EVOLUTIONARY BIOLOGY OF THE AUSTRALIAN CARNIVOROUS MARSUPIAL GENUS ANTECHINUS

Thomas Yeshe Mutton B. App. Sci. (Hons)

School of Earth, Environmental and Biological Sciences Science and Engineering Faculty

Queensland University of Technology

Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

i

Keywords

Antechinus, Australia, Australian mesic zone, biogeographical barriers, biogeography, breeding biology, congeneric competition, conservation, genetic structure, Dasyuridae, dasyurid, life-history, mammal, mammalian, Miocene, molecular systematics, Phascogalini, phylogenetics, phylogeography, Pleistocene, Pliocene, population genetics, Queensland, systematics (Davison )

ii

Abstract

Antechinus is an Australian genus of small carnivorous marsupials. Since , the number of described species in the genus has increased by % from ten to fifteen. The systematic relationships of these new species and others in the genus have not been well resolved and a broad phylogeographic study of the genus is lacking. Moreover, little ecological information is known about these new species. Therefore, the present study examined the evolutionary biology of Antechinus in two complimentary components. The first component aimed to resolve the systematics and phylogeography of the genus Antechinus. The second component, at a finer spatiotemporal scale, aimed to improve understanding of the autecology, habitat use and risk of extinction within the group, with a focus on the recently named buff-footed antechinus, A. mysticus and a partially sympatric congener, A. subtropicus.

To date, powerful (>two gene) molecular studies have only included eight Antechinus species. Here, the first comprehensive, multi-gene phylogenetic analysis of the genus using six genes was provided, incorporating all known species and subspecies of Antechinus. Four main lineages of Antechinus were reconstructed: () The dusky antechinus (A. arktos, A. swainsonii, A. vandycki, A. mimetes) and A. minimus; () A. godmani; () A. agilis, A. stuartii and A. subtropicus; () A. argentus, A. mysticus, A. adustus, A. flavipes, A. leo and A. bellus. The inclusion of A. adustus in lineage was surprising, as it was previously believed a member of lineage . One species, A. stuartii, was not monophyletic and may be more appropriately classified as two species. Timing of cladogenesis was estimated for all species of Antechinus, permitting an evolutionary scenario to be posited for the group.

The mesic zone is the ancestral biome of Australia and, by most measures, the zone of highest taxonomic diversity. However, the south-east region of the

iii

zone has been identified as lacking in mammalian phylogeographic studies. Sequencing of the mitochondrial Cytochrome-b (Cytb) gene was therefore undertaken broadly throughout the geographic range of all species of Antechinus, which collectively occur across the entire zone. High levels of intraspecific phylogeographic structure, largely corresponding to probable Pleistocene biogeographic barriers and comparable to the genetic divergence between named Antechinus subspecies, were revealed in a number of species. For example, the broadly distributed A. flavipes flavipes contained two divergent clades which appear to have been separated by the Great Dividing Range. Within the south-east Australian A. agilis, four phylogeographic clades were identified, each of which appears to have been divided by putative biogeographic barriers. Antechinus mimetes mimetes showed strong divergence between north-east NSW and southern populations. Victorian populations of this species also appear to have been divided by the East Gippsland Basin which may also have divided A. agilis clades and other taxa in the region. Considerable divergence was found between south-east Queensland populations of A. mysticus and the only known population in mid- east Queensland.

The buff-footed antechinus, A. mysticus, was only recently discovered and consequently it is not well understood. It has been suggested that this species utilises a broad range of habitats which over time may result in highly connected populations at a regional scale. This hypothesis was tested using a population genetic approach. Nine microsatellite loci were genotyped for six populations of A. mysticus, sampled from throughout its known range (Eungella in mid-east Qld [ME Qld] and south-east Qld [SE Qld]). Comparative data were sought from four populations of A. subtropicus, which can occur in sympatry across a similar area of SE Qld. Antechinus subtropicus is known to utilise altitudinal vine and rainforest communities which are more fragmented; consequently, it was expected to show greater population differentiation than A. mysticus. Two populations of A. mysticus were revealed to be deeply divergent from most SE Qld populations examined: Eungella (ME

iv

Qld), which is in geographic isolation (>km) from the other A. mysticus populations, and Cooloola (SE Qld). Cooloola is the northernmost known SE Qld population of A. mysticus and shares a mtDNA Cytb haplotype with other SE Qld populations. Yet this population had low microsatellite allelic diversity and appears to be in very low abundance, suggesting divergence is driven by population isolation; it may be at extinction risk. Genetic structure between the other SE Qld populations was also higher than expected, similar to A. subtropicus populations. This suggests A. mysticus is patchily distributed and may be limited to moderate altitude and wetter environments in SE Qld.

The first multi-year ecological study of breeding, growth and movement of A. mysticus was also undertaken. Over a two year period, monthly capture-mark- recapture data from two proximate (~.km apart) sites were collected. At one site, the subtropical antechinus, A. subtropicus, occurred in sympatry. Antechinus mysticus followed the synchronous semelparous (suicidal breeding) breeding strategy seen in all Antechinus. Males were last caught in August at both sites and females appear to give birth in September. Average movement by A. mysticus was comparable to other similar-sized congeners. Antechinus subtropicus occurred at lower density although not lower body mass than proximate conspecifics, at this relatively low altitude study site. Competition from A. subtropicus may affect A. mysticus, as A. mysticus have a higher body mass and males moved further when not in sympatry with A. subtropicus.

Taken together, the present study permitted an investigation of spatio- temporal influences on Antechinus evolution, from the distant Miocene to a very recent inter-generational scale. Genetic diversity was found to be high in Antechinus at all levels investigated which suggests this mesic genus has experienced fragmentation throughout its existence. Several Antechinus species are at risk of extinction. In light of the observed population structuring and purported history of fragmentation, Antechinus must be closely monitored

v

in a future likely to include further habitat degradation, as temperatures and human abundance increases across Australia.

vi

Table of Contents

Keywords ...... ii Abstract ...... iii Table of Contents ...... vii List of Figures ...... ix List of Tables ...... xiii Statement of Original Authorship ...... xvi Acknowledgements ...... xvii Chapter 1: General introduction ...... 1 1.1 Taxonomy and systematics of Antechinus ...... 1 1.2 Biogeography...... 3 1.3 Life history and breeding biology ...... 4 1.4 Movement and home-range ...... 6 1.5 The present study ...... 7 Chapter 2: Molecular systematics and evolution of the genus Antechinus .. 11 2.1 Introduction ...... 12 2.2 Materials and methods ...... 16 2.3 Results ...... 22 2.4 Discussion ...... 31 Chapter 3: Phylogeography of the genus Antechinus ...... 39 3.1 Introduction ...... 40 3.2 Methods ...... 43 3.3 Results ...... 45 3.4 Discussion ...... 58 Chapter 4: Comparative population genetics of two small carnivorous marsupials in the genus Antechinus ...... 66 4.1 Introduction ...... 67 4.2 Methods ...... 71 4.3 Results ...... 77 4.4 Discussion ...... 88 Chapter 5: Life history and ecology of a new species of carnivorous marsupial, the buff-footed antechinus (A. mysticus) and a sympatric congener 97 5.1 Introduction ...... 98

vii

5.2 Methods ...... 102 5.1 Results ...... 106 5.2 Discussion ...... 120 Chapter 6: General discussion ...... 129 References ...... 143

viii

List of Figures

Figure .. BI phylogeny of the concatenated dataset with ML bootstrap values below and BI posterior probabilities above the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. ML bootstrap support of and BI posterior probability values of . are not displayed. L- denote the main lineages of Antechinus...... 24 Figure .. BI phylogeny of the combined nuclear dataset with BI posterior probabilities shown above the node and ML bootstrap values shown below the node. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. ML bootstrap support of and BI posterior probability values of . are not displayed...... 25 Figure .. Geographic distribution of Antechinus. (a) shows distribution of all Antechinus execpt the dusky antechinus and A. minimus lineage, (b) shows the distribution of the dusky antechinus and A. minimus lineage. A number of previously identified biogeographic barriers (see Bryant and Krosch ) are show on on the map...... 26 Figure .. BEAST phylogeny of the concatenated dataset. AS, cladogenesis dates and HPD values for lettered nodes are shown in Table ....... 29 Figure .. BI phylogeny of Cytb dataset with BI posterior probabilities shown above the line and ML bootstrap values shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Bootstrap support of , posterior probability values of . and all node support values for unmarked clades are not shown. For ease of reading node support values for southern A. f. flavipes subclades are also not shown. Tip labels and all support values are given in Fig. .-. L- denote the main Antechinus lineages identified in Chapter Two. See Supplementary Table . for more information on all haplotypes...... 50 Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. swainsonii and A. vandycki; circles, A. minimus; rectangles, A. mimetes. The single haplotype of A. arktos is not shown on the map, see Supplementary Table . for more information on all haplotypes.

ix

Dotted lines delineate biogeographic barriers displayed in Fig. ....... 50 Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. agilis; circles, A. stuartii and A. subtropicus; red stars, sympatric sites of A. stuartii north and south. Dotted lines delineate biogeographic barriers displayed in Fig. .. NA and NA refer to A. subtropicus sites identified in Chapter Two which were not sequenced at Cytb. See Supplementary Table . for more information on all haplotypes...... 53 Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. adustus and A. leo; circles, A. argentus and A. mysticus; rectangles, A. flavipes. Dotted lines delineate biogeographic barriers displayed in Fig. .. The Northern Territory A. bellus and Western Australian A. f. leucogaster are not shown on the map. See Supplementary Table . for more information on all haplotypes...... 55 Figure .. % connection limit parsimony network of A. stuartii south and A. stuartii north samples from the Cytb dataset. Red = New England NP, green = Werrikimbe NP, purple = Gosford, orange = Main Ranges NP, grey = Border Ranges NP. One haplotype (CB) occurred at two sites, this is shown by the larger circle size of this haplotype. Only samples of a haplotype which occur >km apart are considered to be at separate sites. Blue does not represent a geographic location, see Supplementary Table. . for location information of all samples. Unfilled circles represent unsampled hypothetical haplotypes. Dotted lines around haplotypes indicate subclades shown Fig. ....... 57 Figure .. Antechinus mysticus and Antechinus subtropicus populations sampled in the present study. Squares represent A. mysticus sites, circles represent A. subtropicus sites. The star represents a site at which both species were caught...... 72 Figure .. Population differentiation among the six A. mysticus populations sampled, visualised using Principal Coordinate Analysis...... 84

x

Figure 4.3. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci for A. mysticus obtained from sites across the known range of the species. Each plot represents different population assignments for K: (a) K = ; and (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. A graph of the relationship of ∆K to K is shown in panel (c)...... 86 Figure 4.4. Population differentiation among the four A. subtropicus populations sampled, visualised using Principal Coordinate Analysis...... 87 Figure .. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci for A. subtropicus obtained from sites in SE Qld. Each plot represents different population assignments for K: (a) K = ; (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. A graph of the relationship of ∆K to K is shown in panel (c)...... 87 Figure .. Trap success over a two year trapping period for (a) A. mysticus at AW, (b) A. mysticus at DW and (c) A. subtropicus at DW...... 111 Figure .. Minimum number of (a) A. mysticus and (b) A. subtropicus known to be alive (KTBA) at AW and DW. Antechinus subtropicus was only caught at DW...... 114 Figure 5.3. Change in monthly mean weight over the two year trapping period for (a) A. mysticus at AW, (b) A. mysticus at DW and (c) A. subtropicus at DW. Bars show standard error, values without standard error bars represents months in which only one individual was caught. Breaks in the connector lines indicate the change from the first to the second year of the study...... 116 Supplementary material Supplementary Figure .. ML phylogeny of the concatenated dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support …………………….……… Supplementary Figure .. ML phylogeny of the nuclear dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support…………………………….….…… Supplementary Figure .. ML phylogeny of the Cytb dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support. Clades marked with blue lines represent recognised taxonomic units, purple lines mark putative taxonomic units clades revealed in the BI analyse shown in Fig. .………………………………………………………………………….…….

xi

Supplementary Figure .. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci (AaK is excluded) for A. mysticus obtained from sites across the known range of the species. Each plot represents different population assignments for K: (a) K = ; and (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. Pairwise RST estimates of A. mysticus populations for these microsatellite loci are shown (c)………. Supplementary Figure .. Total rainfall in each month from - and mean rainfall per month since . Rainfall was recorded by the Australian Bureau of Meteorology at Samsonvale station ~- km from the field sites ……………………………………………..……………

xii

List of Tables

Table .. Loci analysed for the concatenated and nuclear analyses. Loci sequenced are denoted with an ‘X’, detailed information on the samples is shown in Supplementary Table .. All samples denoted were analysed for the concatenated analyses. Only nuclear (IRBP, BRCA, vWF APOB) and mtDNA (Cytb, S) sequences were used in the respective combined analyses. Sequences for the sample marked with ‘*’ were taken from Genbank. Cytb and IRBP sequences from samples have previously been published in Baker et al. (; ; ; ), see Supplementary Table ....... 17 Table .. List of primers used in this study. All primers were designed from primers used in Krajewski et al. () (Cytb, S, IRBP) and Meredith et al. () (APOB, BRCA, IRBP, vWF)...... 18 Table .. Nucleotide substitution models for BI (MrBayes and BEAST) analysis determined using JMODELTEST version ........ 20 Table 2.5. Results of BEAST analysis and AS reconstruction. Node lettering is shown on Fig. .. For the MP analysis = mesic- closed habitat; small/medium size; high altitude preferencing; = mesic-open habitat; large size; low altitude preferencing...... 30 Table .. Mean net proportion difference (%) between Antechinus species, subspecies and A. stuartii north and south...... 55 Table .. Geographic location of all sites. All sites are named after the National Park in which they occur, except Imbil, which is a State Forest and Crohamhurst, a Conservation Area. Abbreviations: ASL = above sea level; Am = A. mysticus; As = A. subtropicus...... 73 Table .. Primer sequence and references of the nine microsatellites loci genotyped in this study. The primers were divided into two multiplex groupings...... 75 Table .. Table of descriptive statistics and Hardy-Weinberg Equilibrium test for each microsatellite locus at each site for (a) A. mysticus and (b) A. subtropicus. N, number of samples; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; HWE sig., Hardy-Weinberg Equilibrium significant at . level...... 79 Table .. Summary of genetic variation in sampled populations of (a) A. mysticus and (b) A. subtropicus based on eight and nine amplified microsatellite loci, respectively. N, sample size; A, total number of alleles; AR, allelic richness standardised for allele size;

xiii

uA, unique (private) alleles; rA, rare alleles (frequency ≤ %); He, expected heterozygosity; Ho, observed heterozygosity and FIS, inbreeding coefficient. FIS values significantly different (p = <.) are shown in bold. Populations showing a signature of genetic bottleneck are indicated with an asterisk. M-ratio is the Garza-Williamson index following Garza and Williamson ()...... 81

Table .. Pairwise RST estimates of A. mysticus (a) and A. subtropicus (b) populations for and amplified microsatellite loci, respectively. Significantly different pairwise population comparisons (p = <.) are shown in bold...... 83 Table .. Summary of trapping data (number of captures, number of individuals, percentage of individuals recaptured, average number of recaptures and trap success) for Antechinus from both study sites over the two years of the study. No data is displayed for A. subtropicus at AW, as the species was not caught at this site...... 110 Table .. Average distance moved between captures within a month (AvD). The maximum distance moved by an individual over the course of the study (ORL) is also shown for each sex of each species at each site they were caught at...... 119

Supplementary Material

Table .. List of samples previously sequenced for Cytb in Baker et al. (; ; ; ). All listed sequences from Baker et al. (; ; ; ) were analysed in the Cytb analyses presented in Chapter Three. Samples marked with a ‘*’ were also analysed in Chapter Two. For Chapter Two both Cytb and IRBP sequences from Baker et al (; ; ; ) were analysed. An ‘x’ is used to denote which Baker et al. (; ; ; ) studies each sample has previously been analysed in. Detailed information on the samples is shown in Supplementary Table ..….…………………………………………………………………………….… Supplementary Table .. Coding for BI (MrBayes) and MP (Mesquite) ancestral state analysis………………………………………………………….…. Supplementary Table .. List of samples analysed in Fig. . and Fig.. with associated location and collector data. CB numbers refer to BI Cytb haplotypes shown in Fig. .. BM numbers refer to unique haplotypes originally sequenced in Beckman et al. (). Letters following CB and BM are used to denote individual samples. Multiple samples of the same haplotype from the same location where combined and are denoted by multiple entries in the Tissue Code column. Samples marked with ‘*’ were sequenced for the concatenated and combined analysis. NA refers to samples which were not sequenced at Cytb. QM xiv

indicates Queensland Museum, QVM indicates Queen Victoria Museum, SAM indicates South Australia Museum, WAM indicates Western Australia Museum, ANWC indicates the Australian National Wildlife Collection, QPWS indicates the Queensland Parks and Wildlife Service, SF indicates State Forest, NP indicates National Park and PA indicates Protected Area… Supplementary Table .. Pairwise proportion divergence between Cytb haplotypes expressed as a percentage. See Supplementary Table . for haplotype sample information. Haplotypes are ordered as shown in Fig. .………………………………………………………………………. Supplementary Table .. Table of monthly sex ratios at both field sites for A. mysticus. Only those months in which both A. mysticus sexes were caught are show ……………………………………….….………… Supplementary Table ... Table of monthly AvD for A. mysticus at both field sites. Data is combined from both years. Values are given in metres, numbers in brackets show sample size…………….…….…… Supplementary Table .. Number of transient and resident individuals per month for A. mysticus and A. subtropicus at AW and DW. Male A. mysticus captures in have not been analysed due to the short period of trapping in which they were alive. Female A. subtropicus were not included due to their low trap success..

xv

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

Signature: QUT Verified Signature

Date: March 2017

xvi

Acknowledgements

I would firstly like to thank my Principal Supervisor, Dr. Andrew Baker for his remarkable enthusiasm for Antechinus research, which was contagious and sustaining in the many moments mine began to lag, and for his unwavering help, guidance, assistance, friendship and always-open door. My thanks also go to my Associate Supervisor Dr. Susan Fuller who gave me crucial experience in the lab as a young Vacation Research Experience Student and provided level- headed advice during many aspects of this project. Susan was particularly supportive when enthusiasm at times may have outstripped feasibility and in helping me navigate often labyrinthine bureaucratic requirements. I would also like to thank Drs. Litticia Bryant and Matthew Krosch who have consistently provided friendship, advice and help in all aspects of this study – I’m afraid to imagine how my analysis would have turned out without their ever-present help. I would also like to thank Harry Hines and Dr. Ian Gynther for sharing their extensive knowledge and for the many enjoyable field trips we went on, as well as the great number of samples both procured for this project. Thanks must also go to Dr. Steve Van Dyck for guidance and sharing his great knowledge of Antechinus with me in the early stages of this project. I also thank Dr. Matthew Phillips for imparting a measure of his understanding of systematics analysis into this project and Dr. Jennifer Firn for her generous guidance into the strange world of R and generalized linear mixed effects modelling. I thank Dr. Jonathan Cramb for providing much-needed assistance in evaluating the dasyurid fossil record and Dr. Hyungtaek Jung for assistance designing primers. I also thank the other members of the Baker Mammal Ecology Lab: Emma Gray, Gene Mason and Coral Pearce, for their assistance in the field and friendship: it has been fun to be part of the world centre for the study of newly discovered Antechinus.

xvii

This project would not have been possible without the help of a great number of people. My deep thanks go to all those who assisted me in the field, either during the one week a month for two years of my mark-recapture study, the deeply-tiring and ultimately unsuccessful radio-tracking nights, or the many sample collecting trips in Queensland, northern New South Wales and Tasmania. My thanks go to (in alphabetical order): David Benfer, Rob Burton, Kristie De Jong, Isabelle de Haviland, Michael Goode, Emma Gray, Matthew Hemmings, Belinda Locke, Angus McNab, Hannah Maloney, Gene Mason, Kate Moffitt, Nicole Nesvadba, Coral Pearce, Max Rosenthal, Jesse Rowland, Mark Sanders, Eli Walton, Edward White and Jarrah Wills. Special mention must go to Jesse Rowland for his help and great enthusiasm on a number of field trips, to Gene Mason for willingly spending a fairly fruitless, although enjoyable month trapping in Tasmania, and to David Benfer for undertaking a wildly ambitious month of fieldwork to Cairns and back with AB and myself at the beginning of this PhD.

The project was made possible by the many people and organisations who kindly donated tissue samples, included a number who heroically went out of their way to catch Antechinus. My heartfelt thanks go to (in alphabetical order): Kieran Aland, Tina Ball, Dr. Sam Banks, Doug Beckers, Dr. Lilia Bernede, Dr. Terry Bertozzi, Russel Best, Rob Briskie, Dr. Scott Burnett, Gavin Dally, Prof. Chris Dickman, Martin Denny, Dr. Tara Draper, Michael Driessen, Dr. Teresa Eyre, Nik Fuller, Dr. Elise Furlan, Tammy Gordon, Wes Hall, John Hamilton, Ian Hobson, Rod Hobson, Luke Hogan, Dr. Sandy Ingleby, Heather Janetzki, Dr. Christopher Johnstone, Dr. John Kanowski, Stephen King, Dr. Femmie Kraaijeveld-Smit, Prof. Cary Krajewski, Dr. Hania Lada, Prof. William Laurance, Dr. Tyrone Lavery, Dr. Billie Lazenby, Roy Mackay, David Maynard, David Milledge, Prof. Craig Moritz, Dr. Eridani Mulder, Ben Nottidge, Robert Palmer, J. Pope, Dr. Kevin Rowe, Dr. Michael Sale, Dr. Peter Spencer, Dr. Clare Stawski, Claire Stevenson, Prof. Paul Sunnucks, Kevin Taylor, Rowena Thomas, Rosemary Thomson, Dr. Vicki Thomson, Shannon Troy, Claire Wallis, Prof. Mike Westerman, Rebecca Wheatley, Leanne Wheaton, Assoc Prof. John

xviii

White, Stuart Young. I also thank Drs. Mathew Crowther, Mark Eldridge and David Hurwood for diligently reviewing this thesis.

I appreciate the help of the administrative, technical and academic staff of the School of Earth, Environmental and Biological Sciences at QUT who provided assistance in many aspects of this project. Special mention must go to our laboratory manager Vincent Chand for his assistance in the lab and for remarkable good-humour at my impatience for sequence results. Karina Pyle and Amy Carmichael were unfailing in their provision of many essential field work items. My thanks also go Ronnie and Michael from Cedar Creek Falls Retreat and Donny Williams for allowing me to conduct field work on their properties.

I thank the numerous Queensland and New South Wales National Park rangers who assisted me. Special mention goes to Stephen King for providing many samples from the intriguing Border Ranges NP and kindly assisting me when I got food poisoning on his annual field trip. I also thank the Australian Biological Research Study (ABRS) for the Bush Blitz Research Grant which allowed for the many field trips in this project and also for the Student Travel Grants. I thank Jacqui Brock (EHP) and Michael Driessen (Tas DPIPWE) for their friendly help in procuring permits.

My deepest thanks go to my parents, Susan McIntyre and Tom Mutton, for their unwavering love and support throughout my life, without which I surely would not had the fortitude, confidence, or ability to undertake a PhD. I thank the many housemates I have lived with over the course of this work, for their exceptional friendship and tolerance of smelly traps and annoyingly loud boot- stomping during many early mornings and late nights. My deepest appreciation goes to Caitlin Callanan for finding herself in the unenviable position of dating someone whose mind and energy was mostly consumed in writing a thesis - thanks for your love, support, patience and life-sustaining meals.

xix

xx Chapter One

Chapter 1: General introduction

1.1 TAXONOMY AND SYSTEMATICS OF ANTECHINUS

Antechinus is a genus of small, carnivorous marsupials endemic to Australia, where they collectively occur in all states and mainland territories (Van Dyck, Gynther et al. ). The genus lies within the Tribe Phascogalini, Subfamily Dasyurinae and Family Dasyuridae (Krajewski, Wroe et al. , Krajewski, Torunsky et al. ). The Phascogalini consist of three closely related genera: the New Guinean Murexia and the Australian Phascogale and Antechinus (Krajewski, Young et al. , Colgan , Krajewski, Wroe et al. , Krajewski, Torunsky et al. ). Until recently, the taxonomic classification of Murexia has been uncertain, with some species previously classified as Antechinus or as separate genera (Van Dyck , Van Dyck ). However, recent molecular work suggests all New Guinean Phascogalini are of a single genus, Murexia (Krajewski, Moyer et al. , Krajewski, Torunsky et al. , Westerman, Krajewski et al. ). Relationships among the three Phascogalini genera are unclear. Westerman et al. () resolved Murexia and Phascogale as sisters, a result in line with Van Dyck’s () morphological analysis. But other molecular studies have generally resolved Antechinus as sister to Murexia (e.g., Krajewski, Torunsky et al. , Mitchell, Pratt et al. ).

The genus Antechinus was erected when A. stuartii was named by Macleay in (Macleay, ). Since this time, Antechinus has undergone numerous taxonomic revisions. In an influential review of the Dasyuridae, Tate () partitioned Antechinus into three groups (excluding his A. maculatus group, which is now recognised as part of the genus Planigale): A. bellus formed a group of one species distinguished from other Antechinus by its large auditory bullae. Another group consisted of the long-snouted and -clawed A. swainsonii and A. minimus. The final group contained the remaining species: A. flavipes

1

General Introduction

(Tate appears to have conflated A. stuartii with A. flavipes) which consisted of three subspecies: the Western Australian A. f. leucogaster, the broadly distributed south-eastern A. f. flavipes and the north Queensland (Qld) A. flavipes adustus. This group also contained the north Qld A. godmani and the New Guinean ‘Antechinus’, the latter now recognised as genus Murexia. Subsequently, Wakefield and Warneke () resurrected the species A. stuartii, showing it to differ from A. flavipes in cranial and pelage characteristics. They also transferred Tate’s () A. flavipes subspecies adustus to A. stuartii.

In , Van Dyck described the geographically restricted north Qld A. leo, which had previously been confused with A. godmani and A. flavipes. Later, in , Van Dyck undertook a review of Qld A. flavipes and A. stuartii. He named the north Qld form of A. flavipes a distinct subspecies, A. f. rubeculus, a relationship Tate () had suspected but lacked the samples to confirm. Van Dyck () also regarded A. stuartii adustus as a distinct species, although he did not formally raise it and found substantial morphological divergence within A. stuartii in the subtropical rainforests of south-east Qld. In , Van Dyck duly raised these south-east Qld rainforest populations to subspecies (A. stuartii subtropicus) but, noting the overlap in distributions of A. stuartii subtropicus and A. stuartii, suspected the former may warrant full species status. Van Dyck and Crowther () subsequently raised subtropicus and adustus to full species on the basis of marked morphological differences and, in A. adustus, substantial allozyme electrophoretic differences (Baverstock, Archer et al. ). Crowther et al. () later confirmed the decision to raise A. subtropicus to full species, showing morphological, molecular and mating timing differences in sympatric A. subtropicus and A. stuartii from north-east New South Wales (NSW). Over this period, Dickman et al. (; ) also found A. stuartii in Victoria and south-east NSW to contain a morphologically and genetically distinct form, which they named A. agilis.

2 Chapter One

Thus, since Macleay erected the genus Antechinus there has been considerable taxonomic and systematic uncertainty surrounding the number of species it contains. However, by the end of the last decade, considerable molecular and morphological work (e.g., Van Dyck , Krajewski, Wroe et al. , Van Dyck , Crowther, Sumner et al. , Krajewski, Moyer et al. , Krajewski, Torunsky et al. ) appeared to have resolved much of this lower level taxonomic confusion. But this situation has changed in the last four years, as a spate of species discoveries raised the number of species in the genus by %, from to . Five new Antechinus species were named: A. mysticus and A. argentus (which sheltered under A. flavipes) and several species in the dusky antechinus group (formerly A. swainsonii): A. vandycki, A. arktos and A. mimetes, the latter raised from subspecies (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ). These species were named on the basis of combined morphology (craniodental, external and pelt colour), molecular and ecological differences. Molecular support was provided by two-gene analyses which provided clear genetic support for the status of the new species but did not have the power to fully resolve systematic relationships within the group. Furthermore, the systematic position of a number of Antechinus subspecies and potential geographic variants had not been tested by DNA sequencing, leaving exact systematic relationships among Antechinus species unresolved.

1.2 BIOGEOGRAPHY

Australian marsupials form four orders (Dasyuromorphia, Peramelemorphia, Notoryctemorphia and Diprotodontia) which are believed to have diverged around the Cretaceous-Paleogene extinction event (Mitchell, Pratt et al. , Gallus, Janke et al. ). However, dasyurids (Order Dasyuromorphia) are not thought to have arisen until much later; as while the Australian Oligocene- Early Miocene mammalian fossil record is rich, few dasyurids are present and extant dasyurids do not appear until the early Pliocene. This suggests the speciose extant dasyurids (with species) arose after the Early Miocene

3

General Introduction

(Wroe ). This was a time when Australia’s environment was changing from rainforest, which dominated Australia in the early Cenozoic, to grassland and open sclerophyll habitats and, from the Pliocene, arid environments (Martin , Byrne, Yeates et al. ). Most likely, this ongoing aridity drove the massive radiation and diversification which led to the present diverse assemblage of extant dasyurids (Wroe , Crowther and Blacket ). However, given the poor mammalian fossil record of the middle-late Miocene (Wroe , Black, Archer et al. ), it is also feasible that diversification occurred before aridification, which then led to the extinction of many mesic species, resulting in the present-day mostly arid dasyurid assemblage (Cramb, Hocknull et al. ).

1.3 LIFE HISTORY AND BREEDING BIOLOGY

Antechinus are small (adult range: -g), predominately insectivorous marsupials which utilise a range of mesic environments across Australia (Van Dyck, Gynther et al. ). They are largely nocturnal, although daytime activity is common in some species (Van Dyck and Strahan , Sale and Arnould ). Antechinus species vary from ground-dwelling to semi- arboreal and exhibit sexual dimorphism for size, with females on average smaller than males (Van Dyck, Gynther et al. ). Unlike most dasyurids, which are arid-adapted, Antechinus are a mesic genus; all species, except the monsoonal A. bellus, occur in the Australian mesic zone (Van Dyck, Gynther et al. ). Broadly, Antechinus habitat preferences vary from closed rainforest/vine forest (A. adustus, A. godmani, A. leo, A. subtropicus, A. arktos) to those that favour open forest habitats or utilise both closed and open/wet habitats (A. flavipes, A. agilis, A. minimus, A. stuartii, A. bellus, A. swainsonii, A. mysticus, A. argentus, A. mimetes, A. vandycki). Habitat preference appears to vary at a subspecies scale. For example, the northernmost subspecies of A. flavipes (A. f. rubeculus) typically utilises much wetter and closed environments than the more southern A. flavipes subspecies (A. f. flavipes and A. f. leucogaster) (Van Dyck ).

4 Chapter One

Antechinus are one of the few genera of mammals known to undertake semelparous (once in a life-time) ‘suicidal’ mating; consequently, their breeding ecology has been the subject of numerous studies in the last years (e.g., Marlow , Woolley , McAllan, Dickman et al. , Fisher, Dickman et al. ). Antechinus exhibit a short (- weeks), highly synchronised mating period, immediately followed by total male mortality (Woolley , Wood , McAllan, Dickman et al. ). In males, a sharp rise in testosterone occurs approximately .- months before the breeding season (Naylor, Richardson et al. ). This increased testosterone promotes an increase in body mass and thus food consumption. This increases the daily activity of males and ultimately causes a failure of the negative glucocorticoid feedback system, which invariably leads to male death (Bradley , Boonstra , Naylor, Richardson et al. ).

Antechinus breed in the first year of life. Consequently, in the wild, males live for a maximum of ~. months, whereas females can live and reproduce for up to two or, very occasionally, three years (Woolley , Naylor, Richardson et al. ). From year to year, the timing of reproduction within a species differs little at each geographic location but breeding times can vary by up to four months between locations for any given Antechinus species (McAllan and Geiser ). For most species, it appears timing of breeding is linked primarily to different and characteristic rates of change of photoperiod (McAllan, Dickman et al. ). It is thought Antechinus breeding is under selection pressure to coincide young-rearing to times of maximum prey availability (McAllan, Dickman et al. , Fisher, Dickman et al. ). This may also help to explain why no sympatric Antechinus species have been recorded to breed at exactly the same time, as congeneric competition would decrease food availability in this crucial period for generalist (primarily

5

General Introduction invertebrate-eating) carnivores (Crowther and Blacket , McAllan, Dickman et al. ).

1.4 MOVEMENT AND HOME-RANGE

Antechinus occupy small (<ha) home-ranges (Marchesan and Carthew , Sale , Sale and Arnould ). Dispersal of Antechinus is recorded in males during two principal periods: after weaning (~- months), when males disperse to establish a home range, and just prior to and during the mating season (when males range in search of mates) (Smith , Cockburn, Scott et al. , Kraaijeveld-Smit, Lindenmayer et al. , Marchesan and Carthew ). Following the common mammalian pattern, female Antechinus are more philopatric than males, establishing home-ranges near their natal area and generally not travelling far from them (Greenwood , Liberg and von Schantz , Wolff , Marchesan and Carthew ). The time of day at which Antechinus are active varies considerably; while the majority of species are largely nocturnal, some are mainly diurnal (Van Dyck and Strahan ). However, given one species, A. minimus, is diurnal at one location and nocturnal at another, it may be that the timing of activity in Antechinus is partly dependent on environmental factors, such as food availability and prey activity (Sale and Arnould ).

As sympatric Antechinus species utilise similar resources, interspecific competition likely influences their behaviour, reproductive success and evolution. Indeed, evidence of sympatric competition was found by Dickman (a; b). When he removed the larger A. mimetes (then known as A. swainsonii) from sympatry with the smaller A. agilis (then known as A. stuartii), a shift to more diurnal and ground-based activity, an increase in home range size and survivorship of newly weaned A. agilis were recorded (Dickman , Dickman ). Given the majority of Antechinus species are sympatric with a congener in at least part of their range, interspecific

6 Chapter One competition is likely common in Antechinus and has potentially had a substantial effect on evolution and habitat use in the genus.

1.5 THE PRESENT STUDY

This study consists of two complimentary components, each containing two data chapters. The first component, at the deepest spatiotemporal scale, aims to resolve the systematics and phylogeography of the genus Antechinus; the second component, at the finest spatiotemporal scale, aims to improve understanding of the autecology, habitat use and risk of extinction of the recently named and little understood buff-footed antechinus, A. mysticus and a congener, the subtropical antechinus, A. subtropicus, which shares a similar range.

Chapter Two seeks to provide the first comprehensive, multi-gene (> gene) molecular phylogeny of Antechinus which includes all named species and their subspecies. This was undertaken because systematic relationships within the genus Antechinus have not been resolved since the recent naming of five new species between and . The construction of these phylogenies also allowed the cladogenesis dates of all Antechinus species and subspecies to be estimated and, from this, plausible biogeographic causes of speciation to be hypothesised. This chapter was undertaken in conjunction with Chapter Three and the parallel studies which named the recently discovered species.

In Chapter Three, DNA was sequenced from samples obtained after extensive trapping in Australia and sample donations from individuals and institutions, from across the geographic range of all Antechinus. All samples were sequenced for the fast-evolving mitochondrial gene Cytochrome-b (Cytb). This allowed for detailed testing of the monophyly of Antechinus species and subspecies and the identification of cryptic diversity. As well as identifying cryptic species, sequencing broadly permitted the first phylogeographic analysis of the genus Antechinus, testing a primary null hypothesis of panmixia

7

General Introduction for each taxon. Such analyses improved understanding of the evolution of the genus and allowed secondary hypotheses of known mesic phylogeographic barriers affecting Antechinus phylogenetic structure to be tested. Given Antechinus species are distributed across the whole Australian mesic zone, they are also an ideal genus to examine the biogeography of mesic Australia which has been identified as in need of further mammalian studies (Frankham, Handasyde et al. ). The present study fills these recognised knowledge gaps.

The last two data chapters of this study focus on population genetics (Chapter Four) and autecology (Chapter Five) of two Antechinus species: A. mysticus and A. subtropicus.

Given A. mysticus was recently discovery, little was known about the habitat use or population connectivity of the species. To date, no detailed population genetics study of A. mysticus or its congener A. subtropicus has been undertaken. Antechinus mysticus had been found to occur broadly, at presumed moderate densities, in both open and closed forest habitats in south-east Qld. In the past, A. mysticus was taxonomically lumped under A. flavipes, a species which occurs broadly in the area. It was therefore expected A. mysticus would exhibit a high level of connectivity between populations. This hypothesis was tested by undertaking a comparative population genetics study of A. mysticus and A. subtropicus using rapidly-evolving microsatellite DNA. Antechinus subtropicus is known to occur in altitudinal closed vine/rainforest in south-east Qld (Van Dyck ) and thus was expected to show relatively less population connectivity than A. mysticus. Population genetic studies also provide indications of a species’ genetic diversity and if a population has experienced a genetic bottleneck. As such, the results of this chapter also provide valuable baseline genetic information for future conservation and management of A. mysticus and A. subtropicus.

8 Chapter One

When the present study began, A. mysticus had just been discovered, was not well understood and had not been the focus of any ecological studies. Therefore, in Chapter Five, the first multi-year capture-mark-recapture study of A. mysticus was undertaken to provide baseline information on the growth, breeding ecology (including timing) and movement of the species. Like its congeners, it was predicted that A. mysticus would exhibit male-biased movement, have a highly synchronised breeding period followed by complete male die-off, and that males would be significantly larger than females. These hypotheses were all formally tested for A. mysticus. The study was structured to compare two proximate populations: one in which A. mysticus occurs without congeners and one in which it occurs with A. subtropicus. This allowed for the formation of hypotheses about potential congeneric competition between the species. This chapter also provided the first ecological study of an A. subtropicus population which is not occurring at high altitude and in dense closed forest. It was predicted that these factors would cause A. subtropicus to occur at lower abundance and size than previously recorded.

Taken together, the present study provides a deep investigation of the evolutionary biology of Antechinus across the full range of temporal and spatial scales. First, species groups occurring right across Australia dating as far back as the Late Miocene were clearly resolved for the first time (Chapter Two). Then, more recent Plio-Pleistocene divergences and their potential drivers were examined within species across the full scope of their geographic distributions (Chapter Three). At a finer level of geographic detail and at more recent time period, Pleistocene/Holocene divergence between populations of two representative co-occurring species in eastern Australia (Chapter Four) were examined. The research concludes with an examination of these two species over the finest geographic scale – south-east Queensland and a present-day geological scale - a time frame encompassing just two generations (two years).

9

General Introduction

All data chapters are being prepared for submission to international journals, and are presented in this fashion. For ease of reading, all references are displayed at the end of the document in the References section. In the course of conducting the phylogenetic research of Chapter Two and Three, five new Antechinus species were named in parallel with the present work. This resulted in joint authorship of the present author on four published research papers associated with the present thesis, detailed as follows:

Baker, A. M., T. Y. Mutton and H. B. Hines (). "A new dasyurid marsupial from Kroombit Tops, south-east Queensland, Australia: the silver- headed antechinus, Antechinus argentus sp. nov. (Marsupialia: Dasyuridae)." Zootaxa ͳͷʹͶ:-. Baker, A. M., T. Y. Mutton, H. B. Hines and S. Van Dyck (). "The black- tailed antechinus, Antechinus arktos sp. nov.: a new species of carnivorous marsupial from montane regions of the Tweed Volcano caldera, eastern Australia." Zootaxa ͳͷͶ͵:-. Baker, A. M., T. Y. Mutton, E. D. Mason and E. L. Gray (). "A taxonomic assessment of the Australian dusky antechinus complex: a new species, the Tasman Peninsula dusky antechinus (Antechinus vandycki sp. nov.) and an elevation to species of the mainland dusky antechinus (Antechinus swainsonii mimetes (Thomas))." Memoirs of the Queensland Museum–Nature ͵͹:-. Baker, A. M., T. Y. Mutton and S. Van Dyck (). "A new dasyurid marsupial from eastern Queensland, Australia: the buff-footed antechinus, Antechinus mysticus sp. nov. (Marsupialia: Dasyuridae)." Zootaxa ͳ͵ͱ͵:-.

10 Chapter Two

Chapter 2: Molecular systematics and evolution of the genus Antechinus

This data chapter is being prepared for submission to the journal: Zoological Journal of the Linnean Society

Title: Molecular systematics of the Australian carnivorous marsupial genus Antechinus, including proposed evolutionary relationships among five new species

Authors: Thomas Y. Mutton12, Andrew M. Baker1, Matthew J. Phillips1 and

1 Susan J. Fuller (Macleay 1841, Van Dyck 1980, Van Dyck 1982, Dickman, King et al. 1988, Dickman, Parnaby et al.

1998, Meredith, Westerman et al. 2008)

Earth, Environmental and Biological Sciences School, Queensland University of Technology, George St, Brisbane, Queensland , Australia. Corresponding author, Email: [email protected]

Keywords: Dasyuridae, dasyurid, antechinus, mammal, systematics, biogeography, suicidal breeding, semelparous

Author contribution: Conceived and designed the experiments: TM AB SF. Performed the experiments: TM. Analysed the data: TM. Contributed reagents/materials/analysis tools: TM AB MP SF. Wrote the paper: TM.

Abstract: Since , the number of species in the Australian carnivorous marsupial genus, Antechinus has increased by % from to species. The systematic relationship of these species and others in the genus is not well resolved

11

Molecular Systematics because, to date, powerful multi-gene molecular studies have only included eight species of Antechinus. The first comprehensive, molecular systematic analysis of the genus was therefore undertaken, incorporating all known species and subspecies of Antechinus. Two mitochondrial and four autosomal nuclear genes were sequenced. Four lineages of Antechinus were consistently reconstructed: () The dusky antechinus (A. arktos, A. swainsonii, A. vandycki, A. mimetes) and A. minimus; () A. godmani; () A. agilis, A. stuartii and A. subtropicus; () A. argentus, A. mysticus, A. adustus, A. flavipes, A. leo and A. bellus. The inclusion of A. adustus in lineage was surprising, as previous morphology-based studies had suggested it was a member of lineage . Within lineage , A. stuartii was not monophyletic and may more appropriately be classified as two species. Timing of cladogenesis was estimated for all species of Antechinus, permitting us to posit an evolutionary scenario for the group. BEAST analysis dated the divergence of Antechinus from extant congeners to the Late Miocene and cladogenesis of all extant Antechinus to the Plio-Pleistocene. Ancestral State (AS) analysis, which linked state change to phylogenetic branch lengths, failed to resolve the AS of habitat, altitude or size preference, suggesting such traits evolve rapidly in Antechinus. The implications of this result are discussed.

2.1 INTRODUCTION

Relationships within the dasyurids Antechinus is a genus of small, carnivorous marsupials endemic to Australia, where species collectively occur in all states and mainland territories (Van Dyck and Strahan ). Early morphological work, which largely predated modern genetic techniques, recognised Antechinus in New Guinea. However, Archer (, ) believed New Guinean specimens were sufficiently distinct to warrant their own subfamily (Muricinae). Later, Van Dyck () suggested the New Guinean ‘antechinus’ represented five distinct monotypic genera. But DNA hybridisation (Kirsch, Krajewski et al. ), allozyme electrophoresis (Baverstock, Archer et al. ) and DNA sequencing (Krajewski, Painter et al.

12 Chapter Two

, Retief, Krajewski et al. , Krajewski, Buckley et al. , Armstrong, Krajewski et al. , Krajewski, Wroe et al. , Krajewski, Torunsky et al. , Mitchell, Pratt et al. , Westerman, Krajewski et al. ) have consistently placed all New Guinean species in a single genus, Murexia.

Antechinus, Murexia and the arboreal Australian genus Phascogale constitute the tribe Phascogalini, which, along with the tribe Dasyurini, comprise the extant members of the dasyurid subfamily Dasyurinae. Relationships between the three Phascogalini genera are uncertain. Molecular studies have generally resolved Antechinus as sister to Murexia (Krajewski, Torunsky et al. , Mitchell, Pratt et al. ). However, a recent molecular study (Westerman, Krajewski et al. ) resolved Murexia and Phascogale as sister genera, a result in line with Van Dyck’s () morphological analysis.

Fossil evidence suggests dasyuirds arose after the Early Miocene (Wroe ), much later than the extant orders of Australian marsupials appear to have diverged (Mitchell, Pratt et al. , Gallus, Janke et al. ). Although the Australian Oligocene-Early Miocene mammalian fossil record is rich, few dasyurids are present and the now speciose extant dasyurids do not appear until the early Pliocene. Unfortunately, the middle-late Miocene mammalian fossil record is poor in Australia (Wroe , Black, Archer et al. ), leaving understanding of divergence timing in this important period of dasyurid evolution largely reliant on molecular dating (Krajewski, Wroe et al. , Beck , Meredith, Westerman et al. , Mitchell, Pratt et al. , Westerman, Krajewski et al. ).

Molecular dating consistently places cladogenesis of the Phascogalini at the middle-late Miocene (Krajewski, Wroe et al. , Beck , Meredith, Westerman et al. , Mitchell, Pratt et al. , Westerman, Krajewski et al. ). This was purportedly a time when Australia’s environment was changing from rainforest, which spanned across the continent in the early

13

Molecular Systematics

Cenozoic, to grassland and open sclerophyll habitats and, in the Pliocene, arid environments (Martin , Byrne, Yeates et al. ). Ongoing aridity was most likely a major factor driving the massive radiation and diversification of the group leading to today’s speciose dasyurid fauna (Wroe , Crowther and Blacket )

Taxonomic and systematic history of Antechinus Taxonomic classification in the genus Antechinus was repeatedly revised during the th century (Tate , Wakefield and Warneke , Van Dyck , Van Dyck , Dickman, King et al. , Van Dyck , Dickman, Parnaby et al. , Van Dyck and Crowther ). Following Van Dyck and Crowther’s () nomination of A. subtropicus, ten Antechinus species were recognised, but some researchers believed cryptic species remained within A. flavipes (S. Van Dyck, pers. comm.).

Mutton () evaluated A. flavipes systematics, revealing a clade of A. flavipes in eastern Qld that likely consitituted a separate species. Baker et al. () consequently named the taxon A. mysticus, noting its craniodental, pelage and DNA differences from A. flavipes. Efforts to find A. mysticus elsewhere in eastern Qld revealed another new species, A. argentus, at Kroombit Tops National Park. Detailed morphological and limited molecular data suggested this new species was sister to A. mysticus (Baker, Mutton et al. ). Ongoing examination of A. swainsonii then revealed a species complex that was subsequently revised in two papers (Baker et al. , Baker et al. ). On the basis of morphological and DNA evidence, the outlying northernmost population of A. swainsonii was identified as a distinct species, A. arktos, and the mainland subspecies of A. swainsonii (A. s. mimetes) was raised to full species status. Baker et al. () also reported a new species in Tasmania: the Tasman Peninsula dusky antechinus, A. vandycki. This recent work thus represents a % increase in known species diversity within the genus Antechinus since , rising from to species.

14 Chapter Two

The resolution of cryptic and unknown species described above was surprising since the systematic relationships between Antechinus species prior to had appeared fairly well resolved. Krajewski et al. () had built upon previous work (Krajewski, Painter et al. , Retief, Krajewski et al. , Krajewski, Buckley et al. , Krajewski, Young et al. , Armstrong, Krajewski et al. , Krajewski, Wroe et al. ), presenting a molecular phylogeny of three mitochondrial and four nuclear genes which included eight of the ten Antechinus species named at the time. Their combined analysis of these genes resolved A. swainsonii and A. minimus as a sister pair to the other Antechinus. Within the remainder, A. godmani was resolved as sister to the other species, which in turn formed two clades: one comprised of A. agilis and A. stuartii and the other comprising A. leo and A. bellus as sister to A. flavipes. Westerman et al. () in a recent phylogenetic study of Dasyuromorphia, built upon Krajewski et al.’s () dataset by sequencing additional genes for the same species and returned a similar phylogeny for Antechinus. The results of these two studies were also concordant with Baverstock et al.’s () allozyme electrophoresis study which surveyed the same species, except A. agilis, and returned a similar phylogeny, only differing in failing to resolve the relationship between the main clades of Antechinus (A. swainsonii/A. minimus; A. godmani; A. stuartii sister to A. leo/A. bellus and A. flavipes).

Although not included in the aforementioned studies, the sister relationship between A. subtropicus and A. stuartii was not in doubt (Van Dyck and Crowther , Crowther, Sumner et al. ). On the basis of morphological analysis (Wakefield and Warneke , Van Dyck and Crowther , Van Dyck ) and allozyme electrophoresis (Baverstock, Archer et al. , Dickman, Parnaby et al. ) A. adustus had long been believed a member of the A. stuartii group. Mutton () sequenced A. adustus and the other nine Antechinus species named at the time with the mitochondrial gene cytochrome-b (Cytb) and the nuclear interphotoreceptor retinoid-binding protein (IRBP). While his analysis supported the species status of A. adustus

15

Molecular Systematics he was not able to fully resolve the species’ systematic position. Surprisingly, it was situated within a polytomic clade containing A. flavipes/A. mysticus/A. leo/A bellus, rather than the expected A. stuartii group. Mutton’s () analysis was expanded slightly to provide genetic support for the recent naming of five Antechinus species (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ); however, it did not have sufficient geographic coverage or genetic loci to fully resolve the relative systematic positioning of these species or A. adustus.

The present research therefore aimed to resolve these knowledge gaps by, for the first time, sequencing all Antechinus species and their subspecies with a comprehensive multi-gene dataset of two mitochondrial and four nuclear genes. This study was aided by exhaustive exploratory sequencing of Antechinus from over geographic locations around Australia with the mitochondrial gene Cytochrome-b, the details of which are presented in Chapter Three. This mitochondrial sequencing allowed particularly divergent samples to be identified and included in the present multi-gene analysis giving us more power to resolve within- and between-species variation.

2.2 MATERIALS AND METHODS

Sampling

In total, tissue samples were obtained through field collection and donations from individuals, organisations and Australian museums. Tissue samples collected in the field were ear-clipped and stored in % ethanol; donated specimens were either ear or liver samples. All specimen locality and identification information is listed in Supplementary Table .. DNA sequences for one species, A. bellus, were obtained from Genbank. Cytb and IRBP sequenced for samples have previously been analysed in Baker et al. (; ; ; ) (see Supplementary Table . for further details). The analyses presented in this study included all known Antechinus species and

16 Chapter Two their subspecies. One Phascogale and two Murexia were also included as outgroups and for better calibration of the molecular dating analysis.

DNA Extraction and sequencing

DNA was extracted from all samples using the ISOLATE II Genomic DNA Kit (Bioline) following the manufacturers protocol. Two mitochondrial genes: Cytb and S rRNA (S) and four autosomal nuclear genes: IRBP, von Willebrand factor (vWF), apolipoprotein B exon (APOB) and breast cancer , early onset (BRCA) were amplified. See Table . for a list of samples sequenced for each locus.

New primers were designed for all genes based on conserved regions identified in Krajewski et al.’s () dataset for Cytb, S and IRBP and from Meredith et al.’s () dataset for vWF, APOB and BRCA. Primer sequences are shown in Table .. Aligned sequence lengths were bp for Cytb, bp for S, bp for IRBP, bp for vWF, bp for APOB and bp (two non- overlapping fragments separated by a bp gap) for BRCA, for a total of bp. PCR reactions for all genes except S contained: . µl of each primer (pmol/µl.), µl genomic DNA, µl of x polymerase buffer (Roche,

Mannheim, Germany), either mM MgCl (Cytb, BRCA, vWF, APOB) or mM

MgCl (IRBP), . µL of U/mL Taq polymerase and were adjusted to a final volume of µL with autoclaved dHO. The PCR cycle protocol for these genes was: °C for minutes; cycles of °C for s, either °C (BRCA, vWF, APOB), °C (Cytb), or °C (IRBP) for seconds, and °C for seconds; with a final extension at °C for minutes.

Table .. Loci analysed for the concatenated and nuclear analyses. Loci sequenced are denoted with an ‘X’, detailed information on the samples is shown in Supplementary Table .. All samples denoted were analysed for the concatenated analyses. Only nuclear (IRBP, BRCA, vWF APOB) and mtDNA (Cytb, S) sequences were used in the respective combined analyses. Sequences for the sample marked with ‘*’ were taken from Genbank. Cytb and

17

Molecular Systematics

IRBP sequences from samples have previously been published in Baker et al. (; ; ; ), see Supplementary Table ..

Cyt BRCA BRCA APO Samples ͱͶS IRBP vWF b loci ͱ loci Ͳ B A. argentus CB X X X X X X X A. mysticus ME Qld X X X X X X X CB A. mysticus SE Qld X X X X X X X CBb A. f. leucogaster X X X X X X X CB A. f. rubeculus CB X X X X X X X A. f. flavipes Vic X X X X X X X CBa A. f. flavipes SA X X X X X X X CB A. f. flavipes SE Qld X X X X X X X CBa A. bellus CB* X X X A. leo CBa X X X X X X A. adustus CB X X X X X X X A. agilis CBa X X X X X X X A. stuartii south X X X X X X CB A. subtropicus NA X X X X X X A. stuartii north X X X X X X CB A. godmani CBa X X X X X X X A. arktos CBa X X X X X X X A. swainsonii CB X X X X A. vandycki CBa X X X X X X X A. minimus X X X X maritimus CB A. m. minimus X X X X X X CB A. m. mimetes X X X X X X CBa A. m. insulanus X X X X X X X CB M. melanurus X X X X X CB M. habbema CB X X X X X P. calura CB X X X X X X Table .. List of primers used in this study. All primers were designed from primers used in Krajewski et al. () (Cytb, S, IRBP) and Meredith et al. () (APOB, BRCA, IRBP, vWF).

18 Chapter Two

Gene Primer Name Sequence (͵'-ͳ') BRCA loci MBF-MAC- TMF CCAGAGGAAATCCTCAGAATTG MBF-MAC-- TMR CCTTATCTCTTCACTGCTGGG BRCA loci MBF-MAC- CCCAGCAGTGAAGAGATAAGG MBF-MAC-- TMR AAAGCCTGGAGACTTCTCTGGT VwF M.fulgMF-TMF GAGGCTGAGTTTGGGGTGCTG MR-TMR TTGATCTCATCWGTRGCAGGATTGC APOB MARS-F-TMF CCCGAAATGACTCTGCCTTA MARS-R-TMR TACTGCAGAGCGTCGATGA Cytb CybtF-TM TCCAAATYCTAACAGGMTTMTTTCT CytbR-TM GATCGGAGMATWGCRTARGCAATA IRBP IRBPF-TM CCCTTTGTCATTTCCTACCTCCACC IRBPR-TM AAGCGCAGCTAGCCCACGTTGCCCG

S PCR reactions contained . µl of each primer (pmol/µl.), µl genomic DNA, . µl of OneTaq (New England BioLabs) and were adjusted to a final volume of µL with autoclaved dHO. The PCR cycle protocol for S involved: °C for minute; cycles of °C for s; °C for seconds, and °C for minute; with a final extension at °C for minutes.

Amplified PCR products were purified using an ISOLATE PCR and Gel Kit® (Bioline), following the manufacturer’s instructions. Direct sequencing of purified PCR products was performed using ABI Big Dye® Terminator . on an ABI Capillary Electrophoresis Genetic Analyser at the QUT Molecular Genetics Research Facility (Brisbane, Australia). Sequences were aligned by eye using BioEdit version ... (Hall ), indels were coded as ‘-‘.

Model Selection and Phylogenetic analyses

Phylogenies were estimated using maximum likelihood (ML) and Bayesian inference (BI) methods for the combined nuclear dataset, the combined mitochondrial (mtDNA) dataset and the concatenated mtDNA and nDNA

19

Molecular Systematics dataset (concatenated dataset). These datasets were partitioned using functional partitioning of codon position; partitions are shown in Table ..

Maximum likelihood phylogenies (, bootstraps) were estimated in RAxML version .. (Stamatakis ), using the GTR+G model of evolution for each partition. Bayesian inference phylogenies were estimated in MrBayes version .. (Ronquist and Huelsenbeck ). Models of DNA substitution were determined for each partition using JMODELTEST version .. (Darriba, Taboada et al. ) (see Table .). Two simultaneous runs of four chains (two hot and two cold) were performed for million generations for all datasets, with sampling every , generations. All phylogenetic analyses were undertaken on the CIPRES Science Gateway (Miller, Pfeiffer et al. ). A proportion distance matrix of the Cytb dataset was calculated in MEGA (Tamura, Stecher et al. ). Each proportion distances value was expressed as a percentage (p-distance).

Table .. Nucleotide substitution models for BI (MrBayes and BEAST) analysis determined using JMODELTEST version ...

Partition Model Cytb st and nd codon position K+I+G Cytb rd codon position K+I+G S loop GTR+I+G S stem GTR+I All nuclear genes st codon position HKY+G All nuclear genes nd codon position K All nuclear genes rd codon position K

Molecular dating

BEAST version .. (Drummond, Ho et al. , Drummond and Rambaut ) was used to estimate divergence timing. The concatenated dataset was analysed with the data partitions and models of nucleotide substitution used for MrBayes. A relaxed lognormal clock using the uncorrelated lognormal prior was employed; four independent runs of million generations were

20 Chapter Two performed with a burnin of % and sampling ever , generations. As previously described, the Australian Miocene fossil record is poor, a molecular constraint modified from Mitchel et al. () was therefore used to root of the tree (Phascogalini). A normal distribution was selected with a % highest density probability interval (HDP) of .-. million years ago (Ma). The most recent common ancestor of Antechinus was calibrated using a uniform distribution with a minimum value of Ma representing the oldest suggested date of the Antechinus sp. found at the Big Sink Deposit (Dawson, Muirhead et al. ) and an upper age set to . Ma representing the absence of Antechinus in the marsupial rich AL deposit in the Riversleigh World Heritage Area (Woodhead, Hand et al. ). Effective sample size (ESS) values were inspected in Tracer version . (Rambaut and Drummond ) to check the adequacy of chain mixing and convergence.

Ancestral Reconstruction

BI and Maximum Parsimony (MP) ancestral state (AS) reconstruction was performed on the final concatenated dataset. Three attributes were reconstructed: size, habitat and altitude. Size was split into two groups based on average male size: small/medium (-g) and large (-g); habitat was split into mesic-closed, mesic-open or both (coded as polymorphic); altitude was split into two groups: high preferencing (generally occurs at highest density at >m) or low preferencing (generally occurs at highest density at <m). Antechinus size and habitat preference attributes were based on Van Dyck et al. () and Flannery (), except for the four recently named species. Data for these species was taken from their species descriptions, which included a summary of known ecology at the time of publication (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ). Altitude information was compiled from a variety of sources (see Supplementary Table . for trait coding and altitude sources).

21

Molecular Systematics

BI AS analysis was carried out in MrBayes following the protocol previously described, except the topology of the tree was constrained to the final phylogeny of the concatenated BI analysis, and an additional partition for ancestral state was added. Analyses were undertaken in two ways: with the rate of evolution of AS linked or unlinked to the rate of DNA evolution. The relative merits of each approach are considered in the Discussion. MP analysis, performed in Mesquite version . (Maddison and Maddison ) was reported. This analysis does not link rate of trait evolution to DNA evolution and was also limited to the topology of the final concatenated BI analysis.

2.3 RESULTS

In total, samples encompassing all Antechinus species and their subspecies were sequenced. samples were sequenced for all genes; the number of samples sequenced per gene ranged from (APOB) to (Cytb) (see Table .). Seven small (<bp) indels were identified in S. Ratios of transitions to transversions were low for all fragments, ranging from :. for S to :. for BRCA locus .

Four main lineages were consistently reconstructed in the concatenated analyses (Fig. .): () The dusky antechinus (A. arktos, A. swainsonii, A. vandycki, A. mimetes) and A. minimus; () A. godmani; () A. agilis, A. stuartii and A. subtropicus; () A. argentus, A. mysticus, A. adustus, A. flavipes, A. leo and A. bellus. The BI and ML concatenated phylogenies (see Supplementary Figure . for ML phylogeny) resolved the same relationship between these four lineages: lineage was sister to the other lineages and lineage and were sister to lineage . Antechinus and Murexia were strongly supported as reciprocally monophyletic in both concatenated phylogenies and the two Murexia species were deeply divergent. All species were resolved as monophyletic in the concatenated phylogenies except A. stuartii, which was not monophyletic in either phylogeny. Rather, northern A. stuartii (A. stuartii

22 Chapter Two north) was moderately (ML) to strongly (BI) resolved as sister taxon to A. subtropicus, with southern A. stuartii (A. stuartii south) strongly resolved as sister to these taxa in both the BI and ML concatenated analyses. The ML and BI phylogenies resolve the same relationship between all species and subspecies of Antechinus, except the ML phylogeny generally had lower support values and failed to resolve the position of A. arktos and A. adustus within lineages and , respectively (Fig. .).

The combined nuclear phylogenies (Fig. .) reconstructed lineage and but resolved A. adustus, A. argentus and A. mysticus as members of lineage . The BI nuclear phylogeny strongly resolved Murexia and Antechinus as sister genera; however, the two Murexia species were weakly resolved as sisters to the dusky antechinus and A. minimus lineage in the ML nuclear phylogeny (Supplementary Figure .). Antechinus stuartii was not monophyletic in either BI or ML nuclear phylogeny, but rather, as in the concatenated phylogenies, A. subtropicus and A. stuartii north formed a monophyletic clade with weak (ML) to strong (BI) support. Antechinus flavipes was not monophyletic in the BI and ML nuclear phylogenies. Rather, A. f. flavipes and A. f. rubeculus formed a weakly supported clade in both phylogenies which was in a moderately supported polytomic clade with A. f. leucogaster and A. bellus. The four main lineages reconstructed in the concatenated analyses where also resolved in the combined mtDNA analyses (Supplementary Figure .) except for lineage which was resolved in a polytomic clade with lineage and lineage + in the ML analysis.

Within the four main lineages of Antechinus identified above, geographically proximate species were generally most closely related (see Fig. . for geographic distribution of Antechinus). For example, the mid-east Queensland (ME Qld) A. argentus was consistently sister to the ME Qld and south-east Queensland (SE Qld) A. mysticus. Antechinus adustus is geographically

23

Molecular Systematics situated between A. mysticus and A. argentus in the south and the more northern A. leo and A. bellus. In the BI concatenated phylogeny, A. adustus claded with the sister taxa A. argentus and A. mysticus and the north

Figure .. BI phylogeny of the concatenated dataset with ML bootstrap values below and BI posterior probabilities above the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. ML bootstrap support of and BI posterior probability values of . are not displayed. L- denote the main lineages of Antechinus.

Queensland A. leo and Northern Territory A. bellus were resolved as sister species. In the ML concatenated phylogeny, A. adustus was in a polytomic clade with: A. argentus and A. mysticus; A. flavipes and A. leo; and A. bellus. Although the geographically proximate Tasmanian A. swainsonii and A. vandycki were consistently resolved as sister species in all phylogenies, the

24 Chapter Two remaining relationships within the dusky antechinus and A. minimus lineage were less clear, showing similar, relatively deep levels of divergence between species for Cytb (Table .). With moderate (ML) and strong (BI) clade

Figure .. BI phylogeny of the combined nuclear dataset with BI posterior probabilities shown above the node and ML bootstrap values shown below the node. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. ML bootstrap support of and BI posterior probability values of . are not displayed. support, the sister species A. swainsonii and A. vandycki were resolved as the sister group to A. mimetes in the concatenated phylogenies (Fig. .).

25

Molecular Systematics

Antechinus arktos was strongly resolved as sister to the other species of lineage in the BI, but not the ML analyses (Fig. ., Supplementary Figure .).

a A. bellus A. leo A. flavipes rubeculus and A. adustus N A. godmani NT A. mysticus Eungella NP A. argentus QldQ WA W A. subtropicus A. flavipes Brisbane SA & A. mysticus Sflavipes Valley Barrier NSW A. stuartii V A. flavipes VVic A. agilis (red leucogaster AUSTRGippsland Basin Bass Strait line, marble 200km 500 pattern) Tas

inset b

1inset : 4 6 1 9L9

Figure .. Geographic distribution of Antechinus. (a) shows distribution of all Antechinus execpt the dusky antechinus and A. minimus lineage, (b) shows the distribution of the dusky antechinus and A. minimus lineage. A number of previously identified biogeographic barriers (see Bryant and Krosch ) are show on on the map.

26 Chapter Two

Most Antechinus species were deeply divergent. The proportion distance at Cytb (p-distance) between recognised Antechinus species ranged from .- .% (see Table .). The p-distance between A. stuartii north and A. stuartii south was .%. Antechinus godmani, the only species of lineage , was particularly divergent from all other Antechinus species (.-.% p- distance).

Molecular Dating

BEAST analysis (Fig. ., Table .) placed the divergence of Antechinus and Murexia and the MRCA of all Antechinus to the late Miocene, . million years ago (Ma) (HDP .-.) and . Ma (HDP .-.), respectively. The MRCA of all Antechinus represents when the putative ancestors of the dusky antechinus complex and A. minimus diverged from the ancestors of other Antechinus lineages. The three other main lineages evidently diverged from each other in the Pliocene, with the monotypic lineage containing A. godmani separating first, in the early Pliocene (. Ma; HDP .-.). Three Antechinus species were estimated to have diverged from congeners in the Pliocene (A. godmani, A. agilis and A. arktos). The remaining species were estimated to have diverged in the Pleistocene, the youngest of which was A. subtropicus and the northern A. stuartii ( Ma HDP .-.).

27

Molecular Systematics

Table .. Pairwise proportion distance between Cytb haplotypes expressed as a percentage. See Supplementary Table . for haplotype sample information

ͻ. A. argentus ͼ. A. mysticus Eungella . ͽ. A. mysticus SE Qld . . ;. A. adustus . . . Ϳ. A. flavipes leucogaster . . . . ΀. A. flavipes rubeculus . . . . . ΁. A. flavipes flavipes Vic . . . . . . ΂.A. flavipes flavipes SA . . . . . . . ΃. A. flavipes flavipes SE Qld . . . . . . . . ͻͺ. A. leo . . . . . . . . . ͻͻ. A. bellus . . . . . . . . . . ͻͼ. A. agilis . . . . . . . . . . . ͻͽ. A. stuartii south . . . . . . . . . . . . ͻ;. A. stuartii north . . . . . . . . . . . . . ͻͿ. A. godmani . . . . . . . . . . . . . . ͻ΀. A. arktos . . . . . . . . . . . . . . . ͻ΁. A. swainsonii . . . . . . . . . . . . . . . . ͻ΂. A. vandycki . . . . . . . . . . . . . . . . . ͻ΃. A. minimus maritimus . . . . . . . . . . . . . . . . . . ͼͺ. A. minimus minimus . . . . . . . . . . . . . . . . . . . ͼͻ. A. mimetes mimetes . . . . . . . . . . . . . . . . . . . . ΀΀. A. mimetes . . . . . . . . . . . . . . . . . . . . . insulanus ΀΁. M. melanurus . . . . . . . . . . . . . . . . . . . . . . ΀΂. P. calura . . . . . . . . . . . . . . . . . . . . . . .

28 Chapter Two

Figure .. BEAST phylogeny of the concatenated dataset. AS, cladogenesis dates and HPD values for lettered nodes are shown in Table ..

Ancestral State Reconstruction Methods of AS reconstruction, which directly link the rate of trait evolution to the rate of DNA evolution of the concatenated dataset, did not clearly resolve the AS of the main Antechinus lineages.

29

Molecular Systematics

Table 2.5. Results of BEAST analysis and AS reconstruction. Node lettering is shown on Fig. .. For the MP analysis = mesic-closed habitat; small/medium size; high altitude preferencing; = mesic-open habitat; large size; low altitude preferencing.

BEAST Ancestral State Bayesian Inference (probability) Maximum Parsimony Node Medium date SD HDP Altitude Habitat Size Altitude Habitat Size (Mya) High Low Mesic closed Mesic Open small/medium Large A . . .-. ------ B . . .-. . . . . , C . . .-. . . . . , D . . .-. . . E . . .-. . . F . . .-. . . G . . .-. . . H . . .-. . . . . , , I . . .-. . . . . , , J . . .-. . . . . , , K . . .-. . . , L . . .-. . . , M . . .-. . . . . , , N . . .-. O . . .-. . . P . . .-. . . Q . .-. . . R . . .-. . . S . . .-. . . , T . . .-. . , U . . .-. . . , V . . .-. . . , W . . .-. X . . .-. Root . . .-. ------, ,

30 Chapter Two

The MP and BI analyses which both did not consider the rate of DNA change (i.e. the branch lengths of the phylogeny) reconstructed closed-mesic habitat and high altitude as the ancestral states of Antechinus and the MRCA of the four main lineages of Antechinus (see Table .). Size was less clearly reconstructed. Small to medium size was moderately (%) supported as the ancestral state of Antechinus. This size was also moderately to strongly supported as the MRCA of all main lineages of Antechinus in the BI analysis, except the lineage containing the dusky antechinus species and A. minimus, which was strongly resolved as large in both analyses (Table .). MP analysis did not resolve the size of the genus Antechinus.

2.4 DISCUSSION

In sampling all recognised Antechinus species and their subspecies for a multi-gene dataset, the present study represents the most comprehensive phylogenetic analysis of the genus to date. Moreover, as a consequence of sequencing more broadly (see also Chapter Three) than previous studies, a possible species complex was revealed in A. stuartii and the relative systematic positions of A. adustus and A. flavipes were clarified. Most species clades and inter-species relationships were well-resolved in the phylogenies. Timing of cladogenesis was estimated for all Antechinus for the first time, permitting us to posit an evolutionary scenario for the group. These aspects are discussed in turn below.

Systematics Four distinct lineages of Antechinus were consistently revealed in the concatenated analyses (see Fig. .). The structure of the four main lineages are broadly supported by earlier genetic (Baverstock, Archer et al. , Krajewski, Torunsky et al. ) and morphological (Van Dyck ) studies, although the arrangement of all known Antechinus within each lineage is now more

31

Molecular Systematics clearly resolved. Of interest is the position of A. adustus, which was long regarded as a member of lineage (with A. stuartii) on the basis of both morphology (Van Dyck and Crowther , Van Dyck ) and allozyme electrophoresis (Wakefield and Warneke , Baverstock, Archer et al. , Dickman, Parnaby et al. ). However, in the present study, A. adustus was consistently resolved as a member of lineage , containing: A. bellus, A. leo, A. flavipes, A. mysticus and A. argentus. Geographically, this result is intuitive, as A. adustus (limited to the wet tropics of north-east Qld) is located closer to four of the other species of lineage (mid-east and north Australia) than it is to any of the species of lineage (south-east Australia). The phylogenetic position of A. adustus in lineage therefore apparently reflects its shared evolutionary history with other north-eastern Antechinus.

Relative positions of all recently named species were not consistently supported in the concatenated analyses (Fig. .), although the east Qld A. mysticus and A. argentus were always resolved as sister species, as were the Tasmanian A. vandycki and A. swainsonii. Interestingly, A. flavipes was moderately well-resolved in both concatenated analyses as sister to the pairing of A. leo and A. bellus. This result contradicts previous preliminary molecular studies based on mtDNA (Baker, Mutton et al. , Baker, Mutton et al. ) which suggested A. flavipes was sister to A. mysticus and A. argentus. These mixed genetic signals are consistent with the species skull morphology. As while dentition of A. leo shows a close affinity to A. flavipes rubeculus (Wakefield and Warneke , Van Dyck , Baker and Van Dyck ), A. flavipes flavipes shows some craniodental similarities to A. mysticus (Baker, Mutton et al. , Baker and Van Dyck ).

Present phylogenies provided strong monophyletic support for of the currently recognised species clades within Antechinus. However, A. stuartii was not resolved as monophyletic, suggesting it may represent a species complex. The relative geographic distribution of the two A. stuartii clades identified here is examined in more detail in Chapter Three. If further

32 Chapter Two assessment of A. stuartii north and south populations reveals non-overlapping mating times in sympatry, as well as morphological differences, the balance of evidence would favour a reclassification as separate species. Similar criteria has been used to separate A. subtropicus from A. stuartii (Van Dyck and Crowther , Crowther, Sumner et al. ).

Formally testing the position of Murexia in the Phascogalini was not the aim of the present study. However, it is noted that this study follows Mitchell et al. () in resolving Antechinus and Murexia as sister genera in the concatenated analyses.

Molecular Dating and Biogeography

In this study, Antechinus was estimated to have diverged from the New Guinean Murexia in the Late Miocene, approximately million years after the majority of modern New Guinea formed (van Ufford and Cloos ). This is consistent with previous estimations (Aplin, Baverstock et al. , Mitchell, Pratt et al. ) and similar to estimated divergence times of other New Guinean and Australian marsupials (Macqueen, Seddon et al. , Mitchell, Pratt et al. ). Phascogale, the Australian sister genus to Antechinus, was estimated to have diverged from other Phascogalini at the beginning of the Late Miocene, perhaps moving into more open sclerophyll environments which reportedly became widespread in this period (Martin , White ).

The four main lineages of Antechinus identified in the present study were estimated to have diverged in the late Miocene–Pliocene (Table ., Fig. .). The ancestral state (AS) of Antechinus and these lineages was estimated as closed mesic habitat, which concurs with previous estimations (Mitchell, Pratt et al. ). This result is intuitive as the two oldest Antechinus lineages, the

33

Molecular Systematics dusky antechinus group (with A. minimus) and A. godmani, today occur entirely on the comparatively ancient mesic east coast of Australia (Byrne, Steane et al. ). As the continent dried from the warmer, wet Middle Miocene, these two lineages may have become isolated by the dry Burdekin and/or St Lawrence Gaps. Such a scenario has been postulated for the yellow- bellied glider Petaurus australis (Brown, Cooksley et al. ) and other mesic fauna, including reptiles (Moussalli, Hugall et al. ), birds (Joseph, Moritz et al. , Nicholls and Austin ) and invertebrates (Rix and Harvey ). These barriers also appear to have divided the two east coast subspecies of A. flavipes, albeit at a much later date. High altitude was also reconstructed as the AS of Antechinus, likely indicating that Antechinus retracted to higher, wetter habitats as Australia dried, rather than necessarily suggesting Antechinus arose at high altitude.

Speciation of extant Antechinus therefore appears to have been driven by the progressive continental drying during the Late Pliocene and Pleistocene, which evidently changed much of Australia from mesic to arid environments (Byrne, Yeates et al. ). This change may have isolated closed forest mesic species and possibly allowed species which evolved to utilise drier, open-mesic environments to disperse far across the continent. Increased aridity in the Pleistocene may have then isolated Antechinus populations in some areas such as the mesic south-west WA (A. f. leucogaster) and the monsoonal Top End (A. bellus), where they remain today.

Well-known dry biogeographic barriers appear to have been a major driver of Antechinus speciation on the east coast of Australia (see Fig. .). Within lineage , A. adustus and later A. f. rubeculus appear restricted between the Burdekin Gap in the south and the Laura Basin in the north. Antechinus leo also appears to have been restricted to north of the Laura Basin. It is perhaps unsurprising that A. flavipes, which utilises a broader and drier array of

34 Chapter Two habitats than its congeners (Van Dyck and Strahan , Baker and Van Dyck ), was apparently connected across these barriers more recently than A. adustus.

The sister pair A. mysticus and A. argentus were only recently discovered ( and , respectively), so their actual range is likely to be greater than is currently known (Baker, Mutton et al. , Baker, Mutton et al. ). However, at present, A. argentus is only known from small remnants of high altitude wet open forest on the mountain ranges of Kroombit Tops and Blackdown Tableland National Parks in central-east Qld (Baker, Mutton et al. , Mason, Burwell et al. ). The mountain ranges of these National Parks appear to have acted as temperate refugia in subtropical central Qld, in which a diverse array of vertebrates appear endemic or show substantial genetic subdivision (see Hines ). As the surrounding areas dried during the Plio- Pleistocene, the retreat of what is now A. argentus to these areas may have driven its speciation from A. mysticus. Interestingly, A. mysticus occurs both north (Eungella, near Mackay) and south (south-east Qld) of A. argentus, perhaps indicating an ability in A. mysticus to range more freely across a broader assortment of historical habitats. This hypothesis is supported by the low Cytb genetic divergence identified within A. mysticus from SE Qld (.%).

Antechinus agilis appear to have separated from A. subtropicus and A. stuartii in the Late Pliocene, far earlier than divergence estimates suggest for most other Antechinus (Fig. .).The geographic ranges of A. agilis and A. stuartii overlap substantially in coastal south-east NSW (Fig .). With the exception of the broadly distributed A. flavipes, such an extensive overlap between closely related species is absent in Antechinus. This range overlap obscures clear biogeographical explanations of speciation in A. agilis. However, it is possible that this range overlap between A. agilis and A. stuartii may have been

35

Molecular Systematics driven by the early divergence of A. agilis from ancestors of the A. stuartii complex providing more time for subsequent dispersal. As previously suggested by Crowther et al. (), the McPherson-Macleay Overlap zone in northeast NSW and southeast Qld may have driven the subsequent divergence of A. subtropicus and A. stuartii.

Building on the results of Baker et al. (), this study also found that the dusky antechinus group was not monophyletic and instead provides evidence for four deeply divergent and allopatric species, some of which are more genetically different to each other than they are to the swamp antechinus, A. minimus. Speciation within the dusky antechinus complex and A. minimus lineage may have been driven by the drying out and vegetation shifts of the Plio-Pleistocene (Martin , Byrne, Yeates et al. ). This may have first led to retraction of the most northern species of the lineage, A. arktos, to the subtropical rainforest on the slopes of the Tweed shield volcano in north-east NSW and south-east Qld. Antechinus minimus may have moved into the more open, wet heath and tussock habitats that expanded in extent during the Pleistocene in south-eastern Australia (Byrne, Steane et al. ). Our analysis suggests that Tasmanian members of the dusky antechinus group diverged well before the last land bridge connected Tasmania to mainland Australia during the last glaciation period -kya (Lambeck and Chappell ). First, in the Late Pleistocene the Tasmanian sister species A. swainsonii and A. vandycki apparently diverged from mainland A. mimetes, and later, in the early Pleistocene, the A. minimus subspecies diverged from each other. Approximately similar levels of divergence across the Bass Strait are present in several other mammals, including the tiger quoll, Dasyurus maculatus (Firestone, Elphinstone et al. ), long-nosed potoroo, Potorous tridactylus (Frankham, Handasyde et al. ) and platypus, Ornithorhynchus anatinus (Gongora, Swan et al. ). As with A. flavipes on the mainland, the broader habitat use of A. minimus likely explains its later connectivity across the Bass Strait. Little is known of the range and biogeography of the recently discovered

36 Chapter Two

A. vandycki; however, its current known distribution (a small refuge of wet forest on the Tasman Peninsula) corresponds to an area which may have acted as a glacial refuge during the Quaternary (McKinnon, Vaillancourt et al. ). This suggests that the Tasmanian dusky antechinus sister species may have been separated by Quaternary glaciation, which isolated A. vandycki to the Tasman Peninsula (Baker, Mutton et al. ).

Ancestral State The initial BI AS analysis, which linked rate of DNA change to AS trait change, failed to clearly resolve the AS of the analysed traits for the four main lineages of Antechinus. The AS trait analysis presented here was therefore necessarily constrained to the BI concatenated phylogeny but not linked to the rate of DNA change (branch lengths) of this phylogeny.

It is worth noting that AS is a developing field which is inherently difficult, as it is constrained by missing data such as extinct taxa and requires an accurate phylogeny, character state data and statistical model (Griffith, Blackburn et al. ). Given this, AS results have been contested by some authors and it has been suggested that current methods of AS should be used only for the generation of hypotheses rather than being taken as an analytical end points (Christin, Freckleton et al. , Litsios and Salamin , Griffith, Blackburn et al. ). It is common (e.g., Romiguier, Ranwez et al. , Mitchell, Pratt et al. ), but not necessarily appropriate, to link the rate of evolution of a particular trait to the evolution of unconnected DNA, such as initial performed in the BI AS analysis of this study (Litsios and Salamin ). Indeed, a better method may be to link the rate of trait change to a morphological dataset which may be under more similar evolutionary pressures than uncorrelated DNA (Bromham, Woolfit et al. ).

Nevertheless, if the phylogenies of this study are regarded as broadly accurate, then the relative difference in branch lengths should represent approximations

37

Molecular Systematics of the true differences in evolutionary divergence between species (Omland ). If so, the initial AS analyses, which were unresolved for the three studied traits, may suggest altitude, habitat and size have changed so rapidly in Antechinus that the true AS of the main lineages of Antechinus cannot accurately be estimated. If so, it is perhaps unsurprising that preferences for high or low altitude was not determined, as a number of extant species utilise both. The same applies for open and closed mesic environments. Size showed less diversity but was divided between the mostly large dusky antechinus and A. minimus and A. godmani lineages and the small/medium species in other lineages. In each case, a trait change occurred over a relatively small branch length difference relative to the much greater depth of the main lineages and the genus with implications for resolution of the overall ancestral traits of these lineages.

These AS results therefore suggest that Antechinus have changed their size, altitude and habitat preferences relatively quickly, presumably in response to changing environmental factors. Such an interpretation contradicts Mitchell et al. () who strongly resolved the AS habitat preferences of Phascogalini as wet-closed. Yet by sampling at a finer taxonomic scale (subspecies) this study has revealed greater levels of trait diversity. It may be that studies which do not include subspecies miss trait variation and are consequently returning AS results with overinflated confidence values. Other studies applying AS analysis to fine taxonomic scales in a range of mammal species would be required to formally test this idea.

38 Chapter Three

Chapter 3: Phylogeography of the genus Antechinus

This data chapter is being prepared for submission to the journal: Journal of Biogeography.

Title: Phylogeography of the mesic Australian carnivorous marsupial genus Antechinus reveals widespread intraspecific biogeographic structuring.

Authors: Thomas Y. Mutton12, Andrew M. Baker1 and Susan J. Fuller1

Earth, Environmental and Biological Sciences School, Queensland University of Technology, George St, Brisbane, Queensland , Australia. Corresponding author, Email: [email protected]

Keywords: Dasyuridae, dasyurid, antechinus, Australian mesic zone, phylogeography, biogeography

Author contribution: Conceived and designed the experiments: TM AB SF. Performed the experiments: TM. Analysed the data: TM. Contributed reagents/materials/analysis tools: TM AB SF. Wrote the paper: TM.

Abstract: The mesic zone is the ancestral biome of Australia and, by most measures, the zone of highest taxonomic diversity. A detailed knowledge of comparative phylogeography is essential to ensure appropriate conservation management of taxa occurring in this zone. However, few phylogeographic studies on

39

Phylogeography mammals in the south-east of the Australian mesic zone have been undertaken. To fill this knowledge gap, samples were broadly sought from throughout the geographic range of all known species of the carnivorous marsupial genus Antechinus, which collectively occur across the entire Australian mesic zone. DNA sequencing of the fast-evolving mitochondrial gene Cytochrome-b, suggests A. stuartii is a young species complex. High levels of intraspecific phylogeographic structure, largely corresponding to putative Pleistocene biogeographic barriers, and comparable to the genetic divergence between named Antechinus subspecies, were revealed in a number of species. For example, the broadly distributed A. flavipes flavipes contained two divergent clades which appear to have been divided by the Great Dividing Range. Within the south-east Australian A. agilis, four phylogeographic clades were identified, each of which appears divided by suspected biogeographic barriers. Antechinus mimetes mimetes showed strong divergence between north-east NSW, south NSW and Victoria populations. The East Gippsland Basin may have been a barrier dividing Victorian populations of A. m. mimetes, as well as A. agilis. Considerable divergence was found between all south-east Queensland populations of A. mysticus and the only known population in mid- east Qld. It is concluded that many of these clades should be subject to further morphological, ecological and molecular analysis to determine whether classification as subspecies and conservation management of these taxa is required.

3.1 INTRODUCTION

Phylogeographic theory posits that if a biogeographic barrier exists, a phylogeographic break in a group of taxa may be observed (Avise ). However, identifying biogeographic barriers is not necessarily straightforward. This is because the barriers may contract, expand and/or disappear over time, such as during glacial and interglacial periods. The re-expansion and interbreeding of taxa across former biogeographic barriers can also mask phylogenetic signal (Avise ). Furthermore, incomplete lineage sorting and gene introgression may appear to indicate phylogeographic patterns

40 Chapter Three which are not accurate (Avise ). Different taxa may also vary in their response to a potential barrier due to unique ecological and behavioural factors (Joseph and Moritz , James and Moritz , Michaux, Libois et al. ). Given the multiple ways phylogeographic inference can show misleading patterns, it is necessary for a wide range of taxonomic groups to be studied and conform to standard patterns to confidently reveal biogeographic barriers and patterns (Arbogast and Kenagy ).

Having previously spanned much of the continent, mesic environments are considered the ancestral biome of Australia (Byrne, Steane et al. ). However, since the late Miocene, major drying apparently occurred to such an extent that by the end of the Pleistocene, mesic Australian environments were limited to their current distribution: along the coast of east Australia including Tasmania and south-west Western Australia (Byrne, Steane et al. ). Although now drastically reduced in size, the mesic zone still contains greater faunal and floristic diversity across most taxonomic levels than the far larger arid and monsoonal zones of Australia (Byrne, Yeates et al. , Bowman, Brown et al. , Byrne, Steane et al. ). Studies suggest that the drying out of Australia not only reduced the mesic zone, but also fragmented it, creating a number of dry biogeographic barriers for mesic species (Schodde , Chapple, Hoskin et al. , Bryant and Fuller ).

The most extensively studied mesic area in Australia is the Wet Tropics, where a number of taxa from a diverse array of organisms have been sequenced and biogeographic understanding appears relatively well-resolved (e.g., Schneider, Cunningham et al. , Pope, Estoup et al. , Hugall, Moritz et al. , Moritz, Hoskin et al. ). In contrast, phylogeographic studies of south-east Australia are relatively less common and biogeographic barriers are consequently less well understood. Those studies which have been undertaken in this area largely focus on amphibians and reptiles (e.g., Donnellan, McGuigan et al. , Schäuble and Moritz , Chapple, Keogh et al. ,

41

Phylogeography

Chapple, Hoskin et al. , Haines, Moussalli et al. , Ng, Clemann et al. , Pepper, Barquero et al. ). Yet, given the substantial differences in physiology, life histories and dispersal capabilities of reptiles and amphibians relative to mammals (Shine ), the responses of each vertebrate group to biogeographic change and barriers may differ (Taberlet, Fumagalli et al. ). For example, a major phylogeographic break in the long-nosed potoroo (Potorous tridactylus) has recently been identified in the Sydney Basin area, a region in which no barrier has previously been identified (Frankham, Handasyde et al. ). Although it may be real, this inferred phylogeographic break may also be a genetic artefact or obscured by subsequent dispersal. The paucity of comparative mammal phylogeographic studies in the area impedes clear understanding.

Unlike the majority of dasyurids, which are arid adapted, the genus Antechinus is collectively distributed throughout the entire Australian mesic zone. In Chapter Two of the present thesis, single, representative samples of each species and subspecies within the genus were sequenced. The known distribution of Antechinus species, coupled with the estimated cladogenesis dates of species, permitted us to pose the hypothesis that a number of well- known biogeographic barriers had driven the speciation and current distribution of Antechinus species. Indeed, collectively these purported barriers represent all known major biogeographic barriers for mesic taxa in eastern Australia (Chapple, Hoskin et al. , Bryant and Krosch ). They include the far north Queensland Laura Basin, the Black Mountain Corridor and the Burdekin Gap at the end of the Wet Tropics World Heritage Area, the St Lawrence Gap, the Brisbane Valley Barrier and the central NSW Hunter Valley (see Chapter Two, Fig. .)

To date, mammalian phylogeographic studies in south-eastern Australia have only being undertaken on yellow-bellied glider Petaurus australis (Brown, Cooksley et al. ), red-necked pademelon Thylogale thetis and red-legged pademelon Thylogale stigmatica (Eldridge, Heckenberg et al. , Macqueen,

42 Chapter Three

Seddon et al. ), brush-tailed rock wallaby Petrogale penicillata (Hazlitt, Goldizen et al. ) the long-nosed potoroo Potorous tridactylus (Frankham, Handasyde et al. ) and the fawn-footed melomys Melomys cervinipes (Bryant and Fuller ). No dasyurids have been studied across this region and the only phylogeographic study of Antechinus focused more locally on a single species (A. agilis) across its Victorian and south-east NSW distribution (Beckman, Banks et al. ).

Antechinus is an ideal model genus to test biogeographic hypotheses because the group is collectively distributed throughout the entire mesic zone and is speciose, with recent studies revealing a suite of cryptic taxa, a number of which appear to be geographically limited (see Chapter Two). This study aimed to provide the first detailed phylogeographic study of the genus Antechinus, sampling as broadly as possible throughout each species’ range and sequencing the mitochondrial Cytochrome-b (Cytb) gene. Sampling at a broader range allows the monophyly of species to be further tested (following from Chapter Two), with the possibly of uncovering further cryptic diversity within the genus. Such information also provides important baseline data for the management of Antechinus species. A specific aim of the current chapter was to better understand the systematics and phylogeography of A. stuartii which was revealed as a possible species complex in Chapter Two.

3.2 METHODS

Sampling Tissue samples were obtained through numerous field trips and supplemented with generous donations from individuals, organisations and Australian museums (see Supplementary Table .). All specimen locality and identification information is listed in Supplementary Table .. In total, samples were obtained. One A. bellus and A. agilis samples were taken from Genbank (Genbank numbers listed in Supplementary Table .). Forty samples have previously been analysed in Baker et al. (; ; ; ) (see

43

Phylogeography

Supplementary Table .). This study included all known Antechinus species and their subspecies and, as outgroups, one Phascogale and two Murexia.

Genetic procedures and analyses One gene fragment, Cytochrome-b (Cytb), was sequenced in this study. DNA extraction and Cytb sequencing were undertaken as outlined in Chapter Two. Cytb was partitioned by functional partitioning of codon position (+nd position and rd position). Maximum likelihood phylogenies (, bootstraps) were estimated in RAxML version .. (Stamatakis ), using the GTR+G model of evolution for each partition. Bayesian inference phylogenies were estimated in MrBayes version .. (Ronquist and Huelsenbeck ). Models of DNA substitution was determined using JMODELTEST version .. (Darriba, Taboada et al. ) from which the K+I+G model was determined as the appropriate model for both partitions. Two simultaneous runs of four chains (two hot and two cold) were performed for million generations for all datasets, with sampling every , generations.

It had been planned to sequence this dataset with the mitochondrial D-loop, which has been used in other Antechinus studies (Crowther, Sumner et al. , Lada, Thomson et al. ). Universal dasyurid d-loop primers Lm/Hm (Fumagalli, Pope et al. ) and four forward and reverse primers designed from Phascogalini and dasyurid sequences on Genbank were trialled. Each possible combination of forward and reverse primer ( primer pairs) was attempted but multiple efforts, using various PCR conditions, failed to consistently PCR and sequence samples. Consequently, the sequencing of D-Loop was abandoned and is not presented in this study. In any case, Cytb was deemed appropriate to resolve mtDNA phylogeographic structuring, especially as sampling was undertaken across large geographic scales and speciation in Antechinus is clearly a prominent feature in the evolution of the group (see Chapter Two).

44 Chapter Three

Sequences were aligned by eye using BioEdit version .. (Hall ). Genetic differences between species and clades were calculated and related to geographic distribution to reveal phylogeographic patterns. Such an approach has been successfully used for a number of Australian vertebrates (e.g., Spencer, Rhind et al. , Symula, Keogh et al. , Pepper, Barquero et al. ). To calculate genetic differences, a proportion distance matrix of the Cytb dataset and the net between group mean proportion distance between Antechinus species, subspecies and distinctive samples were calculated in MEGA (Tamura, Stecher et al. ). Proportion distance (p-distance) and mean net proportion distance (mean p-distance) were expressed as a percentage. To visualise relationships between the Cytb haplotypes of A. stuartii, where provision of samples assured a fine-scale geographic representation, a haplotype network was constructed using a method of statistical parsimony with a % connection limit in TCS version . (Clement, Posada et al. ).

3.3 RESULTS

The four main lineages of Antechinus identified in Chapter Two were also reconstructed in the more detailed Cytb phylogenies of this study (Fig. .). As in the concatenated phylogenies presented in Chapter Two, all Antechinus species were resolved as monophyletic with moderate to high support, except A. stuartii, which was not monophyletic in either phylogeny.

The BI and ML (Supplementary Figure .) phylogenies were largely congruent, although the BI phylogeny was better resolved and generally recovered higher support values. The systematic relationship between species in both phylogenies was largely congruent with the concatenated analysis presented in Chapter Two (Fig. .). However, A. leo was moderately (BI) and weakly (ML) supported as sister species to A. adustus in the present analysis rather than A. bellus and A. flavipes as in the concatenated phylogenies shown in Chapter

45

Phylogeography

Two (Fig. ., Supplementary Figure .). Further, in contrast to the concatenated phylogenies shown in Chapter Two, both the BI and ML Cytb phylogenies of this study strongly supported A. mimetes as sister species to other members of the dusky antechinus and A. minimus lineage, albeit with low (ML) and moderate (BI) support. In the BI phylogeny, A. arktos was strongly resolved as sister species to the remaining members of this group and A. swainsonii/A. vandycki and A. minimus were weakly supported as sisters taxa (see Fig. .). The ML phylogeny failed to resolve the relationship between A. arktos, the sister species A. swainsonii and A. vandycki, and A. minimus.

In the BI analysis (Fig. .), A. stuartii formed monophyletic north (A. stuartii north) and south (A. stuartii south) clades. A. subtropicus was resolved within A. stuartii, being the moderately supported sister to A. stuartii south. The ML analysis (Supplementary Figure .) also resolved the A. stuartii south clade as a moderately (%) supported sister group to A. subtropicus. However, A. stuartii north were not resolved as monophyletic but rather as polymorphic lineages in a clade with A. stuartii south and A. subtropicus. The south and north A. stuartii clades are geographically structured, with an overlap zone at New England National Park (NP), NSW (see Fig. .).

The mean net proportion distance (mean p-distance) between Antechinus species, excluding A. stuartii, varied from .-.% (see Table .; Supplementary Table . shows proportion difference between all Cytb haplotypes). The mean p-distance between A. stuartii and A. subtropicus (.%) is similar to the distance between A. stuartii south and A. stuartii north (.%) and only slightly less than the difference between each of these clades and A. subtropicus (.% from each). Antechinus godmani, the only species of lineage , stands out as particularly divergent from all other Antechinus species (.-.% mean p-distance).

46 Chapter Three

Unexpectedly high genetic diversity over geographic distance within species, coupled with the unanticipated discovery of several new Antechinus species at the beginning of this study (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ; Chapter Two) meant only a small number of species yielded more than a few haplotypes per geographic site. This precluded quantitative population genetic analyses (i.e

FST, AMOVA).

47

Chapter Three

M. melanurus 0.91 M. habbema 0.88 Kroombit Tops NP 0.86 Blackdown Tableands NP A. argentus 0.94 0.97 0.84 0.57 Eungella, ME Qld 0.97 SE Qld A. mysticus WA A. flavipes leucogaster 0.98 0.98 0.67 A. flavipes rubeculus 0.94 0.93 Vic Vic Southern * SA ACT A. flavipes Central L4 0.96 0.88 NSW flavipes 0.71 NE Northern 0.85 NSW, SE/ME A. flavipes Qld flavipes 0.65 A. bellus 0.53 0.57 A. leo 0.72 0.88 A. adustus

0.85

0.88 SW Vic

0.5 A. agilis * SE Vic 0.94

0.89 SE NSW 0.77 Central NSW

NE & ME L3 0.71 0.97 NSW A. stuartii south 0.91 0.82 0.71 0.55 0.74 A. subtropicus

0.88

SE Qld 0.67 / NE A. stuartii north * NSW

A. godmani A. arktos L2 0.98 A. swainsonii 0.56 0.99 0.94 0.65 A. vandycki * 0.89 A. minimus maritimus 0.89 L1 0.96 0.96 A. minimus minimus NE NSW 0.53 SE NSW, A. mimetes mimetes ACT, S Vic 0.76 0.87 0.60.67 0.98 A. mimetes insulanus 0.62 0.83 A. mimetes mimetes P. calura A. mimetes mimetes 0.04 49

Phylogeography

Figure .. BI phylogeny of Cytb dataset with BI posterior probabilities shown above the line and ML bootstrap values shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Bootstrap support of , posterior probability values of . and all node support values for unmarked clades are not shown. For ease of reading node support values for southern A. f. flavipes subclades are also not shown. Tip labels and all support values are given in Fig. .-. L- denote the main Antechinus lineages identified in Chapter Two. See Supplementary Table . for more information on all haplotypes.

Qld BVB

NSWNSW 119

Vic HR 121a-c 123 Vic 122,125 Vic 120 A. flavipes 126 113 121d 124128 leucogaster AUSTRALI 112 114 GB 127111 200km A 107 Ta 117 105104 102, 103 108, 109b,c s 109a 106 116 118

Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. swainsonii and A. vandycki; circles, A. minimus; rectangles, A. mimetes. The single haplotype of A. arktos is not shown on the map, see Supplementary Table . for more information on all haplotypes. Dotted lines delineate biogeographic barriers displayed in Fig. ..

50 Chapter Three

Phylogenetic relationships within the genus Antechinus A number of species displayed substantial intraspecific genetic structuring (see Figs. .-.). Antechinus flavipes flavipes, which is broadly distributed within south-eastern Australia (see Fig. .), formed reciprocally monophyletic northern and southern clades, which in fact possessed a greater mean p- distance (.%) than that between the northern A. f. flavipes clade and north- east Qld A. f. rubeculus (.%). Western Australia A. f. leucogaster was strongly supported as sister taxon of A. f. rubeculus (.% mean p-distance) and A. f. flavipes (% mean p-distance) in the Cytb phylogenies.

The pairwise divergence between the three A. f. rubeculus sites, located <- km apart, was approximately equal (-.%) and similar to the divergence between the two A. f. leucogaster samples (.%), which were approximately km apart. The most divergent samples within either the southern or northern clade of A. f. flavipes were substantially less divergent (.%) over a comparatively much larger distance (~km). The most northern sample of the southern A. f. flavipes clade was ~km further north than the most southern sample of the northern clade. These samples occur on either side of the Great Dividing Range (~km apart) and are quite divergent (%) despite being in such close proximity.

Antechinus agilis formed four geographically discrete clades (Fig. .), which were comparatively more divergent (.-.% mean p-distance) than the divergence between recognised subspecies of A. flavipes (.-% mean p- distance), A. minimus (.% mean p-distance) and A. mimetes (.% mean p- distance).

In the BI and ML phylogenies (Fig. .), Antechinus mimetes was geographically structured (see Fig. .) and A. m. mimetes was not monophyletic with respect to A. m. insulanus. Instead the single north-east NSW A. m. mimetes sample, which was ~km from the closest A. mimetes

51

Phylogeography sample, showed considerable divergence from all other A. m. mimetes (.- .% p-distance) (Fig. .). In both phylogenies this sample was weakly (BI) and moderately (ML) supported as sister to a clade containing the remaining A. m. mimetes and A. m. insulanus samples.

When the north-east NSW A. m. mimetes sample was excluded, A. m. mimetes was still not resolved as monophyletic. Rather, a single south-east Victoria sample was weakly (BI) to moderately (ML) supported as sister to a clade containing A. m. insulanus and the remaining A. m. mimetes samples (Fig. .). However, the genetic distance between this SE Victorian sample and the closest (~km) A. m. mimetes samples was very low (.%).Within this A. m. mimetes/insulanus clade, only two samples from south-west Victoria were strongly (BI) to moderately (ML) supported as sister taxa. Together, these samples were weakly (BI) to moderately (ML) resolved as sister to the remaining A. m. mimetes samples (see Fig. .). The genetic distance between the north-east NSW A. m. mimetes sample and the other A. mimetes clades was larger (-% mean p-distance) than the difference between the A. m. insulanus and Great Otways NP clade and the two other A. m. mimetes lineages (% mean p-distance from both). This divergence was also greater than between the two non-north east NSW A. m. mimetes lineages (.% mean p-distance). The pairwise genetic difference between the A. m. insulanus and Great Otways NP samples was also substantial (%).

52 Chapter Three

89, 96

south

north

Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. agilis; circles, A. stuartii and A. subtropicus; red stars, sympatric sites of A. stuartii north and south. Dotted lines delineate biogeographic barriers displayed in Fig. .. NA and NA refer to A. subtropicus sites identified in Chapter Two which were not sequenced at Cytb. See Supplementary Table . for more information on all haplotypes.

53

Phylogeography

A. bellus

44

CB1 0.88 CB2 Kroombit Tops NP 0.86 CB3 A. argentus 0.94 CB4 Blackdown Tableands NP 0.97 CB5 17,18 0.84 0.57 CB6 Eungella, ME Qld 0.97 CB7 SE Qld A. mysticus 16 CB8 14 CB10 45 0.98 CB9 WA A. flavipes leucogaster 46,47 0.98 CB11 12,13 0.67 CB12 15 200km CB13 NT 11 CB14 CB15 A. flavipes rubeculus CB16 0.93 CB17 0.94 CB18 6 CB19 NT 5 088 CB20 Vic 063 CB21 CB22 Vic Southern CB23 CB24 SA * 059 CB25 CB26 ACT A. flavipes QldQld 4 CB27 Central 32 0.96 084 CB28 1-3 0.88 CB29 NSW CB30067 flavipes 0.71 WACB31WA CB32 8e CB33 31 CB34 NE Northern 38 39 CB35 7a-c,8c,8d 34a CB36 NSW, Brisbane Valley Barrier 7 0.85 CB37 40a,40b CB38 A. flavipes SS 36 33,34b CB39 SE/ME 37 8b8a CB40 35 CB41 Qld 22b 42 CB42 flavipes AA 41 CB43 NSWNSW 0.65 CB44 A. bellus 30 0.53 0.57 CB45 28 0.72 CB46 A. leo CB47 0.88 CB48 A. adustus Gippsland Basin 27 24a Vic 24b 21c20 29 25 Vic 26 Vic22a 21a 19 21b A. flavipes 23 leucogaster AUSTRALIA

54 Chapter Three

Figure .. BI Cytb phylogeny of lineage extracted from Fig. . and map of corresponding sample locations. BI posterior probabilities are shown above the line and ML bootstrap values are shown below the line. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. Colouring represents lineage membership. CB haplotype are displayed on the map with the letters ‘CB’ excluded. Shapes represent: triangles, A. adustus and A. leo; circles, A. argentus and A. mysticus; rectangles, A. flavipes. Dotted lines delineate biogeographic barriers displayed in Fig. .. The Northern Territory A. bellus and Western Australian A. f. leucogaster are not shown on the map. See Supplementary Table . for more information on all haplotypes.

Table .. Mean net proportion difference (%) between Antechinus species, subspecies and A. stuartii north and south. ͱ Ͳ ͳ ʹ ͵ Ͷ ͷ ͸ ͹ ͱͰ ͱͱ ͱͲ ͱͳ ͱʹ ͱ͵ ͱͶ ͱͷ ͱ͸ . A. argentus . A. mysticus . . A. flavipes . . . A. bellus . . . . A. leo . . . . . A. adustus . . . . . . A. agilis . . . . . . . A. stuartii south . . . . . . . . A. subtropicus . . . . . . . . . A. stuartii north . . . . . . . . . . A. godmani . . . . . . . . . . . A. arktos . . . . . . . . . . . . A. swainsonii . . . . . . . . . . . . . A. vandycki . . . . . . . . . . . . . . A. minimus . . . . . . . . . . . . . . . A. mimetes . . . . . . . . . . . . . . . . M. melanurus . . . . . . . . . . . . . . . . . M. habbema . . . . . . . . . . . . . . . . . . P. calura . . . . . . . . . . . . . . . . . .

55

Phylogeography

Antechinus minimus maritimus formed south-east and south-west Victorian clades which had a p-distance of .% (~-km between samples of the two clades). A similar level of divergence (.-.%) was observed between a sample of Tasmanian A. m. mimetes from an unknown location and the other A. m. minimus samples, which occur along the east coast of Tasmania. This east Tasmanian samples were much less divergent (.-.%) over a maximum distance of ~km. Greater divergence was seen in the Tasmanian species A. swainsonii. The single sample from north-east Tasmania (CB) was .-.% divergent from the other, north-east Tasmanian A. swainsonii samples, which were, in turn, .-% divergent from each other over ~km (Fig. .).

Antechinus stuartii south consisted of two main clades in the BI and ML phylogenies (Fig. .): a north and south clade (.% mean p-distance) (see Fig. .). The geographically closest samples of each clade were separated by the Hawkesbury River (<km apart) and were .% divergent. A. stuartii north consisted of three clades in the BI phylogeny (.-.% mean p-distance between clades).Two of these, a north and south clade, contained the majority of A. stuartii north haplotypes and overlapped at Main Range and New England NPs (Fig. . ). The third clade consisted of two haplotypes from Main Range NP (CB-). Interestingly, three other samples from Main Range NP (including one from the same location) were sequenced and all formed part of the north A. stuartii north clade (CB, CB, CB) (Fig. .).

Coalescent theory predicts shared internal haplotypes to represent the ancestral state (Kingman , Crandall and Templeton , Castelloe and Templeton ). One A. stuartii haplotype (CB) was shared over multiple sites and was internal in the A. stuartii south haplotype network (Fig. .). This haplotype occurred at a number of locations in connected closed forest in Border Ranges and Mebbin NPs (maximum distance <km apart) and at Numinbah (-km from other sites) (Fig. .). New England NP, the only area where A. stuartii north and A. stuartii south were sympatric, had

56 Chapter Three considerable haplotype diversity in the networks of both A. stuartii north and A. stuartii south (Fig. .).

A. stuartii south A. stuartii north

72 73 79 66 south south 76 80 78 65 64 67 71 81 77

63 85 north 83 62 82 84

61 93 87 91 68 69 70 96 94 9797 92 88 89 98 86 90 95 north

Figure .. % connection limit parsimony network of A. stuartii south and A. stuartii north samples from the Cytb dataset. Red = New England NP, green = Werrikimbe NP, purple = Gosford, orange = Main Ranges NP, grey = Border Ranges NP. One haplotype (CB) occurred at two sites, this is shown by the larger circle size of this haplotype. Only samples of a haplotype which occur >km apart are considered to be at separate sites. Blue does not represent a geographic location, see Supplementary Table. . for location information of all samples. Unfilled circles represent unsampled hypothetical haplotypes. Dotted lines around haplotypes indicate subclades shown Fig. ..

Antechinus mysticus from Eungella in mid-east Queensland were notably divergent from A. mysticus from south-east Qld (.% mean p-distance). However, within south-east Qld A. mysticus was sequenced at eight geographic locations and showed little genetic diversity. Two Cytb haplotypes were identified that were one base pair (.%) apart, and correspond, approximately, to the Sunshine Coast hinterland and Brisbane regions (maximum geographic distance between haplotypes: ~km) (Fig. .). This level of difference is less than the diversity within a single geographic location for A. argentus, A. f. rubeculus, A. f. flavipes, A. adustus, A. agilis, A. stuartii

57

Phylogeography north and south, A. swainsonii and A. vandycki. In this study, a second location for the Vulnerable A. argentus: Blackdown NP is reported (pers. comm. E. Mason). Samples sequenced from this NP differ notably (.-.%) from Kroombit Tops NP A. argentus. These two locations are ~km apart.

3.4 DISCUSSION

This study revealed high levels of intraspecific phylogeographic structure. The distribution of genetic structuring largely corresponded to known geographic features which may have acted as biogeographic barriers over time. The present study provides a clearer understanding of the mesic biogeography of Australia, especially in the understudied south-east coast of Australia. It also provides a strong intraspecific systematic basis for better management of Antechinus species and will likely provide the foundation for future subspecific taxonomic revisions. Multi-gene phylogenetic analysis (presented in Chapter Two) and dense mitochondrial Cytb sequencing presented here both supported the status of all currently named Antechinus species. Concatenated multi-gene analysis of two A. stuartii samples presented in Chapter Two suggested A. stuartii was a species complex. The present study sequenced A. stuartii from multiple locations and has provided further insight into this species complex. Implications of these results are discussed in turn below.

A. stuartii In the present BI Cytb analysis (Fig. .) and the concatenated analyses presented in Chapter Two (Fig. .), A. stuartii north and south clades were revealed. In the concatenated analyses, A. stuartii north was sister to A. subtropicus. However, in the Cytb phylogenies (Fig. .) A. stuartii south and A. subtropicus were positioned as sister species. This difference between the analyses may be driven both by the extra samples included in the present analysis and A. stuartii north and A. stuartii south diverging from A. subtropicus relatively recently and at similar times, as indicated by the equal

58 Chapter Three mean p-distance between A. subtropicus and A. stuartii north/south (Table .).

In the BI Cytb phylogeny, A. stuartii north and south are geographically divided but overlap at two locations in New England NP, mid-east NSW (Fig. .). At both sites, representatives of the north and south clade were caught in the same area (<m apart) and habitat type (Supplementary Table .). It may therefore be assumed that, in these areas, the A. stuartii north and south clades are sympatric.

Our research group is in the process of assessing the distribution, morphology and breeding biology of these two clades. If such assessment shows morphological differences between the clades and non-overlapping mating times in sympatry, it would be appropriate to reclassify each clade as a separate species (as per Van Dyck and Crowther (), Crowther et al. () and Baker et al. ). However, these Cytb patterns may represent recent historic divergence, perhaps driven by Pleistocene climate fluctuations, leading to populations subsequently reconnecting and interbreeding (Avise ).

It is noteworthy that the ML Cytb analysis (Supplementary Fig .) did not resolve A. stuartii south as a monophyletic clade. This further complicates our understanding of A. stuartii and highlights the need for further genetic and ecological information to resolve the systematics and taxonomy of A. stuartii.

Intraspecific relationships and phylogeography A number of Antechinus species possess high level of intraspecific genetic diversity. Antechinus mysticus and A. f. flavipes both contain geographically discrete clades with similar genetic divergence to that between other named Antechinus subspecies. In the case of A. mysticus, mid-east Queensland samples also have paler fur (Baker, Mutton et al. , Baker, Mutton et al.

59

Phylogeography

). It is not yet known if A. mysticus occurs across the ~km separating the clades (i.e., between Cooloola east of Gympie and Eungella west of Mackay). Since naming the species, additional trips made to Blackdown Tableland ( trap nights), Kroombit Tops (>, trap nights), Good Night Scrub ( trap nights), Bulburin/Many Peaks Range (~, trap nights) and Mount Robert ( trap nights) National Parks and an area approximately .km SW of Mount Colosseum National Park ( trap nights) have failed to capture A. mysticus, or indeed many antechinus at all despite being conducted in apparently suitable forested habitat (Baker, Mutton et al. , Baker, Mutton et al. , Mason, Burwell et al. , pers. comms. H. Hines and E. Mason). In south-east Qld, A. mysticus appears to favour riparian/ecotone habitats. Such habitat is widespread, albeit patchy, and may explain the extremely low genetic divergence within this clade (.%). The cosmopolitan habitat preferences of A. mysticus perhaps allowed the species to occur more broadly in the past, subsequently becoming separated across the St Lawrence Gap (Fig. .) (Bryant and Krosch ).

The genetic difference between reciprocally monophyletic A. f. flavipes clades (.%) was greater than the difference between the northern A. f. flavipes clade and A. f. rubeculus (.%). In the present study, the closest samples of the northern and southern A. flavipes clades lie approximately km apart, on either side of the Great Dividing Range (GDR), a well known biogeographic barrier to a number of vertebrates (Bryant and Krosch ). Indeed, no samples of the southern A. f. flavipes clade occur east of the GDR and only one sample occurs on the range (CB). In contrast, all samples except two (CB- ) of the northern A. f. flavipes clade occur along or east of the GDR. Taken together, this suggests that the GDR was likely a barrier leading to divergence of the two A. f. flavipes clades. Unfortunately, the two clades were not found at the same geographic location and there is a ~km sampling gap along the east coast of northern NSW in this study where they conceivably could overlap. Future work should focus on sampling and sequencing within this area to better understand the evolutionary history of these two clades.

60 Chapter Three

Antechinus agilis formed four phylogeographically discrete clades (south-west Victoria, south-east Victoria, south-east NSW and central NSW). The first three of these clades were revealed in Beckman et al (), however the lack of comparative intraspecific genetic data for Antechinus and smaller sample size of this study made the significants of these divergent clades unclear. Unfortunately, sampling coverage across the range of A. agilis was also patchy in the current study. The closest samples of adjacent clades were approximately km between the Victorian clades, km between the NSW clades and km between the SE Vic and SE NSW clades. However, genetic distance between the most geographically separate samples within clades (>km), was substantially less than that between clades (see Supplementary Table .). This suggests that divergence between clades may have been driven, at least in part, by physical separation across a biogeographical barrier, rather than being solely an artefact of sampling coverage.

The genetic divergence observed between A. agilis sampled from south-west Victoria and south-east NSW has also been reported in a diverse array of taxa, including brush-tailed rock-wallaby, petrogale penicillate (Hazlitt, Goldizen et al. 2014), assassin spiders, Family Archaeidae (Rix and Harvey ), reptiles (Chapple, Keogh et al. , Chapple, Hoskin et al. , Pepper, Barquero et al. ), plants (Milner, Rossetto et al. ) and the satin bowerbird, Ptilonorhynchus violaceus (Nicholls and Austin ). This area has been termed the ‘Southern Transition Zone’ (Milner, Rossetto et al. ) and represents an area where the lowlands of Eastern Victoria transition to the Great Dividing Range (GDR) highlands, which apparently glaciated repeatedly in the Pleistocene (Barrows, Stone et al. ). Such forces may have isolated populations of A. agilis to either side of the range. The south-east and central NSW A. agilis clades appear to be separated by the Illawarra district, which also has been reported as a biogeographic barrier for a number of reptiles (Sumner, Webb et al. , Dubey, Croak et al. , Pepper, Barquero et al.

61

Phylogeography

) and assassin spiders (Rix and Harvey ). The low-lying coastal region in this area was apparently arid during the last glacial maximum (Thom, Hesp et al. ). Together, these areas may have acted as a biogeographic barrier to A. agilis over much of the Pleistocene (Pepper, Barquero et al. ). Antechinus agilis clades from Victoria were perhaps isolated by marine incursion of the East Gippsland Basin and glaciation during the Plio- Pliestocene, a process which also appears to have isolated a skink species (Lampropholis guichenoti) in this region (Gallagher, Greenwood et al. , Chapple, Hoskin et al. ). Support for divergence between southern Victoria, Eastern Victoria and NSW is also provided by Crowther () who found morphological differences between populations from these areas.

The relatively early divergence of A. agilis in the Late Pliocene (see Chapter Two, Fig. .) and increased aridity during the Pleistocene (Byrne, Yeates et al. ) may explain the high genetic divergence within this species. Studies by Beckman et al. () and Draper () of morphology, habitat preference and microsatellite structure between and teat populations of south-west Victoria A. agilis suggest incipient speciation may be occurring. Ecological data, coupled with further sampling in geographic gaps to inform genetics and morphology, will be required before A. agilis taxonomy can be resolved.

On the basis of morphological and molecular data A. subtropicus and A. stuartii populations are reported to overlap at Sheepstation Creek, Border Ranges in far north-east NSW (Crowther, Sumner et al. ). Trapping was undertaken at this location and other areas in the Border Ranges and surrounding NPs but unfortunately A. subtropicus was never caught (data not shown). Rather, A. subtropicus was found only north of the Brisbane Valley (Fig. .). The Brisbane Valley is an important biogeographic barrier for a diverse array of mesic taxa, including frogs (McGuigan, McDonald et al. ), spiders (Rix and Harvey ) and rodents (Bryant and Fuller ). This barrier may have led to the Pleistocene speciation of A. subtropicus from A. stuartii. It is plausible that A. subtropicus crossed this barrier later and

62 Chapter Three persisted in lower densities to the south, assisted by warmer and wetter climates during a Pleistocene interglacial period (Zachos, Pagani et al. ).

The phylogeographic history of A. mimetes is less clear. The single sample from north-east NSW of this species is sister to all other A. m. mimetes and A. m. insulanus samples in the Cytb phylogenies (Fig. .). This sample is approximately as divergent from these clades (-% mean p-distance) as the divergence between A. f. rubeculus and A. f. flavipes (.%). However, clear understanding is obscured by A. mimetes from north-east NSW being only weakly (BI) to moderately (ML) supported as sister to the other A. mimetes. Unfortunately, this single north-east NSW sample was collected far from the next most southerly A. mimetes sample (~km away). Further sampling in the gap is warranted, as a major biogeographic barrier, the Hunter River, occurs between north-east NSW and southern conspecifics. This barrier has been identified as being responsible for divergence between a number of reptiles (e.g., Dubey and Shine , Chapple, Hoskin et al. , Pepper, Barquero et al. ) and amphibians (McGuigan, McDonald et al. , Donnellan, McGuigan et al. , Schäuble and Moritz ).

In a morphological study of A. mimetes which sampled from a number of locations in western Victoria, Davison () recognised and named A. m. insulanus only from Grampians NP. This subspecies differs substantially in cranial morphology and dentition to A. m. mimetes (Baker, Mutton et al. ). In this study, A. m. insulanus from the Grampians NP was sequenced and found to be well supported as sister to A. mimetes from Great Otways NP. The relatively large genetic difference (%) between these two locations coupled with the distinctive morphology and pelage of A. m. insulanus, would seem sufficient to justify the present subspecific status of A. m. insulanus. However, such divergence could represent either ends of a cline, in which case subspecies recognition may be inappropriate. A future molecular and

63

Phylogeography morphological study sampling A. mimetes throughout Western Victoria is needed to clarify the position of A. m. insulanus.

Presumably, the same biogeographical barrier which separated west Victorian A. mimetes from conspecifics would have also separated populations of A. agilis in south-west Victoria. Indeed, the pairwise difference at Cytb between A. agilis from Grampians NP and Great Otways NP (.-.%) is remarkably similar to the divergence between A. mimetes from these locations (%). Interestingly, both species have larger morphological variants in the Grampians than elsewhere in Victoria. Our research group is currently investigating the morphology of specimens from the Otways. It is notable that the rare smoky mouse, Pseudomys fumeus, also shows comparative levels of divergence between its only western Victorian populations at Grampians NP and eastern Victorian locations (pers. comm. C. Newton). Pseudomys fumeus was also once known from the Otway Ranges; however, it has not been found in this area since and has not been genetically analysed (Menkhorst and Broome ). Taken together, these patterns suggest a strong Pleistocene biogeographical barrier may have affected a range of mammal taxa in Victoria.

Overall, this study has revealed a remarkably high level of intraspecific genetic diversity in a number of Antechinus species. In particular, the divergences between A. mysticus from mid-east and south-east Qld, the northern and southern A. f. flavipes clades, north-east NSW A. mimetes and south-east NSW/Victorian A. mimetes and the four clades of A. agilis could all conceivably be more appropriately reclassified as distinct subspecies. However, in each case, further morphological, molecular and ecological work is needed before such a revision would be appropriate. Such is also true of A. stuartii, which, on the balance of evidence, appears to comprise a recently-diverged species complex. The identification of these and other phylogeographic patterns in this study adds to our understanding of mesic biogeography in

64 Chapter Three

Australia, particularly for mammals along the understudied south-east coast of Australia.

65

Autecology

Chapter 4: Comparative population genetics of two small carnivorous marsupials in the genus Antechinus

This data chapter is being prepared for submission to the journal: Heredity

Title: Marked population genetic structuring in a new species of semelparous mammal may be linked to anthropogenic pressures

Authors: Thomas Y. Mutton12, Andrew M. Baker1 and Susan J. Fuller1

Earth, Environmental and Biological Sciences School, Queensland University of Technology, George St, Brisbane, Queensland , Australia. Corresponding author, Email: [email protected]

Keywords: Antechinus mysticus, Antechinus subtropicus, dasyurid, mammal, population genetics, Queensland

Author contribution: Conceived and designed the experiments: TM AB SF. Performed the experiments: TM. Analysed the data: TM. Contributed reagents/materials/analysis tools: TM AB SF. Wrote the paper: TM.

Abstract: The Australian dasyurid marsupial genus Antechinus are renowned worldwide for being one of only a few mammal genera to exhibit semelparous breeding. Annually, all males die of immune system malfunction at the end of a one to three week frenetic mating period. Recently, five new Antechinus species have been named, at least two of which are threatened. Important facets of the life

66 Chapter Four history, habitat use and extinction risk of one of the new species, the buff- footed antechinus, A. mysticus, are not well understood. The species was hypothesised to use a broad range of inter-connected forested habitats in south-east Queensland (SE Qld). Comparative population genetic analysis of species across a similar geographic range can reveal previously overlooked facets of a species’ life history or biogeography. This study tested that idea using a population genetic approach. It was predicted that over time, movement across connected populations should result in limited regional structuring within A. mysticus. Nine microsatellite loci were genotyped for six populations of A. mysticus, sampled throughout their known range in eastern Australia and compared with four populations of a congener, A. subtropicus, which occurs across a similar area in south-east Queensland. Antechinus subtropicus is found in fragmented altitudinal vine and rainforest communities and consequently, it was expected that it would show a greater degree of population differentiation than A. mysticus. Yet this was not the case. The northernmost SE Qld population of A. mysticus at Cooloola was revealed as deeply differentiated from adjacent sites in the south-east. Evidence presented in this study suggests that the Cooloola A. mysticus population occurs at very low density and may be at risk of extinction. Interestingly, genetic structuring among other SE Qld populations of A. mysticus was also moderate to high and similar to that between A. subtropicus populations. These results indicate that A. mysticus may be more scattered and fragmented than previously thought and may warrant listing as threatened.

4.1 INTRODUCTION

Differences in population genetic patterns between species with similar ranges and life histories can reveal previously overlooked facets of a species’ life history or biogeography (Turner, Gardner et al. ). In ecology, it is common to assume the range of a little studied species and its presumed historical connectivity based on the habitat types in which it has been found.

67

Autecology

In closely-related species, which are believed to occupy largely separate habitats across a similar range, a comparative analysis of population genetics allows the formulation and testing of assumptions about differential habitat use, past connectivity and the biogeography of an area (Manel, Schwartz et al. , Segelbacher, Cushman et al. ). Understanding these patterns is integral to effective conservation management of a species, as are the estimates of genetic diversity such studies provide (Frankham, Briscoe et al. ).

Antechinus are one of just a few mammal genera which exhibit semelparous (suicidal) reproduction and, as a consequence, the genus has been used as a model for breeding biology studies. Such general interest has also encouraged a number of genetic studies on Antechinus, with a principal focus on deeper level systematics and taxonomy (e.g., Krajewski, Torunsky et al. , Westerman, Krajewski et al. ) and a range of population-level studies (see below). However, molecular studies of the genus have largely not undertaken assessment across a species’ total geographic range, which can otherwise provide invaluable information on life history, habitat use and extinction risk. Given Australian mammals have suffered an extremely high rate of extinction in the last ~ years (Woinarski, Burbidge et al. ) there is a vital need for such fine-scale yet geographically detailed molecular studies, particularly on species which are little known.

The recently discovered buff-footed antechinus, A. mysticus, is a case in point. Antechinus mysticus and its congener, the subtropical antechinus, A. subtropicus, share a similar range in south-east Queensland (SE Qld) but are hypothesised to occupy largely separate habitats (Baker, Mutton et al. ; Chapter Three). Excluding the genetically and geographically distinct altitudinal rainforest population of A. mysticus in Eungella, mid-east Queensland (ME Qld), A. mysticus has not been found in the subtropical rainforest and vine-forests which are scattered throughout the protected habitats of near coastal SE Qld and favoured by A. subtropicus (Van Dyck and

68 Chapter Four

Crowther , Crowther, Sumner et al. , Baker, Mutton et al. ; Chapter Three). Rather, A. mysticus has consistently been found in comparatively drier, more open and lower altitude riparian environments of SE Qld (Baker, Mutton et al. ; Chapter Three).

The hypothesis of alternate habitat preference in these species also appears to be supported by a known locale in D’Aguilar National Park (NP) where the species are known to be sympatric (Chapter Five). In parts of this NP, A. subtropicus and A. mysticus occur in the absence of congeners in altitudinal rainforest (-m) and lower altitude (-m) open-forest, respectively. They occasionally co-occur at a mid-altitude (-m) and transitional environment/ecotone, where open forest and closed, vine and rainforest communities merge (Chapter Five). Thus, the balance of evidence to date suggests A. mysticus and A. subtropicus may co-occur at some narrow zones of range overlap, but largely appear to utilise separate habitats across their SE Qld range.

If the hypothesis of habitat distinction is true, over time it might be expected that differences in the relative connectivity of populations between the two species would be observed, assuming similar genetic mutation rates. This is because the lower altitude, drier forested habitats of A. mysticus would presumably be more connected in recent geological time than the comparative islands of high altitude vine and rainforest which A. subtropicus favour. This may have promoted a higher degree of population genetic structuring among A. subtropicus across a similar range in SE Qld. The mitochondrial Cytochrome-b (Cytb) results of the present study (Chapter Three) support this contention. Antechinus mysticus showed very little diversity at Cytb in SE Qld, forming two haplotypes just one base pair different (.%) across approximately km of the species’ known within SE Qld range (Chapter Three). In contrast, A. subtropicus was sequenced from altitudinal vine and rainforest sites in two locations, Conondale and D’Aguilar NPs, where they

69

Autecology showed four times as much genetic divergence (.%) over only half the geographic distance (km; Chapter Three).

To formally test the hypothesis of greater population connectivity in A. mysticus than A. subtropicus a number of populations throughout the range of both species were analysed using nine microsatellite loci. As microsatellites evolve much more rapidly than mitochondrial Cytb (Sunnucks , Bhargava and Fuentes ), their genotyping allows population connectivity to be comparatively assessed for the two species at a finer temporal scale than previously undertaken (in Chapter Three). It also permits estimates of genetic diversity within and between populations. This knowledge is essential for the effective conservation management of any given species (Frankham, Briscoe et al. ).

Microsatellite analysis of Antechinus has been undertaken to examine the effects of habitat fragmentation over small (Banks, Finlayson et al. , Banks, Lindenmayer et al. , Banks, Ward et al. , Sale, Kraaijeveld- Smit et al. ) and larger (Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Thomson et al. ) scales. It has also been used to test for male dispersal (Kraaijeveld-Smit, Lindenmayer et al. ), investigate the relatedness of populations of a species with different nipple numbers (Beckman, Banks et al. , Draper ), examine paternity and mate choice (Kraaijeveld-Smit, Ward et al. , Kraaijeveld-Smit, Ward et al. , Kraaijeveld-Smit, Ward et al. , Fisher, Double et al. , Holleley, Dickman et al. , Parrott, Ward et al. , Parrott, Ward et al. , Sale, Kraaijeveld-Smit et al. ) and compare life histories of various sympatric mammals in a small area (Kraaijeveld-Smit, Lindenmayer et al. ). However, a microsatellite study across the entire geographic range of an Antechinus species has only been undertaken on one species, A. agilis (Beckman, Banks et al. ) and no population genetic studies have been undertaken on the recently-described A. mysticus or its congener A. subtropicus. The present study will fill this knowledge gap.

70 Chapter Four

4.2 METHODS

Study sites and taxon sampling

Samples were collected from across the known geographic range of A. mysticus, including five localities in SE Qld and one from Eungella, ME Qld (see Fig. .) (Baker, Mutton et al. ; Chapter Three). Despite considerable effort, A. mysticus has not been found in the ~km separating SE Qld from Eungella or from further localities in ME Qld (Baker, Mutton et al. , Baker, Mutton et al. ; Chapter Three). In SE Qld, A. mysticus sites ranged from -km straight line distance (SLD) apart (see Fig. .) and -m above sea level (ASL). Eungella is located -km SLD from the other sites and at a much higher altitude (m ASL) (Table .). A detailed vegetation survey was outside the scope of the present study, but the SE Qld A. mysticus sites were predominately riparian open woodland, while the ME Qld site, was dominated by rainforest (Pearce ). The D’Aguilar site was the only site at which both species occur. This site is typified by a split between riparian open woodland and rainforest type communities (see Chapter Five).

71

Autecology

Australia

Section of South-east Queensland

Figure .. Antechinus mysticus and Antechinus subtropicus populations sampled in the present study. Squares represent A. mysticus sites, circles represent A. subtropicus sites. The star represents a site at which both species were caught.

Here, samples were collected from four sites covering the entire known range of A. subtropicus, except their southern latitudinal maximum at Border Ranges NP area (latitude: . o S). At this location they co-occur with A. stuartii (Van Dyck and Crowther , Crowther, Sumner et al. ). Although trapping was undertaken at multiple locations in the Border Ranges NP A. subtropicus was not caught. It is possible that A. subtropicus is today at low abundance at its southern limit (Chapter Three). A phylogeographic study (Chapter Three) suggests that A. stuartii does not occur north of Main Range NP, which is ~km south of D’Aguilar NP. Thus, these two species do not co-occur at any of the sites surveyed in the present study. Three of the A. subtropicus sites were approximately equidistant (~km SLD) from each other (Wrattens, Woondum and Conondale), while the fourth site, D’Aguilar, was located -

72 Chapter Four

km SLD south of these sites (Table ., Fig. .). Excluding D’Aguilar, where the two species co-occur, all A. subtropicus sites occurred at relatively high altitude, ranging from -m ASL (Table .).

Species were identified by eye based on pelage colour as described in Baker et al. () and their identity confirmed using mtDNA (Cytb) sequencing (Chapter Three), prior to microsatellite screening. Comparative estimates of genetic structure using a fast-evolving mitochondrial DNA gene, such as D- loop (Avise ), would have been ideal. However, repeated attempts at amplifying D-Loop using a range of universal and specifically designed primers yielded only spurious results (see Chapter Three). Thus, the present analysis focusses on microsatellite variation alone.

Table .. Geographic location of all sites. All sites are named after the National Park in which they occur, except Imbil, which is a State Forest and Crohamhurst, a Conservation Area. Abbreviations: ASL = above sea level; Am = A. mysticus; As = A. subtropicus.

Metres Antechinus Name of Site Latitude and longitude ASL species caught Eungella -.°S .°E m Am Cooloola -.°S .°E m Am Mapleton -.°S .°E m Am Imbil -.°S .°E m Am Crohamhurst -.°S .°E m Am D’Aguilar -.°S .°E m Am & As Wrattens -.°S .°E m As Woondum -.°S .°E m As Conondale -.°S .°E m As

Genetic sampling, extraction and trapping procedures were undertaken as detailed in Chapter Two. Samples from Eungella and D’Aguilar were collected during parallel capture-mark-recapture studies described in Pearce () and Chapter Five (present study), respectively. Cooloola samples were collected by R. Wheatley (UQ) and collaborators as part of her PhD project. Samples from

73

Autecology the other six sites were collected by TYM by trapping for - days and~, trap nights at each site.

Nine microsatellite loci, which have previously been used on Antechinus (see Table .) were amplified using a Qiagen multiplex kit (Qiagen, Dusseldorf, Germany). As the allele sizes of some primers were similar, two multiplexes of loci were amplified separately (Table .). For each multiplex, an individual primer mix was made containing µL of each forward and reverse primer ( pmol) with diluted water added to a final volume µL (fluorescent dye- labelled forward primers were manufactured by Life Technologies, Victoria, Australia; unlabelled reverse primers were manufactured by IDT Integrated DNA Technologies, New South Wales, Australia). Microsatellite fragments were amplified in a PCR reaction containing µL of DNA, µL of RNase-free

HO, . µL of primer mix and . µL of Qiagen multiplex master mix. The following PCR cycler protocol was used for both microsatellite groupings: °C for min, cycles of °C for s, °C for s and °C for s, followed by °C for min. Fragments were analysed on an ABI sequencing platform in a sequencing reaction of L of Hi-Di™ formamide (Applied Biosystems), L of GSLIZ sequencing size standard (Applied Biosystems) and L of a / dilution of each PCR product.

74 Chapter Four

Table .. Primer sequence and references of the nine microsatellites loci genotyped in this study. The primers were divided into two multiplex groupings.

Locus Primer sequence Reference Multiplex AaA F (’ – TCAGCCTCGATATTTTTCTAATG – ’) Banks et al. A R (’ – AGCTCCTTTTGTATCCTAAC – ’) AaA F (’ – TTTGATCCTCAGAGACTTGAT – ’) Banks et al. A R (’ – CCAAATCTACGTAAAATATCC – ’) AaK F (’ – TCTGTGGAGCCTCTAGAGAAT – ’) Kraaijeveld-Smit et al. A R (’ – AAGAGGATAACCCATTCAGA – ’) AaD F (’ – GGATTTGATCTCAGGTTTTC – ’) Kraaijeveld-Smit et al. A R (’ – ATATCCACCAATGACTGCAA – ’) AaK F (’ – TTTCTGGATGAACAGTTTGA – ’) Banks et al. A R (’ – GAGATGTGAGCAGTTAGTGGAC – ’) AaH F (’ – AATTCAGTTGAGTCCACTTTG – ’) Banks et al. B R (’ – GTGCTTTCTCTGTCTTTCC – ’) AaM F (’ – TGCTTTGTTCTTGCTAAGTA – ’) Banks et al. B R (’ – ACAATCATATGTTTATGTAGCC – ’) AaO F (’ – GTCTTTGGATAATTGAAGTCTG – ’) Kraaijeveld-Smit et al. B R (’ – GAATGAGGATCTAAGTGAATGT – ’) AaQ F (’ – AAGCCCTGACAAATGGT – ’) Lada et al. B R (’ – ATTCACTGTGCCATCAACTACCT– ’)

Genetic Variation

Allele size was scored and checked in GeneMapper version . (ABI). The total number of alleles (A), private (unique) alleles (uA), rare alleles (rA; frequency ≤ %), observed (Ho) and expected (He) heterozygosity per population were estimated using GenAlEx . (Peakall and Smouse ). Allelic richness was standardised for sample size (AR) and was estimated in Fstat ... (Goudet ). Tests for Linkage Disequilibrium (LD) and departure from Hardy-Weinberg Equilibrium (HWE) were carried out in Genepop . (Raymond and Rousset , Rousset ) using , permutations to test for statistical significance.

Population structure and genetic bottlenecks

Genetic structure between populations was tested using a sum of squared

allele size difference method (pairwise RST) (Slatkin ). RST is an analogue of

75

Autecology

Wright’s Fst which can deal better with large levels of population differentiation (Balloux and Lugon-Moulin ). Hierarchical structuring of populations was assessed by an Analysis of Molecular Variance (AMOVA) (Excoffier, Smouse et al. ). The relationship between geographic distance and genetic distance (pairwise RST) was analysed using Mantel tests (Mantel

). Pairwise RST, AMOVA and Mantel tests were undertaken in Arelquin ... (Excoffier and Lischer ). To visualise population structure,

Principal Component Analysis (PCA) (Orlóci ) based on pairwise RST values was carried out in GeneAlex . (Peakall and Smouse ).

BOTTLENECK .. (Piry, Luikart et al. ) was used to test whether any of the populations showed a molecular signature of recent (- Ne generation) genetic bottleneck. A two-phased mutation model (TPM) incorporating % single-step changes with variance of multiple-step changes set to % (Piry, Luikart et al. ) . Statistical significance was evaluated from , simulations of the one-tailed Wilcoxon sign-rank test (Piry, Luikart et al. ). For each population, Garza and Williamson’s () M-ratio was calculated in Arelquin. M-ratio is a measure of the proportion of unoccupied allelic states given the allele size range. It is sensitive to population bottlenecks (often for over generations) as the ratio reduces as alleles are lost due to random drift when a bottleneck occurs (Garza and Williamson ). Estimates of effective population size were not calculated, as sample size and loci number were too small to provide reliable estimates (Luikart and Cornuet

). The inbreeding coefficient (FIS) was estimated for all loci in each population using Arlequin ... (Excoffier and Lischer ), with , permutations of alleles among individuals within a population to test for significance.

To define the number of distinct population groups (K), Bayesian clustering of individuals without prior assignment to population was performed in the software package STRUCTURE version .. (Pritchard, Stephens et al. ). The program was run for iterations of , generations, with an initial

76 Chapter Four burn-in of , generations. No assumptions were made about the shared descent of populations, allele frequencies were set to uncorrelated and separate alpha values were used for each population (Pritchard, Stephens et al. ). The program assigns individuals to K clusters, with the user nominating which value of K is most appropriate for their data. Evanno et al. () recommends that the highest value of ∆K be taken as the true K value. However, it has been recommended that the value of K which captures the majority of structure in the dataset be used (Pritchard, Stephens et al. ), as has been implemented in a number of ecological studies (e.g., Krosch, Schutze et al. , Bryant and Fuller , Cardoso, Mooney et al. ). The online resource Structure Harvester (Earl and vonHoldt ) was used to plot the ∆K values and to summarise the STRUCTURE result files. Cluster membership coefficient matrices for each K value were summarised in CLUMPP version .. (Jakobsson and Rosenberg ) and then inputted into the program Distruct version . (Rosenberg ) to produce admixture graphs.

4.3 RESULTS

Descriptive statistics

In total, A. mysticus and A. subtropicus individuals were screened for nine microsatellite loci. One locus, AaQ, failed to amplify for all A. mysticus, presumably due to a mutation in the primer binding region (Selkoe and Toonen ). All loci were polymorphic. Pairwise comparison between all individual loci revealed low rates of significant linkage disequilibrium for A. mysticus (.%) and A. subtropicus (.%). As there was no consistent pattern of linkage across sites or loci (data not shown), it is unlikely these low rates of significant linkage disequilibrium were due to physical linkage (Selkoe and Toonen ). For A. mysticus, no site significantly departed from HWE for more than two of the eight loci, but one locus (AaK) significantly departed from HWE at four of the six sites (Table .). This may be due to null alleles, as

77

Autecology

Ho was much lower than He at these sites for this locus (Selkoe and Toonen

). As RST bias can be larger after using correction methods (Chapuis and

Estoup ), pairwise RST and Bayesian clustering analysis were performed on the dataset without AaK. However, as little difference was found in the results (Supplementary Figure .) and the locus showed differentiation between populations, it was therefore included in the final analysis (Chapuis and Estoup ). In contrast, no locus significantly departed from HWE for more than two sites for A. subtropicus, but at one site (D’Aguilar) six of the nine loci significantly departed from HWE (Table .). Possible causes and consequences of this will be examined in the Discussion.

Number of samples genotyped per site varied from to for A. mysticus and to for A. subtropicus (see also Table .). Although a greater number of samples and sites were screened, less unique alleles were observed for A. mysticus () compared to A. subtropicus (); however, the range of alleles per locus was the same for both species (-) (see also Table .). The average A per population was similar for both species (.. A mysticus; . A. subtropicus), ranging from . (Cooloola) to . (D’Aguilar) for A. mysticus and . (Wrattens) to . (D’Aguilar) for A. subtropicus (see also Table .). However, AR was higher at all A. mysticus populations (average: .), except Cooloola, than for any A. subtropicus population (average: .) (Table .). Allelic diversity was below average for all loci at Cooloola and the AR (.) and He (.) of this site were far lower than any other site (see Table .). Private alleles were low at all sites for both species (Table .). The average number of rare alleles relative to sample size was similar for A. mysticus (. ± .) and A. subtropicus (. ± .).

78 Chapter Four

Table .. Table of descriptive statistics and Hardy-Weinberg Equilibrium test for each microsatellite locus at each site for (a) A. mysticus and (b) A. subtropicus. N, number of samples; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; HWE sig., Hardy-Weinberg Equilibrium significant at . level.

(a) Av. Aa Aa Aa Aa Aa Aa Aa Aa Site Locus: for A K K A D H m loci Eungella N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no yes no no no no no no Cooloola N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no no no no no no no no Mapleton N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no yes no no yes no no no Imbil N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no yes no no no yes no no Crohamhurst N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no no no no no no no no D Aguilar N Na . Ho . . . . . . . . . He . . . . . . . . . HWE sig. no yes yes no no no no no

79

Autecology

(b)

Site Aa AaK AaK AaA AaD Aa AaH AaQ AaM Av. A for loci Wrattens N Na . Ho . . . . . . . . . . He . . . . . . . . . . HWE sig. yes no no yes no no yes no no Woondum N Na . Ho . . . . . . . . . . He . . . . . . . . . . HWE sig. yes no no no no no no yes no Conondale N Na . Ho . . . . . . . . . . He . . . . . . . . . . HWE sig. no no no no no yes no no no D’Aguilar N Na . Ho . . . . . . . . . . He . . . . . . . . . . HWE sig. no yes yes no yes yes no yes yes

80 Chapter Four

Table .. Summary of genetic variation in sampled populations of (a) A. mysticus and (b) A. subtropicus based on eight and nine amplified microsatellite loci, respectively. N, sample size; A, total number of alleles; AR, allelic richness standardised for allele size; uA, unique (private) alleles; rA, rare alleles (frequency ≤ %); He, expected heterozygosity; Ho, observed heterozygosity and FIS, inbreeding coefficient. FIS values significantly different (p = <.) are shown in bold. Populations showing a signature of genetic bottleneck are indicated with an asterisk. M-ratio is the Garza-Williamson index following Garza and Williamson ().

(a) A r He Ho Site N AR uA A FIS M-ratio

Eungella . ± . . ± . . . . .

Cooloola . ± . . ± . . . . .

Mapleton . ±. . ± . . . . .

Imbil . ± . . ± . . . -. .

Crohamhurst . ± . . ± . . . -. .

D Aguilar . ± . . ± . . . . .

(b) Site N A AR uA rAHe Ho FIS M-ratio

Wrattens* . ± . ± . . . . .

Woondum . ± . ± . . . Ͱ.͵ͰͲ .

Conondale . ± . ± . . . -. .

D Aguilar . ± . ± . . . -. .

Genetic bottlenecks and inbreeding

BOTTLENECK and FIS analysis did not detect significant heterozygosity excess or inbreeding, respectively, at any site for A. mysticus. However, evidence of a significant genetic bottleneck was found in one A. subtropicus population (Wrattens) which also had a substantially lower M-ratio (.) than the other A. subtropicus populations (average for all populations: .). The Wrattens

81

Autecology

population also had a high, but not significant, FIS value (.). FIS analysis returned one A. subtropicus population (Woondum) with evidence of significant inbreeding (.) (Table .). All A. mysticus sites had M-ratio values substantially below the critical value Garza and Williamson () calculated for wild populations (.) (Table .). In contrast, Wrattens was the only population of A. subtropicus with an M-ratio substantially below this critical value (Table .).

Spatial patterns

A. mysticus

AMOVA showed % of total genetic variation partitioned among the six A. mysticus populations (p = <.). If the Eungella population was excluded, the total genetic variation between populations fell slightly (%; p = .). However, if the Cooloola population was excluded, total variation among populations fell by % (%; p = <.). When Eungella and Cooloola were both excluded, total genetic variation among the four SE Qld A. mysticus populations was % (p = .).

Pairwise RST estimates revealed significant structure among all A. mysticus populations, excluding the geographically close Mapleton and Imbil populations (km). No structure was found between these two sites (RST = ) (Table .). The northernmost SE Qld site, Cooloola, exhibited more differentiation (RST: .-.) than the geographically more isolated

Eungella site (RST: .-.) (see Table .). Differentiation was substantially lower between the other sites (-.) (Table .). PCA was used to visualise the overall pattern of genetic structure, with the first two axes capturing .% of variation (Fig. .). Three main genetic clusters were revealed, corresponding to Eungella, Cooloola and the remaining SE Qld sites (Crohamhurst, D’Aguilar, Mapleton, Imbil) (Fig. .).

82 Chapter Four

Bayesian clustering analysis revealed a similar pattern of genetic structure. The Evanno et al. () method identified two groups (K = ) (Fig. .c). Graphical representation revealed one group to largely correspond to Cooloola and the other group to contain all other populations (Fig. .a). However, exploration of additional groupings revealed further population structuring. The geographically isolated Eungella population was revealed at K = as a separate cluster. Cooloola represented a second cluster which showed a small amount of admixture with the third grouping, which encompassed the other SE Qld populations (Fig. .b). Increasing K to higher values increased admixture and did not reveal further biologically informative groupings (data not shown).

Table .. Pairwise RST estimates of A. mysticus (a) and A. subtropicus (b) populations for and amplified microsatellite loci, respectively. Significantly different pairwise population comparisons (p = <.) are shown in bold.

(a) Eungella Cooloola Mapleton Imbil Crohamhurst Eungella Cooloola Ͱ.ͶͶ͵Ͷͱ Mapleton Ͱ.ͳͲͳͲ͸ Ͱ.͵ʹͶͲ͸ Imbil Ͱ.ʹͲͱʹͷ Ͱ.͵͵ͲͰͶ Crohamhurst Ͱ.Ͳ͸ͷͱ͵ Ͱ.͵Ͱͳͱ͵ Ͱ.Ͱ͸ͳͲͳ Ͱ.ͱͰʹͰͲ D Aguilar Ͱ.ͳ͸Ͱʹʹ Ͱ.Ͷͷ͵͵ͱ Ͱ.ͱ͵Ͷ͹ͷ Ͱ.ͱͰ͹Ͱͱ Ͱ.Ͳ͵Ͷ͸Ͳ

(b) Wrattens Woondum Conondale D Aguilar Wrattens Woondum Ͱ.Ͱ͹ͳͱͱ Conondale Ͱ.ͱͲʹ͹ʹ Ͱ.ͱͲͶͶͲ D Aguilar Ͱ.ͱ͹ͳͱ͸ Ͱ.ͱͳ͹ͱ͹ Ͱ.ͱͳ͵͸͵

For A. mysticus, Mantel tests did not indicate a significant relationship between genetic and geographic distance (Rxy = ., p = .). However, when the geographically divergent Eungella population was excluded, a significant effect was found (Rxy = ., p = .). A significant, although less pronounced, effect was also found if the genetically divergent Cooloola

83

Autecology population was excluded (Rxy = ., p = .). However, when both Eungella and Cooloola were excluded a significant relationship was not resolved between the remaining four SE Qld populations (Rxy = ., p = .).

A. subtropicus

AMOVA revealed .% of total genetic variation partitioned between the four

A. subtropicus populations (p = <.) and pairwise RST estimates showed a significant difference between all A. subtropicus populations. Unlike A. mysticus, no sites were highly differentiated from other sites (RST range: .- .) (Table .). Rather, differentiation appears largely driven by isolation- by-distance in A. subtropicus (Rxy = ., p = .).

0.350 0.300 Eungella 0.250 0.200 0.150 0.100 0.050 Axis 2 0.000 Crohamhurst -0.050 D'aguilar Cooloola Mapleton -0.100 -0.150 Imbil -0.200 -0.200 -0.100 0.000 0.100 0.200 0.300 0.400 0.500 Axis 1

Figure .. Population differentiation among the six A. mysticus populations sampled, visualised using Principal Coordinate Analysis.

Of the three equidistant (~km) sites, Conondale was similarly divergent from the other two sites (range .-.% pairwise divergence), but Woondum and Wrattens were more closely related (.%) (Table .). The more geographically separate D’Aguilar site (range -km from the other sites), was consistently more genetically divergent (range: .-.%) than the other sites (Table .). PCA was used to visualise the overall pattern of genetic

84 Chapter Four structure, with the two axes capturing .% of variation (Fig. .). Conondale and D’Aguilar were more divergent than Wrattens and Woondum, but the distance between all sites was not large (Fig. .).

Following the Evanno et al. () method, Bayesian clustering analysis using STRUCTURE revealed two groupings (K = ) (Fig. .c). Graphical representation revealed these to largely correspond to () D’Aguilar and () the other three populations (Fig. .a). Admixture between D’ Aguilar and these sites decreased as geographic distance increased (Fig. .a). As for A. mysticus, the Evanno et al. () method appeared to underrepresent population structure in A. subtropicus. Graphical representation of K = (Fig. .b) also showed D’Aguilar to form a largely discreet grouping, but additionally showed Wrattens to be separate from the Woondum/Conondale populations, which formed a third grouping (Fig. .c). Increasing the K to greater than three did not reveal further meaningful structure (data not shown).

85

Autecology

(a)

Eungella Cooloola Mapleton Imbil Crohamhurst D’Aguilar (b)

Eungella Cooloola Mapleton Imbil Crohamhurst D’Aguilar

(c)

Figure 4.3. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci for A. mysticus obtained from sites across the known range of the species. Each plot represents different population assignments for K: (a) K = ; and (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. A graph of the relationship of ∆K to K is shown in panel (c).

0.200

0.150 Conondale

0.100

0.050

Axis. 2 0.000 Wrattens -0.050 D'Aguilar -0.100 Woondum

-0.150 -0.200 -0.150 -0.100 -0.050 0.000 0.050 0.100 0.150 0.200 Axis 1

86 Chapter Four

Figure 4.4. Population differentiation among the four A. subtropicus populations sampled, visualised using Principal Coordinate Analysis.

(a)

Wrattens Woondum Conondale D’Aguilar

(b)

Wrattens Woondum Conondale D’Aguilar

(c)

Figure .. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci for A. subtropicus obtained from sites in SE Qld. Each plot represents different population assignments for K: (a) K = ; (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. A graph of the relationship of ∆K to K is shown in panel (c).

87

Autecology

4.4 DISCUSSION

Genetic structure and diversity

We used microsatellite analysis to provide the first investigation of population genetic structure and gene flow across the geographic range of two SE Qld small carnivorous marsupials, A. mysticus and A. subtropicus. The baseline demographic data generated provides critical information for management of the two species. Unsurprisingly, given its geographic isolation, the only known A. mysticus population in ME Qld was found to be deeply genetically differentiated. However, unexpectedly, the northernmost SE Qld A. mysticus population, Cooloola, was also clearly differentiated from the other proximate SE Qld populations. Moreover, contrary to expectations, even if these two differentiated A. mysticus populations were excluded, genetic variation was significant and comparable between populations of both Antechinus species in SE Qld (Table .). The microsatellite differentiation among these Antechinus populations appears larger than recorded between populations of the broad- ranging A. f. flavipes in south-east Australia (pairwise RST = <. over ~km) (Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Thomson et al. ) and between A. agilis over a much greater geographic distance (>km; pairwise RST = .-.). However, geographically proximate populations of A. agilis with different nipple numbers show much greater differentiation (pairwise RST = .-.) (Beckman, Banks et al. ). However, this has been attributed to insipient speciation (Beckman, Banks et al. , Draper ). Differentiation recorded in the current study was also greater than that found between Australian mainland or Tasmanian populations of the large Australian carnivorous marsupials (quolls and Tasmanian devil) (Firestone, Houlden et al. , Jones, Paetkau et al. , Cardoso, Eldridge et al. , Cardoso , Cardoso, Mooney et al. ). Unfortunately, few comparative studies have been undertaken on other small carnivorous marsupials, although greater population differentiation was unsurprisingly found between mainland and island populations of the endangered dibbler, Parantechinus apicalis (pairwise

88 Chapter Four

RST = .-.) (Mills, Moro et al. ). Population genetic diversity found in the current study was comparable to the more vagile threatened brush- tailed rock-wallaby, Petrogale penicillata (pairwise FST = .-. over km) (Hazlitt, Goldizen et al. ).

Allelic richness (AR), expected and observed heterozygosity (He and Ho) were moderate for all populations except A. mysticus at Cooloola, which had low values. Excluding this population, their values were lower than reported for congeners A. flavipes (AR = .-.; Ho = .-.) and A. agilis (AR = .- .; He = .-.) (Beckman, Banks et al. , Lada, Thomson et al. ). Similar to two threatened marsupials, the brush-tailed rock-wallaby (AR = .-.; Ho = .-.) (Hazlitt, Goldizen et al. ) and mainland populations of the northern quoll (AR = .-.; Ho = .-.) (Cardoso, Eldridge et al. ) and higher than reported for two threatened marsupials, the eastern quoll (AR = .-.l; Ho = .-.) (Cardoso, Mooney et al. ) and Tasmanian devil (AR not reported; Ho = .-) (Jones, Paetkau et al. ). Overall, the moderate to high level of structure between populations of both Antechinus species studied here, combined with gene diversity and heterozygosity similar to levels reported for threatened marsupials, suggest A. mysticus and A. subtropicus are isolated in a patchwork of relatively unconnected populations across SE Qld and may be at risk of localised extinction. This idea is discussed further below.

Microsatellite differentiation among A. mysticus populations

Both RST and Bayesian clustering analysis revealed two populations of A. mysticus, which were strongly differentiated from the other SE Qld populations. The first of these, Eungella, was expected, given its geographic (> km) isolation from all other known A. mysticus populations (Chapter Three). Furthermore, A. mysticus was found to be >% divergent at Cytb from all other known (SE Qld) A. mysticus populations (Chapter Three). However, the second highly differentiated population, Cooloola, was surprising.

89

Autecology

Cooloola is the northernmost known population of A. mysticus in SE Qld. Mitochondrial analysis showed it to be only minimally divergent (one base pair different) from other haplotypes identified in SE Qld A. mysticus (Chapter

Three). However, both RST and Bayesian clustering identified Cooloola as a distinct population to all others sampled (Fig. ., Table .). This structure was not a result of misidentification. Visual (pelage) inspection of captured individuals (which is diagnostic, see Baker et al. ) and Cytb sequencing clearly identified all individuals genotyped here as A. mysticus (see also Chapter Three). Cooloola A. mysticus also have a similar allele size range to the other A. mysticus populations genotyped (Table .) and, like all A. mysticus in this study, failed to sequence for the locus AaQ. This locus was successfully sequenced for A. subtropicus and has previously been sequenced for A. flavipes, the other Antechinus species known to occur in this area (Lada, Mac Nally et al. , Van Dyck, Gynther et al. ).

The lack of concordance between Cooloola microsatellite and Cytb results may be driven by natural selection acting on Cytb. However, Cytb patterns are otherwise well aligned with known biogeographic barriers (Chapter Three) and morphological variation in Antechinus (Baker, Mutton et al. ). Furthermore, strong selection pressure on Cytb is often associated with very high altitude environments (e.g., Li, Malyarchuk et al. , Zhang, Lin et al. ), which was not a factor in the present study (altitude of A. mysticus sites: -m).

It therefore seems that the low Cytb and high microsatellite divergence seen within SE Qld A. mysticus may primarily be driven by the different evolutionary speeds of the two marker types (Sunnucks , Bhargava and Fuentes ). Such an explanation has also been suggested for a similar difference between Cytb and microsatellite results in another Antechinus species, A. agilis (Beckman, Banks et al. ).

90 Chapter Four

Cytb divergence between Eungella and SE Qld A. mysticus has been dated to the mid-Pleistocene (. Ma) (Chapter Two). Throughout the Pleistocene, there was a general trend of ongoing aridification in southern Australia (Martin ) superimposed with climatic cycling of glacial/interglacial periods, which became less frequent (~ thousand years) but of higher amplitude from the mid-Pleistocene (Zachos, Pagani et al. ). It has been postulated that this climatic cycling caused population contraction and expansion in a number of mesic species (Byrne, Steane et al. ). Perhaps SE Qld A. mysticus retracted to a refugium during a glacial period, where they experienced a genetic bottleneck, resulting in the current low Cytb genetic diversity. The species may have subsequently expanded throughout SE Qld in an interglacial period, before later aridification and human modification of the environment could have isolated A. mysticus in a number of fragmented populations in SE Qld. If so, fragmentation over the last hundreds-thousands of generations may have left a signature of genetic structuring as shown by microsatellite, rather than mitochondrial markers.

Given its significant microsatellite differentiation from the other SE Qld populations, it is possible that Cooloola was the first extant SE Qld A. mysticus population to become isolated. However, it is not immediately clear why this would have occurred; no obvious geographic boundary to movement is apparent between Cooloola and southern populations. The region is not high in vertebrate endemism, although a population of the delicate skink, Lampropholis delicata, from Cooloola appears similarly different from its SE Qld conspecifics (Chapple, Hoskin et al. ). There is also a species of carabid beetle endemic to Cooloola. However, this species appears to have diverged from a Kroombit Tops congener much earlier, interestingly at a similar time to when A. mysticus and A. argentus from Kroombit Tops apparently separated (Chapter Three; Sota, Takami et al. , Takami and Sota ). It is also possible that the results indicate incipient speciation of the Cooloola A. mysticus population, as has been suggested as occurring in A.

91

Autecology agilis populations which also show deep microsatellite but low Cytb divergence (Beckman, Banks et al. , Draper ). Perhaps A. mysticus at this location diverged in response to unique environmental pressures at this coastal, predominantly sandy, location (Gontz, Moss et al. ).

Cooloola was the only A. mysticus population with very low (~.%) trap success. This population also exhibited lower Ho and AR than the other A. mysticus populations. This suggests that the population is both small and isolated; factors which may cause high differentiation in RST (Wright , Holsinger and Weir ). However, unique (uA) and rare (rA) alleles were not high in the Cooloola population, to be expected if the population had long been isolated. Taken together, these results suggest that the strong differentiation of the Cooloola A. mysticus from other populations is more likely driven by low abundance and recent isolation rather than long-term divergence from conspecifics or incipient speciation.

The furthermost limits of a species’ range represent the bounds of suitable habitat and are often suboptimal habitat (Parmesan ). It may be that Cooloola represents such a habitat for SE Qld A. mysticus and that it is becoming unsuitable or degraded in the face of warming temperatures from climate change (Parmesan ). This could explain the low genetic diversity and small population size observed in this population (Table .). Cooloola is the southern extension of Fraser Island, to which it has been connected for most of the ~ kya since formation (Gontz, Moss et al. ). Antechinus mysticus is not known from Fraser Island (where only A. flavipes is known to occur) but it has not been actively sought there (Van Dyck, Gynther et al. ). Discovery and genotyping of A. mysticus from Fraser Island would help further understand the population structure of this species in this region.

Comparative population structure between A. mysticus and A. subtropicus

92 Chapter Four

It was hypothesised that A. mysticus utilises a broader and more connected array of habitats in SE Qld than A. subtropicus. Antechinus subtropicus is widely considered to be restricted to altitudinal vine and rainforest (Van Dyck , Van Dyck and Crowther , Crowther, Sumner et al. , Van Dyck and Strahan ). If true, less microsatellite structure between SE Qld populations of A. mysticus relative to A. subtropicus would be expected. However, as indicated above, this was not the case. This seems unlikely to be driven primarily by different dispersal capacity, as these species and all Antechinus appear to share relatively similar life-histories and dispersal capacities (Chapter Five; Dickman , Watts ). Higher AR and lower M- ratio values suggest some of the differentiation in A. mysticus is driven by anthropogenic effects (see below). However, given the large extent of differentiation reported it is also likely that A. mysticus utilises a more restricted array of habitats than previously assumed. On two mountains in SE Qld (D’Aguilar and Conondale NPs) A. subtropicus and A. mysticus are known to occur without congeners, with the former occurring in higher, more closed habitats than the latter. One other Antechinus species, A. flavipes, occurs in SE Qld. This species is broadly distributed throughout the region but was not caught at any of the study sites. Rather, it is predominately found in drier, more open sclerophyll habitats than either species (Baker et al. ). Indeed, A. flavipes was found in low density in drier habitats nearby a number of sites in this study (D’Aguilar, Cooloola, Crohamhurst). Therefore, it seems likely that the three SE Qld Antechinus species are largely partitioned into separate habitats, with A. subtropicus in wet, closed high altitude sites, A. mysticus in intermediate habitats and A. flavipes in drier, open and low altitude habitats. Taken together, this suggests that A. mysticus, like A. subtropicus is likely isolated to islands of mesic habitat. If so, A. flavipes should show less population structure than A. mysticus or A. subtropicus across the same range. This would be a valuable future investigation. Interestingly, as mentioned, A. flavipes in south-east Australia appear to show less population structuring than revealed between the two species of this study, suggesting a similar result

93

Autecology may be found in SE Qld (Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Mac Nally et al. , Lada, Thomson et al. ).

We reported observed heterozygosity and rare alleles at moderate levels for both A. mysticus and A. subtropicus. However, allelic richness was higher in all A. mysticus populations, except Cooloola, than in any A. subtropicus population (Table .). Further, M-ratios were generally much lower in A. mysticus (Table .). This suggests A. mysticus was previously more connected than A. subtropicus but has recently undergone population contractions throughout its range (Nei, Maruyama et al. , Garza and Williamson ). SE Qld has experienced a remarkably high rate of land clearing in the years since European settlement (Cogger, Ford et al. , Bradshaw ). The more open and lower altitude habitats that A. mysticus utilise are also more easy to clear and utilise for humans and thus have likely experienced greater land clearing rates (McAlpine, Fensham et al. , Cogger, Ford et al. , Bradshaw ). This was evident in two areas in this study: Conondale and D’Aguilar, where the high altitude areas where A. subtropicus occurs are more intact and have been preserved as national parks since the s (NPRSR n.d., NPRSR n.d.). However, the habitat of A. mysticus occurs on the edge and outside the national park at both locations, where heavy modification and land clearing by humans has occurred.

Conservation

Overall, genetic diversity and trap success were moderately high for both species, suggesting neither species is at imminent extinction risk. However, M- ratios indicate that all A. mysticus populations may have recently (last hundred years/generations) undergone population bottlenecks. Threats such as land clearing, introduced predators and climate change may have caused population reductions in A. mysticus and will continue to affect the species (Woinarski, Burbidge et al. ). Parallel trapping efforts indicate that A. mysticus is scattered, in very low density or absent over large tracts of

94 Chapter Four ostensibly suitable forest between Cooloola (SE Qld) and Eungella (ME Qld) (Chapter Three). But the present study also highlights that SE Qld populations of A. mysticus, previously hypothesised to be well-connected, are in fact highly structured and fragmented. Across its range then, A. mysticus may occur patchily, and in the face of ongoing threats, may ultimately warrant listing in a threatened category. It is clear that a more detailed mapping of A. mysticus’ range and habitat use in SE Qld is needed if this recently discovered species is to be effectively conserved in the future. The low trap success and genetic diversity of A. mysticus at Cooloola suggest the species’ ranges may be contracting. This is likely to continue in response to anthropogenic climate change (Pachauri, Allen et al. ) and may indicate that A. mysticus is at risk of localised extinction. In the future, monitoring of both species should be undertaken to ensure genetic diversity is maintained.

95

Autecology

96 Chapter Five

Chapter 5: Life history and ecology of a new species of carnivorous marsupial, the buff-footed antechinus (A. mysticus) and a sympatric congener

This data chapter is being prepared for submission to the journal: Mammal Research

Title: Life history and ecology of a new species of semelparous breeding mammal, the buff-footed antechinus (A. mysticus), compared to a sympatric congener.

Authors: Thomas Y. Mutton12, Andrew M. Baker1 and Susan J. Fuller1

Earth, Environmental and Biological Sciences School, Queensland University of Technology, George St, Brisbane, Queensland , Australia. Corresponding author, Email: [email protected]

Keywords: Antechinus mysticus, Antechinus subtropicus, dasyurid, mammal, life-history, congeneric competition, carnivorous marsupial, semelparity

Author contribution: Conceived and designed the experiments: TM AB SF. Performed the experiments: TM. Analysed the data: TM. Contributed reagents/materials/analysis tools: TM AB SF. Wrote the paper: TM.

Abstract: Antechinus are one of just a few mammal genera which exhibit semelparous (‘suicidal’) reproduction. Consequently, the breeding biology and life-history

97

Autecology of many Antechinus has been well-studied. However, this is not true for a number of recently discovered Antechinus species. Here, the first multi-year ecological study of breeding, growth and movement on one of these species, the buff-footed antechinus, A. mysticus, was undertaken. Over a two year period, monthly capture-mark-recapture data from two geographically close (~.km apart) sites in south-east Queensland, Australia was collected. At one site, the subtropical antechinus, A. subtropicus, also occurred. This allowed for the investigation of possible competitive effects by this larger Antechinus species on A. mysticus. Results showed A. mysticus followed the synchronous, semelparous breeding strategy seen in all Antechinus. Males were last caught in August at both sites and females gave birth in September, suckling a maximum of young. Average movement (M: m, F: .m) by A. mysticus was comparable to other congeners. Mating timing for A. mysticus was ~- weeks later at the higher altitude site where the two Antechinus species co- occurred. Competition with A. subtropicus may affect A. mysticus, as A. mysticus weighed more and males moved further when not in sympatry with A. subtropicus. However, female A. mysticus moved further when in sympatry with A. subtropicus, confounding any clear interpretation about possible effects of interspecific competition. Overall, the present study provides foundational life-history information on A. mysticus which will aid conservation management of the species.

5.1 INTRODUCTION

Effective conservation relies on comprehensive species-level ecological information (Groom, Meffe et al. ). In the Australian small carnivorous marsupial genus Antechinus, four new species have been discovered in the last few years (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ). Given Australian mammals have experienced an extraordinarily high rate of extinction in the last ~ years (Woinarski, Burbidge et al. ), there is an urgent need for fundamental

98 Chapter Five ecological information to be provided on recently discovered and little understood species.

Antechinus are small (-g), predominantly insectivorous marsupials which utilise a range of mesic environments across Australia (see Chapters Two and Three). Species vary from ground-dwelling to semi-arboreal and show sexual dimorphism for size, with females being on average smaller than males (Van Dyck, Gynther et al. ). Antechinus are largely nocturnal, although daytime activity is common in some species and one population of the mainland swamp antechinus (A. minimus maritimus) has been recorded as mainly diurnal (Van Dyck and Strahan , Sale and Arnould ).

Antechinus are one of only a few genera of mammals known to undertake semelparous, ‘suicidal’ mating and consequently their breeding ecology has been the subject of a number of studies (e.g., Marlow , Woolley , McAllan, Dickman et al. , Fisher, Dickman et al. ). They have a short (- week), annual, highly synchronised mating period followed by total male mortality after immune system collapse when testosterone surges cause a failure in the cortisol (stress hormone) shut-off mechanism (Woolley , Wood , McAllan, Dickman et al. ).

Breeding timing in Antechinus species varies little from year to year at a geographic location, but may be up to four months different across a species’ range (McAllan, Dickman et al. ). Timing of breeding for most species appears linked to different and characteristic rates of change of photoperiod (McAllan, Dickman et al. ). It has been suggested that breeding timing is under selection pressure to allow females to rear young when food is most readily available (McAllan, Dickman et al. , Fisher, Dickman et al. ).

99

Autecology

This may also explain why no sympatric Antechinus species have been found breeding synchronously, as congeneric competition should decrease food availability in this crucial period (Crowther and Blacket , McAllan, Dickman et al. ).

Antechinus occupy small home-ranges (<.km) (Marchesan and Carthew , Sale , Sale and Arnould ). In males, dispersal occurs during two periods: after weaning (~- months) when males disperse to establish a home range and just prior to and during the mating season (Smith, , Cockburn et al., , Kraaijeveld-Smit et al., , Marchesan and Carthew, ). As is common in mammals, female antechinus are more philopatric, generally establishing home-ranges near (or in) their natal areas (Smith, , Cockburn et al., , Kraaijeveld-Smit et al., , Marchesan and Carthew, ).

As Antechinus species utilise similar food resources and shelters, it is likely that competition between sympatric species influences their behaviour, reproductive success and evolution. Indeed, Dickman (a; b) found evidence of competition between the larger, more ground-dwelling A. mimetes (then classified as A. swainsonii) and the smaller, more arboreal A. agilis (then A. stuartii). When A. mimetes was removed from a location where it was sympatric with A. agilis, a shift to more diurnal and ground-based activity occurred (Dickman , Dickman ). Furthermore, an increase in home- range size and survivorship of newly weaned A. agilis was also recorded (Dickman , Dickman ).

The present study represents the first comprehensive ecological assessment of one of the newly discovered Antechinus species, A. mysticus, based on two consecutive years of capture-mark-recapture data from two proximate sites. Comparative ecological data from a sympatric congener, A. subtropicus, is also

100 Chapter Five presented from one of these sites. Antechinus subtropicus has been the focus of previous ecological study in high altitude rainforest (Wood , Braithwaite , Braithwaite ) but this is the first time an ecological study of a lower altitude A. subtropicus population has been undertaken.

Gray’s () honours thesis investigated the fine-scale breeding timing of A. mysticus and A. subtropicus across a single breeding season, trapping intensively every third day for three months during the second year of the present study at the two sites studied here. Gray’s study falls within the broader scope of the present ecological work. Pearce () investigated comparative breeding ecology and growth within A. mysticus, at the latitudinal extremes of the species’ known range (Cedar Creek, SE Qld and Eungella, mid-east Qld). The present study is thus the first which monitors A. mysticus over multiple years and outside the few months around their breeding period. It also presents a novel comparison of A. mysticus with and without the presence of a sympatric congener, A. subtropicus. Antechinus subtropicus has been the focus of previous ecological study in high altitude rainforest (Wood , Braithwaite , Braithwaite ) but this is the first time an ecological study of a lower altitude A. subtropicus population has been undertaken.

The primary aim of this study was to provide the first detailed ecological information on A. mysticus, including novel information on its life history, home-range, population size, breeding ecology and movement in the months leading up to, during and post breeding. It was predicted that A. mysticus, like its congeners, would exhibit male-biased movement, have a highly synchronised breeding period followed by complete male die-off and that males would be significantly larger than females. A secondary comparison of A. mysticus populations in and out of sympatry with A. subtropicus was undertaken to explore possible intraspecific competition effects. Following

101

Autecology

Dickman (a; b), it was predicted A. mysticus would, on average, be smaller and move shorter distances at the site where they occur in sympatry with A. subtropicus. Third, autecological data on the relatively low altitude (~m) A. subtropicus population was compared to previous published studies of a nearby (~km away) high altitude (~m) population (Wood , Braithwaite , Braithwaite ). It was postulated that this lower altitude site represents marginal habitat for A. subtropicus (see Chapter Four); it was therefore predicted that A. subtropicus would occur in lower abundance and size at this site.

5.2 METHODS

Study Areas

The present study was undertaken at two sites approximately .km straight line distance apart: Andy Williams Park (AW; -. S, . E; m ASL) and Donny Williams (DW; -. S, . E; m ASL). The latter spanned both private property and the edge of D’Aguilar NP. Both sites are situated along the Cedar Creek River, adjacent to Cedar Creek Road, in Cedar Creek, ~km north-west of Brisbane, Queensland, Australia. The sites occupy different habitat types, with AW being drier open forest dominated by Eucalyptus, melaleuca and Lophostemon confertus (Regional Ecosystems .. and ..). DW contains a mix of closed forest and subtropical rainforest communities, dominated by Corymbia intermedia, Eucalyptus species, Lophostemon confertus, Lantana camara and notophyll vine forest (Regional Ecosystems .. and ..). These closely proximate sites were chosen to permit comparison of two adjacent A. mysticus populations, one in sympatry with A. subtropicus (DW) and one not in sympatry with any congeners (AW).

Trapping At both sites trapping was conducted monthly between August and November in and April and October in . At AW, trapping was also undertaken

102 Chapter Five in July . Although equal trap effort across years was aimed for, limitations became apparent in the initial trap layout. Consequently, trap locations had to be changed after the first few months (May-July) of trapping in and this data could not be used. Type A Elliott traps were used (Elliott Scientific, Victoria, Australia) to capture antechinus. Three nights per site per month were trapped within the first ten days of each trapped month. Trapping was not undertaken on consecutive nights which ensured antechinus had every other night free to forage naturally.

To minimise the time animals spent in traps, traps were checked as close to dawn as possible. Traps were closed during the daytime and opened near dusk, in an effort to limit disturbance by the Australian brush-turkeys (Alectura lathami), which were common at both sites. Following previous studies (e.g., Friend , Dickman , Tasker and Dickman , Marchesan and Carthew ) traps were baited with a mixture of peanut butter and oats.

At both sites traps were laid parallel to Cedar Creek; with one line of traps laid on the eastern side of the creek and one line of traps laid on the western side of the creek. Traps were laid at metre trapping intervals. To increase the capture rate of A. subtropicus, an additional line of traps, called the O line, was laid m straight line distance (SLD) up the eastern side of the mountain at DW in November and for all trapping in . Due to the riparian zone, topography and privately owned patches of land interspersing trappable areas, a balanced sampling design on either side of the creek or standard GPS-marked grid was not possible. At the time of study commencement, this was the only known accessible population of A. mysticus. This prevented consideration of any alternate study site that may have otherwise permitted a more standardised trap array.

All Antechinus captures were identified to species by eye based on distinguishing pelt colour (as per Baker et al. ), weighed (to the nearest .

103

Autecology of a gram using Pesola spring balance) and their reproductive condition assessed (see below). The first time each individual was caught it was ear clipped (for genotyping in Chapter Four) and a Passive Integrated Transponder (PIT) tag (Biomark) was inserted. On each subsequent recapture, antechinus were then easily identified by scanning their unique PIT tag number while in the capture bag.

Reproductive Condition

When females were caught with pouch young, three were randomly chosen and crown-rump measurements taken to the nearest . mm. From this, birth dates were estimated based on the growth curve of A. mysticus reported by Gray (). The growth curve of A. flavipes was used (Marlow ) for A. subtropicus, as this is the closest related species that is most similar in size to A. subtropicus. Following McAllan et al. (), an estimation of the probable time of ovulation was calculated. As Antechinus can store sperm for up to two weeks, this is necessarily an estimation of timing of ovulation rather than mating (Selwood ). Hair loss and clearly visible nipples can be used to identify second year females, but this requires a practiced eye which was not possible in the first year of the present study.

Data Analyses

Trap success was calculated for the period of interest by dividing the number of captures by the number of trap nights and multiplying by to get a percentage. For both species, generalised linear modelling (GLM) was undertaken in R version .. (R Core Team ) to test the significance of year, month, site and sex on trap success and sex ratios. ‘Residents’ were classified as those caught in more than one month within a three month period and ‘transients’ were classified as those caught only once within any three month period (Wood ). Residents and transients were only calculated in the second year for male A. mysticus because few male A. mysticus were trapped in the first year of the study.

104 Chapter Five

Following previous Antechinus studies (e.g., Wood , Dickman ), abundance was measured as the minimum number of animals known to be alive (KTBA). Other estimates of population size exist, but KTBA was used to permit direct comparison with other Antechinus studies. Monthly KTBA was calculated as the number of individuals alive in a given month, plus previously caught individuals that were recaptured in later months (Krebs ). Monthly KTBA was calculated for both sites. For ease of comparison, monthly KTBA was also calculated for DW without the O line, as trap effort was equal at both sites when this line was excluded. Due to the sample design, it was not possible to distinguish whether the absence of a previously caught animal was due to emigration or death. Sex ratios were calculated by dividing the number of males by the number of females caught. As the data was not normal, the non-parametric Mann-Whitney U and Kruskall-Wallis tests implemented in SPSS version (IBM SPSS Statistics, IBM Corporation, NY) were used to compare difference in monthly minimum population size.

General linear mixed effects models (GLMMs), with PIT tagged individuals as the random effect, were used to model the effect of fixed variable (sex, site, month) on body mass. To prevent autocorrelation, only one entry per individual antechinus was used per month. If an individual was caught multiple times in a month, their mean body mass was used. GLMMs were calculated using the package nlme (Pinheiro, Bates et al. ) in R. The package MuMIn (Bartoń ) was then used to generate R values (Nakagawa and Schielzeth ) and the dredge function applied to determine the best model using the Akaike Information Criterion (AICc). From this output, the model (or models) with the least factors within four AICc of the lowest AICc model was considered the ‘best’ model (Burnham and Anderson , Grueber, Nakagawa et al. ). Differences in body mass were also compared using Mann-Whitney U tests in SPSS version .

105

Autecology

Antechinus movement was calculated as the average straight-line distance moved by an individual over successive captures within a month (AvD) (Brant ). For each species, the AvD of individuals were averaged to get the AvD of each sex for each site/month. The Observed Range Length (ORL), the maximum straight-line distance recorded for an individual between any two capture points (Kikkawa ), was also calculated and the maximum ORL for each sex of both species at each site is shown for comparison. Non-parametric Kruskall-Wallis tests were used to compare the differences in AvD and ORL.

5.1 RESULTS

Trapping

Over the course of the two years of this study, A. mysticus ( females and males) and A. subtropicus ( males, females) were caught in , trap nights (total trap nights - AW: ,, DW: ,). Of this total, individual A. mysticus ( female, male) and individual A. subtropicus ( female, male) were caught and monitored (see Table .). Antechinus mysticus was caught at both sites and A. subtropicus was caught only at DW. No other Antechinus species were caught at either site. Non-target species trap success at both sites was similar and very high for two rodents: R. fuscipes (~%) and Melomys sp. (~%). Occasional captures of the house mouse, Mus musculus, and northern brown bandicoot, Isoodon macrourus, were also recorded (data not shown).

Trap Success

Overall, trap success for A. mysticus was higher in year and remarkably similar at both sites in any given year (.% AW, % DW in year ; .% AW, .% DW in year ). Trap success for A. subtropicus was % lower than A. mysticus at DW in the first year (.%) and over % lower in the second year (.%). The overall trap success for A. subtropicus (.%) was significantly lower than overall trap success for A. mysticus (.%) (t = -.,

106 Chapter Five d.f. = , p = <.). Across the sites, monthly variation in trap success ranged from to .% for A. mysticus males and . to .% for A. mysticus females (Fig. .). For A. subtropicus, monthly trap success varied from to .% for males but was consistently low for A. subtropicus females: to .% (Fig. .).

For both species, trap success was highest in the months before male die-off (see Fig. .). Female A. mysticus had greater yearly trap success than males at both sites except the second year at DW (see Table . and Sex Ratio Results section below). In contrast, the trap success of male A. subtropicus was substantially higher than females in both years (see Fig. .). Eleven A. subtropicus were caught on the O line, representing the majority (~%) of A. subtropicus captures after this trap line was added.

Generalised linear models were constructed to test the effect of sex, year and month on the trap success of both species. The effect of site was also tested for A. mysticus. Month was the only factor significantly affecting trap success for A. mysticus (t = -., d.f. = , p = <.), with the total trap success for A. mysticus substantially higher in the months that males were alive (see Fig. .). For A. subtropicus, month was not a significant factor on trap success but sex was (t = ., d.f. = , p = <.). This is unsurprising, as the trap success of A. subtropicus was very male-biased ( males, females). There was no significant effect of year on A. subtropicus captures (t = -., d.f = , p = .). A. subtropicus were caught in the first year, which was trapped for fewer months, and were caught in the second year (Table .). The difference in yearly A. subtropicus trap success was driven by the high capture rate in the first two months of the study at DW (August, September), with captures recorded, accounting for .% of total captures for A. subtropicus (see Fig. .).

Recaptures

107

Autecology

The total number of A. mysticus recaptures varied from to % between sites and years and was higher for females than males at each site and year except year at AW (Table . ). The recapture rate of A. subtropicus at DW was % in the first year and % in the second year.

108

Autecology

Table .. Summary of trapping data (number of captures, number of individuals, percentage of individuals recaptured, average number of recaptures and trap success) for Antechinus from both study sites over the two years of the study. No data is displayed for A. subtropicus at AW, as the species was not caught at this site.

Year Species Sex Donny Williams Andy Williams Total No. No. % ind. Avg. Trap No. No. % ind. Avg. Trap No. No. % ind. Avg. of of recap. no. success of of recap. no. success of of recap. no. caps ind. recap. % caps ind. recap . % caps indi. recap. Year A. mysticus Total . . . . . (August Male . . . . . -Nov) Female . . . . . A. subtropicus Total . . ------Male . . ------Female . . ------Year A. mysticus Total . . . . . (April - Male . . . . . Oct) Female . . . . . A. subtropicus Total . . ------Male . . ------Female . . ------

110 Chapter Five

(a)

(b)

(c) (c)

Figure .. Trap success over a two year trapping period for (a) A. mysticus at AW, (b) A. mysticus at DW and (c) A. subtropicus at DW.

111 Autecology

For A. mysticus, the average number of recaptures per individual was higher in the second year when trapping was undertaken for more months, although the total number of individuals re-caught was higher in the first year at DW (see Table .). The average number of A. mysticus re-caught was higher in both years at DW than AW (Table .).

Four female A. mysticus were caught in both years of the study. Of these, three were caught at DW, representing % of the total number of females caught in the first year at this site. As second year females were not identified in the first year of trapping, it is likely that the total percentage of females which survive into a second year is higher than reported here. Only one female was caught with young in both years. No individual A. subtropicus or male Antechinus of either species were caught in both years. Following the overall trapping results, the number of transients and residents was higher for A. mysticus than A. subtropicus and was also higher in the second year, when trapping occurred over a longer period (Supplementary Table .).

Sex Ratio

Monthly sex ratios for the months in which males were captured (April-August) varied significantly between sites (X2 = 6.346 d.f = 1, p = 0.012), but not months (X2 =1.016 d.f = 4, p = 0.316) (see Supplementary Table .). Overall, a female-bias (mean: 0.77 +/- 0.656, range 0.2-2) was found at AW, while DW was strongly male- biased (mean: 1.5 +/- 0.531, range: 0.6-2). At DW, the sex ratio was male-biased in each month males were alive except the first trapped month of 2013. At this site, the sex ratio showed the greatest male bias (2-2.25) in the three months before male die- off in 2013. In contrast, sex ratios were heavily female-biased (0.2-0.25) in the last two months males were alive in 2013 at AW. The overall trap success for individual A. subtropicus was heavily male-biased (13 males and 2 females). Due to low trap success, sex ratios were not calculated for A. subtropicus.

Minimum Population Size

112 Chapter Five

Monthly KTBA did not differ significantly between sites for A. mysticus (X = ., d.f. = , p = .), although it was higher on average and in most months at DW (mean = ., Std Dev = ., range: -) than AW (mean = ., Std Dev = ., range: -) (see Fig. .). When data from the O line at DW was excluded, such that trap effort was equal between sites, the mean KTBA was higher at DW (mean = ., Std Dev = ., range: -) (Fig. .). Although not significantly different (U = , Z = -., p = .), KTBA increased markedly during the three months up to and including the mating season, before falling to its lowest levels after male die-off occurred (see Fig. .).

Antechinus subtropicus showed a similar seasonal pattern of highest monthly KTBA in the months preceding male die-off, followed by the lowest levels after the breeding season. However, overall monthly KTBA was far lower for A. subtropicus, although not significantly so (U = , Z = -., p = .). Monthly KTBA fell to zero for two months when captures from the O line were included (mean = ., Std Dev = ., range: -) and six months when captures from this line were excluded (mean = ., Std Dev = ., range: -). Monthly KTBA was not significantly different over months for A. subtropicus (U = , Z = -., p = .).

Body Mass

Both species were strongly sexually dimorphic for body mass. Antechinus mysticus males (average body mass: .g) were significantly larger (U = ., Z = -., p = <.) than females (average body mass: .g). Antechinus subtropicus males (average body mass: .g) were significantly larger than A. subtropicus females (average body mass: .g) (U = ., Z = - ., p = .). Male A. subtropicus were significantly heavier than male A. mysticus (U = , Z = -., p = .), as were female A. subtropicus relative to female A. mysticus (U = , Z = -., p = <.). For both species, females at the upper extent of their body mass range (.-.g A. mysticus; .-.g

113 Autecology

A. subtropicus) were larger than males at the lowest extent of their range (.-.g A. mysticus; .-.g A. subtropicus).

(a) 20 18 16 14 12 Site 10 KTBA 8 AW 6 DW 4 DW without O 2 0

Month and Year

(b) 7 6 5 4 Site KTBA 3 DW 2 DW without O 1 0

Month and Year

Figure .. Minimum number of (a) A. mysticus and (b) A. subtropicus known to be alive (KTBA) at AW and DW. Antechinus subtropicus was only caught at DW.

There was a clear trend of increasing body mass for males of both species as they aged. In female A. mysticus, body mass rose when they were carrying young but was relatively consistent over months otherwise (see Fig. .). There

114 Chapter Five were too few captures of A. subtropicus females to show a clear trend in body mass change (see Fig. .). Comparisons of the sites showed the mean body mass of A. mysticus at AW to be greater in .% of the studied months for males and % for females (Fig. .).

45 (a) Male 40 Female 35

30

Weight (g) 25

20

15 Jul Aug Sep Oct Nov Apr May Jun Jul Aug Sep Oct 201220122012201220122013201320132013201320132013

40 (b) Male 35 Female

30

25 Weight (g)

20

15 Jul Aug Sep Oct Nov Apr May Jun Jul Aug Sep Oct 201220122012201220122013201320132013201320132013

115 Autecology

65 (c) 60 Male 55 Female 50 45

Weight (g) 40 35 30 25 Aug Sep Oct Nov Apr May Jun Jul Aug Sep 2012 2012 2012 2012 2013 2013 2013 2013 2013 2013

Figure 5.3. Change in monthly mean body mass over the two year trapping period for (a) A. mysticus at AW, (b) A. mysticus at DW and (c) A. subtropicus at DW. Bars show standard error, values without standard error bars represents months in which only one individual was caught. Breaks in the connector lines indicate the change from the first to the second year of

GLMMs were used to test the influence of month, sex, site (for A. mysticus) and the interaction of these factors on body mass change for both species. For A. mysticus, models were compared. Following the principle of parsimony, two ‘best’ (i.e., shortest path) models with approximately equal

AICc scores (. and .) were chosen. They both included the factors month, site, sex and the interaction of month and sex. There was one difference between the models: one included the interaction of month and site and the other included the interaction of sex and site. The models therefore suggest these factors have a near equal explanatory power and also lesser explanatory power than other factors (month, site, sex and the interaction of month and sex) included in both of the models. The marginal and conditional values for the best models were . and ., respectively, indicating moderate explanatory power (Nakagawa and Schielzeth ). Five models were compared for A. subtropicus and the best model included two factors: month and sex (AICc: .). Unlike the situation for A. mysticus, the interaction of these two factors was not included for A. subtropicus. The

116 Chapter Five marginal and conditional values for the best model were . and ., respectively, again indicating moderate explanatory power (Nakagawa and Schielzeth ).

Breeding

A. mysticus

Antechinus mysticus bred synchronously at each site, over the two years of the study. In both years of the study, at both sites, male A. mysticus were last caught in August and were observed during August to show signs of breeding fatigue (hair missing, pendulous testes and lethargic behaviour) (Woolley ). Female A. mysticus at both sites always had eight nipples and carried a maximum of eight young.

Breeding pattern of A. mysticus at AW

In the first year of the study, three A. mysticus females were caught at AW on the first day of trapping in September (the nd); two of these females were without young but one had eight young ~mm long. This is approximately equal in size to hr old A. mysticus young recorded by Gray (). This individual was caught four days later with young which were now -mm long. One of the females caught on the first day was re-caught four days later with four young which were ~mm long, suggesting she gave birth on the rd or th of September. In , a female A. mysticus was also caught at AW with young indicating a very recent birth (-.mm long) at the start of September (rd). Two females were also caught three days later with young very similar in size (.-mm) to those caught exactly one year earlier. Pouch young were also caught in October of both years at AW, ranging from .-.mm long (n = ). Given that female A. mysticus appear to have given birth at around the nd-th of September in both years, ovulation would have occurred at approximately the start of August (Gray ).

117 Autecology

Breeding Pattern of A. mysticus at DW Antechinus mysticus bred significantly later at DW than AW (X = ., d.f. = , p = .). During both years of the study at DW, all female A. mysticus caught in October (n = ) had young. No females at DW had young in September (n = ), although none were caught in this month during the second year of the study. Pouch young caught in the first week of October were relatively large (n = , range: -mm), suggesting they were born - weeks previously (Gray ), just after trapping occurred in September (last capture in September: //). This would place the timing of ovulation in A. mysticus at DW - weeks later than at AW. Male A. mysticus were last caught on the last day of trapping in August for both years at DW (// and //). No females caught in November (n = ) were carrying young.

Breeding Pattern of A. subtropicus at DW

In both years of the present study, A. subtropicus males were last caught in September at DW (-th), with a number showing signs of breeding fatigue (i.e., pendulous testes, hair loss). Only one female A. subtropicus was caught after September, on November (//) with large (mm long) pouch young. No pouch young growth curve exists for A. subtropicus. However, based on the comparative growth rate of A. flavipes flavipes young, this would suggest a birth ~ days previously (Marlow ). Wood () found nearby A. subtropicus (Mt Glorious) to have a gestation period of - days; this would place ovulation of A. subtropicus in this study to around the first week of October, approximately a month later than A. mysticus at DW. As only one A. subtropicus was caught with pouch young, a statistical comparison was not undertaken

Movement

For A. mysticus, the average distance moved (AvD) within a month varied notably between sexes at AW (M: m, F: .m) but was not significantly

118 Chapter Five different (X = ., d.f. = , p = .) (Table .). The AvD was not significantly different (X = ., d.f. = , p = .) but rather very similar for both sexes of A. mysticus at DW (M: m, F: .m). The overall mean distances moved by A. mysticus were .m for males and .m for females. The AvD by A. subtropicus males (.m) was less than the AvD by A. mysticus at AW, but not DW. No movement data on female A. subtropicus was collected within months and recaptures occurred only once over the period of this study (Table .). When female A. subtropicus were excluded, the maximum distance moved over the course of the study (ORL) was similar and not significantly different for both species and sexes across the two sites (X = ., d.f = , p = .) (see Table .). The AvD of male A. mysticus increased in the last two months of their life at AW but not at DW (see Supplementary Table .). Monthly AvD showed no clear temporal pattern for A. mysticus females (Supplementary Table . ). For A. subtropicus males, AvD could only be calculated for two months (August and September).

Table .. Average distance moved between captures within a month (AvD). The maximum distance moved by an individual over the course of the study (ORL) is also shown for each sex of each species at each site they were caught at.

AvD (m) ORL Site Species Sex (m) Std N Mean Range SE Dev F . - . . AW A. mysticus M - . . F - . . A. mysticus M . - . . DW F - - - - A. subtropicus M . - . .

119 Autecology

5.2 DISCUSSION

Trap Success, Abundance and Sex Ratios

A. mysticus

A. mysticus was similarly abundant at both field sites. Overall, trap success (%) for A. mysticus was within the middle of previous estimates for other Antechinus (Woolley , Dickman , Statham , Smith , Friend , Dickman , Watts , Leung , Marchesan and Carthew , Parrott, Ward et al. , Sale , Baker, Mutton et al. , Baker, Mutton et al. ). Observed trap success of A. mysticus was higher than recorded for its threatened sister species A. argentus (.-.%) (Baker, Mutton et al. ) and approximately half as abundant as recorded for the genetically and geographically divergent Eungella (rainforest) population of A. mysticus (Pearce ).

It is difficult to compare minimum population numbers as trapping design varies between studies. However, the KTBA of A. mysticus reported here (- ), appears similar to those reported for other Antechinus, such as A. mimetes (then A. swainsonii) (Dickman ) and A. leo (Watts ) but lower than those reported for A. subtropicus and A. agilis (then A. stuartii) (Wood , Dickman ). Trapping at other locations in south-east Qld (see Chapter Three), suggests that the two sites presented here may support relatively high abundance populations of A. mysticus in south-east Qld (data not shown).

While overall trap success was similar for A. mysticus at both sites, sex ratios were not. At AW, the overall sex ratio of A. mysticus was female-biased but at DW it was strongly male-biased. Female-biased populations have been recorded in the literature for A. leo and A. bellus (Friend , Leung ). A strong male-bias has not previously been recorded for Antechinus, although A. stuartii populations may be similarly male-biased at some locations (Gray, Baker et al. in press). The differences in sex ratio observed here were largely

120 Chapter Five driven by a near : ratio of males to females caught at DW in the second year and a similar but inverse relationship of females to males at AW in the first year (Table .). This suggests the sex ratio differences between sites could be driven by random variation or temporary environmental factors. Although, Pearce () found a similar female-biased sex ratio at AW, suggesting the sex ratio variation seen here may represent more consistent differences between the sites.

Antechinus have been recorded to show strong sex bias at birth and in litters (Cockburn, Scott et al. , Dickman , Davison and Ward ) and also brood reduction (Cockburn ). Cockburn et al. () found Antechinus populations to produce strongly male-biased litters when there was a high probability of females breeding twice and female-biased litters when there was a low probability of females breeding twice. They suggested this is because female Antechinus are philopatric and therefore may compete for resources if females live into a second year (Clark , Cockburn, Scott et al. ). The majority of second year females in this study were caught at DW. Perhaps this was a factor which male-biased the sex ratio recorded at this site. Another possible explanation may be that the partially closed forest and moderate altitude of the DW site is edge habitat for A. mysticus and that the male-bias at this site represents males moving further, into substandard habitat, in the energetic last months of their life. A future study looking at the sex and subsequent survival of pouch young at these sites would be informative.

A. subtropicus Antechinus subtropicus occurs at highest densities in high altitude closed forest environments (Van Dyck and Strahan ). It was therefore hypothesised that DW may represent a marginal, lower-altitude, site for A. subtropicus in this area, with the species occurring at higher densities in the wetter and more high altitude habitats of D’Aguilar NP. This view is supported by the KTBA and trap success of A. subtropicus at DW, which is far lower than A. mysticus at either site or in Wood’s () study of nearby higher altitude A.

121 Autecology subtropicus in D’Aguilar NP. Indeed, the overall trap success of A. subtropicus at DW (.%) is similar to that of the threatened A. argentus (.-.%) and endangered A. arktos (.-.%) (Baker, Mutton et al. , Mason, Firn et al. , Gray, Baker et al. in press).

The overall sex ratio of A. subtropicus was strongly male-biased, with the majority of A. subtropicus captures (~%) occurring in the last two months males were alive in the first year of the study (see Fig. .). It may be that males roamed into this site in the last months of their life, as they reached their maximum sizes and were under the effects of increased testosterone (Naylor, Richardson et al. ). Rainfall has been proposed to have a significant influence on Antechinus survivability, abundance and overall condition (Van Dyck , Parrott, Ward et al. , Magnusdottir, Wilson et al. , Sale , Lada, Thomson et al. , Parra Faundes ). During the early months of , rainfall was far higher than average (see Supplementary Figure .), perhaps this higher rainfall increased the population size of A. subtropicus in the area and temporarily allowed the species’ range to expand into more marginal habitats, such as the DW. However, rainfall was similarly high in the early months of when this was not seen (Supplementary Figure .).

Body Mass

A. mysticus

The mean body mass of adult A. mysticus presented here are similar to those recorded for many of the smaller Antechinus species (Van Dyck, Gynther et al. ). Like all members of the genus, a clear sexual dimorphism in body mass and size was evident. The present study represents a larger and more temporally comprehensive survey of A. mysticus than previous studies (Baker, Mutton et al. , Gray , Pearce ). As trapping occurred earlier in A. mysticus’ life cycle in this study, the minimum body masses recorded for both sexes are substantially lower than reported in other studies. This also explains

122 Chapter Five the lower overall mean body mass reported here for A. mysticus males. In contrast, the overall mean body mass of A. mysticus females in this study is greater than previously reported. This is unsurprising as female A. mysticus weighed more when carrying young, a period studied over more months in this research than in previous studies (Baker, Mutton et al. , Gray , Pearce ). It is notable that Baker et al. () and Pearce () included the genetically divergent A. mysticus from Eungella, and that they are similar in body mass to south-east Qld A. mysticus.

It has been suggested that competition between sympatric Antechinus species would lead to a decrease in body mass of the smaller species (Dickman , Dickman ). In the present study, the A. mysticus population which was not in sympatry with the larger A. subtropicus (AW) had larger mean body masses, for both sexes, than the population which did co-occur with A. subtropicus (DW) (Table .). However, a comparison of monthly body mass recordings between the sites does not show a clear trend. It is also plausible that intraspecific competition would have a greater effect on the body mass of A. mysticus than the relatively low abundance A. subtropicus population. Dickman (b) found multiple signs of a larger Antechinus species having negative competitive effects on a smaller sympatric Antechinus species. However, one result was surprising, when the larger species was removed from sympatry with the smaller species, the smaller species’ body mass decreased. Dickman (b) attributed this result to increased interspecific competition. In this study, A. mysticus occurred at a slightly lower population density at the site without A. subtropicus (see Fig. ). Exactly what affect inter- or intraspecific competition has on A. mysticus body mass in this study is therefore hard to determine. A more detailed study exploring a sequence of transects across the sympatric habitat and altitude transition zones of the two species in south-east Qld would provide more scope for quantitative assessment. Of course, this would fall short of a removal/replacement study for direct comparison to Dickman’s earlier work, but such an intrusive study

123 Autecology on a species which shows signs of population decline would be hard to justify (Chapter Four).

A. subtropicus

The mean size and range of both A. subtropicus sexes recorded in this study closely align with those Wood () reported for the nearby, high altitude D’Aguilar NP conspecifics and are also similar to other studies of the species (e.g., Braithwaite , Van Dyck and Crowther , Gray ). The maximum body mass recorded for a male A. subtropicus (g) in this study is larger than previously recorded. This is a surprising result, as the site A. subtropicus was caught at (DW) was believed to represents marginal habitat for the species (Chapter Four). However, the majority of captures were males, presumably because males disperse further than females and therefore were more likely to move into more marginal habitat. If this is true, it would then perhaps be unsurprising for an abnormally large A. subtropicus male to move further than average and be caught in a marginal habitat (Harestad and Bunnel , Lindstedt, Miller et al. , Carbone, Cowlishaw et al. ).

Movement

A. mysticus

No movement studies have previously been undertaken on A. mysticus. There were clear limitations in the sample design of this study. Nevertheless, the close similarity between the maximum distance moved by an individual within a month (AvD) and over months (ORL) (see Table . ) and the fact that the maximum ORL possible in this study (m) was greater than double the highest ORL recorded (m), suggests this study provides a reasonably accurate reflection of the movement distance of A. mysticus. This is also

124 Chapter Five supported by the concordance of distances moved here with previous estimates for congeners (see below).

Previous studies have not reported any clear relationship between Antechinus size and distance moved. The average movement distances for the similar sized A. stuartii and slightly larger subtropicus were similar to those recorded here for A. mysticus, although A. mysticus males had larger AvD and ORL in this study than reported for these species (Wood , Gray, Baker et al. in press). The recorded AvD and ORL for two larger species (A. flavipes, A. leo), are mostly greater than for A. mysticus (Smith , Leung , Marchesan and Carthew , Carthew, Jones et al. ). However, movement of one much larger species, A. minimus maritimus, was lower than for A. mysticus, contradicting this trend (Wilson, Bourne et al. ). There have been relatively few movement studies of Antechinus. Further studies are needed to determine the relationship between size and habitat preference on Antechinus movement.

In many marsupials, males have notably larger home-ranges than females (Claridge, Paull et al. , Bos and Carthew ). This does not seem to be the case for Antechinus at most stages of its life, with most studies showing no strong difference in movement patterns between Antechinus sexes (Watts , Leung ). However, there are two exceptions to this general pattern; when males disperse to new territories after weaning and during the breeding season, when males increase their movement in search of mates (Smith , Cockburn, Scott et al. , Marchesan and Carthew ). It was likely that, in the present study, Antechinus were only trapped during the latter dispersal period. It was expected that males would move significantly further during their breeding season; but this was not found. In fact, no significant difference was found between monthly AvD for A. mysticus males or females at either site. Indeed, the AvD of male A. mysticus at DW was lowest in the two months before they died (Supplementary Table . ). However, this is not true at AW,

125 Autecology where males moved further during the last two months of their life (Supplementary Table . ). As expected, female A. mysticus did not appear to show any clear seasonal pattern in movement (Table .).

It is unclear why male A. mysticus do not appear to have increased movement during the breeding season at DW. One possible explanation is congeneric competition from the larger A. subtropicus. As previously discussed, Dickman (a; b) also studied sympatric Antechinus populations in which a larger, more ground-dwelling and less abundant species (A. mimetes) and a smaller, more arboreal and abundant species (A. agilis) were present. When he removed the larger species from the population, the distance moved by the smaller species increased. Therefore, it could be that the presence of A. subtropicus is supressing the movement of A. mysticus males at DW. However, Dickman (b) found the movement of both sexes of the smaller Antechinus species to decrease when in sympatry with the larger species. In comparison A. mysticus mean AvD at DW was found to be ~m lower for males but ~m greater for females than at AW (Fig. .). As previously discussed, DW has a slightly greater density of A. mysticus than AW and it may be that interspecific competition is affecting movement. It may also be that the differences are driven by environmental differences, such as less movement because resources are more abundant at the wetter and more densely vegetated DW site. However, the number of measurements of male movement at AW is relatively small (), suggesting this difference in male movement, at least in part, could also be an artefact of poor sample coverage (Table .).

We found evidence that male A. mysticus dispersed during the breeding period. There was an increase in transient rates during the last two months males were alive at DW (Supplementary Table . ). This presumably represents the arrival of new males to the site during their dispersal period. Such a pattern is not seen at AW, but transient rates for male A. mysticus could only be calculated in the second year of the study and the capture rate of A. mysticus males during that year at AW was very low (Table .). It is thus

126 Chapter Five possible that male A. mysticus dispersal occurred during the breeding season at both sites, with the failure of AvD to reflect this, in part, driven by males dispersing outside the bounds of the study site and not being caught.

A. subtropicus

The AvD of A. subtropicus males at DW (.m) appears larger than in Wood’s () study of nearby, higher altitude (m), A. subtropicus. However, Wood () suggested that his movement measurements could be an underestimation. Surprisingly, in this study the AvD of A. subtropicus males is similar to males of the smaller A. mysticus at DW (.m).

Breeding

A. mysticus

Antechinus mysticus gave birth at approximately the same time in both years of this study. At AW, strong evidence was found that A. mysticus gave birth in the first week of September in both years of this study. At DW, birthing time was less clear. In the second year of this study, Gray () examined breeding timing in detail at both sites, trapping every third day from the end of June to the end of September. She first caught A. mysticus with pouch young on the th and th of September at DW. It is likely that A. mysticus at DW gave birth at approximately the same time both years, as pouch young of similar size were caught in the first week of October on both years of this study. Therefore, A. mysticus appears to have bred approximately . weeks later at DW during both years of this study. Given the close geographic proximity of the sites (~.km), this is a considerable difference, although one which has been recorded in other Antechinus species (Marchesan and Carthew , McAllan and Geiser ). Altitude is known to delay the onset of reproduction in Antechinus (Dickman , McAllan ). DW is a higher (by ~m) altitude site than AW. Therefore, it is plausible that the higher altitude of this site may be linked to the later breeding period. It may also be that denser cover of DW

127 Autecology modifies perceived photoperiodic change at DW for A. mysticus (McAllan, Dickman et al. ).

A. subtropicus

Conforming to expectations, the A. subtropicus population at the higher altitude (~m) D’Aguilar NP site bred approximately - weeks later than at DW (Wood , Gray ). It has been suggested that when Antechinus species are in sympatry, the larger species will mate first (Dickman , Dickman ). That was not the case in the present study. Antechinus subtropicus, the significantly larger species, bred approximately one month later than A. mysticus at DW. Antechinus breeding correlates with peak prey availability (Braithwaite and Lee , Fisher, Dickman et al. ). Antechinus mysticus is smaller and likely more arboreal than A. subtropicus. These factors may mean peak prey availability differs for the two species. Such a difference could drive the difference in breeding timing seen in this study.

In conclusions, this study provided the first multi-year autecological information on A. mysticus. The results showed A. mysticus to be a moderately-sized Antechinus which, like congeners, utilised a relatively small home-range and follows the synchronous, semelparous mating pattern seen in all Antechinus.

128 General Discussion

Chapter 6: General discussion

The present study consisted of two complimentary components which together encompassed the full range of spatiotemporal scales concerning the evolution of Antechinus. The first component (Chapters Two and Three) sought to provide the most comprehensive systematic and phylogeographic study of the genus Antechinus to date and the second component explored the comparative population genetic structure (Chapter Four) and autecology (Chapter Five) of two Antechinus species; A. mysticus and A. subtropicus.

Taxonomic Significance Genetic studies are a powerful tool for uncovering previously overlooked taxonomic diversity. The recent finding of a cryptic species, A. mysticus, when investigating the phylogeography of A. flavipes in a relatively well-understood region (south-east Qld) fuelled our suspicion that further cryptic taxa may be present in the genus (Mutton , Baker, Mutton et al. ). However, previous genetic studies of the genus Antechinus had mostly only included a single individual of each species, being aimed as they were at resolving deeper phylogenetic placements (e.g., Armstrong, Krajewski et al. , Krajewski, Torunsky et al. , Westerman, Krajewski et al. ). This left a knowledge gap: species-level monophyly had not been formally tested, especially considering the broader geographic occurrence of various Antechinus species.

The broad-scale molecular systematic studies presented here (Chapters Two and Three) tested the monophyly of Antechinus species, they revealed a further three unknown, but now formally named species; A. argentus, A. arktos and A. vandycki (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ). A subspecies (A. swainsonii mimetes) was also raised to

129 Chapter Six full species status (A. mimetes) on the basis of substantial molecular and morphological divergence (Baker, Mutton et al. ). This research also revealed that another species (A. stuartii) likely containing a cryptic species (Chapters Two and Three), although formal revision will require detailed morphological and ecological analysis. These are significant findings; in total they represent a % increase in the recognised species diversity of Antechinus since .

Accurate taxonomic delineation underpins effective conservation management (Mace ). If five species can be found in short order in a well-studied and easily caught genus it seems likely that many other unknown mammal species exist in Australia’s diverse ecosystems and extensive landscapes. Given the well-recognised critical threats of introduced predators, land clearing, climate change and changed fire regimes to Australian mammals (Woinarski, Burbidge et al. ), the results of the this thesis highlight the urgency at which a concerted effort to better document Australia’s highly endemic mammals is needed. Otherwise Australian mammals may be unwittingly sent to extinction before they are even recognised by science. The present methodology of first sequencing broadly to discover cryptic diversity, followed by sequencing multiple molecular markers in parallel with morphological re-analysis of any divergent taxa would likely uncover many currently unknown taxa if undertaken in a broad-scale manner across Australia’s mammals. Indeed, despite the limitations of inadequate funding and political disinterest, such work continues across a range of Australia’s mammal fauna. In dasyurids alone, such work has already indicated the presence of likely cryptic species in a number of genera, such as Pseudantechinus (Westerman, Young et al. ), Sminthopsis (Blacket, Krajewski et al. , Blacket, Cooper et al. ) and Planigale (Blacket, Adams et al. , Blacket, Kemper et al. ). If a concerted effort was made to systematically undertake such work throughout Australia’s diverse and mostly endemic mammal fauna it would prove an invaluable aid to future conservation efforts and go some way towards

130 General Discussion redressing Australia’s appalling record of post-European settlement mammal extinctions. In a period where the scarcity of taxonomists has been repeatedly identified in the literature (Wägele, Klussmann-Kolb et al. ) it is worth noting some of the ways in which the parallel undertaking of morphological analysis increased the overall value of much of the molecular research presented in this thesis. For instance, this morphological work allowed for the rapid naming of species initial identified by genetic analysis (Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. , Baker, Mutton et al. ). This allowed for confident identification of these new species in the field and also generated publicity on the genus. Increased publicity resulted in the provision of useful information and resources, such as Antechinus bodies, photographs, hair and scats from members of the public and the scientific community. This increased the numbers of samples for many of the analyses presented in this thesis. Conservation outcomes were also improved by formally naming these species, for instance it allowed us to seek listing for some of these species as threatened under Australian law. Morphological knowledge also improved understanding of the evolution and autecology of these new species, such as Baker et al.’s () suggestion that the large feet of the newly discovered A. arktos may indicate it forages on the ground more often than smaller Antechinus. Given the benefits and relative ease of undertaking morphological analysis it is encouraged that more molecular ecologists consider including it in tandem with their molecular research.

Conservation Australia is in the midst of a mammalian extinction crisis, with approximately % of land mammals believed to have become extinct in the last years and a further % currently listed in a threatened category (Woinarski, Burbidge et al. ). No Antechinus are known to have become extinct since European settlement. Indeed, the group has previously been considered lower risk than many Australian mammals, as they mostly fall below the critical weight range (.-kg) of extinction-prone marsupials (Murray and Dickman

131 Chapter Six

, Johnson and Isaac ). Many Antechinus are semi-arboreal, which also perhaps provides some protection from introduced middle-sized carnivores, such as cats (Felis catus) and foxes (Vulpes vulpes), which appear to be a primary factor in the extinction and/or range reduction of the majority of Australian mammals (Woinarski, Burbidge et al. ).

However, the present research and recent work (e.g., Baker et al. ) suggests a reappraisal of the vulnerability of Antechinus to extinction is needed. Three Antechinus species, and one subspecies, have been identified as at risk of extinction under Australian law within the last two years. The only Northern Territory Antechinus, A. bellus, was recently listed as vulnerable under federal legislation, as was south-east Australia’s A. minimus maritimus. Two of the recently-named species; A. argentus and A. arktos, have been listed, respectively, as threatened and endangered in Qld, with A. arktos also listed as endangered in NSW. Federal listings are currently being sought for both species. A fourth Antechinus, A. vandycki from Tasman Peninsula, about which very little is presently known, may also be threatened (Baker, Mutton et al. ). Antechinus godmani in the wet tropics of north-east Queensland has a limited and likely fragmented montane distribution. Antechinus mysticus (and possibly A. subtropicus) populations of south-east Queensland may be more scattered, limited and poorly connected than previously thought and appear to have suffered genetic bottlenecks, suggesting they may warrant listing as threatened (see Chapter Four). Thus, at least one-third of known Antechinus species may in fact be at risk of extinction, or likely to become so in the foreseeable future.

Threatening processes for newly discovered Antechinus species Antechinus argentus and A. arktos apparently occur solely in elevationally- restricted montane habitat, generally considered to be one of the most at-risk ecosystems in Australia (Laurance, Dell et al. ). These species are likely to be thermally limited to such habitats, the climatic suitability of which may retract or disappear in response to global warming (La Sorte and Jetz ).

132 General Discussion

Indeed, it is believed that climate-induced range contraction is already occurring in A. arktos, which is currently only known from three proximate locations at the highest parts of the Tweed Caldera but appears to have occurred more widely and at lower altitude in the ’s and ‘s (Baker, Mutton et al. , pers. comms. E. Gray and I. Gynther). Similar fragmentation and range reduction may be also occurring in the north-east Queensland A. godmani (Baker and Van Dyck, ). Such processes may also limit A. argentus, which is only known from two small locations at the highest reaches of mountains and occurs at similarly low densities (Baker, Mutton et al. , Mason, Burwell et al. ). As both A. argentus and A. arktos have only recently been discovered they may be found at other locations in the future. However, their low known population densities and apparent preference for montane, cool and wet habitats suggests they are at particular extinction risk.

Little is known of the most recently discovered Antechinus, A. vandycki, but it also appears to occur at very low population density. Moreover, it is currently only known from one location, the eastern Tasman Peninsula, an area which continues to be actively logged (Baker, Mutton et al. ). It is crucial that the distribution and conservation status of this species be rapidly assessed. Antechinus vandycki and A. arktos are both members of the dusky antechinus and A. minimus lineage. Members of this lineage may have a higher extinction risk as it contains the majority of large Antechinus species (see Supplementary Table .), the male of which often reach weights within the critical weight range (above g). These species are also likely less arboreal than most other Antechinus, which may also increase the likelihood of predation from introduced predators (Van Dyck and Strahan , Johnson and Isaac ). Indeed, evidence from sooty owl deposits in Victoria appears to support this hypothesis of higher extinction risk. As the population density of the smaller, more arboreal A. agilis appears not to have significantly decreased since European arrival, whereas the larger, less arboreal dusky antechinus, A.

133 Chapter Six mimetes (then classified as A. swainsonii) has been more affected (Bilney, Cooke et al. ). As previously discussed, A. mysticus appears to be fragmented and to have experienced declines in population sizes over the last hundred years, possibly linked to the high rate of land clearing and urbanisation in south-east Qld, where the species predominately occurs (see Chapter Four).

Conservation recommendations for genetically distinct Antechinus clades

The delineation of units for management is a fundamental element of conservation biology (Frankham ). One commonly used conservation unit is the Evolutionary Significant Unit (ESU), generally taken to indicate groups with high genetic and ecological distinctiveness (Ryder , Moritz , Fraser and Bernatchez ). According to Moritz () an ESU ‘should be reciprocally monophyletic for mtDNA alleles and show significant divergence of allele frequencies at nuclear loci’. He also defined a second tier conservation unit, termed a Management Unit (MU), relating to populations which show significant allele frequency variation in mtDNA and nDNA, indicative of ‘such low levels of gene flow that they are functionally independent’. Following Moritz’s () criteria, the present study suggests that A. stuartii north and south should be managed as separate ESU’s, pending the results of ongoing work that may taxonomically classify them as separate species. In Chapter Three, a number of species were identified as containing genetically distinct clades that are as divergent as those between named Antechinus subspecies. Four such clades were identified within A. agilis (south-west Vic; south-east Vic; south-east NSW; central NSW), two clades within A. mysticus (south-east Qld; Eungella, mid-east Qld), two in A. f. flavipes (south-east Qld/north-east NSW; NSW/Vic/SA), and three in A. m. mimetes (north-east NSW; south-east NSW, ACT, south-east Vic; south-west Vic). As discussed in Chapter Three the position of south-west Vic A. m. mimetes is unclear and warrants further investigation, following the precautionary principle it has been listed as a

134 General Discussion separate clade here. I recommend each of these clades be considered as separate MU’s, pending more detailed phylogeographic and taxonomic study.

Phylogeny and Photoperiod of Antechinus

By a series of studies had established characteristic rates of change of photoperiod as the likely primary cue determining mating timing in eight of the ten Antechinus species named at the time (McAllan and Dickman , McAllan, Joss et al. , McAllan, Westman et al. , McAllan , McAllan, Dickman et al. , McAllan and Geiser ). The two species in which specific rates of photoperiodic change did not clearly correlate with mating timing were A. minimus and the species then known as A. swainsonii (henceforth referred to as ‘A. swainsonii’; now recognised as a complex containing: A. swainsonii, A. mimetes, A. arktos and A. vandycki). These two species bred at a wide range of rates of change of photoperiod. McAllen et al. () suggested a number of possible reasons for this, including that these species utilise a wider and less seasonal array of food sources than other Antechinus (Hall ) and thus were under less pressure to align reproduction with insect flushes. Or that ‘A. swainsonii’ may show more flexibility in its response to specific rates of photoperiod change, as rates of change are significantly faster at high latitudes, which the species was known to occupy. McAllen et al. () also suggested ‘A. swainsonii’ may utilise a more flexible rate of photoperiodic change because it was the dominant species when sympatric with A. agilis on mainland Australia and thus may experience less pressure to cue ovulation to optimise survival of young (Dickman , Dickman ). They also suggested there could be a phylogenetic basis to their observed divergence in mating timing, as genetic and morphological analysis (Baverstock, Archer et al. , Armstrong, Krajewski et al. , Van Dyck ) found ‘A. swainsonii’ and A. minimus formed a clade separate from all other Antechinus species.

135 Chapter Six

The results of the present study prompt the question: could the failure of ‘A. swainsonii’ and A. minimus to cue their breeding period to a specific rate of change in photoperiod be at least partly explained by the presence of cryptic species unknown at the time of McAllan et al.’s () study? As mentioned, since McAllan et al. (), ‘A. swainsonii’ has been split into A. arktos (NSW/Qld border), A. mimetes (NSW, ACT, Vic), A. swainsonii (Tas) and A. vandycki (Tas) (Baker et al. ). The taxonomy of A. minimus, however, remains unchanged (Baker and Van Dyck ). In Tasmania, McAllen et al. () found that all ‘A. swainsonii’ populations, with the exception of two outliers, ovulated at a similar rate of change of photoperiod. Unfortunately, it was not noted which two populations corresponded to these outliers. However, McAllen et al. () analysed ‘A. swainsonii’ from two broad areas in Tasmania; the north-west, from which a number of populations were analysed and the south central/east, where two populations ~km apart were analysed. If these southern populations are the outliers (which also had a similar rate of change of photoperiod), one explanation is that the north- western populations are A. swainsonii and the southern populations are A. vandycki. If true, the two species would have mating times restricted to a similarly small rate of change of photoperiod as other Antechinus species. Though tempting to suggest, it is noted that A. vandycki is only presently known from the Tasman Peninsula, ~-km south of these populations. However, given A. vandycki is the most recently discovered and least understood Antechinus, it may occur more broadly. A field survey of the Antechinus at these sites would be a productive step in further understanding A. vandycki and possibly resolving the mating timing paradox for that region.

Recently named taxa within the dusky antechinus complex cannot, however, easily explain the broad rate of photoperiod change over which mainland ‘A. swainsonii’ mates. In McAllen et al. () only one A. arktos population was sampled and populations of what is now A. mimetes showed very broad variation in the rate of photoperiod change at which they bred. Unfortunately, the rate of change for different geographic locations is not shown in the

136 General Discussion original work. The present thesis found a high level of regional phylogeographic differentiation within A. mimetes (Chapter Three). It is plausible that re-analysis of McAllen et al.’s () data, taking into account the phylogenetic structure of A. mimetes, may find specific rates of change of photoperiod which align with the phylogenetic groupings revealed in Chapter Three. Such could also be true for A. minimus, as the two subspecies were each revealed to contain two reciprocally monophyletic clades at Cytb (Chapter Three) and in McAllen et al.’s () analysis, two groupings of rates of change of photoperiod for each A. minimus subspecies were found. However, if phylogenetic structure alone is invoked to explain breeding timing discrepancies, one might also expect to observe more divergence of mating timing in the deeply phylogenetically structured A. agilis (Chapter Three). Given the present uncertainties, it is clear that a comprehensive re-analysis of photoperiod in relation to the phylogenetic patterns revealed in this thesis would be a valuable avenue for future research.

Speciation and habitat use in the south-east Queensland Antechinus and A. stuartii Habitat partitioning in south-east Queensland Antechinus The present study suggests that there may be habitat partitioning between the three south-east Qld Antechinus species. Similar partitioning has been suggested to occur in south-east Australia between A. stuartii (highest rainfall), A. agilis (intermediate rainfall) and A. flavipes (lowest rainfall) (Sumner and Dickman , Crowther ). Before A. mysticus was discovered, Van Dyck () also suggested partitioning occurred in Queensland between A. subtropicus (high altitude, wet and closed habitats) and A. flavipes (lower altitude, drier and open habitats). The results of the present population genetics (Chapter Four) and autecological (Chapter Five) studies corroborate the hypothesis that A. mysticus may occupy a habitat niche intermediate (moderately wet, mid altitude) to A. subtropicus and A. flavipes.

137 Chapter Six

The strength of such habitat partitioning in Antechinus and the relatively rapid ability of Antechinus to move into new habitats when congeneric competition is not present is likely demonstrated by the habitat preferences of A. mysticus. Antechinus mysticus does not appear to be present in the rainforest habitats that A. subtropicus utilises in south-east Qld. However, at Eungella, where the significantly larger A. subtropicus is not present, A. mysticus occurs in relatively high densities in rainforest (Pearce ). The northern subspecies of A. flavipes (rubeculus) can also utilise much wetter, more closed habitat than the two more southern A. flavipes subspecies (flavipes and leucogaster) (Van Dyck and Strahan ). Together, this suggests that Antechinus habitat preference can change between open and closed mesic environments at a subspecies or lower level.

Biogeography, competition and speciation in A. mysticus, A. subtropicus and A. stuartii In the present study, attention was focussed at a finer spatiotemporal scale on two species which occur predominately in south-east Qld; A. mysticus and A. subtropicus. It has been suggested that the Macleay-McPherson Overlap (MMO) caused the divergence of A. subtropicus from its sister species, A. stuartii (Crowther and Blacket , Crowther, Sumner et al. ). The northernmost biogeographic barrier for mesic taxa of the MMO is the Brisbane Valley Barrier (Bryant and Krosch ). Although A. subtropicus is known south of this barrier in Border Ranges National Park (Van Dyck and Crowther , Crowther, Sumner et al. ), it was not caught there in the present study (Chapters Three and Four). It is possible that A. subtropicus occurs at low density (relative to A. stuartii) in the Border Ranges. One possible explanation is that historically, populations were isolated north of the Brisbane Valley Barrier and said isolation subsequently led to speciation as A. subtropicus. Later, in a Pleistocene interglacial period, A. subtropicus may have crossed the barrier south into the Border Ranges (Chapter Three). It is possible that A. subtropicus is currently unable to persist in high-densities due to competition from abundant populations of A. stuartii (data not shown).

138 General Discussion

However, speciation of A. subtropicus from A. stuartii (north and south) may have resulted predominantly from interspecific competition rather than biogeographic barriers. Crowther and Blacket () suggested competition from the larger, and more ground-dwelling A. mimetes (then A. swainsonii) may have driven speciation of A. agilis from A. stuartii. Antechinus subtropicus is, on average, larger in size with a longer rostrum than A. stuartii (north and south) (Van Dyck , Van Dyck and Crowther , Crowther , Crowther, Sumner et al. ; Chapter Five). It also appears to occur primarily, if not solely, outside the range of the larger mainland dusky antechinus species (Chapter Three). In contrast, A. stuartii (north and south) occur in sympatry with dusky antechinus species at several locations (Chapters Two and Three). It is plausible that competition from these larger species led to the evolution of smaller size, arboreality and a shift in mating time in A. stuartii resulting in its speciation from A. subtropicus and the formation of multiple species.

In the present study, A. stuartii was resolved as a putative species complex comprising a north and south form (Chapters Two and Three). The results of Chapter Two suggest A. stuartii north is sister to A. subtropicus and that these taxa diverged in the Pleistocene. Antechinus stuartii north and south appear to largely co-occur with different dusky antechinus, A. arktos and A. mimetes, respectively, with the transition zone of the two A. stuartii species being around the northernmost extent of A. mimetes’ range (Chapter Three). Antechinus arktos appears limited to the Tweed Caldera, further north (Chapter Three; Gray, Baker et al. in press). Competition from these larger dusky antechinus, A. mimetes and A. arktos, may have precipitated speciation of A. stuartii south and north, respectively, the putative species having since recontacted in the New England NP area (Chapter Three). Notably, there is close but separate breeding timing in sympatric A. stuartii north and A. arktos at Springbrook NP (Gray, Baker et al. in press). Plausibly, competition from these larger Antechinus may have resulted in a shift in breeding time of

139 Chapter Six sympatric A. stuartii, leading to their reproductive isolation and thus the speciation of A. stuartii north and south. Future work to resolve the taxonomy of A. stuartii should also seek to uncover the breeding times of sympatric dusky antechinus. Such research should also assess the comparative habitat use of these taxa and sympatric dusky antechinus, so the influence of competition on the speciation of putative A. stuartii species can be further evaluated.

Another explanation is that the speciation of A. stuartii north and south was primarily a consequence of reproductive isolation of these taxa due to the Plio- Pleistocene drying of Australia and the subsequent retraction of wet forest habitat. Antechinus arktos and A. mimetes appear to have speciated much earlier than A. stuartii and A. subtropicus (Chapter Two). The northernmost members of the dusky antechinus lineage may be more restricted to cool, wet high altitude rainforests in the area than A. stuartii (north and south) and A. subtropicus. Thus, as the continent dried and wet, closed forest retracted, these species may have separated earlier, with A. subtropicus and the two potential A. stuartii species becoming separated and speciating later (Byrne, Steane et al. ). The Clarence River Corridor biogeographic barrier (Bryant and Krosch ), located approximately km north of New England NP, may have isolated A. stuartii north and south, leading to their speciation, with A. stuartii north potentially dispersing across the barrier later, perhaps during a Pleistocene interglacial (Zachos, Pagani et al. ).

As shown above, the causes of the speciation of the A. stuartii and A. subtropicus taxa are unclear and may well be the result of several driving forces. In each case, taxa occur on either side of known biogeographical barriers postulated as important in the speciation of co-occurring terrestrial vertebrate taxa (Bryant and Krosch ). However, congeneric competition, clearly an important process in Antechinus evolution (Dickman , Dickman , Crowther and Blacket ), may also have been key in the speciation of

140 General Discussion

A. stuartii (north/south) and A. subtropicus, particularly given their coexistence with much larger congeners.

The driver(s) of speciation for A. mysticus and sister taxon A. argentus are also uncertain. There is no well-established biogeographical barrier between the species and A. mysticus occurs both north (in Eungella) and south (in SE Qld) of A. argentus. Antechinus argentus appears to utilise a very narrow range of habitats, as it is only known from small reaches of high altitude, wet open forest (Baker, Mutton et al. , Mason, Burwell et al. ). The results of the present study also suggest that A. mysticus is restricted to a narrower range of habitats and is less connected between them than previously thought. The two regions supporting A. mysticus (Eungella and south-east Qld) both have higher average rainfall than the drier region surrounding the mountaintops of Blackdown and Kroombit Tops NPs (Jones, Wang et al. ), where A. argentus is known. Plausibly, this is an area in which mesic environments retracted rapidly in the Pleistocene (Rosauer, Catullo et al. ). It is therefore conceivable that Pleistocene aridity restricted ancestral A. argentus to mountain refugees in an otherwise dry area. Antechinus mysticus may have become fragmented between Eungella and south-east Qld during the progressive drying which followed, with subsequent fragmentation of A. mysticus occurred within SE Qld (Chapter Four).

Conclusion The present study has shown Antechinus to be a diverse group of carnivorous marsupials harbouring high levels of cryptic variation, the populations of which have often become deeply spatially structured over time and space. Unfortunately, like many of Australia’s endemic mammals, numerous Antechinus face the threat of extinction as a consequence of human influence. The range, cryptic diversity, conservation units, population structure and ecology of Antechinus identified in the present study will provide valuable information, useful in a range of scientific endeavours. In particular, this

141 Chapter Six research should act as a catalyst to devise on-ground strategies to conserve these unique and precious mammals as they face an uncertain future.

142 Supplementary Material

References

Aplin, K. P., P. R. Baverstock and S. C. Donnellan (1993). "Albumin immunological evidence for the time and mode of origin of the New Guinean terrestrial mammal fauna." Science in New Guinea 19(3): 131-145. Arbogast, B. S. and G. Kenagy (2001). "Comparative phylogeography as an integrative approach to historical biogeography." Journal of Biogeography 28(7): 819-825. Armstrong, L. A., C. Krajewski and M. Westerman (1998). "Phylogeny of the dasyurid marsupial genus Antechinus based on cytochrome-b, 12S-rRNA, and protamine-P1 genes." Journal of Mammalogy 79(4): 1379-1389. Avise, J. C. (2000). Phylogeography: The History and Formation of Species. London, Harvard University Press. Baker, A. M., T. Y. Mutton and H. B. Hines (2013). "A new dasyurid marsupial from Kroombit Tops, south-east Queensland, Australia: the silver-headed antechinus, Antechinus argentus sp. nov. (Marsupialia: Dasyuridae)." Zootaxa 3746(2): 201-239. Baker, A. M., T. Y. Mutton, H. B. Hines and S. Van Dyck (2014). "The black-tailed antechinus, Antechinus arktos sp. nov.: a new species of carnivorous marsupial from montane regions of the Tweed Volcano caldera, eastern Australia." Zootaxa 3765(2): 101-133. Baker, A. M., T. Y. Mutton, E. D. Mason and E. L. Gray (2015). "A taxonomic assessment of the Australian dusky antechinus complex: a new species, the Tasman Peninsula dusky antechinus (Antechinus vandycki sp. nov.) and an elevation to species of the mainland dusky antechinus (Antechinus swainsonii mimetes (Thomas))." Memoirs of the Queensland Museum–Nature 59: 75-126. Baker, A. M., T. Y. Mutton and S. Van Dyck (2012). "A new dasyurid marsupial from eastern Queensland, Australia: the buff-footed antechinus, Antechinus mysticus sp. nov. (Marsupialia: Dasyuridae)." Zootaxa 3515: 1-37. Baker, A. M. and S. Van Dyck (2013). "Taxonomy and redescription of the atherton antechinus, Antechinus godmani (Thomas) (Marsupialia: Dasyuridae)." Zootaxa 3670(4): 401-439. Baker, A. M. and S. Van Dyck (2013). "Taxonomy and redescription of the yellow- footed antechinus, Antechinus flavipes (Waterhouse) (Marsupialia: Dasyuridae)." Zootaxa 3649: 1-62. Baker, A. M. and S. Van Dyck (2015). "Taxonomy and redescription of the swamp antechinus, Antechinus minimus (E. Geoffroy) (Marsupialia: Dasyuridae)." Memoirs of the Queensland Museum-Nature 59: 127-170. Balloux, F. and N. Lugon Moulin (2002). "The estimation of population differentiation with microsatellite markers." Molecular Ecology 11(2): 155-165. Banks, S. C., G. R. Finlayson, S. J. Lawson, D. B. Lindenmayer, D. Paetkau, S. J. Ward and A. C. Taylor (2005). "The effects of habitat fragmentation due to forestry plantation establishment on the demography and genetic variation of a marsupial carnivore, Antechinus agilis." Biological Conservation 122(4): 581-597. Banks, S. C., D. B. Lindenmayer, S. J. Ward and A. C. Taylor (2005). "The effects of habitat fragmentation via forestry plantation establishment on spatial genotypic

143 Supplementary Material structure in the small marsupial carnivore, Antechinus agilis." Molecular Ecology 14(6): 1667-1680. Banks, S. C., S. J. Ward, D. B. Lindenmayer, G. R. Finlayson, S. J. Lawson and A. C. Taylor (2005). "The effects of habitat fragmentation on the social kin structure and mating system of the agile antechinus, Antechinus agilis." Molecular Ecology 14(6): 1789-1801. Barrows, T. T., J. O. Stone, L. K. Fifield and R. G. Cresswell (2002). "The timing of the last glacial maximum in Australia." Quaternary Science Reviews 21(1): 159-173. Bartoń, K. (2013). "MuMIn: multi-model inference." R package version 1.0.0, from http://CRAN.R-project.org/package=MuMIn. Baverstock, P. R., M. Archer, M. Adams and S. J. Richardson (1982). Genetic relationships among 32 species of Australian dasyurid marsupials. Carnivorous Marsupials (ed. Archer, M.), Royal Zoological Society of New South Wales, Sydney, Australia. 2: 621-650. Beck, R. M. D. (2008). "A dated phylogeny of marsupials using a molecular supermatrix and multiple fossil constraints." Journal of Mammalogy 89(1): 175-189. Beckman, J., S. C. Banks, P. Sunnucks, A. Lill and A. C. Taylor (2007). "Phylogeography and environmental correlates of a cap on reproduction: teat number in a small marsupial, Antechinus agilis." Molecular Ecology 16(5): 1069-1083. Bhargava, A. and F. F. Fuentes (2010). "Mutational dynamics of microsatellites." Molecular Biotechnology 44(3): 250-266. Bilney, R. J., R. Cooke and J. G. White (2010). "Underestimated and severe: small mammal decline from the forests of south-eastern Australia since European settlement, as revealed by a top-order predator." Biological Conservation 143(1): 52- 59. Black, K. H., M. Archer, S. J. Hand and H. Godthelp (2012). The rise of Australian marsupials: a synopsis of biostratigraphic, phylogenetic, palaeoecologic and palaeobiogeographic understanding. Earth and Life: Global Biodiversity, Extinction Intervals and Biogeographic Perturbations Through Time (ed. Talent, J.A.). Dordrecht, Netherlands, Springer: 983-1078. Blacket, M. J., M. Adams, C. Krajewski and M. Westerman (2000). "Genetic variation within the dasyurid marsupial genus Planigale." Australian Journal of Zoology 48(5): 443-459. Blacket, M. J., S. J. Cooper, C. Krajewski and M. Westerman (2006). "Systematics and evolution of the dasyurid marsupial genus Sminthopsis: II. The Murina species group." Journal of Mammalian Evolution 13(2): 125-138. Blacket, M. J., C. Kemper and R. Brandle (2008). "Planigales (Marsupialia: Dasyuridae) of eastern Australia's interior: a comparison of morphology, distributions and habitat preferences, with particular emphasis on South Australia." Australian Journal of Zoology 56(3): 195-205. Blacket, M. J., C. Krajewski, A. Labrinidis, B. Cambron, S. Cooper and M. Westerman (1999). "Systematic Relationships within the Dasyurid Marsupial Tribe Sminthopsini—A Multigene Approach." Molecular Phylogenetics and Evolution 12(2): 140-155. Boonstra, R. (2005). "Equipped for life: the adaptive role of the stress axis in male mammals." Journal of Mammalogy 86(2): 236-247. Bos, D. G. and S. M. Carthew (2008). "Patterns of movement in the small dasyurid (Ningaui yvonneae)." Australian Journal of Zoology 55(5): 299-307.

144 Supplementary Material

Bowman, D. M. J. S., G. K. Brown, M. F. Braby, J. R. Brown, L. G. Cook, M. D. Crisp, F. Ford, S. Haberle, J. Hughes and Y. Isagi (2010). "Biogeography of the Australian monsoon tropics." Journal of Biogeography 37(2): 201-216. Bradley, A. J. (2003). Stress, hormones and mortality in small carnivorous marsupials. Predators with Pouches: the Biology of Carnivorous Marsupials (eds. Jones, M., Dickman, C R., Archer, M.). Melbourne, Australia, CSIRO: 255-267. Bradshaw, C. J. A. (2012). "Little left to lose: deforestation and forest degradation in Australia since European colonization." Journal of Plant Ecology 5(1): 109-120. Braithwaite, R. W. (1974). An ecological study of Antechinus stuartii (Marsupialia: Dasyuridae) PhD Thesis, University of Queensland. Braithwaite, R. W. (1979). "Social dominance and habitat utilization in Antechinus stuartii (Marsupialia)." Australian Journal of Zoology 27(4): 517-528. Braithwaite, R. W. and A. K. Lee (1979). "A mammalian example of semelparity." The American Naturalist 113(1): 151-155. Brant, D. H. (1962). "Measures of the movements and population densities of small rodents." University of California Publications in Zoology 62(2): 105-183. Bromham, L., M. Woolfit, M. S. Lee and A. Rambaut (2002). "Testing the relationship between morphological and molecular rates of change along phylogenies." Evolution 56(10): 1921-1930. Brown, M., H. Cooksley, S. M. Carthew and S. J. B. Cooper (2006). "Conservation units and phylogeographic structure of an arboreal marsupial, the yellow-bellied glider (Petaurus australis)." Australian Journal of Zoology 54(5): 305-317. Bryant, L. M. and S. J. Fuller (2014). "Pleistocene climate fluctuations influence phylogeographical patterns in Melomys cervinipes across the mesic forests of eastern Australia." Journal of Biogeography 41(10): 1923-1935. Bryant, L. M. and M. N. Krosch (2016) "Lines in the land: a review of evidence for eastern Australia's major biogeographical barriers to closed forest taxa." Biological Journal of the Linnean Society DOI: 10.1111/bij.12821. Burnham, K. P. and D. R. Anderson (2003). Model selection and multimodel inference: a practical information-theoretic approach. New York, U.S.A., Springer Science & Business Media. Byrne, M., D. A. Steane, L. Joseph, D. K. Yeates, G. J. Jordan, D. Crayn, K. Aplin, D. J. Cantrill, L. G. Cook and M. D. Crisp (2011). "Decline of a biome: evolution, contraction, fragmentation, extinction and invasion of the Australian mesic zone biota." Journal of Biogeography 38(9): 1635-1656. Byrne, M., D. Yeates, L. Joseph, M. Kearney, J. Bowler, M. Williams, S. Cooper, S. Donnellan, J. Keogh and R. Leys (2008). "Birth of a biome: insights into the assembly and maintenance of the Australian arid zone biota." Molecular Ecology 17(20): 4398-4417. Carbone, C., G. Cowlishaw, N. J. B. Isaac and J. M. Rowcliffe (2005). "How far do animals go? Determinants of day range in mammals." The American Naturalist 165(2): 290-297. Cardoso, M. J. (2011). Conservation genetics of Australian quolls PHD Thesis, The University of New South Wales. Cardoso, M. J., M. D. B. Eldridge, M. Oakwood, B. Rankmore, W. B. Sherwin and K. B. Firestone (2009). "Effects of founder events on the genetic variation of translocated island populations: implications for conservation management of the northern quoll." Conservation Genetics 10(6): 1719-1733.

145 Supplementary Material

Cardoso, M. J., N. Mooney, M. D. B. Eldridge, K. B. Firestone and W. B. Sherwin (2014). "Genetic monitoring reveals significant population structure in eastern quolls: implications for the conservation of a threatened carnivorous marsupial." Australian Mammalogy 36(2): 169-177. Carthew, S. M., K. M. W. Jones and M. Lawes (2013). "Responses of small vertebrates to linear clearings in a South Australian woodland." Ecological Research 28(6): 1003-1010. Castelloe, J. and A. R. Templeton (1994). "Root probabilities for intraspecific gene trees under neutral coalescent theory." Molecular Phylogenetics and Evolution 3(2): 102-113. Chapple, D. G., C. J. Hoskin, S. N. J. Chapple and M. B. Thompson (2011). "Phylogeographic divergence in the widespread delicate skink (Lampropholis delicata) corresponds to dry habitat barriers in eastern Australia." BMC Evolutionary Biology 11(1): 191. Chapple, D. G., J. S. Keogh and M. N. Hutchinson (2005). "Substantial genetic substructuring in southeastern and alpine Australia revealed by molecular phylogeography of the Egernia whitii (Lacertilia: Scincidae) species group." Molecular Ecology 14(5): 1279-1292. Chapuis, M.-P. and A. Estoup (2007). "Microsatellite null alleles and estimation of population differentiation." Molecular Biology and Evolution 24(3): 621-631. Christin, P.-A., R. P. Freckleton and C. P. Osborne (2010). "Can phylogenetics identify C4 origins and reversals?" Trends in Ecology & Evolution 25(7): 403-409. Claridge, A. W., D. Paull, J. Dawson, G. Mifsud, A. J. Murray, R. Poore and M. J. Saxon (2005). "Home range of the spotted-tailed quoll (Dasyurus maculatus), a marsupial carnivore, in a rainshadow woodland." Wildlife Research 32(1): 7-14. Clark, A. B. (1978). "Sex ratio and local resource competition in a prosimian primate." Science 201(4351): 163-165. Clement, M., D. Posada and K. A. Crandall (2000). "TCS: a computer program to estimate gene genealogies." Molecular Ecology 9(10): 1657-1659. Cockburn, A. (1994). "Adaptive sex allocation by brood reduction in antechinuses." Behavioral Ecology and Sociobiology 35(1): 53-62. Cockburn, A., M. P. Scott and C. R. Dickman (1985). "Sex ratio and intrasexual kin competition in mammals." Oecologia 66(3): 427-429. Cockburn, A., M. P. Scott and D. J. Scotts (1985). "Inbreeding avoidance and male- biased natal dispersal in Antechinus spp (Marsupialia: Dasyuridae)." Animal Behaviour 33(3): 908-915. Cogger, H. G., H. Ford, C. Johnson, J. Holman and D. Butler (2003). Impacts of land clearing on Australian wildlife in Queensland. Brisbane, Queensland, Australia, WWF Australia. Colgan, D. J. (1999). "Phylogenetic studies of marsupials based on phosphoglycerate kinase DNA sequences." Molecular Phylogenetics and Evolution 11(1): 13-26. Cramb, J., S. Hocknull and G. E. Webb (2009). "High diversity Pleistocene rainforest dasyurid assemblages with implications for the radiation of the Dasyuridae." Austral Ecology 34(6): 663-669. Crandall, K. A. and A. R. Templeton (1993). "Empirical tests of some predictions from coalescent theory with applications to intraspecific phylogeny reconstruction." Genetics 134(3): 959-969.

146 Supplementary Material

Crowther, M. S. (2002). "Distributions of species of the Antechinus stuartii-A. flavipes complex as predicted by bioclimatic modelling." Australian Journal of Zoology 50(1): 77-91. Crowther, M. S. and M. J. Blacket (2003). Biogeography and speciation in the Dasyuridae: why are there so many kinds of dasyurids. Predators with Pouches: the Biology of Carnivorous Marsupials (eds. Jones, M., Dickman, C R., Archer, M.). M. Jones, C. R. Dickman and M. Archer. Melbourne, Australia, CSIRO: 124–132. Crowther, M. S., J. Sumner and C. R. Dickman (2003). "Speciation of Antechinus stuartii and A. subtropicus (Marsupialia: Dasyuridae) in eastern Australia: molecular and morphological evidence." Australian Journal of Zoology 51(5): 443-462. Darriba, D., G. L. Taboada, R. Doallo and D. Posada (2012). "jModelTest 2: more models, new heuristics and parallel computing." Nature Methods 9(8): 772-772. Davison, A. (1991). "A new subspecies of dusky antechinus, Antechinus swainsonii (Marsupialia: Dasyuridae) from western Victoria." Australian Mammalogy 14: 103- 113. Davison, M. J. and S. J. Ward (1998). "Prenatal bias in sex ratio in a marsupial, Antechinus agilis." Proceedings of the Royal Society of London B: Biological Sciences 265(1410): 2095-2099. Dawson, L., J. Muirhead and S. Wroe (1999). "The Big Sink local fauna: A lower Pliocene mammalian fauna from the Wellington Caves complex, Wellington, New South Wales." Records of the Western Australian Museum Supplement 57: 265-290. Dickman, C. R. (1980). "Ecological studies of Antechinus stuartii and Antechinus flavipes (Marsupialia: Dasyuridae) in open-forest and woodland habitats." Australian Zoologist 20(3): 433-446. Dickman, C. R. (1982). Some ecological aspects of seasonal breeding in Antechinus (Marsupialia: Dasyuridae). Carnivorous Marsupials (ed. Archer, M.). Royal Zoological Society of New South Wales, Sydney, Australia. 1: 139-150. Dickman, C. R. (1986). "An experimental manipulation of the intensity of interspecific competition: effects on a small marsupial." Oecologia 70(4): 536-543. Dickman, C. R. (1986). "An experimental study of competition between two species of dasyurid marsupials." Ecological Monographs 56(3): 221-241. Dickman, C. R. (1988). "Body size, prey size, and community structure in insectivorous mammals." Ecology 69(3): 569-580. Dickman, C. R. (1988). "Sex-ratio variation in response to interspecific competition." The American Naturalist 132(2): 289-297. Dickman, C. R., D. H. King, M. Adams and P. R. Baverstock (1988). "Electrophoretic identification of a new species of Antechinus (Marsupialia: Dasyuridae) in southeastern Australia." Australian Journal of Zoology 36(4): 455- 463. Dickman, C. R., H. E. Parnaby, M. S. Crowther and D. H. King (1998). "Antechinus agilis (Marsupialia: Dasyuridae), a new species from the A. stuartii complex in south-eastern Australia." Australian Journal of Zoology 46(1): 1-26. Donnellan, S., K. McGuigan, R. Knowles, M. Mahony and C. Moritz (1999). "Genetic evidence for species boundaries in frogs of the Litoria citropa species- group (Anura: Hylidae)." Australian Journal of Zoology 47(3): 275-293. Draper, T. L. (2012). Evidence for incipient speciation in the agile antechinus (Antechinus agilis) PhD Thesis, Monash University. Drummond, A. J., S. Y. W. Ho, M. J. Phillips and A. Rambaut (2006). "Relaxed phylogenetics and dating with confidence." PLoS Biology 4(5): e88.

147 Supplementary Material

Drummond, A. J. and A. Rambaut (2007). "BEAST: Bayesian evolutionary analysis by sampling trees." BMC Evolutionary Biology 7(1): 214. Dubey, S., B. Croak, D. Pike, J. Webb and R. Shine (2012). "Phylogeography and dispersal in the velvet gecko (Oedura lesueurii), and potential implications for conservation of an endangered snake (Hoplocephalus bungaroides)." BMC Evolutionary Biology 12(1): 67. Dubey, S. and R. Shine (2010). "Evolutionary diversification of the lizard genus Bassiana (Scincidae) across southern Australia." PLoS one 5(9): e12982. Earl, D. A. and B. M. vonHoldt (2012). "STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method." Conservation Genetics Resources 4(2): 359-361. Eldridge, M. D. B., K. Heckenberg, L. E. Neaves, C. J. Metcalfe, S. Hamilton, P. M. Johnson and R. L. Close (2011). "Genetic differentiation and introgression amongst Thylogale (pademelons) taxa in eastern Australia." Australian Journal of Zoology 59(2): 103-117. Excoffier, L. and H. E. L. Lischer (2010). "Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows." Molecular Ecology Resources 10(3): 564-567. Excoffier, L., P. E. Smouse and J. M. Quattro (1992). "Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data." Genetics 131(2): 479-491. Firestone, K. B., M. S. Elphinstone, W. B. Sherwin and B. A. Houlden (1999). "Phylogeographical population structure of tiger quolls Dasyurus maculatus (Dasyuridae: Marsupialia), an endangered carnivorous marsupial." Molecular Ecology 8(10): 1613-1625. Firestone, K. B., B. A. Houlden, W. B. Sherwin and E. Geffen (2000). "Variability and differentiation of microsatellites in the genus Dasyurus and conservation implications for the large Australian carnivorous marsupials." Conservation Genetics 1(2): 115-133. Fisher, D. O., C. R. Dickman, M. E. Jones and S. P. Blomberg (2013). "Sperm competition drives the evolution of suicidal reproduction in mammals." Proceedings of the National Academy of Sciences 110(44): 17910-17914. Fisher, D. O., M. C. Double and B. D. Moore (2006). "Number of mates and timing of mating affect offspring growth in the small marsupial Antechinus agilis." Animal Behaviour 71(2): 289-297. Flannery, T. F. (1995). Mammals of New Guinea. Sydney, Australia, Reed. Frankham, G. J., K. A. Handasyde and M. D. B. Eldridge (2012). "Novel insights into the phylogenetic relationships of the endangered marsupial genus Potorous." Molecular Phylogenetics and Evolution 64(3): 592-602. Frankham, G. J., K. A. Handasyde and M. D. B. Eldridge (2016). "Evolutionary and contemporary responses to habitat fragmentation detected in a mesic zone marsupial, the long-nosed potoroo (Potorous tridactylus) in south-eastern Australia." Journal of Biogeography 43(4): 653–665. Frankham, R. (2010). "Challenges and opportunities of genetic approaches to biological conservation." Biological Conservation 143(9): 1919-1927. Frankham, R., D. A. Briscoe and J. D. Ballou (2002). Introduction to Conservation Genetics. Cambridge, United Kingdom, Cambridge University Press.

148 Supplementary Material

Fraser, D. J. and L. Bernatchez (2001). "Adaptive evolutionary conservation: towards a unified concept for defining conservation units." Molecular Ecology 10(12): 2741-2752. Friend, G. R. (1985). "Ecological studies of a population of Antechinus bellus (Marsupialia: Dasyuridae) in tropical northern Australia." Wildlife Research 12(2): 151-162. Fumagalli, L., L. C. Pope, P. Taberlet and C. Moritz (1997). "Versatile primers for the amplification of the mitochondrial DNA control region in marsupials." Molecular Ecology 6(12): 1199-1201. Gallagher, S. J., D. R. Greenwood, D. Taylor, A. J. Smith, M. W. Wallace and G. R. Holdgate (2003). "The Pliocene climatic and environmental evolution of southeastern Australia: evidence from the marine and terrestrial realm." Palaeogeography, Palaeoclimatology, Palaeoecology 193(3–4): 349-382. Gallus, S., A. Janke, V. Kumar and M. A. Nilsson (2015). "Disentangling the relationship of the Australian marsupial orders using retrotransposon and evolutionary network analyses." Genome Biology and Evolution 7(4): 985-992. Garza, J. C. and E. G. Williamson (2001). "Detection of reduction in population size using data from microsatellite loci." Molecular Ecology 10(2): 305-318. Gongora, J., A. B. Swan, A. Y. Chong, S. Y. W. Ho, C. S. Damayanti, S. Kolomyjec, T. Grant, E. Miller, D. Blair, E. Furlan and N. Gust (2012). "Genetic structure and phylogeography of platypuses revealed by mitochondrial DNA." Journal of Zoology 286(2): 110-119. Gontz, A. M., P. T. Moss, C. R. Sloss, L. M. Petherick, A. McCallum and F. Shapland (2015). "Understanding past climate variation and environmental change for the future of an iconic landscape–K'gari Fraser Island, Queensland, Australia." Australasian Journal of Environmental Management 22(2): 105-123. Goudet, J. (1995). "FSTAT (version 1.2): a computer program to calculate F- statistics." Journal of Heredity 86(6): 485-486. Gray, E. L. (2013). A field study of breeding biology in a new species of carnivorous marsupial, the Buff-footed Antechinus A. mysticus. Honours Thesis, QUT, Brisbane. Gray, E. L., A. M. Baker and J. Firn (in press). "Autecology of a new species of carnivorous marsupial, the endangered black-tailed dusky antechinus (Antechinus arktos), compared to a sympatric congener, the brown antechinus (Antechinus stuartii)." Mammal Research. Greenwood, P. J. (1980). "Mating systems, philopatry and dispersal in birds and mammals." Animal behaviour 28(4): 1140-1162. Griffith, O. W., D. G. Blackburn, M. C. Brandley, J. U. Van Dyke, C. M. Whittington and M. B. Thompson (2015). "Ancestral state reconstructions require biological evidence to test evolutionary hypotheses: a case study examining the evolution of reproductive mode in squamate reptiles." Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 324(B): 493–503. Groom, M. J., G. K. Meffe and C. R. Carroll (2006). Principles of Conservation Biology. Sunderland, Massachusetts, U.S.A., Sinauer. Grueber, C. E., S. Nakagawa, R. J. Laws and I. G. Jamieson (2011). "Multimodel inference in ecology and evolution: challenges and solutions." Journal of Evolutionary Biology 24(4): 699-711. Haines, M. L., A. Moussalli, D. Stuart-Fox, N. Clemann and J. Melville (2014). "Phylogenetic evidence of historic mitochondrial introgression and cryptic diversity

149 Supplementary Material in the genus Pseudemoia (Squamata: Scincidae)." Molecular Phylogenetics and Evolution 81: 86-95. Hall, S. (1980). "The diets of two coexisting species of Antechinus (Marsupialia: Dasyuridae)." Wildlife Research 7(3): 365-378. Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium. Harestad, A. S. and F. L. Bunnel (1979). "Home range and body weight-a reevaluation." Ecology 60(2): 389-402. Hazlitt, S. L., A. W. Goldizen and M. D. B. Eldridge (2006). "Significant patterns of population genetic structure and limited gene flow in a threatened macropodid marsupial despite continuous habitat in southeast Queensland, Australia." Conservation Genetics 7(5): 675-689. Hazlitt, S. L., A. W. Goldizen, J. A. Nicholls and M. D. B. Eldridge (2014). "Three divergent lineages within an Australian marsupial (Petrogale penicillata) suggest multiple major refugia for mesic taxa in southeast Australia." Ecology and evolution 4(7): 1102-1116. Hines, H. B. (2014). "Presidential address 2014: Kroombit tops: Endemism and outliers." Queensland Naturalist 52(1/2/3): 4. Holleley, C. E., C. R. Dickman, M. S. Crowther and B. P. Oldroyd (2006). "Size breeds success: multiple paternity, multivariate selection and male semelparity in a small marsupial, Antechinus stuartii." Molecular Ecology 15(11): 3439-3448. Holsinger, K. E. and B. S. Weir (2009). "Genetics in geographically structured populations: defining, estimating and interpreting FST." Nature Reviews Genetics 10(9): 639-650. Hugall, A., C. Moritz, A. Moussalli and J. Stanisic (2002). "Reconciling paleodistribution models and comparative phylogeography in the Wet Tropics rainforest land snail Gnarosophia bellendenkerensis (Brazier 1875)." Proceedings of the National Academy of Sciences 99(9): 6112-6117. Jakobsson, M. and N. A. Rosenberg (2007). "CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure." Bioinformatics 23(14): 1801-1806. James, C. H. and C. Moritz (2000). "Intraspecific phylogeography in the sedge frog Litoria fallax (Hylidae) indicates pre-Pleistocene vicariance of an open forest species from eastern Australia." Molecular Ecology 9(3): 349-358. Johnson, C. N. and J. L. Isaac (2009). "Body mass and extinction risk in Australian marsupials: the ‘critical weight range’ revisited." Austral Ecology 34(1): 35-40. Jones, D. A., W. Wang and R. Fawcett (2009). "High-quality spatial climate data- sets for Australia." Australian Meteorological and Oceanographic Journal 58(4): 233. Jones, M. E., D. Paetkau, E. Geffen and C. Moritz (2004). "Genetic diversity and population structure of Tasmanian devils, the largest marsupial carnivore." Molecular Ecology 13(8): 2197-2209. Joseph, L. and C. Moritz (1994). "Mitochondrial DNA phylogeography of birds in eastern Australian rainforests: first fragments." Australian Journal of Zoology 42(3): 385-403. Joseph, L., C. Moritz and A. Hugall (1993). "A mitochondrial DNA perspective on the historical biogeography of mideastern Queensland rainforest birds." Memoirs of the Queensland Museum 34(1): 201-214.

150 Supplementary Material

Kikkawa, J. (1964). "Movement, activity and distribution of the small rodents Clethrionomys glareolus and Apodemus sylvaticus in woodland." The Journal of Animal Ecology: 259-299. Kingman, J. F. C. (1982). "On the genealogy of large populations." Journal of Applied Probability: 27-43. Kirsch, J. A. W., C. Krajewski, M. S. Springer and M. Archer (1990). "DNA-DNA hybridization studies of carnivorous marsupials. II. Relationships among dasyurids (Marsupialia: Dasyuridae)." Australian Journal of Zoology 38(6): 673-696. Kraaijeveld-Smit, F. J. L., D. B. Lindenmayer and A. C. Taylor (2002). "Dispersal patterns and population structure in a small marsupial, Antechinus agilis, from two forests analysed using microsatellite markers." Australian Journal of Zoology 50(4): 325-338. Kraaijeveld-Smit, F. J. L., D. B. Lindenmayer, A. C. Taylor, C. MacGregor and B. Wertheim (2007). "Comparative genetic structure reflects underlying life histories of three sympatric small mammal species in continuous forest of south-eastern Australia." Oikos 116(11): 1819-1830. Kraaijeveld-Smit, F. J. L., S. Ward and P. D. Temple Smith (2002). "Multiple paternity in a field population of a small carnivorous marsupial, the agile antechinus, Antechinus agilis." Behavioral Ecology and Sociobiology 52(1): 84-91. Kraaijeveld-Smit, F. J. L., S. J. Ward, P. D. Temple Smith and D. Paetkau (2002). "Factors influencing paternity success in Antechinus agilis: Last male sperm precedence, timing of mating and genetic compatibility." Journal of Evolutionary Biology 15(1): 100-107. Kraaijeveld Smit, F. J. L., S. J. Ward and P. D. Temple Smith (2003). "Paternity success and the direction of sexual selection in a field population of a semelparous marsupial, Antechinus agilis." Molecular Ecology 12(2): 475-484. Krajewski, C., L. Buckley, P. A. Woolley and M. Westerman (1996). "Phylogenetic analysis of cytochrome b sequences in the dasyurid marsupial subfamily Phascogalinae: systematics and the evolution of reproductive strategies." Journal of Mammalian Evolution 3(1): 81-91. Krajewski, C., G. R. Moyer, J. T. Sipiorski, M. G. Fain and M. Westerman (2004). "Molecular systematics of the enigmatic 'phascolosoricine' marsupials of New Guinea." Australian Journal of Zoology 52(4): 389-415. Krajewski, C., J. Painter, L. Buckley and M. Westerman (1994). "Phylogenetic structure of the marsupial family Dasyuridae based on cytochrome b DNA sequences." Journal of Mammalian Evolution 2(1): 25-35. Krajewski, C., R. Torunsky, J. T. Sipiorski and M. Westerman (2007). "Phylogenetic relationships of the dasyurid marsupial genus Murexia." Journal of Mammalogy 88(3): 696-705. Krajewski, C., S. Wroe and M. Westerman (2000). "Molecular evidence for the pattern and timing of cladogenesis in dasyurid marsupials." Zoological Journal of the Linnean Society 130(3): 375-404. Krajewski, C., J. Young, L. Buckley, P. A. Woolley and M. Westerman (1997). "Reconstructing the evolutionary radiation of dasyurine marsupials with cytochrome b, 12S rRNA, and protamine P1 gene trees." Journal of Mammalian Evolution 4(3): 217-236. Krebs, C. J. (1966). "Demographic changes in fluctuating populations of Microtus californicus." Ecological Monographs 36(3): 239-273.

151 Supplementary Material

Krosch, M. N., M. K. Schutze, K. F. Armstrong, Y. Boontop, L. M. Boykin, T. A. Chapman, A. Englezou, S. L. Cameron and A. R. Clarke (2013). "Piecing together an integrative taxonomic puzzle: microsatellite, wing shape and aedeagus length analyses of Bactrocera dorsalis s.l. (Diptera: Tephritidae) find no evidence of multiple lineages in a proposed contact zone along the Thai/Malay Peninsula." Systematic Entomology 38(1): 2-13. La Sorte, F. A. and W. Jetz (2010). "Projected range contractions of montane biodiversity under global warming." Proceedings of the Royal Society of London B: Biological Sciences 277: 3401–3410. Lada, H., R. Mac Nally and A. C. Taylor (2007). "Genetic reconstruction of the population dynamics of a carnivorous marsupial (Antechinus flavipes) in response to floods." Molecular Ecology 16(14): 2934-2947. Lada, H., R. Mac Nally and A. C. Taylor (2008). "Distinguishing past from present gene flow along and across a river: the case of the carnivorous marsupial (Antechinus flavipes) on southern Australian floodplains." Conservation Genetics 9(3): 569-580. Lada, H., R. Mac Nally and A. C. Taylor (2008). "Phenotype and gene flow in a marsupial (Antechinus flavipes) in contrasting habitats." Biological Journal of the Linnean Society 94(2): 303-314. Lada, H., J. R. Thomson, S. C. Cunningham and R. Mac Nally (2013). "Rainfall in prior breeding seasons influences population size of a small marsupial." Austral Ecology 38(5): 581-591. Lada, H., J. R. Thomson, R. Mac Nally and A. C. Taylor (2008). "Impacts of massive landscape change on a carnivorous marsupial in south-eastern Australia: inferences from landscape genetics analysis." Journal of Applied Ecology 45(6): 1732-1741. Lambeck, K. and J. Chappell (2001). "Sea level change through the last glacial cycle." Science 292(5517): 679-686. Laurance, W. F., B. Dell, S. M. Turton, M. J. Lawes, L. B. Hutley, H. McCallum, P. Dale, M. Bird, G. Hardy and G. Prideaux (2011). "The 10 Australian ecosystems most vulnerable to tipping points." Biological Conservation 144(5): 1472-1480. Leung, L. K.-P. (1999). "Ecology of Australian tropical rainforest mammals. I. the Cape York antechinus, Antechinus leo (Dasyuridae: Marsupialia)." Wildlife Research 26(3): 287-306. Li, B., B. Malyarchuk, X. He and M. Derenko (2013). "Molecular evolution and adaptation of the mitochondrial cytochrome b gene in the subgenus Martes." Genetics and Molecular Research 12(3): 3944-3954. Liberg, O. and T. von Schantz (1985). "Sex-biased philopatry and dispersal in birds and mammals: the Oedipus hypothesis." The American Naturalist 126(1): 129-135. Lindstedt, S. L., B. J. Miller and S. W. Buskirk (1986). "Home range, time, and body size in mammals." Ecology 67(2): 413-418. Litsios, G. and N. Salamin (2012). "Effects of phylogenetic signal on ancestral state reconstruction." Systematic Biology 61(3): 533-538. Luikart, G. and J.-M. Cornuet (2010). "Estimating the effective number of breeders from heterozygote excess in progeny." Genetics 151(3): 1211-1216. Mace, G. M. (2004). "The role of taxonomy in species conservation." Philosophical Transactions of the Royal Society of London B: Biological Sciences 359(1444): 711- 719.

152 Supplementary Material

Macleay, W. S. (1841). "Notice of an new genus of mammalia discovered by J. Stuart, Esq., in New South Wales." Annals and Magazine of Natural History 8: 241– 243. Macqueen, P., J. M. Seddon, J. J. Austin, S. Hamilton and A. W. Goldizen (2010). "Phylogenetics of the pademelons (Macropodidae: Thylogale) and historical biogeography of the Australo-Papuan region." Molecular Phylogenetics and Evolution 57(3): 1134-1148. Macqueen, P., J. M. Seddon and A. W. Goldizen (2012). "Effects of historical forest contraction on the phylogeographic structure of Australo Papuan populations of the red legged pademelon (Macropodidae: Thylogale stigmatica)." Austral Ecology 37(4): 479-490. Maddison, W. P. and D. R. Maddison. (2015). "Mesquite: a modular system for evolutionary analysis. Version 3.04. ." from http://mesquiteproject.org. Magnusdottir, R., B. A. Wilson and P. Hersteinsson (2008). "Dispersal and the influence of rainfall on a population of the carnivorous marsupial swamp antechinus (Antechinus minimus maritimus)." Wildlife Research 35(5): 446-454. Manel, S., M. K. Schwartz, G. Luikart and P. Taberlet (2003). "Landscape genetics: combining landscape ecology and population genetics." Trends in Ecology & Evolution 18(4): 189-197. Mantel, N. (1967). "The detection of disease clustering and a generalized regression approach." Cancer Research 27(2 Part 1): 209-220. Marchesan, D. and S. M. Carthew (2004). "Autecology of the yellow-footed antechinus (Antechinus flavipes) in a fragmented landscape in southern Australia." Wildlife Research 31(3): 273-282. Marchesan, D. and S. M. Carthew (2008). "Use of space by the yellow-footed antechinus, Antechinus flavipes, in a fragmented landscape in South Australia." Landscape Ecology 23(6): 741-752. Marlow, B. J. (1961). "Reproductive behaviour of the marsupial mouse, Antechinus flavipes (Waterhouse) (Marsupialia) and the development of the pouch young." Australian Journal of Zoology 9(2): 203-218. Martin, H. A. (2006). "Cenozoic climatic change and the development of the arid vegetation in Australia." Journal of Arid Environments 66(3): 533-563. Mason, E. D., C. J. Burwell and A. M. Baker (2015). "Prey of the silver-headed antechinus (Antechinus argentus), a new species of Australian dasyurid marsupial." Australian Mammalogy 37(2): 164-169. Mason, E. D., J. Firn, H. B. Hines and A. M. Baker (2016). "Breeding biology and growth in a new mammalian suicidal reproducer under threat from climate change, fire and ferals." Under review. McAllan, B. M. (2003). Timing of reproduction in carnivorous marsupials. Predators with Pouches: the Biology of Carnivorous Marsupials (eds. Jones, M., Dickman, C R., Archer, M.). Melbourne, Australia, CSIRO: 147-164. McAllan, B. M. and C. R. Dickman (1986). "The role of photoperiod in the timing of reproduction in the dasyurid marsupial Antechinus stuartii." Oecologia 68(2): 259- 264. McAllan, B. M., C. R. Dickman and M. S. Crowther (2006). "Photoperiod as a reproductive cue in the marsupial genus Antechinus: ecological and evolutionary consequences." Biological Journal of the Linnean Society 87(3): 365-379.

153 Supplementary Material

McAllan, B. M. and F. Geiser (2006). "Photoperiod and the timing of reproduction in Antechinus flavipes (Dasyuridae: Marsupialia)." Mammalian Biology-Zeitschrift für Säugetierkunde 71(3): 129-138. McAllan, B. M., J. M. P. Joss and B. T. Firth (1991). "Phase delay of the natural photoperiod alters reproductive timing in the marsupial Antechinus stuartii." Journal of Zoology 225(4): 633-646. McAllan, B. M., W. Westman and J. M. P. Joss (2002). "The seasonal reproductive cycle of a marsupial, Antechinus stuartii: effects of oral administration of melatonin." General and Comparative Endocrinology 128(1): 82-90. McAlpine, C., R. Fensham and D. Temple-Smith (2002). "Biodiversity conservation and vegetation clearing in Queensland: principles and thresholds." The Rangeland Journal 24(1): 36-55. McGuigan, K., K. McDonald, K. Parris and C. Moritz (1998). "Mitochondrial DNA diversity and historical biogeography of a wet forest restricted frog (Litoria pearsoniana) from mid east Australia." Molecular Ecology 7(2): 175-186. McKinnon, G. E., R. E. Vaillancourt, H. D. Jackson and B. M. Potts (2001). "Chloroplast sharing in the Tasmanian eucalypts." Evolution 55(4): 703-711. Menkhorst, P. and L. Broome (2006). National Recovery Plan for the Smoky Mouse: Pseudomys Fumeus. Melbourne, Australia, Department of Sustainability and Environment. Meredith, R. W., M. Westerman, J. A. Case and M. S. Springer (2008). "A phylogeny and timescale for marsupial evolution based on sequences for five nuclear genes." Journal of Mammalian Evolution 15(1): 1-36. Meredith, R. W., M. Westerman and M. S. Springer (2008). "A phylogeny and timescale for the living genera of kangaroos and kin (Macropodiformes: Marsupialia) based on nuclear DNA sequences." Australian Journal of Zoology 56(6): 395-410. Michaux, J., R. Libois and M. Filippucci (2005). "So close and so different: comparative phylogeography of two small mammal species, the yellow-necked fieldmouse (Apodemus flavicollis) and the woodmouse (Apodemus sylvaticus) in the Western Palearctic region." Heredity 94(1): 52-63. Miller, M., W. Pfeiffer and T. Schwartz (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop, New Orleans, Louisiana, U.S.A. Mills, H. R., D. Moro and P. Spencer (2004). "Conservation significance of island versus mainland populations: a case study of dibblers (Parantechinus apicalis) in Western Australia." Animal Conservation 7(4): 387-395. Milner, M. L., M. Rossetto, M. D. Crisp and P. H. Weston (2012). "The impact of multiple biogeographic barriers and hybridization on species-level differentiation." American Journal of Botany 99(12): 2045-2057. Mitchell, K. J., R. C. Pratt, L. N. Watson, G. C. Gibb, B. Llamas, M. Kasper, J. Edson, B. Hopwood, D. Male, K. N. Armstrong, M. Meyer, M. Hofreiter, J. Austin, S. C. Donnellan, M. S. Y. Lee, M. J. Phillips and A. Cooper (2014). "Molecular phylogeny, biogeography, and habitat preference evolution of marsupials." Molecular Biology and Evolution 31(9): 2322-2330. Moritz, C. (1994). "Defining 'evolutionarily significant units' for conservation." Trends in Ecology & Evolution 9(10): 373-374. Moritz, C., C. J. Hoskin, J. B. MacKenzie, B. L. Phillips, M. Tonione, N. Silva, J. VanDerWal, S. E. Williams and C. H. Graham (2009). "Identification and dynamics

154 Supplementary Material of a cryptic suture zone in tropical rainforest." Proceedings of the Royal Society of London B: Biological Sciences 276: 1235–1244. Moussalli, A., A. F. Hugall and C. Moritz (2005). "A mitochondrial phylogeny of the rainforest skink genus Saproscincus, Wells and Wellington (1984)." Molecular Phylogenetics and Evolution 34(1): 190-202. Murray, B. R. and C. R. Dickman (2000). "Relationships between body size and geographical range size among Australian mammals: has human impact distorted macroecological patterns?" Ecography 23(1): 92-100. Mutton, T. Y. (2011). Systematics and Evolution of the Dasyurid marsupial genus Antechinus. Honours, Queensland University of Technology. Nakagawa, S. and H. Schielzeth (2013). "A general and simple method for obtaining R2 from generalized linear mixed effects models." Methods in Ecology and Evolution 4(2): 133-142. Naylor, R., S. J. Richardson and B. M. McAllan (2008). "Boom and bust: a review of the physiology of the marsupial genus Antechinus." Journal of Comparative Physiology B: Biochemical, Systemic, and Environmental Physiology 178(5): 545- 562. Nei, M., T. Maruyama and R. Chakraborty (1975). "The bottleneck effect and genetic variability in populations." Evolution 29(1): 1-10. Ng, J., N. Clemann, S. N. J. Chapple and J. Melville (2014). "Phylogeographic evidence links the threatened ‘Grampians’ mountain dragon (Rankinia diemensis Grampians) with Tasmanian populations: conservation implications in south-eastern Australia." Conservation Genetics 15(2): 363-373. Nicholls, J. A. and J. J. Austin (2005). "Phylogeography of an east Australian wet- forest bird, the satin bowerbird (Ptilonorhynchus violaceus), derived from mtDNA, and its relationship to morphology." Molecular Ecology 14(5): 1485-1496. NPRSR. (n.d.). "Conondale Range Great Walk - Nature, culture and history." from http://www.nprsr.qld.gov.au/parks/great-walks-conondale-range/culture.html. NPRSR. (n.d.). "D'aguilar National Park - Nature, culture and history." from http://www.nprsr.qld.gov.au/parks/daguilar/culture.html. Omland, K. E. (1999). "The assumptions and challenges of ancestral state reconstructions." Systematic Biology 48(3): 604-611. Orlóci, L. (2013). Multivariate analysis in vegetation research. The Hague, Netherlands, Springer. Pachauri, R. K., M. R. Allen and J. C. Minx (2014). Climate change 2014: synthesis report. Geneca, IPCC. Parmesan, C. (2006). "Ecological and evolutionary responses to recent climate change." Annual Review of Ecology, Evolution, and Systematics 37: 637-669. Parra Faundes, D. (2015). Sex allocation, terminal investment and the effects of environmental constraints on maternal investment in subtropical antechinus PhD Thesis, University of Queensland. Parrott, M. L., S. J. Ward and P. D. Temple-Smith (2006). "Genetic similarity, not male size, influences female mate choice in the agile antechinus (Antechinus agilis)." Australian Journal of Zoology 54(5): 319-323. Parrott, M. L., S. J. Ward and P. D. Temple-Smith (2007). "Olfactory cues, genetic relatedness and female mate choice in the agile antechinus (Antechinus agilis)." Behavioral Ecology and Sociobiology 61(7): 1075-1079. Parrott, M. L., S. J. Ward, P. D. Temple-Smith and L. Selwood (2007). "Effects of drought on weight, survival and breeding success of agile antechinus (Antechinus

155 Supplementary Material agilis), dusky antechinus (A. swainsonii) and bush rats (Rattus fuscipes)." Wildlife Research 34(6): 437-442. Peakall, R. O. D. and P. E. Smouse (2006). "GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research." Molecular Ecology Notes 6(1): 288-295. Pearce, C. (2016). Diet, breeding and growth in a new carnivorous marsupial, the buff-footed antechinus, Antechinus mysticus, at the northern and southern limits of its range MSc Thesis, QUT. Pepper, M., M. D. Barquero, M. J. Whiting and J. S. Keogh (2014). "A multi-locus molecular phylogeny for Australia’s iconic Jacky Dragon (Agamidae: Amphibolurus muricatus): Phylogeographic structure along the Great Dividing Range of south- eastern Australia." Molecular Phylogenetics and Evolution 71: 149-156. Pinheiro, J., D. Bates, S. DebRoy, D. Sarkar and R. C. Team (2012). "nlme: Linear and nonlinear mixed effects models." R package version 3: 103. Piry, S., G. Luikart and J.-M. Cornuet (1999). "BOTTLENECK: a program for detecting recent effective population size reductions from allele data frequencies." Journal of Heredity 90(4): 502-503. Pope, L., A. Estoup and C. Moritz (2000). "Phylogeography and population structure of an ecotonal marsupial, Bettongia tropica, determined using mtDNA and microsatellites." Molecular Ecology 9(12): 2041-2053. Pritchard, J. K., M. Stephens and P. Donnelly (2000). "Inference of population structure using multilocus genotype data." Genetics 155(2): 945-959. R Core Team. (2015). "R: A language and environment for statistical computing." from http://www.R-project.org. Rambaut, A. and A. J. Drummond. (2007). "Tracer." from http://tree.bio.ed.ac.uk/software/tracer/. Raymond, M. and F. Rousset (1995). "GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism." Journal of Heredity 86(3): 248-249. Retief, J. D., C. Krajewski, M. Westerman and G. H. Dixon (1995). "The evolution of protamine P1 genes in dasyurid marsupials." Journal of Molecular Evolution 41(5): 549-555. Rix, M. G. and M. S. Harvey (2012). "Phylogeny and historical biogeography of ancient assassin spiders (Araneae: Archaeidae) in the Australian mesic zone: evidence for Miocene speciation within Tertiary refugia." Molecular Phylogenetics and Evolution 62(1): 375-396. Romiguier, J., V. Ranwez, E. J. P. Douzery and N. Galtier (2013). "Genomic evidence for large, long-lived ancestors to placental mammals." Molecular Biology and Evolution 30(1): 5-13. Ronquist, F. and J. P. Huelsenbeck (2003). "MrBayes 3: Bayesian phylogenetic inference under mixed models." Bioinformatics 19(12): 1572. Rosauer, D. F., R. A. Catullo, J. VanDerWal, A. Moussalli and C. Moritz (2015). "Lineage range estimation method reveals fine-scale endemism linked to pleistocene stability in Australian rainforest herpetofauna." PloS one 10(5): e0126274. Rosenberg, N. A. (2004). "DISTRUCT: a program for the graphical display of population structure." Molecular Ecology Notes 4(1): 137-138. Rousset, F. (2008). "Genepop’007: a complete re implementation of the genepop software for Windows and Linux." Molecular Ecology Resources 8(1): 103-106. Ryder, O. A. (1986). "Species conservation and systematics: the dilemma of subspecies." Trends in Ecology & Evolution 1(1): 9-10.

156 Supplementary Material

Sale, M. G. (2008). Comparative ecology of island and mainland swamp antechinus populations. PhD Thesis, Deakin University. Sale, M. G. and J. P. Y. Arnould (2009). "Spatial and temporal organization in the swamp antechinus: comparison between island and mainland populations." Journal of Mammalogy 90(2): 347-355. Sale, M. G., F. J. L. Kraaijeveld-Smit and J. P. Y. Arnould (2009). "Natal dispersal and social organization of the swamp antechinus (Antechinus minimus) in a high- density island population." Canadian Journal of Zoology 87(3): 262-272. Sale, M. G., F. J. L. Kraaijeveld-Smit and J. P. Y. Arnould (2013). "Multiple paternity in the swamp antechinus (Antechinus minimus)." Australian Mammalogy 35(2): 227-230. Schäuble, C. S. and C. Moritz (2001). "Comparative phylogeography of two open forest frogs from eastern Australia." Biological Journal of the Linnean Society 74(2): 157-170. Schneider, C. J., M. Cunningham and C. Moritz (1998). "Comparative phylogeography and the history of endemic vertebrates in the Wet Tropics rainforests of Australia." Molecular Ecology 7(4): 487-498. Schodde, R. (2006). Australasia’s bird fauna today-origins, and evolutionary development. Evolution and Biogeography of Australasian Vertebrates (eds. Merrick, J.R., Archer, M., Hickey, G. M. and Lee, M. S. Y.). Sydney, Australia, Auscipub: 413-458. Segelbacher, G., S. A. Cushman, B. K. Epperson, M.-J. Fortin, O. Francois, O. J. Hardy, R. Holderegger, P. Taberlet, L. P. Waits and S. Manel (2010). "Applications of landscape genetics in conservation biology: concepts and challenges." Conservation Genetics 11(2): 375-385. Selkoe, K. A. and R. J. Toonen (2006). "Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers." Ecology Letters 9(5): 615- 629. Selwood, L. (1985). "Synchronization of oestrus, ovulation and birth in female Antechinus stuartii (Marsupialia: Dasyuridae)." Australian Mammalogy 8: 91-96. Shine, R. (2005). "Life-history evolution in reptiles." Annual Review of Ecology, Evolution, and Systematics 36: 23-46. Slatkin, M. (1995). "A measure of population subdivision based on microsatellite allele frequencies." Genetics 139(1): 457-462. Smith, G. C. (1984). "The biology of the yellow-footed antechinus, Antechinus flavipes (Marsupialia: Dasyuridae), in a swamp forest on Kinaba Island, Cooloola, Quensland." Wildlife Research 11(3): 465-480. Sota, T., Y. Takami, G. B. Monteith and B. P. Moore (2005). "Phylogeny and character evolution of endemic Australian carabid beetles of the genus Pamborus based on mitochondrial and nuclear gene sequences." Molecular Phylogenetics and Evolution 36(2): 391-404. Spencer, P. B. S., S. G. Rhind and M. D. B. Eldridge (2001). "Phylogeographic structure within Phascogale (Marsupialia: Dasyuridae) based on partial cytochrome b sequence." Australian Journal of Zoology 49(4): 369-377. Stamatakis, A. (2014). "RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies." Bioinformatics 30(9): 1312-1313. Statham, H. L. (1982). Antechinus stuartii (Dasyuridae, Marsupialia) diet and food availability at Petroi, northeastern New South Wales. Carnivorous Marsupials (ed.

157 Supplementary Material

Archer, M.) Royal Zoological Society of New South Wales, Sydney, Australia. 1: 151-163. Sumner, J. and C. R. Dickman (1998). "Distribution and identity of species in the Antechinus stuartii-A. flavipes group (Marsupialia: Dasyuridae) in south-eastern Australia." Australian Journal of Zoology 46(1): 27-41. Sumner, J., J. K. Webb, R. Shine and J. S. Keogh (2010). "Molecular and morphological assessment of Australia’s most endangered snake, Hoplocephalus bungaroides, reveals two evolutionarily significant units for conservation." Conservation Genetics 11(3): 747-758. Sunnucks, P. (2000). "Efficient genetic markers for population biology." Trends in Ecology & Evolution 15(5): 199-203. Symula, R., J. S. Keogh and D. C. Cannatella (2008). "Ancient phylogeographic divergence in southeastern Australia among populations of the widespread common froglet, Crinia signifera." Molecular Phylogenetics and Evolution 47(2): 569-580. Taberlet, P., L. Fumagalli, A.-G. Wust-Saucy and J.-F. Cosson (1998). "Comparative phylogeography and postglacial colonization routes in Europe." Molecular Ecology 7(4): 453-464. Takami, Y. and T. Sota (2006). "Four new species of the Australian Pamborus Latreille (Coleoptera, Carabidae) carabid beetles." Australian Journal of Entomology 45(1): 44-54. Tamura, K., G. Stecher, D. Peterson, A. Filipski and S. Kumar (2013). "MEGA6: molecular evolutionary genetics analysis version 6.0." Molecular Biology and Evolution 30(12): 2725-2729. Tasker, E. M. and C. R. Dickman (2002). "A review of Elliott trapping methods for small mammals in Australia." Australian Mammalogy 23(2): 77-87. Tate, G. H. H. (1947). "Results of the Archbold expeditions, No. 56: On the anatomy and classification of the Dasyuridae." Bulletin of the American Museum of Natural History 88: 101-155. Thom, B., P. Hesp and E. Bryant (1994). "Last glacial “coastal” dunes in Eastern Australia and implications for landscape stability during the Last Glacial Maximum." Palaeogeography, Palaeoclimatology, Palaeoecology 111(3): 229-248. Turner, M. G., R. H. Gardner and R. V. O'neill (2001). Landscape Ecology in Theory and Practice. London, United Kingdom, Springer. Van Dyck, S. (1980). "The cinnamon antechinus, Antechinus leo (Marsupialia: Dasyuridae), a new species from the vine-forests of Cape York Peninsula." Australian Mammalogy 3(1): 5-17. Van Dyck, S. (1982). The relationships of Antechinus stuartii and A. flavipes (Dasyuridae: Marsupialia) with special reference to Queensland. Carnivorous Marsupials (ed. Archer, M.). Sydney, Australia, Royal Zoological Society of New South Wales. 2: 723–766. Van Dyck, S. (1982). "The status and relationships of the atherton antechinus, Antechinus godmani (Marsupialia: Dasyuridae)." Australian Mammalogy 5: 195- 210. Van Dyck, S. (1997). Revisionary studies in Murexia and Antechinus (Marsupalia: Dasyuridae) PhD Thesis, University of New South Wales. Van Dyck, S. (2002). "Morphology-based revision of Murexia and Antechinus (Marsupialia: Dasyuridae)." Memoirs of the Queensland Museum 48(1): 239-330. Van Dyck, S. and M. S. Crowther (2000). "Reassessment of northern representatives of the Antechinus stuartii complex (Marsupialia: Dasyuridae): A. subtropicus sp.

158 Supplementary Material nov. and A. adustus new status." Memoirs of the Queensland Museum 45(2): 611- 635. Van Dyck, S., I. Gynther and A. M. Baker (2013). Field Companion to Mammals of Australia. Sydney, Australia, New Holland Publishers. Van Dyck, S. and R. Strahan (2008). The Mammals of Australia. Syndey, Australia, New Holland Publishers. van Ufford, A. Q. and M. Cloos (2005). "Cenozoic tectonics of New Guinea." AAPG Bulletin 89(1): 119-140. Wägele, H., A. Klussmann-Kolb, M. Kuhlmann, G. Haszprunar, D. Lindberg, A. Koch and J. W. Wägele (2011). "The taxonomist - an endangered race. A practical proposal for its survival." Frontiers in zoology 8(1): 1. Wakefield, N. A. and R. M. Warneke (1967). "Some Revision in Antechinus (Marsupialia)." Victorian Naturalist 84: 69–99. Watts, A. (1991). The ecology of three species of Antechinus (Marsupialia: Dasyuridae) in upland rainforests of north-east Queensland PhD Thesis, James Cook University of North Queensland. Watts, A. (1997). "Population ecology and reproductive seasonality in three species of Antechinus (Marsupialia: Dasyuridae) in the wet tropics of Queensland." Wildlife Research 24(5): 531-547. Westerman, M., C. Krajewski, B. P. Kear, L. Meehan, R. W. Meredith, C. A. Emerling and M. S. Springer (2015). "Phylogenetic relationships of dasyuromorphian marsupials revisited." Zoological Journal of the Linnean Society 176(3): 686-701. Westerman, M., J. Young and C. Krajewski (2008). "Molecular relationships of species of Pseudantechinus, Parantechinus and Dasykaluta (Marsupialia: Dasyuridae)." Australian Mammalogy 29(2): 201-212. White, M. E. (2006). Environments of the geological past. Evolution and Biogeography of Australasian Vertebrates (eds. Merrick, J.R., Archer, M., Hickey, G. M. and Lee, M. S. Y.). Sydney, Australia: 17-50. Wilson, B. A., A. R. Bourne and R. E. Jessop (1986). "Ecology of small mammals in coastal heathland at Anglesea, Victoria." Wildlife Research 13(3): 397-406. Woinarski, J. C. Z., A. A. Burbidge and P. L. Harrison (2015). "Ongoing unraveling of a continental fauna: Decline and extinction of Australian mammals since European settlement." Proceedings of the National Academy of Sciences 112(15): 4531-4540. Wolff, J. O. (1994). "More on juvenile dispersal in mammals." Oikos 71(2): 349- 352. Wood, D. H. (1970). "An ecological study of Antechinus stuartii (Marsupialia) in a south-east Queensland rain forest." Australian Journal of Zoology 18(2): 185-207. Woodhead, J., S. J. Hand, M. Archer, I. Graham, K. Sniderman, D. A. Arena, K. H. Black, H. Godthelp, P. Creaser and E. Price (2014). "Developing a radiometrically- dated chronologic sequence for Neogene biotic change in Australia, from the Riversleigh World Heritage Area of Queensland." Gondwana Research 29(1): 153– 167. Woolley, P. A. (1966). "Reproduction in Antechinus spp. and other dasyurid marsupials." Symposia of the Zoological Society of London 15: 281-294. Wright, S. (1931). "Evolution in Mendelian populations." Genetics 16(2): 97-159. Wroe, S. (1996). "Muribacinus gadiyuli (Thylacinidae: Marsupialia), a very plesiomorphic thylacinid from the Miocene of Riversleigh, northwestern

159 Supplementary Material

Queensland, and the problem of paraphyly for the Dasyuridae (Marsupialia)." Journal of Paleontology 70(6): 1032-1044. Wroe, S. (2003). Australian marsupial carnivores: recent advances in palaeontology. Predators with Pouches: the Biology of Carnivorous Marsupials (eds. Jones, M., Dickman, C R., Archer, M.). Melbourne, Australia, CSIRO: 102-123. Zachos, J., M. Pagani, L. Sloan, E. Thomas and K. Billups (2001). "Trends, rhythms, and aberrations in global climate 65 Ma to present." Science 292(5517): 686-693. Zhang, T., G. Lin, E. Nevo, C. Yang and J. Su (2013). "Cytochrome b gene selection of subterranean rodent Gansu zokor Eospalax cansus (Rodentia, Spalacidae)." Zoologischer Anzeiger - A Journal of Comparative Zoology 252(1): 118-122.

160 Supplementary Material

Supplementary material Table .. List of samples previously sequenced for Cytb in Baker et al. (; ; ; ). All listed sequences from Baker et al. (; ; ; ) were analysed in the Cytb analyses presented in Chapter Three. Samples marked with a ‘*’ were also analysed in Chapter Two. For Chapter Two both Cytb and IRBP sequences from Baker et al (; ; ; ) were analysed. An ‘x’ is used to denote which Baker et al. (; ; ; ) studies each sample has previously been analysed in. Detailed information on the samples is shown in Supplementary Table ..

Baker Baker Baker Baker Samples et al. et al. et al. et al. 2012 2013 2014 2015 A. argentus CB x x x A. argentus CB x x x A. argentus CB* x x x A. mysticus ME Qld CB* x x x x A. mysticus SE Qld CBA x x x x A. mysticus SE Qld CBa* x x x x A. f. leucogaster CBb x x x x A. f. rubeculus CB x x x x A. f. rubeculus CB x x x x A. f. rubeculus CB x x x x A. f. rubeculus CB* x x x x A. f. flavipes CB x x x x A. f. flavipes CB x x x x A. f. flavipes CB* x x x x A. f. flavipes CB x x x x A. f. flavipes CB x x x x A. f. flavipes CBa* x x x x A. f. flavipes CB x x x x A. leo CB* x x x x A. adustus CB* x x x x A. agilis CB x x x x A. agilis CB x x x x A. agilis CBa x x x x A. subtropicus CB x x x x A. stuartii CB x x x x A. stuartii CBa x x x x A. stuartii CB x x x x A. godmani CB x x x x A. arktos CB* x x A. swainsonii CB x A. swainsonii CB* x A. vandycki CB x A. vandycki CBa* x A. minimus CB x x A. minimus CB x A. minimus CBa* x

161 Supplementary Material

Baker Baker Baker Baker Samples et al. et al. et al. et al. 2012 2013 2014 2015 A. mimetes CBc x x A. m. insulanus CB* x x A. m. insulanus CB x A. m. insulanus CB x x

Supplementary Table .. Coding for BI (MrBayes) and MP (Mesquite) ancestral state analysis.

Taxa Habitat Size Altitud Notes on altitude e Over m at Kroombit Tops NP A. argentus (Baker, Mutton et al. ) A. mysticus Occurs at high densitites over Eungella m at Eungella NP Highest known location is Jolly’s Lookout (~m), D’aguillar NP. Generally appears to be replaced A. mysticus SE by A. subtropicus at higher Qld altitudes Occurs at altitudes m and over A. adustus (Van Dyck and Strahan ) Range does not encompass areas A. f. over m (Van Dyck and Strahan leucogaster ) Much of range encompasses areas with altitude over m and appears to favour them (Baker and A. f. rubeculus Van Dyck ) Highest densities occur below m, highest known location is Kroombit Tops NP (~m) A. f. flavipes (Chapter Three) Little information but appears to favour McIlwraith Range (- m) so has been coded as high A. leo preferencing Range does not include high A. bellus altitude areas Occurs from -m. High population densities have been found at a number of sites well over m, so assume preference A. agilis for high density (Kraaijeveld-Smit,

162 Supplementary Material

Lindenmayer et al. , Banks, Finlayson et al. , Van Dyck and Strahan ). Our trapping has found A. stuartii A. stuartii South at high densities at high south altitude locations Our trapping has found A. stuartii A. stuartii South at high densities at high north altitude locations We have found A. subtropicus at A. subtropicus highest abundance over m Occurs at altitudes above m A. godmani (Van Dyck and Strahan ) Only know from altitudes over A. arktos m (Baker, Mutton et al. ) Appears to be at highest densities A. swainsonii above m (TYM unpublished) Too little is known about this species to confidently determine A. vandycki ? ? its altitude preference Much of Grampians NP is above m, assumed it, like A. m. A. m. insulanus mimetes, favours high altitude Densest populations occur in mountainous areas (Van Dyck and A. m. mimetes Strahan ) A. m. Prefers low altitude (Van Dyck and maritimus Strahan ) Prefers low altitude (Van Dyck and A. m. minimus Strahan ) Occurs at altitudes over m M. habbema (Flannery ) Below to above m, assumed preference for altitudes M. melanurus above m (Flannery ) Range mainly low altitude (Van P. calura Dyck and Strahan )

163 Supplementary Material

Supplementary Figure .. ML phylogeny of the concatenated dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support.

164 Supplementary Material

Supplementary Figure .. ML phylogeny of the nuclear dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support.

165 Supplementary Material

0.87

0.99 0.59

0.97 0.99

0.64

0.5 * 0.98

0.5 0.93 0.84

0.99 0.97 0.98

0.97 0.82

0.98

Supplementary Figure .. BI phylogeny of the combined mtDNA dataset with BI posterior probabilities shown above the node and ML bootstrap values shown below the node. Clades not reconstructed in the ML phylogeny are denoted with ‘*’. ML bootstrap of and BI posterior probability values of . are not displayed. 166 Supplementary Material

Supplementary Table .. List of samples analysed in Fig. . and Fig.. with associated location and collector data. CB numbers refer to BI Cytb haplotypes shown in Fig. .. BM numbers refer to unique haplotypes originally sequenced in Beckman et al. (). Letters following CB and BM are used to denote individual samples. Multiple samples of the same haplotype from the same location where combined and are denoted by multiple entries in the Tissue Code column. Samples marked with ‘*’ were sequenced for the concatenated and combined analysis. NA refers to samples which were not sequenced at Cytb. QM indicates Queensland Museum, QVM indicates Queen Victoria Museum, SAM indicates South Australia Museum, WAM indicates Western Australia Museum, ANWC indicates the Australian National Wildlife Collection, QPWS indicates the Queensland Parks and Wildlife Service, SF indicates State Forest, NP indicates National Park and PA indicates Protected Area.

CB code Tissue code Species Location State Latitude Longitude Collector Collection

Date

A. argentus

CBͱ* HH-, HH-, A. argentus Kroombit Tops NP Qld -. . Harry Hines

HH-*,

ABTC, KTL,

JM

CBͱ ABTC A. argentus Kroombit Tops NP Qld -. . unknown

CBͲ HH-, HH-, A. argentus Kroombit Tops NP Qld -. . Harry Hines, Ben Nottidge //

CBͲ EDM, EDM A. argentus Kroombit Tops NP Qld -. . Eugene Mason

CBͳ* HH-, HH-, A. argentus Kroombit Tops NP Qld -. . Harry Hines, Thomas Mutton, David Benfer, Jesse Rowland

HH-, HH-*, 167 Supplementary Material

K

CBʹ BDNP, BDNP, A. argentus Blackdown Tableland NP Qld -. . Eugene Mason -

BDNP, BDNP, //

BDNP, BDNP

A. mysticus

Eungella, mid-east QLD

CB͵ E, E, A. mysticus Eungella NP Qld -. . Coral Pearce

CBͶ Q/, Q/ A. mysticus Eungella NP Qld -. . Thomas Mutton, Andrew Baker, David Benfer // // CBͶ DNA A. mysticus Eungella NP Qld Tina Ball

// CBͶ* A. mysticus Eungella NP Qld -. . Tina Ball

South-east Qld

CBͷa A. mysticus Kondalilla NP Qld -. . Thomas Mutton, Andrew Baker

CBͷb A. mysticus Maleny Qld Kieran Aland //

CBͷc samples A. mysticus London Creek, Peachester Qld Kieran Aland //

CB͸a A. mysticus Jolly’s Lookout, D Aguilar NP Qld -. . Thomas Mutton, Andrew Baker

CB͸b* JW A. mysticus Andy William s Park, Cedar Creek Qld -. . Emma Gray //

CB͸c JJ A. mysticus Kidaman Creek Rd, Curramore (Blackall Qld -. . Rob Briskie via Scott Burnett //

Range)

CB͸d HH- A. mysticus Mount Gerald, Conondale NP Qld Harry Hines

CB͸e AC, BC, + A. mysticus Cooloola National Park Qld -. . Rebecca Wheatley //

more

168 Supplementary Material

A. flavipes

A. f. leucogaster

CB͹a WA A. f. leucogaster Nanga Rd, Dwellingup WA -. . P. Spencer

CBͱͰb* A. f. leucogaster Albany WA -. . Simmons, G./WAM //

A. f. rubeculus

CBͱͱ A. f. rubeculus Normanton Box Woodland, Mt Zero, Qld Eri Mulder //

Taravale

CBͱͲ PA A. f. rubeculus Paluma NP Qld -. . Harry Hines, Jessie Rowland //

CBͱͳ Q/ A. f. rubeculus Paluma NP Qld . . //

CBͱʹ A. f. rubeculus Gadgarra Road, Gadgarra Forest Reserve Qld -. . Russell Best

CBͱ͵ ABTC A. f. rubeculus Mt Spec Qld SAM

CBͱͶ RU/ A. f. rubeculus Danbulla NP Qld -. . Jesse Rowland, Tyrone Lavery //

CBͱͷ Af A. f. rubeculus Mt. Windsor Qld -. . Bill Laurance via Kevin Rowe

CBͱ͸* A. f. rubeculus Mt. Windsor Qld -. . Bill Laurance via Kevin Rowe

A. f. flavipes

CBͱ͹ C A. f. flavipes Chiltern Vic Hania Lada

CBͲͰ B A. f. flavipes Barmah Vic Hania Lada

CBͲͱ* W*, E A. f. flavipes Shepparton Vic Shannon Troy

CBͲͱ A. f. flavipes Grampians NP Vic John White

CBͲͱ K A. f. flavipes Koondrook Vic Hania Lada

CBͲͲ Gun A. f. flavipes Gunbower Vic Hania Lada

CBͲͲ A. f. flavipes Willows Indigenous PA NSW David Milledge //

169 Supplementary Material

CBͲͳ SAMAM A. f. flavipes .k NW Nangwarry SA -. . SAM

CBͲʹ SAMAM A. f. flavipes .k SW Williamstown SA -. . SAM

CBͲʹ SAMAM/ A. f. flavipes .k W Mount Bonython SA -. . SAM

ABTC

CBͲ͵* A. f. flavipes .k WSW Delamere Sa -. . SAM

CBͲͶ M A. f. flavipes Tara Bush Property, Murrumbateman NSW -. . ANWC ..

CBͲͷ M A. f. flavipes Burrendong Dam, near Mudgee NSW -. . ANWC //

CBͲͷ M A. f. flavipes Belandah Park, Taylors Flat Rd, Frogmore NSW -. . ANWC //

CBͲ͸ ABTC A. f. flavipes Cobar NSW

CBͲ͹ M A. f. flavipes Belandah Park, Taylors Flat Rd, Frogmore NSW -. . ANWC //

CBͳͰ M A. f. flavipes South of Coutts Crossing, North of Coffs NSW -. . ANWC //

Harbour

CBͳͱ Lupo A. f. flavipes Cooloola NP Qld -. . Rebecca Wheatley

CBͳͲ KTDC A. f. flavipes Kroombit Tops NP Qld //

CBͳͳ samples A. f. flavipes Gap Creek Rd, Brookfield Qld Lilia Bernede

CBͳʹ A. f. flavipes London creek , Peachester Qld Kieran aland //

CBͳʹ A. f. flavipes Gap Creek Rd Qld Lilia Bernede

CBͳ͵ plot b A. f. flavipes Mebbin Springs, Minyumai Indigenous PA NSW -. . David Milledge

CBͳͶ A. f. flavipes Redwood Park, Toowoomba Qld -. . R. Hobson //

CBͳͷ A. f. flavipes East of Warwick Qld -. . Ian Gynther

170 Supplementary Material

CBͳ͸ RT- A. f. flavipes Gympie Qld R. Thomas QPWS (via Harry Hines)

CBͳ͹ A. f. flavipes Andrew Rd, Pomona Qld Kieran Aland

CBʹͰa A. f. flavipes Cedar Creek, Samford Qld -. . Heather Janetzki //

CBʹͰb* SE A. f. flavipes Samford Ecology Research Facility, Qld -. . Thomas Mutton

Samford

CBʹͱ A. f. flavipes Minyumai Indigenous PA NSW David Milledge

CBʹͲ NSW A. f. flavipes Bungawalbin Nature Reserve NSW -. . Litticia Bryant, Susan Fuller

A. bellus

CBʹͳ* AF A. bellus Kakadu NP NT -. . Genbank/P. A. Woolley

A. leo

CBʹʹ NEQ A. leo Silver Plains Qld -. . Kevin Rowe

CBʹʹ* ABTC A. leo McIlwraith Ranges, Kulla NP Qld SAM

AMSM

A. adustus

CBʹ͵* A. adustus Dinden NP Qld -. . Russell Best -. . CBʹͶ AD/ A. adustus Tully falls NP Qld Jesse Rowland, Tyrone Lavery //

CBʹͷ AD/ A. adustus Tully falls NP Qld . . Jesse Rowland and Tyrone Lavery //

CBʹ͸ PA A. adustus Paluma Qld Roy Mackay //

A. agilis

CBʹ͹ # Small Patch, A. agilis Grampians NP Vic John White

# Large Patch, #

171 Supplementary Material

Large Patch

BMͱ DA A. agilis Portland, Cobboboonee SF Vic -. . Genbank

BMͲ DQ A. agilis Portland, Cobboboonee SF Vic -. . Genbank

CB͵Ͱa N A. agilis West Otways (Corajil) -teat Vic Tara Draper

CB͵Ͱb DQ A. agilis Otways (Goldhole) Vic -. . Genbank

CB͵Ͱc DQ A. agilis Otways (Kaanglang) Vic -. . Genbank

CB͵ͱa BB A. agilis East Otways (Bambra) -teat Vic Tara Draper

CB͵ͱb DQ A. agilis Otways (Wonga) Vic -. . Genbank

CB͵Ͳ FO A. agilis Naringal ?-teat Vic Claire Wallis

BMͳ DQ A. agilis Otways (seaview) Vic -. . Genbank

BMʹ DQ A. agilis Otways (Bambra) Vic -. . Genbank

BM͵ DQ A. agilis Otways (Wonga) Vic -. . Genbank

BMͶ DQ A. agilis Otways (Charley s Creek) Vic -. . Genbank

BMͷ DQ A. agilis Otways (Seaview) Vic -. . Genbank

BM͸ DQ A. agilis Otways (Kaanglang) Vic -. . Genbank

CB͵ͳ AF A. agilis Cambarville Vic Genbank

CB͵ʹa* Agilis, WP, A. agilis Wilsons Promontory NP Vic -. . Ian Gynther (agilis), Nich Walker (WP), Genbank ( DQ)

DQ

CB͵ʹb ABTC A. agilis Cape Liptrap Vic

CB͵ʹc A. agilis North-west and inland of Cape Liptrap NP Vic Chris Johnstone //

BM͹ DQ A. agilis Mount Donna Buang Vic -. . Genbank

BMͱͰ DQ A. agilis Mount Donna Buang Vic -. . Genbank

172 Supplementary Material

CB͵͵ M A. agilis Tallaganda National Park, km SE of NSW -. . ANWC //

Bungendore

CB͵Ͷ M A. agilis Central Tilba NSW -. . ANWC //

CB͵ͷ aag, DQ A. agilis Tumut, Buccleuch State Forest NSW Sam Banks ( aag), Genbank (DQ)

CB͵͸ M A. agilis Mongarlowe river, km south of NSW -. . ANWC

Mongarlowe

CB͵͹ ABTC/ A. agilis Bega NSW SAM

SAMAM

CBͶͰ N A. agilis Newnes Plateau, Lithgow NSW -. . Martin Denny

A. stuartii south // CBͶͱ WNP A. stuartii Werrikimbe NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba

CBͶͲ EH, EH A. stuartii New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney // // CBͶͳ WNP A. stuartii Werrikimbe NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba

CBͶʹ EH A. stuartii New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͶ͵ EH A. stuartii Arm/kemp Rd New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͶͶ EH A. stuartii New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͶͷ EH A. stuartii New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͶ͸ ABTC A. stuartii near Gosford NSW SAM

CBͶ͹ SDXB A. stuartii FZ/ Powerpole off Myoora Road, NSW -. . Doug Beckers //

Somersby, near Gosford // CBͷͰ* WNP A. stuartii Werrikimbe NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba

173 Supplementary Material

CBͷͱ Ast A. stuartii Booderee NP, Jervis Bay NSW Sam Banks

CBͷͲ M A. stuartii Lithgow, Blue Mountains NSW -. . ANWC //

CBͷͳ ABTC A. stuartii Cowan NSW SAM

A. subtropicus

CBͷʹ MG A. subtropicus Mount Glorious, D Aguilar NP Qld -. . Thomas Mutton and Andrew Baker

CBͷ͵ HH- A. subtropicus Conondale NP Qld Harry Hines //

NAͱ RMT A. subtropicus Woondum NP Qld -. . Thomas Mutton //

NAͲ BS A. subtropicus Wrattens NP Qld -. . Thomas Mutton //

A. stuartii north

CBͷͶ HH-, HH-, A. stuartii Currawong Property, about km NSW Harry Hines //

HH- northeast of Tenterfield

CBͷͷ EH A. stuartii Point Lookout, New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͷ͸a EH, NEST, TNH A. stuartii New England NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba (EH, //

NEST, TNH); Eugene Mason, Emma Gray, Hannah Maloney

(EH)

CBͷ͸b EH A. stuartii Arm/kemp Rd New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͷ͹ EH A. stuartii Arm/kemp Rd New England NP NSW -. . Emma Gray, Eugene Mason, Hannah Maloney //

CB͸Ͱ JM A. stuartii Giraween NP Qld -. . QM

CB͸ͱ A. stuartii Wattleridge Indigenous Protected Area NSW -. . David Milledge //

CB͸Ͳ EH A. stuartii Arm/kemp Rd New England NP NSW -. . Eugene Mason, Emma Gray, Hannah Maloney //

CB͸ͳ TNH A. stuartii New England NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba //

CB͸ʹ MRG A. stuartii Main Range NP Goomburra section Qld . . Thomas Mutton //

174 Supplementary Material

CB͸͵a N A. stuartii Main Range NP Qld -. . Ian Gynther //

CB͸͵b IG-, CG A. stuartii Main Range NP Goomburra section Qld -. . Ian Gynther ( IG-), Ian Hobson (CG)

CB͸͵c IG- A. stuartii Gambubal Section, Main Range NP Qld -. . Ian Gynther //

CB͸Ͷ Plot A A. stuartii Mebbin Springs Estate NSW -. . David Milledge // -. . CB͸ͷ MW A. stuartii Main Range NP, Spicer s Gap Rd, Moss s NSW Thomas Mutton, Andrew Baker, David Benfer //

Well

CB͸͸ NC A. stuartii Nightcap NP NSW -. . Thomas Mutton //

CB͸͹ IG- A. stuartii Gambubal Section, Main Range NP, SEQ Qld -. . Ian Gynther

CB͹Ͱ* AS/BA *, AS/BA I A. stuartii Sprinbrook NP Qld -. . Emma Gray //

CB͹ͱ IG- A. stuartii Duck Creek Rd, Lamington NP Qld -. . Ian Gynther

CB͹Ͳ DR A. stuartii Dalton rd off Tallebudgera rd, Qld Andrew Baker //

Tallebudgera ck

CB͹ͳ A. stuartii Mount Nullum NSW -. .

CB͹ʹ MW A. stuartii Wollumbin NP (Mount Warning ) NSW -. . //

CB͹͵ LNP A. stuartii Duck Creek Rd, Lamington NP NSW . . Wes Hall

CB͹Ͷ IG-O A. stuartii Gambubal Section, Main Range NP, SEQ Qld -. . Ian Gynther

CB͹ͷa BCS, BSC A. stuartii Antartic Beech picnic area, Border Ranges NSW -. . Thomas Mutton, Andrew Baker, Coral Pearce, Angus McNab, //

NP Mark Sanders

CB͹ͷb BCS A. stuartii Brindle Creek, Border Ranges NP NSW -. . Thomas Mutton, Andrew Baker, Coral Pearce, Angus McNab, //

Mark Sanders

CB͹ͷc BCS A. stuartii Bar Mountain, Border Ranges NP NSW -. . Thomas Mutton, Andrew Baker, Coral Pearce, Angus McNab, //

Mark Sanders

175 Supplementary Material

CB͹ͷd Plot c A. stuartii Mebbin Springs Estate NSW -. . David Milledge //

CB͹ͷe IG- A. stuartii Upper Wishing Tree Track, Lamington NP Qld -. . Ian Gynther

CB͹ͷf SP, SP A. stuartii Forest Park, Numinbah Qld -. . Thomas Mutton //

A. godmani

CB͹͹* GO , GO A. godmani Danbulla NP Qld -. Jesse Rowland and Tyrone Lavery //

CB͹͹ ABTC/ A. godmani Near Ravenshoe Qld Genbank

AMSM -. . CB͹͹ GO, GO A. godmani Tully Falls NP Qld Jesse Rowland, Tyrone Lavery //

CB͹͹ A. godmani Danbulla NP Qld Scott Burnett

CBͱͰͰ MGOD A. godmani Wooroonooran NP Qld -. . Russell Best

A. arktos

CBͱͰͱ Holotype A. arktos Bilsborough Court, Sprinbrook NP Qld //

CBͱͰͱ* HH-*, HH-, A. arktos Best of All Lookout, Sprinbrook NP Qld -. . Harry Hines, Andrew Baker, Thomas Mutton, Jessie Rowland, -

HH-, HH-, Emma Gray

AA/BA FY, AA/BC

H

A. swainsonii

CBͱͰͲ RR A. swainsonii Southwest NP Tas -. . Billie Lazenby //

CBͱͰͳ TV/ A. swainsonii Southwest NP Tas Thomas Mutton, Eugene Mason //

CBͱͰʹ R A. swainsonii Mt. Wellington Tas -. . Billie Lazenby //

CBͱͰ͵ TV/, TV/ A. swainsonii Mt Field NP Tas -. . Thomas Mutton, Eugene Mason //

CBͱͰͶ A A. swainsonii Bruny Island Tas Michael Driessen

176 Supplementary Material

CBͱͰͷ* ABTC A. swainsonii Arthur River SF Tas SAM

A. vandycki

CBͱͰ͸ EH A. vandycki Licen rd, Tasman Peninsula Tas -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͱͰ͹a* EH, EH* A. vandycki Fortescue bay, Tasman Peninsula Tas -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͱͰ͹b EH A. vandycki Licen rd, Tasman Peninsula Tas -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͱͰ͹c L A. vandycki Tasman Peninsula Tas -. . Billie Lazenby

A. minimus

A. minimus maritimus

CBͱͱͰ # A. m. maritimus Kanowna Island Vic Nik Fuller via Tara Draper

CBͱͱͱ ABTC A. m. maritimus Cape Liptrap Vic SAM

CBͱͱͲ ABTC A. m. maritimus Gembrook Vic SAM

CBͱͱͳ* # Baldhill (Scotts Bridge) Vic Nik Fuller via Tara Draper

CBͱͱʹ ABTC A. m. maritimus Cape Otway Vic SAM

A. minimus minimus

CBͱͱ͵ QVM : A. m. minimus Unknown Tas QVM

CBͱͱͶ* EH A. m. minimus Fortescue bay, Tasman Peninsula Tas -. . Eugene Mason, Emma Gray, Hannah Maloney //

CBͱͱͷ A. m. minimus The Gardens Tas -. . Billie Lazenby //

CBͱͱ͸ B Cape Bruny Tas Michael Driessen

A. mimetes

CBͱͱ͹ NESW A. mimetes New England NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba //

CBͱͱ͹ TNH A. mimetes New England NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba //

177 Supplementary Material

CBͱͱ͹* NESW, NESW* A. mimetes New England NP NSW -. . Thomas Mutton, Hannah Maloney, Nicole Nesvadba //

CBͱͲͰ A. mimetes Angle Crossing ACT ANWC // -. . CBͱͲͱa M A. mimetes Tara Bush Property, Murrumbateman ACT ANWC //

CBͱͲͱb M A. mimetes Chapman, Canberra ACT -. . ANWC //

CBͱͲͱc A. mimetes Brindabella ACT ANWC

CBͱͲͱd M A. mimetes The Paralyser, Mt Perisher, Kosciuszko NP NSW -. . ANWC -

CBͱͲͲ M A. mimetes Barren Grounds NSW -. . ANWC //

CBͱͲͳ SDXB A. mimetes Rumbalara Carpark, off Henry Wheeler NSW -. . Doug Beckers //

Place, Gosford

CBͱͲʹ SF A. mimetes Sherbrooke Forest, Dandenong Ranges Vic Paul Sunnucks

CBͱͲ͵ M A. mimetes Barren Grounds NSW -. . ANWC //

CBͱͲͶ* #/ Grampians NP Vic John White

CBͱͲͷ ABTC A. mimetes Cape Otway Vic SAM

CBͱͲ͸ ABTC A. mimetes Gembrook Vic SAM

Murexia

CBͱͲ͹* ABTC/ M. melanurus Telefolip PNG SAM

AMSM

CBͱͳͰ* ABTC M. habbema Near Edie Creek PNG SAM

Phascogale

CBͱͳͱ* P. calura Lake Grace WA -. . S. Phelans //

178 Supplementary Material

Supplementary Table .. Pairwise proportion divergence between Cytb haplotypes expressed as a percentage. See Supplementary Table . for haplotype sample information. Haplotypes are ordered as shown in Fig. ..

CB1 CB2 CB3 CB4 CB5 CB6 CB7 CB8 CB9 CB10 CB11 CB12 CB13 CB14 CB15 CB2 . CB3 . . CB4 . . . CB5 . . . . CB6 . . . . . CB7 . . . . . . CB8 . . . . . . . CB9 . . . . . . . . CB10 . . . . . . . . . CB11 . . . . . . . . . . CB12 . . . . . . . . . . . CB13 . . . . . . . . . . . . CB14 . . . . . . . . . . . . . CB15 . . . . . . . . . . . . . . CB16 . . . . . . . . . . . . . . . CB17 . . . . . . . . . . . . . . . CB18 . . . . . . . . . . . . . . . CB19 . . . . . . . . . . . . . . . CB20 . . . . . . . . . . . . . . . CB21 . . . . . . . . . . . . . . . CB22 . . . . . . . . . . . . . . . CB23 . . . . . . . . . . . . . . . CB24 . . . . . . . . . . . . . . . CB25 . . . . . . . . . . . . . . . CB26 . . . . . . . . . . . . . . . CB27 . . . . . . . . . . . . . . . CB28 . . . . . . . . . . . . . . . CB29 . . . . . . . . . . . . . . . CB30 . . . . . . . . . . . . . . . CB31 . . . . . . . . . . . . . . . CB32 . . . . . . . . . . . . . . . CB33 . . . . . . . . . . . . . . . CB34 . . . . . . . . . . . . . . . CB35 . . . . . . . . . . . . . . . CB36 . . . . . . . . . . . . . . . CB37 . . . . . . . . . . . . . . . CB38 . . . . . . . . . . . . . . . CB39 . . . . . . . . . . . . . . . CB40 . . . . . . . . . . . . . . . CB41 . . . . . . . . . . . . . . . CB42 . . . . . . . . . . . . . . . CB43 . . . . . . . . . . . . . . . CB44 . . . . . . . . . . . . . . . CB45 . . . . . . . . . . . . . . . CB46 . . . . . . . . . . . . . . . CB47 . . . . . . . . . . . . . . . CB48 . . . . . . . . . . . . . . . CB49 . . . . . . . . . . . . . . . BM1 . . . . . . . . . . . . . . . BM2 . . . . . . . . . . . . . . . CB50 . . . . . . . . . . . . . . . CB51 . . . . . . . . . . . . . . . CB52 . . . . . . . . . . . . . . . BM3 . . . . . . . . . . . . . . . BM4 . . . . . . . . . . . . . . . BM5 . . . . . . . . . . . . . . . BM6 . . . . . . . . . . . . . . . BM7 . . . . . . . . . . . . . . . BM8 . . . . . . . . . . . . . . . CB53 . . . . . . . . . . . . . . . CB54 . . . . . . . . . . . . . . . BM9 . . . . . . . . . . . . . . . BM10 . . . . . . . . . . . . . . . CB55 . . . . . . . . . . . . . . . CB56 . . . . . . . . . . . . . . . CB57 . . . . . . . . . . . . . . . CB58 . . . . . . . . . . . . . . . CB59 . . . . . . . . . . . . . . . CB60 . . . . . . . . . . . . . . . CB61 . . . . . . . . . . . . . . . CB62 . . . . . . . . . . . . . . . CB63 . . . . . . . . . . . . . . . CB64 . . . . . . . . . . . . . . . CB65 . . . . . . . . . . . . . . .

179 Supplementary Material

CB66 . . . . . . . . . . . . . . . CB67 . . . . . . . . . . . . . . . CB68 . . . . . . . . . . . . . . . CB69 . . . . . . . . . . . . . . . CB70 . . . . . . . . . . . . . . . CB71 . . . . . . . . . . . . . . . CB72 . . . . . . . . . . . . . . . CB73 . . . . . . . . . . . . . . . CB74 . . . . . . . . . . . . . . . CB75 . . . . . . . . . . . . . . . CB76 . . . . . . . . . . . . . . . CB77 . . . . . . . . . . . . . . . CB78 . . . . . . . . . . . . . . . CB79 . . . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

CB16 CB17 CB18 CB19 CB20 CB21 CB22 CB23 CB24 CB25 CB26 CB27 CB28 CB29 CB30 CB17 . CB18 . . CB19 . . . CB20 . . . . CB21 . . . . . CB22 . . . . . . CB23 . . . . . . . CB24 . . . . . . . . CB25 . . . . . . . . . CB26 . . . . . . . . . . CB27 . . . . . . . . . . . CB28 . . . . . . . . . . . . CB29 . . . . . . . . . . . . .

180 Supplementary Material

CB30 . . . . . . . . . . . . . . CB31 . . . . . . . . . . . . . . . CB32 . . . . . . . . . . . . . . . CB33 . . . . . . . . . . . . . . . CB34 . . . . . . . . . . . . . . . CB35 . . . . . . . . . . . . . . . CB36 . . . . . . . . . . . . . . . CB37 . . . . . . . . . . . . . . . CB38 . . . . . . . . . . . . . . . CB39 . . . . . . . . . . . . . . . CB40 . . . . . . . . . . . . . . . CB41 . . . . . . . . . . . . . . . CB42 . . . . . . . . . . . . . . . CB43 . . . . . . . . . . . . . . . CB44 . . . . . . . . . . . . . . . CB45 . . . . . . . . . . . . . . . CB46 . . . . . . . . . . . . . . . CB47 . . . . . . . . . . . . . . . CB48 . . . . . . . . . . . . . . . CB49 . . . . . . . . . . . . . . . BM1 . . . . . . . . . . . . . . . BM2 . . . . . . . . . . . . . . . CB50 . . . . . . . . . . . . . . . CB51 . . . . . . . . . . . . . . . CB52 . . . . . . . . . . . . . . . BM3 . . . . . . . . . . . . . . . BM4 . . . . . . . . . . . . . . . BM5 . . . . . . . . . . . . . . . BM6 . . . . . . . . . . . . . . . BM7 . . . . . . . . . . . . . . . BM8 . . . . . . . . . . . . . . . CB53 . . . . . . . . . . . . . . . CB54 . . . . . . . . . . . . . . . BM9 . . . . . . . . . . . . . . . BM10 . . . . . . . . . . . . . . . CB55 . . . . . . . . . . . . . . . CB56 . . . . . . . . . . . . . . . CB57 . . . . . . . . . . . . . . . CB58 . . . . . . . . . . . . . . . CB59 . . . . . . . . . . . . . . . CB60 . . . . . . . . . . . . . . . CB61 . . . . . . . . . . . . . . . CB62 . . . . . . . . . . . . . . . CB63 . . . . . . . . . . . . . . . CB64 . . . . . . . . . . . . . . . CB65 . . . . . . . . . . . . . . . CB66 . . . . . . . . . . . . . . . CB67 . . . . . . . . . . . . . . . CB68 . . . . . . . . . . . . . . . CB69 . . . . . . . . . . . . . . . CB70 . . . . . . . . . . . . . . . CB71 . . . . . . . . . . . . . . . CB72 . . . . . . . . . . . . . . . CB73 . . . . . . . . . . . . . . . CB74 . . . . . . . . . . . . . . . CB75 . . . . . . . . . . . . . . . CB76 . . . . . . . . . . . . . . . CB77 . . . . . . . . . . . . . . . CB78 . . . . . . . . . . . . . . . CB79 . . . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . .

181 Supplementary Material

CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

CB31 CB32 CB33 CB34 CB35 CB36 CB37 CB38 CB39 CB40 CB41 CB42 CB43 CB44 CB45 CB32 . CB33 . . CB34 . . . CB35 . . . . CB36 . . . . . CB37 . . . . . . CB38 . . . . . . CB39 . . . . . . . . CB40 . . . . . . . . . CB41 . . . . . . . . . . CB42 . . . . . . . . . . . CB43 . . . . . . . . . . . . CB44 . . . . . . . . . . . . . CB45 . . . . . . . . . . . . . . CB46 . . . . . . . . . . . . . . . CB47 . . . . . . . . . . . . . . . CB48 . . . . . . . . . . . . . . . CB49 . . . . . . . . . . . . . . . BM1 . . . . . . . . . . . . . . . BM2 . . . . . . . . . . . . . . . CB50 . . . . . . . . . . . . . . . CB51 . . . . . . . . . . . . . . . CB52 . . . . . . . . . . . . . . . BM3 . . . . . . . . . . . . . . . BM4 . . . . . . . . . . . . . . . BM5 . . . . . . . . . . . . . . . BM6 . . . . . . . . . . . . . . . BM7 . . . . . . . . . . . . . . . BM8 . . . . . . . . . . . . . . . CB53 . . . . . . . . . . . . . . . CB54 . . . . . . . . . . . . . . . BM9 . . . . . . . . . . . . . . . BM10 . . . . . . . . . . . . . . . CB55 . . . . . . . . . . . . . . . CB56 . . . . . . . . . . . . . . . CB57 . . . . . . . . . . . . . . . CB58 . . . . . . . . . . . . . . . CB59 . . . . . . . . . . . . . . . CB60 . . . . . . . . . . . . . . . CB61 . . . . . . . . . . . . . . . CB62 . . . . . . . . . . . . . . . CB63 . . . . . . . . . . . . . . . CB64 . . . . . . . . . . . . . . . CB65 . . . . . . . . . . . . . . . CB66 . . . . . . . . . . . . . . . CB67 . . . . . . . . . . . . . . . CB68 . . . . . . . . . . . . . . . CB69 . . . . . . . . . . . . . . .

182 Supplementary Material

CB70 . . . . . . . . . . . . . . . CB71 . . . . . . . . . . . . . . . CB72 . . . . . . . . . . . . . . . CB73 . . . . . . . . . . . . . . . CB74 . . . . . . . . . . . . . . . CB75 . . . . . . . . . . . . . . . CB76 . . . . . . . . . . . . . . . CB77 . . . . . . . . . . . . . . . CB78 . . . . . . . . . . . . . . . CB79 . . . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

CB46 CB47 CB48 CB49 BM1 BM2 CB50 CB51 CB52 BM3 BM4 BM5 BM6 BM7 BM8 CB47 . CB48 . . CB49 . . . BM1 . . . . BM2 . . . . . CB50 . . . . . . CB51 . . . . . . . CB52 . . . . . . . . BM3 . . . . . . . . . BM4 . . . . . . . . . . BM5 . . . . . . . . . . . BM6 . . . . . . . . . . . . BM7 . . . . . . . . . . . . . BM8 . . . . . . . . . . . . . . CB53 . . . . . . . . . . . . . . . CB54 . . . . . . . . . . . . . . . BM9 . . . . . . . . . . . . . . .

183 Supplementary Material

BM10 . . . . . . . . . . . . . . . CB55 . . . . . . . . . . . . . . . CB56 . . . . . . . . . . . . . . . CB57 . . . . . . . . . . . . . . . CB58 . . . . . . . . . . . . . . . CB59 . . . . . . . . . . . . . . . CB60 . . . . . . . . . . . . . . . CB61 . . . . . . . . . . . . . . . CB62 . . . . . . . . . . . . . . . CB63 . . . . . . . . . . . . . . . CB64 . . . . . . . . . . . . . . . CB65 . . . . . . . . . . . . . . . CB66 . . . . . . . . . . . . . . . CB67 . . . . . . . . . . . . . . . CB68 . . . . . . . . . . . . . . . CB69 . . . . . . . . . . . . . . . CB70 . . . . . . . . . . . . . . . CB71 . . . . . . . . . . . . . . . CB72 . . . . . . . . . . . . . . . CB73 . . . . . . . . . . . . . . . CB74 . . . . . . . . . . . . . . . CB75 . . . . . . . . . . . . . . . CB76 . . . . . . . . . . . . . . . CB77 . . . . . . . . . . . . . . . CB78 . . . . . . . . . . . . . . . CB79 . . . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

184 Supplementary Material

CB53 CB54 BM9 BM10 CB55 CB56 CB57 CB58 CB59 CB60 CB61 CB62 CB63 CB64 CB65 CB54 . BM9 . . BM10 . . . CB55 . . . . CB56 . . . . . CB57 . . . . . . CB58 . . . . . . . CB59 . . . . . . . . CB60 . . . . . . . . . CB61 . . . . . . . . . . CB62 . . . . . . . . . . . CB63 . . . . . . . . . . . . CB64 . . . . . . . . . . . . . CB65 . . . . . . . . . . . . . . CB66 . . . . . . . . . . . . . . . CB67 . . . . . . . . . . . . . . . CB68 . . . . . . . . . . . . . . . CB69 . . . . . . . . . . . . . . . CB70 . . . . . . . . . . . . . . . CB71 . . . . . . . . . . . . . . . CB72 . . . . . . . . . . . . . . . CB73 . . . . . . . . . . . . . . . CB74 . . . . . . . . . . . . . . . CB75 . . . . . . . . . . . . . . . CB76 . . . . . . . . . . . . . . . CB77 . . . . . . . . . . . . . . . CB78 . . . . . . . . . . . . . . . CB79 . . . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

185 Supplementary Material

CB66 CB67 CB68 CB69 CB70 CB71 CB72 CB73 CB74 CB75 CB76 CB77 CB78 CB79 CB80 CB67 . CB68 . . CB69 . . . CB70 . . . . CB71 . . . . . CB72 . . . . . . CB73 . . . . . . . CB74 . . . . . . . . CB75 . . . . . . . . . CB76 . . . . . . . . . . CB77 . . . . . . . . . . . CB78 . . . . . . . . . . . . CB79 . . . . . . . . . . . . . CB80 . . . . . . . . . . . . . . CB81 . . . . . . . . . . . . . . . CB82 . . . . . . . . . . . . . . . CB83 . . . . . . . . . . . . . . . CB84 . . . . . . . . . . . . . . . CB85 . . . . . . . . . . . . . . . CB86 . . . . . . . . . . . . . . . CB87 . . . . . . . . . . . . . . . CB88 . . . . . . . . . . . . . . . CB89 . . . . . . . . . . . . . . . CB90 . . . . . . . . . . . . . . . CB91 . . . . . . . . . . . . . . . CB92 . . . . . . . . . . . . . . . CB93 . . . . . . . . . . . . . . . CB94 . . . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

CB81 CB82 CB83 CB84 CB85 CB86 CB87 CB88 CB89 CB90 CB91 CB92 CB93 CB94 CB95 CB82 . CB83 . . CB84 . . . CB85 . . . . CB86 . . . . . CB87 . . . . . . CB88 . . . . . . . CB89 . . . . . . . . CB90 . . . . . . . . .

186 Supplementary Material

CB91 . . . . . . . . . . CB92 . . . . . . . . . . . CB93 . . . . . . . . . . . . CB94 . . . . . . . . . . . . . CB95 . . . . . . . . . . . . . . CB96 . . . . . . . . . . . . . . . CB97 . . . . . . . . . . . . . . . CB98 . . . . . . . . . . . . . . . CB99 . . . . . . . . . . . . . . . CB100 . . . . . . . . . . . . . . . CB101 . . . . . . . . . . . . . . . CB102 . . . . . . . . . . . . . . . CB103 . . . . . . . . . . . . . . . CB104 . . . . . . . . . . . . . . . CB105 . . . . . . . . . . . . . . . CB106 . . . . . . . . . . . . . . . CB107 . . . . . . . . . . . . . . . CB108 . . . . . . . . . . . . . . . CB109 . . . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . . .

CB96 CB97 CB98 CB99 CB100 CB101 CB102 CB103 CB104 CB105 CB106 CB107 CB108 CB109 CB97 . CB98 . . CB99 . . . CB100 . . . . CB101 . . . . . CB102 . . . . . . CB103 . . . . . . . CB104 . . . . . . . . CB105 . . . . . . . . . CB106 . . . . . . . . . . CB107 . . . . . . . . . . . CB108 . . . . . . . . . . . . CB109 . . . . . . . . . . . . . CB110 . . . . . . . . . . . . . . CB111 . . . . . . . . . . . . . . CB112 . . . . . . . . . . . . . . CB113 . . . . . . . . . . . . . . CB114 . . . . . . . . . . . . . . CB115 . . . . . . . . . . . . . . CB116 . . . . . . . . . . . . . . CB117 . . . . . . . . . . . . . . CB118 . . . . . . . . . . . . . . CB119 . . . . . . . . . . . . . . CB120 . . . . . . . . . . . . . . CB121 . . . . . . . . . . . . . . CB122 . . . . . . . . . . . . . . CB123 . . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . . CB131 . . . . . . . . . . . . . .

187 Supplementary Material

CB110 CB111 CB112 CB113 CB114 CB115 CB116 CB117 CB118 CB119 CB120 CB121 CB122 CB111 . CB112 . . CB113 . . . CB114 . . . . CB115 . . . . . CB116 . . . . . . CB117 . . . . . . . CB118 . . . . . . . . CB119 . . . . . . . . . CB120 . . . . . . . . . . CB121 . . . . . . . . . . . CB122 . . . . . . . . . . . . CB123 . . . . . . . . . . . . . CB124 . . . . . . . . . . . . . CB125 . . . . . . . . . . . . . CB126 . . . . . . . . . . . . . CB127 . . . . . . . . . . . . . CB128 . . . . . . . . . . . . . CB129 . . . . . . . . . . . . . CB130 . . . . . . . . . . . . . CB131 . . . . . . . . . . . . .

CB123 CB124 CB125 CB126 CB127 CB128 CB129 CB1130 CB124 0.2 CB125 0.3 0.2 CB126 2.1 2.1 2.1 CB127 2.0 1.8 2.0 2.0 CB128 0.7 0.2 0.7 2.2 1.8 CB129 17.1 17.3 17.0 16.8 16.5 16.1 CB130 15.9 15.3 15.7 16.3 16.6 15.1 15.7 CB131 14.8 15.0 15.2 15.2 15.7 14.3 18.0 18.2

188 Supplementary Material

CB131 P. calura CB129 M. melanurus CB130 M. habbema 0.91 CB119 NE NSW CB128 Vic CB126 A. m. mimetes 0.76 CB127 0.83 CB125 A. mimetes insulanus 0.62 CB122 Central/ CB120 CB121 south NSW, 0.62 CB123 A. m. mimetes CB124 ACT, Vic 0.96 CB101 CB108 A. arktos CB109 CB106 A. vandycki 0.94 CB107 CB105 0.99 CB104 0.56 0.84 CB103 A. swainsonii 0.98 CB102 0.86 CB115 CB117 0.96 CB116 0.97 CB118 A. m. minimus 0.53 CB114 CB113 0.81 CB110 0.89 CB112 A. m. maritimus CB111 0.65 CB99 CB100 A. godmani CB43 CB44 A. bellus CB45 A. leo 0.63 0.53 CB46 0.72 CB48 CB47 A. adustus 0.88 CB5 CB6 Eungella, MEQ 0.57 CB8 0.97 CB7 SEQ A. mysticus 0.96 CB4 0.84 CB1 CB3 A. argentus 0.86 CB2 0.67 CB10 CB9 A. f. leucogaster 0.98 CB18 0.67 CB17 0.98 CB16 CB15 0.93 CB14 CB12 A. f. rubeculus 0.62 CB13 0.94 0.6 CB11 0.62 0.6 CB26 Central NSW CB22 Vic 0.55 CB29 Central/South CB28 0.86 0.59 CB27 NSW 0.67 CB20 CB21 North Vic CB19 0.63 CB25 CB23 CB24 SA 0.86 CB31 0.71 CB33 CB42 A. f. flavipes CB40 CB37 CB34 North NSW, CB38 CB39 Central/South 0.85 CB32 CB30 CB41 Qld CB36 CB35 0.84 CB60 Central NSW BM9 BM10 0.99 CB54 SE Vic 0.94 CB53 0.98 CB55 CB56 CB58 SE NSW 0.89 CB57 0.77 CB59 CB49 BM2 BM1 A. agilis 0.9 0.88 CB51 CB52 0.88 0.94 BM3 0.7 CB50 SW Vic BM4 0.94 BM5 BM8 0.71 0.75 BM7 BM6 CB83 CB81 SE NSW CB82 CB84 A. stuartii CB85 SE NSW 0.95 CB76 A. stuartii CB80 CB77 NE Qld / SE North CB79 0.6 CB78 NSW north 0.88 CB97 CB96 CB88 CB87 CB86 CB98 SE NSW/ CB95 A. stuartii 0.79 CB91 NE Qld A. stuartii CB92 CB90 CB89 South 0.72 CB93 north CB94 0.52 CB74 CB75 A. subtropicus CB68 CB70 CB69 0.74 0.59 CB72 CB73 0.71 CB71 SE / A. stuartii 0.86 CB61 CB63 Central 0.64 CB62 A. stuartii 0.61 CB64 NSW North 0.73 CB65 0.85 CB67 south 0.63 CB66 2.0

189 Supplementary Material

Supplementary Figure .. ML phylogeny of the Cytb dataset with bootstrap values shown below the node. Bootstrap support is not shown for nodes with % support. Clades marked with blue lines represent recognised taxonomic units, purple lines mark putative taxonomic units clades revealed in the BI analyse shown in Fig. ..

190 Supplementary Material

(a)

Eungella Cooloola Mapleton Imbil Crohamhurst D’Aguilar

(b)

Eungella Cooloola Mapleton Imbil Crohamhurst D’Aguilar

(c) Eungella Cooloola Mapleton Imbil Crohamhurst Eungella 0.00000 Cooloola 0.63908 0.00000 Mapleton 0.35362 0.58594 0.00000 Imbil 0.39043 0.55020 0 0.00000 Crohamhurst 0.30432 0.485c82 0.08201 0.09208 0.00000 D’Aguilar 0.37718 0.68517 0.18119 0.12293 0.26695

Supplementary Figure .. Graphical representation of membership coefficients of the Bayesian STRUCTURE analysis of microsatellite loci (AaK is excluded) for A. mysticus obtained from sites across the known range of the species. Each plot represents different population assignments for K: (a) K = ; and (b) K = . Solid black lines delineate the different sites; each vertical line represents a single individual. Colours represent cluster assignments. Pairwise RST estimates of A. mysticus populations for these microsatellite loci are shown (c).

191 Supplementary Material

Supplementary Table .. Table of monthly sex ratios at both field sites for A. mysticus. Only those months in which both A. mysticus sexes were caught are show

Year A. mysticus 2013 AW DW DW without O line July 2 n/a n/a August 0.75 1.5 1.5 2013 April 0.17 0.7 0.8 May 1 1.3 1.4 June 1 2.25 2.7 July 0.25 2 2.2 August 0.2 2.2 3.3

Supplementary Table .. Table of monthly AvD for A. mysticus at both field sites. Data is combined from both years. Values are given in metres, numbers in brackets show sample size.

AW DW F M F M Apr 46 (4) 28 (4) 44 (4) 8 (1) 64 (3) 100 May (2) 37.3 (3) 59.2 (5) 8 (2) 45.7 Jun (7) 24 (1) 84 (2) 32 (3) 34.7 Jul (6) Aug 42 (4) 77.3 (3) 81.3 (6) 40 (7) Sep 32 (2) 24 (2) Oct 12 (3) 64 (1) Nov 32 (1) 40 (1)

192 Supplementary Material

Supplementary Table .. Number of transient and resident individuals per month for A. mysticus and A. subtropicus at AW and DW. Male A. mysticus captures in have not been analysed due to the short period of trapping in which they were alive. Female A. subtropicus were not included due to their low trap success.

A. mysticus A. subtropicus AW DW Female Male Female Male male Male Month Transient Resident Transient Resident Transient Resident Transient Resident Transient Resident 2012 Jul 2 Aug 3 1 3 0 2 4 Sep 2 1 2 2 3 4 Oct 3 2 1 2 Nov 0 2 1 3 2013 Apr 2 40 1 1 4 04 May 1 4 2 3 1 3 1 6 1 1 Jun 2 33 2 0 4 26 1 1 Jul 2 50 2 1 5 47 0 0 Aug 0 3 1 0 1 4 4 7 1 3 Sep 0 3 0 0 0 3 Oct 1 4 0 2

193 Supplementary Material

700

600

500

400 2011 (mm) 2012 300

Rainfall 2013 Mean 200

100

0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Month

Supplementary Figure .. Total rainfall in each month from - and mean rainfall per month since . Rainfall was recorded by the Australian Bureau of Meteorology at Samsonvale station ~-km from the field sites

194

Supplementary Material

196