Itoh, Y., & Muraki, K. (2009). Cardiac fibroblasts have functional TRPV4

activated by 4alpha-phorbol 12,13-didecanoate. Life Sci, 85(23-26), 808-814.

doi:10.1016/j.lfs.2009.10.013

Hatano, N., Suzuki, H., Itoh, Y., & Muraki, K. (2013). TRPV4 partially participates in

proliferation of human brain capillary endothelial cells. Life Sci, 92(4-5), 317-324.

doi:10.1016/j.lfs.2013.01.002

Hebda, J. K., Leclair, H. M., Azzi, S., Roussel, C., Scott, M. G., Bidere, N., & Gavard, J.

(2013). The C-terminus region of beta-arrestin1 modulates VE-cadherin

expression and endothelial cell permeability. Cell Commun Signal, 11(1), 37.

doi:10.1186/1478-811X-11-37

Heupel, W. M., Efthymiadis, A., Schlegel, N., Muller, T., Baumer, Y., Baumgartner, W.,

Drenckhahn, D., & Waschke, J. (2009). Endothelial barrier stabilization by a

cyclic tandem peptide targeting VE-cadherin transinteraction in vitro and in vivo.

J Cell Sci, 122(Pt 10), 1616-1625. doi:10.1242/jcs.040212

Hida, K., Maishi, N., Sakurai, Y., Hida, Y., & Harashima, H. (2016). Heterogeneity of

tumor endothelial cells and drug delivery. Adv Drug Deliv Rev, 99(Pt B), 140-

147. doi:10.1016/j.addr.2015.11.008

Hlatky, L., Tsionou, C., Hahnfeldt, P., & Coleman, C. N. (1994). Mammary fibroblasts

may influence breast tumor angiogenesis via hypoxia-induced vascular

111

endothelial growth factor up-regulation and protein expression. Cancer Res,

54(23), 6083-6086.

Huynh, J., Nishimura, N., Rana, K., Peloquin, J. M., Califano, J. P., Montague, C. R.,

King, M. R., Schaffer, C. B., & Reinhart-King, C. A. (2011). Age-related intimal

stiffening enhances endothelial permeability and leukocyte transmigration. Sci

Transl Med, 3(112), 112ra122. doi:10.1126/scitranslmed.3002761

Hynes, R. O. (1992). Specificity of cell adhesion in development: the cadherin

superfamily. Curr Opin Genet Dev, 2(4), 621-624.

Ingber, D. E. (1997). Tensegrity: the architectural basis of cellular mechanotransduction.

Annu Rev Physiol, 59, 575-599. doi:10.1146/annurev.physiol.59.1.575

Ingber, D. E., & Folkman, J. (1989). Mechanochemical switching between growth and

differentiation during fibroblast growth factor-stimulated angiogenesis in vitro:

role of extracellular matrix. J Cell Biol, 109(1), 317-330.

Ingber, D. E., Prusty, D., Sun, Z., Betensky, H., & Wang, N. (1995). Cell shape,

cytoskeletal mechanics, and cell cycle control in angiogenesis. J Biomech, 28(12),

1471-1484.

Jain, R. K. (1989). Delivery of novel therapeutic agents in tumors: physiological barriers

and strategies. J Natl Cancer Inst, 81(8), 570-576.

Jain, R. K. (2005). Normalization of tumor vasculature: an emerging concept in

antiangiogenic therapy. Science, 307(5706), 58-62. doi:10.1126/science.1104819

Jain, R. K. (2013). Normalizing tumor microenvironment to treat cancer: bench to

bedside to biomarkers. J Clin Oncol, 31(17), 2205-2218.

doi:10.1200/JCO.2012.46.3653

112

Jain, R. K., Duda, D. G., Clark, J. W., & Loeffler, J. S. (2006). Lessons from phase III

clinical trials on anti-VEGF therapy for cancer. Nat Clin Pract Oncol, 3(1), 24-40.

doi:10.1038/ncponc0403

Janssen, D. A., Hoenderop, J. G., Jansen, K. C., Kemp, A. W., Heesakkers, J. P., &

Schalken, J. A. (2011). The mechanoreceptor TRPV4 is localized in adherence

junctions of the human bladder urothelium: a morphological study. J Urol,

186(3), 1121-1127. doi:10.1016/j.juro.2011.04.107

Janssen, D. A., Jansen, C. J., Hafmans, T. G., Verhaegh, G. W., Hoenderop, J. G.,

Heesakkers, J. P., & Schalken, J. A. (2016). TRPV4 channels in the human

urogenital tract play a role in cell junction formation and epithelial barrier. Acta

Physiol (Oxf), 218(1), 38-48. doi:10.1111/apha.12701

Jia, Y., Wang, X., Varty, L., Rizzo, C. A., Yang, R., Correll, C. C., Phelps, P. T., Egan,

R. W., & Hey, J. A. (2004). Functional TRPV4 channels are expressed in human

airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol, 287(2), L272-

278. doi:10.1152/ajplung.00393.2003

Jo, A. O., Lakk, M., Frye, A. M., Phuong, T. T., Redmon, S. N., Roberts, R., Berkowitz,

B. A., Yarishkin, O., & Krizaj, D. (2016). Differential volume regulation and

calcium signaling in two ciliary body cell types is subserved by TRPV4 channels.

Proc Natl Acad Sci U S A, 113(14), 3885-3890. doi:10.1073/pnas.1515895113

Jo, A. O., Ryskamp, D. A., Phuong, T. T., Verkman, A. S., Yarishkin, O., MacAulay, N.,

& Krizaj, D. (2015). TRPV4 and AQP4 Channels Synergistically Regulate Cell

Volume and Calcium Homeostasis in Retinal Muller Glia. J Neurosci, 35(39),

13525-13537. doi:10.1523/JNEUROSCI.1987-15.2015

113

Juliano, R. L., & Haskill, S. (1993). Signal transduction from the extracellular matrix. J

Cell Biol, 120(3), 577-585.

Kalluri, R. (2003). Basement membranes: structure, assembly and role in tumour

angiogenesis. Nat Rev Cancer, 3(6), 422-433. doi:10.1038/nrc1094

Kempen, J. H., O'Colmain, B. J., Leske, M. C., Haffner, S. M., Klein, R., Moss, S. E.,

Taylor, H. R., Hamman, R. F., & Eye Diseases Prevalence Research, G. (2004).

The prevalence of diabetic retinopathy among adults in the United States. Arch

Ophthalmol, 122(4), 552-563. doi:10.1001/archopht.122.4.552

Kerbel, R. S. (2000). Tumor angiogenesis: past, present and the near future.

Carcinogenesis, 21(3), 505-515.

Kevil, C. G., Payne, D. K., Mire, E., & Alexander, J. S. (1998). Vascular permeability

factor/vascular endothelial cell growth factor-mediated permeability occurs

through disorganization of endothelial junctional proteins. J Biol Chem, 273(24),

15099-15103.

Kohler, R., Heyken, W. T., Heinau, P., Schubert, R., Si, H., Kacik, M., Busch, C., Grgic,

I., Maier, T., & Hoyer, J. (2006). Evidence for a functional role of endothelial

transient receptor potential V4 in shear stress-induced vasodilatation. Arterioscler

Thromb Vasc Biol, 26(7), 1495-1502. doi:10.1161/01.ATV.0000225698.36212.6a

Kondo, S., Scheef, E. A., Sheibani, N., & Sorenson, C. M. (2007). PECAM-1 isoform-

specific regulation of kidney endothelial cell migration and capillary

morphogenesis. Am J Physiol Cell Physiol, 292(6), C2070-2083.

doi:10.1152/ajpcell.00489.2006

114

Krishnan, R., Klumpers, D. D., Park, C. Y., Rajendran, K., Trepat, X., van Bezu, J., van

Hinsbergh, V. W., Carman, C. V., Brain, J. D., Fredberg, J. J., Butler, J. P., & van

Nieuw Amerongen, G. P. (2011). Substrate stiffening promotes endothelial

monolayer disruption through enhanced physical forces. Am J Physiol Cell

Physiol, 300(1), C146-154. doi:10.1152/ajpcell.00195.2010

Krizaj, D., Ryskamp, D. A., Tian, N., Tezel, G., Mitchell, C. H., Slepak, V. Z., &

Shestopalov, V. I. (2014). From mechanosensitivity to inflammatory responses:

new players in the pathology of glaucoma. Curr Eye Res, 39(2), 105-119.

doi:10.3109/02713683.2013.836541

Lakshminarayanan, S., Gardner, T. W., & Tarbell, J. M. (2000). Effect of shear stress on

the hydraulic conductivity of cultured bovine retinal microvascular endothelial

cell monolayers. Curr Eye Res, 21(6), 944-951.

Le Guelte, A., Dwyer, J., & Gavard, J. (2011). Jumping the barrier: VE-cadherin, VEGF

and other angiogenic modifiers in cancer. Biol Cell, 103(12), 593-605.

doi:10.1042/BC20110069

Lee, P. F., Bai, Y., Smith, R. L., Bayless, K. J., & Yeh, A. T. (2013). Angiogenic

responses are enhanced in mechanically and microscopically characterized,

microbial transglutaminase crosslinked collagen matrices with increased stiffness.

Acta Biomater, 9(7), 7178-7190. doi:10.1016/j.actbio.2013.04.001

Less, J. R., Skalak, T. C., Sevick, E. M., & Jain, R. K. (1991). Microvascular architecture

in a mammary carcinoma: branching patterns and vessel dimensions. Cancer Res,

51(1), 265-273.

115

Leveen, P., Pekny, M., Gebre-Medhin, S., Swolin, B., Larsson, E., & Betsholtz, C.

(1994). Mice deficient for PDGF B show renal, cardiovascular, and hematological

abnormalities. Genes Dev, 8(16), 1875-1887.

Levental, K. R., Yu, H., Kass, L., Lakins, J. N., Egeblad, M., Erler, J. T., Fong, S. F.,

Csiszar, K., Giaccia, A., Weninger, W., Yamauchi, M., Gasser, D. L., & Weaver,

V. M. (2009). Matrix crosslinking forces tumor progression by enhancing integrin

signaling. Cell, 139(5), 891-906. doi:10.1016/j.cell.2009.10.027

Li, R., Ren, M., Chen, N., Luo, M., Zhang, Z., & Wu, J. (2012). Vitronectin increases

vascular permeability by promoting VE-cadherin internalization at cell junctions.

PLoS One, 7(5), e37195. doi:10.1371/journal.pone.0037195

Liao, F., Li, Y., O'Connor, W., Zanetta, L., Bassi, R., Santiago, A., Overholser, J.,

Hooper, A., Mignatti, P., Dejana, E., Hicklin, D. J., & Bohlen, P. (2000).

Monoclonal antibody to vascular endothelial-cadherin is a potent inhibitor of

angiogenesis, tumor growth, and metastasis. Cancer Res, 60(24), 6805-6810.

Liedtke, W., Choe, Y., Marti-Renom, M. A., Bell, A. M., Denis, C. S., Sali, A.,

Hudspeth, A. J., Friedman, J. M., & Heller, S. (2000). Vanilloid receptor-related

osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor.

Cell, 103(3), 525-535.

Liekens, S., De Clercq, E., & Neyts, J. (2001). Angiogenesis: regulators and clinical

applications. Biochem Pharmacol, 61(3), 253-270.

Loot, A. E., Popp, R., Fisslthaler, B., Vriens, J., Nilius, B., & Fleming, I. (2008). Role of

cytochrome P450-dependent transient receptor potential V4 activation in flow-

induced vasodilatation. Cardiovasc Res, 80(3), 445-452. doi:10.1093/cvr/cvn207

116

Luo, N., Conwell, M. D., Chen, X., Kettenhofen, C. I., Westlake, C. J., Cantor, L. B.,

Wells, C. D., Weinreb, R. N., Corson, T. W., Spandau, D. F., Joos, K. M., Iomini,

C., Obukhov, A. G., & Sun, Y. (2014). Primary cilia signaling mediates

intraocular pressure sensation. Proc Natl Acad Sci U S A, 111(35), 12871-12876.

doi:10.1073/pnas.1323292111

Mahabeleshwar, G. H., Somanath, P. R., & Byzova, T. V. (2006). Methods for isolation

of endothelial and smooth muscle cells and in vitro proliferation assays. Methods

Mol Med, 129, 197-208. doi:10.1385/1-59745-213-0:197

Mammoto, A., Connor, K. M., Mammoto, T., Yung, C. W., Huh, D., Aderman, C. M.,

Mostoslavsky, G., Smith, L. E., & Ingber, D. E. (2009). A mechanosensitive

transcriptional mechanism that controls angiogenesis. Nature, 457(7233), 1103-

1108. doi:10.1038/nature07765

Mammoto, A., Mammoto, T., & Ingber, D. E. (2008). Rho signaling and mechanical

control of vascular development. Curr Opin Hematol, 15(3), 228-234.

doi:10.1097/MOH.0b013e3282fa7445

Mantovani, A., Sozzani, S., Locati, M., Allavena, P., & Sica, A. (2002). Macrophage

polarization: tumor-associated macrophages as a paradigm for polarized M2

mononuclear phagocytes. Trends Immunol, 23(11), 549-555.

Marrelli, S. P., O'Neil R, G., Brown, R. C., & Bryan, R. M., Jr. (2007). PLA2 and

TRPV4 channels regulate endothelial calcium in cerebral arteries. Am J Physiol

Heart Circ Physiol, 292(3), H1390-1397. doi:10.1152/ajpheart.01006.2006

Martinez-Rendon, J., Sanchez-Guzman, E., Rueda, A., Gonzalez, J., Gulias-Canizo, R.,

Aquino-Jarquin, G., Castro-Munozledo, F., & Garcia-Villegas, R. (2016). TRPV4

117

Regulates Tight Junctions and Affects Differentiation in a Cell Culture Model of

the Corneal Epithelium. J Cell Physiol. doi:10.1002/jcp.25698

Matthews, B. D., Overby, D. R., Mannix, R., & Ingber, D. E. (2006). Cellular adaptation

to mechanical stress: role of integrins, Rho, cytoskeletal tension and

mechanosensitive ion channels. J Cell Sci, 119(Pt 3), 508-518.

doi:10.1242/jcs.02760

Matthews, B. D., Thodeti, C. K., Tytell, J. D., Mammoto, A., Overby, D. R., & Ingber, D.

E. (2010). Ultra-rapid activation of TRPV4 ion channels by mechanical forces

applied to cell surface beta1 integrins. Integr Biol (Camb), 2(9), 435-442.

doi:10.1039/c0ib00034e

Mazure, N. M., Chen, E. Y., Yeh, P., Laderoute, K. R., & Giaccia, A. J. (1996).

Oncogenic transformation and hypoxia synergistically act to modulate vascular

endothelial growth factor expression. Cancer Res, 56(15), 3436-3440.

McDonald, D. M., & Baluk, P. (2002). Significance of blood vessel leakiness in cancer.

Cancer Res, 62(18), 5381-5385.

Mendoza, S. A., Fang, J., Gutterman, D. D., Wilcox, D. A., Bubolz, A. H., Li, R., Suzuki,

M., & Zhang, D. X. (2010). TRPV4-mediated endothelial Ca2+ influx and

vasodilation in response to shear stress. Am J Physiol Heart Circ Physiol, 298(2),

H466-476. doi:10.1152/ajpheart.00854.2009

Mentzer, S. J., & Konerding, M. A. (2014). Intussusceptive angiogenesis: expansion and

remodeling of microvascular networks. Angiogenesis, 17(3), 499-509.

doi:10.1007/s10456-014-9428-3

118

Mergler, S., Valtink, M., Taetz, K., Sahlmuller, M., Fels, G., Reinach, P. S., Engelmann,

K., & Pleyer, U. (2011). Characterization of transient receptor potential vanilloid

channel 4 (TRPV4) in human corneal endothelial cells. Exp Eye Res, 93(5), 710-

719. doi:10.1016/j.exer.2011.09.021

Mignatti, P., & Rifkin, D. B. (1996a). Plasminogen activators and angiogenesis. Curr Top

Microbiol Immunol, 213 ( Pt 1), 33-50.

Mignatti, P., & Rifkin, D. B. (1996b). Plasminogen activators and matrix

metalloproteinases in angiogenesis. Enzyme Protein, 49(1-3), 117-137.

Monaghan, K., McNaughten, J., McGahon, M. K., Kelly, C., Kyle, D., Yong, P. H.,

McGeown, J. G., & Curtis, T. M. (2015). Hyperglycemia and Diabetes

Downregulate the Functional Expression of TRPV4 Channels in Retinal

Microvascular Endothelium. PLoS One, 10(6), e0128359.

doi:10.1371/journal.pone.0128359

Moncada, S., Gryglewski, R., Bunting, S., & Vane, J. R. (1976). An enzyme isolated

from arteries transforms prostaglandin endoperoxides to an unstable substance

that inhibits platelet aggregation. Nature, 263(5579), 663-665.

Moore, K. A., Polte, T., Huang, S., Shi, B., Alsberg, E., Sunday, M. E., & Ingber, D. E.

(2005). Control of basement membrane remodeling and epithelial branching

morphogenesis in embryonic lung by Rho and cytoskeletal tension. Dev Dyn,

232(2), 268-281. doi:10.1002/dvdy.20237

Moss, A. (2013). The angiopoietin:Tie 2 interaction: a potential target for future therapies

in human vascular disease. Cytokine Growth Factor Rev, 24(6), 579-592.

doi:10.1016/j.cytogfr.2013.05.009

119

Murakami, M., & Simons, M. (2009). Regulation of vascular integrity. J Mol Med (Berl),

87(6), 571-582. doi:10.1007/s00109-009-0463-2

Nilius, B., Prenen, J., Wissenbach, U., Bodding, M., & Droogmans, G. (2001).

Differential activation of the volume-sensitive cation channel TRP12 (OTRPC4)

and volume-regulated anion currents in HEK-293 cells. Pflugers Arch, 443(2),

227-233. doi:10.1007/s004240100676

Nilius, B., Vriens, J., Prenen, J., Droogmans, G., & Voets, T. (2004). TRPV4 calcium

entry channel: a paradigm for gating diversity. Am J Physiol Cell Physiol, 286(2),

C195-205. doi:10.1152/ajpcell.00365.2003

Niranjan, H. S., Benakappa, N., Reddy, K. B., Nanda, S., & Kamath, M. V. (2012).

Retinopathy of prematurity promising newer modalities of treatment. Indian

Pediatr, 49(2), 139-143.

O'Brien, C. D., Cao, G., Makrigiannakis, A., & DeLisser, H. M. (2004). Role of

immunoreceptor tyrosine-based inhibitory motifs of PECAM-1 in PECAM-1-

dependent cell migration. Am J Physiol Cell Physiol, 287(4), C1103-1113.

doi:10.1152/ajpcell.00573.2003

Pan, Z., Yang, H., Mergler, S., Liu, H., Tachado, S. D., Zhang, F., Kao, W. W., Koziel,

H., Pleyer, U., & Reinach, P. S. (2008). Dependence of regulatory volume

decrease on transient receptor potential vanilloid 4 (TRPV4) expression in human

corneal epithelial cells. Cell Calcium, 44(4), 374-385.

doi:10.1016/j.ceca.2008.01.008

Park, S., DiMaio, T. A., Scheef, E. A., Sorenson, C. M., & Sheibani, N. (2010). PECAM-

1 regulates proangiogenic properties of endothelial cells through modulation of

120

cell-cell and cell-matrix interactions. Am J Physiol Cell Physiol, 299(6), C1468-

1484. doi:10.1152/ajpcell.00246.2010

Parker, K. K., Brock, A. L., Brangwynne, C., Mannix, R. J., Wang, N., Ostuni, E.,

Geisse, N. A., Adams, J. C., Whitesides, G. M., & Ingber, D. E. (2002).

Directional control of lamellipodia extension by constraining cell shape and

orienting cell tractional forces. FASEB J, 16(10), 1195-1204. doi:10.1096/fj.02-

0038com

Patz, A., Eastham, A., Higginbotham, D. H., & Kleh, T. (1953). Oxygen studies in

retrolental fibroplasia. II. The production of the microscopic changes of

retrolental fibroplasia in experimental animals. Am J Ophthalmol, 36(11), 1511-

1522.

Patz, A., Hoeck, L. E., & De La Cruz, E. (1952). Studies on the effect of high oxygen

administration in retrolental fibroplasia. I. Nursery observations. Am J

Ophthalmol, 35(9), 1248-1253.

Pepper, M. S., Ferrara, N., Orci, L., & Montesano, R. (1991). Vascular endothelial

growth factor (VEGF) induces plasminogen activators and plasminogen activator

inhibitor-1 in microvascular endothelial cells. Biochem Biophys Res Commun,

181(2), 902-906.

Petersen, R., Hunter, D., & Mukai, S. (1994). Retinopathy of prematurity. Principles and

practice of ophthalmology, 4, 2799-2812.

Phelps, C. B., Wang, R. R., Choo, S. S., & Gaudet, R. (2010). Differential regulation of

TRPV1, TRPV3, and TRPV4 sensitivity through a conserved binding site on the

121

ankyrin repeat domain. J Biol Chem, 285(1), 731-740.

doi:10.1074/jbc.M109.052548

Pierce, E. A., Foley, E. D., & Smith, L. E. (1996). Regulation of vascular endothelial

growth factor by oxygen in a model of retinopathy of prematurity. Arch

Ophthalmol, 114(10), 1219-1228.

Presta, M., Moscatelli, D., Joseph-Silverstein, J., & Rifkin, D. B. (1986). Purification

from a human hepatoma cell line of a basic fibroblast growth factor-like molecule

that stimulates capillary endothelial cell plasminogen activator production, DNA

synthesis, and migration. Mol Cell Biol, 6(11), 4060-4066.

Przybylski, M. (2009). A review of the current research on the role of bFGF and VEGF

in angiogenesis. J Wound Care, 18(12), 516-519.

doi:10.12968/jowc.2009.18.12.45609

Puro, D. G. (1991). Stretch-activated channels in human retinal Muller cells. Glia, 4(5),

456-460. doi:10.1002/glia.440040505

Rabinowitz, R., Priel, A., Rosner, M., Pri-Chen, S., & Spierer, A. (2012). Avastin

treatment reduces retinal neovascularization in a mouse model of retinopathy of

prematurity. Curr Eye Res, 37(7), 624-629. doi:10.3109/02713683.2012.669003

Rath, G., Saliez, J., Behets, G., Romero-Perez, M., Leon-Gomez, E., Bouzin, C., Vriens,

J., Nilius, B., Feron, O., & Dessy, C. (2012). Vascular hypoxic preconditioning

relies on TRPV4-dependent calcium influx and proper intercellular gap junctions

communication. Arterioscler Thromb Vasc Biol, 32(9), 2241-2249.

doi:10.1161/ATVBAHA.112.252783

122

RayChaudhury, A., Elkins, M., Kozien, D., & Nakada, M. T. (2001). Regulation of

PECAM-1 in endothelial cells during cell growth and migration. Exp Biol Med

(Maywood), 226(7), 686-691.

Reynolds, J. D. (2001). The management of retinopathy of prematurity. Paediatr Drugs,

3(4), 263-272.

Ribatti, D., & Crivellato, E. (2012). "Sprouting angiogenesis", a reappraisal. Dev Biol,

372(2), 157-165. doi:10.1016/j.ydbio.2012.09.018

Risau, W. (1997). Mechanisms of angiogenesis. Nature, 386(6626), 671-674.

doi:10.1038/386671a0

Rosenfeld, P. J., Brown, D. M., Heier, J. S., Boyer, D. S., Kaiser, P. K., Chung, C. Y.,

Kim, R. Y., & Group, M. S. (2006). Ranibizumab for neovascular age-related

macular degeneration. N Engl J Med, 355(14), 1419-1431.

doi:10.1056/NEJMoa054481

Ryskamp, D. A., Frye, A. M., Phuong, T. T., Yarishkin, O., Jo, A. O., Xu, Y., Lakk, M.,

Iuso, A., Redmon, S. N., Ambati, B., Hageman, G., Prestwich, G. D., Torrejon, K.

Y., & Krizaj, D. (2016). TRPV4 regulates calcium homeostasis, cytoskeletal

remodeling, conventional outflow and intraocular pressure in the mammalian eye.

Sci Rep, 6, 30583. doi:10.1038/srep30583

Ryskamp, D. A., Jo, A. O., Frye, A. M., Vazquez-Chona, F., MacAulay, N., Thoreson,

W. B., & Krizaj, D. (2014). Swelling and eicosanoid metabolites differentially

gate TRPV4 channels in retinal neurons and glia. J Neurosci, 34(47), 15689-

15700. doi:10.1523/JNEUROSCI.2540-14.2014

123

Ryskamp, D. A., Witkovsky, P., Barabas, P., Huang, W., Koehler, C., Akimov, N. P.,

Lee, S. H., Chauhan, S., Xing, W., Renteria, R. C., Liedtke, W., & Krizaj, D.

(2011). The polymodal ion channel transient receptor potential vanilloid 4

modulates calcium flux, spiking rate, and apoptosis of mouse retinal ganglion

cells. J Neurosci, 31(19), 7089-7101. doi:10.1523/JNEUROSCI.0359-11.2011

Sack, K. D., Teran, M., & Nugent, M. A. (2016). Extracellular Matrix Stiffness Controls

VEGF Signaling and Processing in Endothelial Cells. J Cell Physiol, 231(9),

2026-2039. doi:10.1002/jcp.25312

Saharinen, P., Bry, M., & Alitalo, K. (2010). How do angiopoietins Tie in with vascular

endothelial growth factors? Curr Opin Hematol, 17(3), 198-205.

doi:10.1097/MOH.0b013e3283386673

Salazar, H., Jara-Oseguera, A., Hernandez-Garcia, E., Llorente, I., Arias, O., II, Soriano-

Garcia, M., Islas, L. D., & Rosenbaum, T. (2009). Structural determinants of

gating in the TRPV1 channel. Nat Struct Mol Biol, 16(7), 704-710.

doi:10.1038/nsmb.1633

Santoro, M. M., Samuel, T., Mitchell, T., Reed, J. C., & Stainier, D. Y. (2007). Birc2

(cIap1) regulates endothelial cell integrity and blood vessel homeostasis. Nat

Genet, 39(11), 1397-1402. doi:10.1038/ng.2007.8

Santos, L., Fuhrmann, G., Juenet, M., Amdursky, N., Horejs, C. M., Campagnolo, P., &

Stevens, M. M. (2015). Extracellular Stiffness Modulates the Expression of

Functional Proteins and Growth Factors in Endothelial Cells. Adv Healthc Mater.

doi:10.1002/adhm.201500338

124

Sastry, S. K., & Horwitz, A. F. (1993). Integrin cytoplasmic domains: mediators of

cytoskeletal linkages and extra- and intracellular initiated transmembrane

signaling. Curr Opin Cell Biol, 5(5), 819-831.

Sawada, J., Urakami, T., Li, F., Urakami, A., Zhu, W., Fukuda, M., Li, D. Y., Ruoslahti,

E., & Komatsu, M. (2012). Small GTPase R-Ras regulates integrity and

functionality of tumor blood vessels. Cancer Cell, 22(2), 235-249.

doi:10.1016/j.ccr.2012.06.013

Schierling, W., Troidl, K., Apfelbeck, H., Troidl, C., Kasprzak, P. M., Schaper, W., &

Schmitz-Rixen, T. (2011). Cerebral arteriogenesis is enhanced by

pharmacological as well as fluid-shear-stress activation of the Trpv4 calcium

channel. Eur J Vasc Endovasc Surg, 41(5), 589-596.

doi:10.1016/j.ejvs.2010.11.034

Schwartz, M. A., Schaller, M. D., & Ginsberg, M. H. (1995). Integrins: emerging

paradigms of signal transduction. Annu Rev Cell Dev Biol, 11, 549-599.

doi:10.1146/annurev.cb.11.110195.003001

Shahar, J., Avery, R. L., Heilweil, G., Barak, A., Zemel, E., Lewis, G. P., Johnson, P. T.,

Fisher, S. K., Perlman, I., & Loewenstein, A. (2006). Electrophysiologic and

retinal penetration studies following intravitreal injection of bevacizumab

(Avastin). Retina, 26(3), 262-269.

Shahidullah, M., Mandal, A., & Delamere, N. A. (2012). TRPV4 in porcine lens

epithelium regulates hemichannel-mediated ATP release and Na-K-ATPase

activity. Am J Physiol Cell Physiol, 302(12), C1751-1761.

doi:10.1152/ajpcell.00010.2012

125

Shigematsu, H., Sokabe, T., Danev, R., Tominaga, M., & Nagayama, K. (2010). A 3.5-

nm structure of rat TRPV4 cation channel revealed by Zernike phase-contrast

cryoelectron microscopy. J Biol Chem, 285(15), 11210-11218.

doi:10.1074/jbc.M109.090712

Shojaei, F. (2012). Anti-angiogenesis therapy in cancer: current challenges and future

perspectives. Cancer Lett, 320(2), 130-137. doi:10.1016/j.canlet.2012.03.008

Sieminski, A. L., Hebbel, R. P., & Gooch, K. J. (2004). The relative magnitudes of

endothelial force generation and matrix stiffness modulate capillary

morphogenesis in vitro. Exp Cell Res, 297(2), 574-584.

doi:10.1016/j.yexcr.2004.03.035

Sieminski, A. L., Was, A. S., Kim, G., Gong, H., & Kamm, R. D. (2007). The stiffness of

three-dimensional ionic self-assembling peptide gels affects the extent of

capillary-like network formation. Cell Biochem Biophys, 49(2), 73-83.

Simons, M. (2005). Angiogenesis: where do we stand now? Circulation, 111(12), 1556-

1566. doi:10.1161/01.CIR.0000159345.00591.8F

Skalak, T. C., & Price, R. J. (1996). The role of mechanical stresses in microvascular

remodeling. Microcirculation, 3(2), 143-165.

Skrzypski, M., Kakkassery, M., Mergler, S., Grotzinger, C., Khajavi, N., Sassek, M.,

Szczepankiewicz, D., Wiedenmann, B., Nowak, K. W., & Strowski, M. Z. (2013).

Activation of TRPV4 channel in pancreatic INS-1E beta cells enhances glucose-

stimulated insulin secretion via calcium-dependent mechanisms. FEBS Lett,

587(19), 3281-3287. doi:10.1016/j.febslet.2013.08.025

126

Smith, L. E. (2003). Pathogenesis of retinopathy of prematurity. Semin Neonatol, 8(6),

469-473. doi:10.1016/S1084-2756(03)00119-2

Smith, L. E., Wesolowski, E., McLellan, A., Kostyk, S. K., D'Amato, R., Sullivan, R., &

D'Amore, P. A. (1994). Oxygen-induced retinopathy in the mouse. Invest

Ophthalmol Vis Sci, 35(1), 101-111.

Sokabe, T., Fukumi-Tominaga, T., Yonemura, S., Mizuno, A., & Tominaga, M. (2010).

The TRPV4 channel contributes to intercellular junction formation in

keratinocytes. J Biol Chem, 285(24), 18749-18758. doi:10.1074/jbc.M110.103606

St Croix, B., Rago, C., Velculescu, V., Traverso, G., Romans, K. E., Montgomery, E.,

Lal, A., Riggins, G. J., Lengauer, C., Vogelstein, B., & Kinzler, K. W. (2000).

Genes expressed in human tumor endothelium. Science, 289(5482), 1197-1202.

Stahl, A., Connor, K. M., Sapieha, P., Chen, J., Dennison, R. J., Krah, N. M., Seaward,

M. R., Willett, K. L., Aderman, C. M., Guerin, K. I., Hua, J., Lofqvist, C.,

Hellstrom, A., & Smith, L. E. (2010). The mouse retina as an angiogenesis model.

Invest Ophthalmol Vis Sci, 51(6), 2813-2826. doi:10.1167/iovs.10-5176

Stewart, M. W. (2012). The expanding role of vascular endothelial growth factor

inhibitors in ophthalmology. Mayo Clin Proc, 87(1), 77-88.

doi:10.1016/j.mayocp.2011.10.001

Strotmann, R., Harteneck, C., Nunnenmacher, K., Schultz, G., & Plant, T. D. (2000).

OTRPC4, a nonselective cation channel that confers sensitivity to extracellular

osmolarity. Nat Cell Biol, 2(10), 695-702. doi:10.1038/35036318

127

Strotmann, R., Schultz, G., & Plant, T. D. (2003). Ca2+-dependent potentiation of the

nonselective cation channel TRPV4 is mediated by a C-terminal calmodulin

binding site. J Biol Chem, 278(29), 26541-26549. doi:10.1074/jbc.M302590200

Suresh, K., Servinsky, L., Reyes, J., Baksh, S., Undem, C., Caterina, M., Pearse, D. B., &

Shimoda, L. A. (2015). Hydrogen peroxide-induced calcium influx in lung

microvascular endothelial cells involves TRPV4. Am J Physiol Lung Cell Mol

Physiol, 309(12), L1467-1477. doi:10.1152/ajplung.00275.2015

Suzuki, M., Hirao, A., & Mizuno, A. (2003). Microtubule-associated [corrected] protein

7 increases the membrane expression of transient receptor potential vanilloid 4

(TRPV4). J Biol Chem, 278(51), 51448-51453. doi:10.1074/jbc.M308212200

Taddei, A., Giampietro, C., Conti, A., Orsenigo, F., Breviario, F., Pirazzoli, V., Potente,

M., Daly, C., Dimmeler, S., & Dejana, E. (2008). Endothelial adherens junctions

control tight junctions by VE-cadherin-mediated upregulation of claudin-5. Nat

Cell Biol, 10(8), 923-934. doi:10.1038/ncb1752

Takahashi, N., Hamada-Nakahara, S., Itoh, Y., Takemura, K., Shimada, A., Ueda, Y.,

Kitamata, M., Matsuoka, R., Hanawa-Suetsugu, K., Senju, Y., Mori, M. X.,

Kiyonaka, S., Kohda, D., Kitao, A., Mori, Y., & Suetsugu, S. (2014). TRPV4

channel activity is modulated by direct interaction of the ankyrin domain to

PI(4,5)P(2). Nat Commun, 5, 4994. doi:10.1038/ncomms5994

Tanaka, M., Koyama, T., Sakurai, T., Kamiyoshi, A., Ichikawa-Shindo, Y., Kawate, H.,

Liu, T., Xian, X., Imai, A., Zhai, L., Hirabayashi, K., Owa, S., Yamauchi, A.,

Igarashi, K., Taniguchi, S., & Shindo, T. (2016). The endothelial adrenomedullin-

128

RAMP2 system regulates vascular integrity and suppresses tumour metastasis.

Cardiovasc Res, 111(4), 398-409. doi:10.1093/cvr/cvw166

Taylor, L., Arner, K., & Ghosh, F. (2016). Specific inhibition of TRPV4 enhances retinal

ganglion cell survival in adult porcine retinal explants. Exp Eye Res, 154, 10-21.

doi:10.1016/j.exer.2016.11.002

Thodeti, C. K., Matthews, B., Ravi, A., Mammoto, A., Ghosh, K., Bracha, A. L., &

Ingber, D. E. (2009). TRPV4 channels mediate cyclic strain-induced endothelial

cell reorientation through integrin-to-integrin signaling. Circ Res, 104(9), 1123-

1130. doi:10.1161/CIRCRESAHA.108.192930

Thoma, R. (1893). Untersuchungen über die Histogenese und Histomechanik des

Gefäßsystems: Enke.

Thoppil, R. J., Adapala, R. K., Cappelli, H. C., Kondeti, V., Dudley, A. C., Gary

Meszaros, J., Paruchuri, S., & Thodeti, C. K. (2015). TRPV4 channel activation

selectively inhibits tumor endothelial cell proliferation. Sci Rep, 5, 14257.

doi:10.1038/srep14257

Thoppil, R. J., Cappelli, H. C., Adapala, R. K., Kanugula, A. K., Paruchuri, S., &

Thodeti, C. K. (2016). TRPV4 channels regulate tumor angiogenesis via

modulation of Rho/Rho kinase pathway. Oncotarget, 7(18), 25849-25861.

doi:10.18632/oncotarget.8405

Tredan, O., Galmarini, C. M., Patel, K., & Tannock, I. F. (2007). Drug resistance and the

solid tumor microenvironment. J Natl Cancer Inst, 99(19), 1441-1454.

doi:10.1093/jnci/djm135

129

Troyanovsky, R. B., Sokolov, E. P., & Troyanovsky, S. M. (2006). Endocytosis of

cadherin from intracellular junctions is the driving force for cadherin adhesive

dimer disassembly. Mol Biol Cell, 17(8), 3484-3493. doi:10.1091/mbc.E06-03-

0190

Tzima, E., Irani-Tehrani, M., Kiosses, W. B., Dejana, E., Schultz, D. A., Engelhardt, B.,

Cao, G., DeLisser, H., & Schwartz, M. A. (2005). A mechanosensory complex

that mediates the endothelial cell response to fluid shear stress. Nature,

437(7057), 426-431. doi:10.1038/nature03952

Van der Veldt, A. A., Lubberink, M., Bahce, I., Walraven, M., de Boer, M. P., Greuter,

H. N., Hendrikse, N. H., Eriksson, J., Windhorst, A. D., Postmus, P. E., Verheul,

H. M., Serne, E. H., Lammertsma, A. A., & Smit, E. F. (2012). Rapid decrease in

delivery of chemotherapy to tumors after anti-VEGF therapy: implications for

scheduling of anti-angiogenic drugs. Cancer Cell, 21(1), 82-91.

doi:10.1016/j.ccr.2011.11.023

Vennekens, R., Menigoz, A., & Nilius, B. (2012). TRPs in the Brain. Rev Physiol

Biochem Pharmacol, 163, 27-64. doi:10.1007/112_2012_8

Villalta, P. C., Rocic, P., & Townsley, M. I. (2014). Role of MMP2 and MMP9 in

TRPV4-induced lung injury. Am J Physiol Lung Cell Mol Physiol, 307(8), L652-

659. doi:10.1152/ajplung.00113.2014

Voets, T., Prenen, J., Vriens, J., Watanabe, H., Janssens, A., Wissenbach, U., Bodding,

M., Droogmans, G., & Nilius, B. (2002). Molecular determinants of permeation

through the cation channel TRPV4. J Biol Chem, 277(37), 33704-33710.

doi:10.1074/jbc.M204828200

130

Vriens, J., Watanabe, H., Janssens, A., Droogmans, G., Voets, T., & Nilius, B. (2004).

Cell swelling, heat, and chemical agonists use distinct pathways for the activation

of the cation channel TRPV4. Proc Natl Acad Sci U S A, 101(1), 396-401.

doi:10.1073/pnas.0303329101

Walshe, T. E., Connell, P., Cryan, L., Ferguson, G., O'Brien, C., & Cahill, P. A. (2011).

The role of pulsatile flow in controlling microvascular retinal endothelial and

pericyte cell apoptosis and proliferation. Cardiovasc Res, 89(3), 661-670.

doi:10.1093/cvr/cvq341

Wang, Y., & Sheibani, N. (2006). PECAM-1 isoform-specific activation of MAPK/ERKs

and small GTPases: implications in inflammation and angiogenesis. J Cell

Biochem, 98(2), 451-468. doi:10.1002/jcb.20827

Wangsa-Wirawan, N. D., & Linsenmeier, R. A. (2003). Retinal oxygen: fundamental and

clinical aspects. Arch Ophthalmol, 121(4), 547-557.

doi:10.1001/archopht.121.4.547

Watanabe, H., Davis, J. B., Smart, D., Jerman, J. C., Smith, G. D., Hayes, P., Vriens, J.,

Cairns, W., Wissenbach, U., Prenen, J., Flockerzi, V., Droogmans, G., Benham,

C. D., & Nilius, B. (2002). Activation of TRPV4 channels (hVRL-2/mTRP12) by

phorbol derivatives. J Biol Chem, 277(16), 13569-13577.

doi:10.1074/jbc.M200062200

Watanabe, H., Vriens, J., Suh, S. H., Benham, C. D., Droogmans, G., & Nilius, B.

(2002). Heat-evoked activation of TRPV4 channels in a HEK293 cell expression

system and in native mouse aorta endothelial cells. J Biol Chem, 277(49), 47044-

47051. doi:10.1074/jbc.M208277200

131

White, J. P., Cibelli, M., Urban, L., Nilius, B., McGeown, J. G., & Nagy, I. (2016).

TRPV4: Molecular Conductor of a Diverse Orchestra. Physiol Rev, 96(3), 911-

973. doi:10.1152/physrev.00016.2015

Wissenbach, U., Bodding, M., Freichel, M., & Flockerzi, V. (2000). Trp12, a novel Trp

related protein from kidney. FEBS Lett, 485(2-3), 127-134.

Wu, J., & Sheibani, N. (2003). Modulation of VE-cadherin and PECAM-1 mediated cell-

cell adhesions by mitogen-activated protein kinases. J Cell Biochem, 90(1), 121-

137. doi:10.1002/jcb.10600

Xu, H., Fu, Y., Tian, W., & Cohen, D. M. (2006). Glycosylation of the osmoresponsive

transient receptor potential channel TRPV4 on Asn-651 influences membrane

trafficking. Am J Physiol Renal Physiol, 290(5), F1103-1109.

doi:10.1152/ajprenal.00245.2005

Yamamura, N., Sudo, R., Ikeda, M., & Tanishita, K. (2007). Effects of the mechanical

properties of collagen gel on the in vitro formation of microvessel networks by

endothelial cells. Tissue Eng, 13(7), 1443-1453. doi:10.1089/ten.2006.0333

Yamawaki, H., Mihara, H., Suzuki, N., Nishizono, H., Uchida, K., Watanabe, S.,

Tominaga, M., & Sugiyama, T. (2014). Role of transient receptor potential

vanilloid 4 activation in indomethacin-induced intestinal damage. Am J Physiol

Gastrointest Liver Physiol, 307(1), G33-40. doi:10.1152/ajpgi.00105.2013

Yin, J., & Kuebler, W. M. (2010). Mechanotransduction by TRP channels: general

concepts and specific role in the vasculature. Cell Biochem Biophys, 56(1), 1-18.

doi:10.1007/s12013-009-9067-2

132

Yuan, S. Y., & Rigor, R. R. (2010). The Endothelial Barrier Regulation of Endothelial

Barrier Function. San Rafael (CA): Morgan & Claypool Life Sciences.

Yurchenco, P., & O'Rear, J. (1993). Supramolecular organization of basement

membranes. Molecular and Cellular Aspects of Basment Membranes; Rohrbach,

DH, Timpl, R., Eds, 19-47.

Zanetta, L., Corada, M., Grazia Lampugnani, M., Zanetti, A., Breviario, F., Moons, L.,

Carmeliet, P., Pepper, M. S., & Dejana, E. (2005). Downregulation of vascular

endothelial-cadherin expression is associated with an increase in vascular tumor

growth and hemorrhagic complications. Thromb Haemost, 93(6), 1041-1046.

doi:10.1160/TH04-10-0680

Zhang, D. X., Mendoza, S. A., Bubolz, A. H., Mizuno, A., Ge, Z. D., Li, R., Warltier, D.

C., Suzuki, M., & Gutterman, D. D. (2009). Transient receptor potential vanilloid

type 4-deficient mice exhibit impaired endothelium-dependent relaxation induced

by acetylcholine in vitro and in vivo. Hypertension, 53(3), 532-538.

doi:10.1161/HYPERTENSIONAHA.108.127100

Zhang, H., & Labouesse, M. (2012). Signalling through mechanical inputs: a coordinated

process. J Cell Sci, 125(Pt 13), 3039-3049. doi:10.1242/jcs.093666

Zhang, L. P., Ma, F., Abshire, S. M., & Westlund, K. N. (2013). Prolonged high

fat/alcohol exposure increases TRPV4 and its functional responses in pancreatic

stellate cells. Am J Physiol Regul Integr Comp Physiol, 304(9), R702-711.

doi:10.1152/ajpregu.00296.2012

133

Zhang, P., Ma, Y., Wang, Y., Ma, X., Huang, Y., Li, R. A., Wan, S., & Yao, X. (2014).

Nitric oxide and protein kinase G act on TRPC1 to inhibit 11,12-EET-induced

vascular relaxation. Cardiovasc Res, 104(1), 138-146. doi:10.1093/cvr/cvu190

Zhao, P. Y., Gan, G., Peng, S., Wang, S. B., Chen, B., Adelman, R. A., & Rizzolo, L. J.

(2015). TRP Channels Localize to Subdomains of the Apical Plasma Membrane

in Human Fetal Retinal Pigment Epithelium. Invest Ophthalmol Vis Sci, 56(3),

1916-1923. doi:10.1167/iovs.14-15738

Zhao, Y., & Adjei, A. A. (2015). Targeting Angiogenesis in Cancer Therapy: Moving

Beyond Vascular Endothelial Growth Factor. Oncologist, 20(6), 660-673.

doi:10.1634/theoncologist.2014-0465

Ziche, M., Morbidelli, L., Choudhuri, R., Zhang, H. T., Donnini, S., Granger, H. J., &

Bicknell, R. (1997). Nitric oxide synthase lies downstream from vascular

endothelial growth factor-induced but not basic fibroblast growth factor-induced

angiogenesis. J Clin Invest, 99(11), 2625-2634. doi:10.1172/JCI119451

134