DOCSLIB.ORG

JOURNAL of NEMATOLOGY Molecular Approach to Confirm

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
JOURNAL of NEMATOLOGY Molecular Approach to Confirm JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-020 e2020-20 | Vol. 52 Molecular approach to confirm traditional identification of Radopholus similis sampled in Tanzania Doreen M. Mgonja1, 2,*, Gladness E. Temu1, Joseph C. Ndunguru2, Abstract 3 Magreth F. Mziray , Banana (Musa spp. L.) is an important staple food and cash crop 1,4 Sylvester L. Lyantagaye for about 30% of the population in Tanzania; however, the burrowing 3 and Nessie D. Luambano plant-parasitic nematode Radopholus similis causes black head 1College of Natural and Applied disease and toppling in banana plants, which results in yield losses. Sciences, University of Dar es We collected and identified 80 specimens ofR. similis from four agro- Salaam, P.O. Box 35091, Dar es ecological zones in Tanzania using morphological characters. We Salaam, Tanzania. then used universal and specific R. similis primers to amplify the small 2Tanzania Agricultural Research subunit, internal transcribed spacer and large subunit of ribosomal Institute, Mikocheni, P.O. Box 6226, DNA regions of these specimens. The amplicons were subsequently Dar es Salaam, Tanzania. sequenced and analyzed using Bayesian inference. We identified two major clades, one that comprised all R. similis sequences 3 Tanzania Agricultural Research derived from this study and another that included R. similis and Institute, Kibaha, P.O. Box 30031, Radopholus spp. sequences obtained from GenBank, indicating the Kibaha, Tanzania. separation of this species from congeneric sequences. Our findings 4Mbeya College of Health and provide a useful, simple and rapid method for identifying burrowing Allied Sciences, University of Dar nematodes. This outcome could contribute to the development of es Salaam, P.O. Box 608, Mbeya, permanent, integrated pest management strategies for the control Tanzania. of R. similis in banana and other crops in order to reduce associated yield losses in Tanzania. To our knowledge, this is the first study of *E-mail: [email protected] nematodes to use combined morphological and molecular methods This paper was edited by for the identification of R. similis in Tanzania. Erik J. Ragsdale. Received for publication Keywords August 2 2019. Banana, Burrowing nematodes, Genetic variation, Musa spp., Pest management, Plant-parasitic nematodes, Taxonomy. Banana (Musa spp. L.) is a key food crop in rural and to be used by small-scale farmers as they involve the urban areas of the humid tropics, with an annual use of hot water and expensive nematicides, many global production of up to 100mn tons (FAO, 2015). In of which are environmentally hazardous (Van, 2013). East Africa, banana is widely consumed and provides Thus, burrowing nematode species need rapid and approximately 10% of the calorific intake for more accurate identification in order to allow development of than 70mn people (Kilimo Trust, 2012). In Tanzania, in alternative and permanent sustainable management particular, it is a staple food and cash crop for more strategies specific to R. similis (Kaplan et al., 2000). than 30% of the total population (Nkuba, 2007). This would contribute to achieving the estimated Plant-parasitic nematodes (PPN) are the principal annual banana production potential of 10 Mt/ha in pests of banana in Tanzania, adversely affecting Tanzania (Kilimo Trust, 2012). Morphological features banana production by causing up to 50% yield losses have been used in the identification ofR. similis (Coyne, 2009). However, the effective management of in Tanzania (Speijer and De Waele, 2001; Coyne, R. similis in banana crops is problematic, because the 2009). More recent research suggests that the limited control strategies available at present tend not use of only morphological features increases the 1 © 2020 Authors. This is an Open Access article licensed under the Creative Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Molecular identification of R. similis: Mgonja et al. risk of misidentification (Handoo et al., 2016; Wang offset and knob-shaped head; degenerated pharynx et al., 2016). Thus, additional identification methods, and stylet with very small stylet knobs in males (Siddiqi, particularly molecular-based identification, which 2000). Extracted nematodes were placed on a glass requires a small amount of nucleic acid extracted slide with 10 to 20 µl of sddH2O, and specimens were from a single individual, will allow more accurate then further observed under a compound microscope nematode identification, regardless of developmental (Leica 2500, Leica Microsystems CMS GmbH, Wetzler, stage (Handoo et al., 2016). The present study Germany) at 20× magnification to confirm initial aimed to characterize R. similis using a combined identification based on morphology. Nematodes were morphological and morphometric approach and to identified from digital photographs (40× magnification) confirm its identity using rDNA sequencing. and under 100× magnification with oil immersion. They were measured according to parameters described by Materials and methods Handoo et al. (2016). Nematode populations Molecular characterization We collected 314 root samples from 104 smallholder PCR amplification of small subunit (SSU), internal farms distributed across four agro-ecological zones of transcribed spacers 1 and 2 (ITS1 and ITS2) and large Tanzania, comprising three on the mainland (Kagera subunit (LSU) of rDNA regions of nematodes collected region in the Lake zone, Mbeya and Ruvuma regions from the four agro-ecological zones were used for in the Southern Highlands zone, and Kilimanjaro and molecular characterization of R. similis. Arusha regions in the Northern zone) and one on the The DNA extraction was carried out according to Zanzibar islands of Unguja and Pemba. Out of 24 the protocol described by Ye et al. (2015). A single fields, 10 were surveyed in each region. The variation adult R. similis nematode was removed from the glass on the number of fields surveyed from one region to microscope slide previously used for morphological another was due to the availability of banana fields. analysis thus, made a total of 20 DNA samples from Three samples of 10 to 15-cm lengths, each weighing each zone. approximately 20 g, of banana roots were collected randomly from each banana field as described by PCR amplification, cleaning Luambano et al. (2019). and sequencing Nematode extraction and identification The extracted DNAs were used for PCR amplification, using universal primers 18S965/18S1573R GGCGAT Nematode extraction was done using a modified CAGATACCGCCCTAGTT/TACAAAGGGCAGGGAC Baermann’s method as explained by Coyne et al. GTAAT (Mullin et al., 2005) and rDNA2/rDNA 1.58 S TT (2007), by which 5 g of banana roots were extracted GATTACGTTCCCTGCCCTTT/ACGAGCCGAGTG from each sample. The extracted material was ATCCACCG (Vrain et al., 1992; Cherry et al., 1997) to subsequently incubated for 24 hr, after which a amplify the SSU & ITS1 rDNA regions, respectively, for dissecting microscope (Leica MZ 9.5, Heerbrugg, the preliminary identification of R. similis. Additional Switzerland) was used to observe nematodes from species-specific primers were designed including; the extracted material. primers RD1f/RD1r (ACTGAGCCGATTCGAGAAATC/ ATGATTTGGAAAAGCTGCCAATTT); RS3ITSF/RS3IT Morphological and morphometric SR (CTGTGAGTCGTGGAGCAGTT/ATGATTTGGAAAA characterization GCTGCCAAT) and RS4ITSF/RS4ITSR (TGTAGTCC ATGTCCGTGGC/TGATTTGGAAAAGCTGCCAATTT) From the 314 banana root samples, more than which amplify the ITS1 & ITS2 and primers RS8LSUF/ 20 nematodes were extracted from each zone. In RS8LSUR (AGGACGTGAAACCGGTGAGG/TATACCC total, 20 (10 males and 10 females) were picked for AAGTCAGACGATCG) and RS6LSUF/RS6LSUR (CTGG morphological and morphometric characterization CGTATCTAGCCTGCAT/TTTACACCGAGGATT under a dissecting microscope (Leica MZ 9.5) based GGCGT), which target the LSU rDNA regions for on characters associated with R. similis including: confirmation of morphological identification. These presence of three to four lip annuli; long stylet with primers were designed using the Primer3 and BLAST rounded and flattened basal knobs; elongated tail with tool from the NCBI site (https://www.ncbi.nlm.nih. pointed terminus and vulva positioned slightly below gov/tools/primer-blast/) and synthesized by the mid body (54-55%) in females; presence of a strongly Bioneer Corporation, Daejeon, Republic of South 2 JOURNAL OF NEMATOLOGY Korea. The specificity of each primer to amplify target lip annuli; the long stylet was well developed with nematode species was evaluated using pretested rounded and flattened basal knobs; excretory pores DNA for R. similis, P. goodeyi and P. coffeae, which were present at the esophago-intestinal junction; were obtained by PCR amplification using universal the tail was elongated with a pointed terminus; the primers 18S965/18S1573R and rDNA2/rDNA1.58 S pharyngeal gland dorsally overlapped the intestine; and species were determined by sequencing. and the vulva was positioned post equatorial, with The PCR amplification using the designed primers approximately 54 to 55% of body length at the was done as described by Ye et al. (2015). The anterior (Fig. 1A-F). In males, the body was slender thermocycler conditions for amplification comprised and ventrally curved; the pharynx and stylet were initial denaturation at 94°C for 3 min, followed by 35 degenerated with very small stylet knobs and an cycles of denaturation at 94°C for 30 sec, annealing indistinct median bulb; head was strongly offset and for 45 sec at 55°C
Load more

Recommended publications
  • Endophytic Control of Cosmopolites Sordidus and Radopholus Similis Using Fusarium Oxysporum V5w2 in Tissue Culture Banana
    Endophytic control of Cosmopolites sordidus and Radopholus similis using Fusarium oxysporum V5w2 in tissue culture banana Dennis M.W. Ochieno Thesis committee Thesis supervisors Prof. dr. Marcel Dicke Professor of Entomology Wageningen University Prof. dr. ir. Arnold van Huis Personal Chair at the Laboratory of Entomology Wageningen University Thesis co-supervisor Dr. Thomas Dubois Biocontrol Specialist International Institute of Tropical Agriculture Other members Prof. dr. TWM Kuijper, Wageningen University Prof. dr. RA Sikora, University of Bonn, Germany Dr. JM Raaijmakers, Wageningen University Dr. MNEJ Smit, IPM specialist, (private consultant) This research was conducted under the auspices of the C. T. de Wit Graduate School of Production Ecology and Resource Conservation Endophytic control of Cosmopolites sordidus and Radopholus similis using Fusarium oxysporum V5w2 in tissue culture banana Dennis M.W. Ochieno Thesis submitted in partial fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Monday 1 November 2010 at 11 a.m. in the Aula Dennis M.W. Ochieno Endophytic control of Cosmopolites sordidus and Radopholus similis using Fusarium oxysporum V5w2 in tissue culture banana Thesis, Wageningen University, Wageningen, NL (2010) With references, with summaries in Dutch and English ISBN 978-90-8585-637-5 Table of contents Acknowledgements vii Abstract
    [Show full text]
  • Towards Management of Musa Nematodes in Asia and the Pacific
    The mission of the International Network for the Improvement of Banana and Plantain (INIBAP) is to sustainably increase the productivity of banana and plantain grown on smallholdings for domestic consumption and for local and export markets. The programme has four specific objectives: To organize and coordinate a global research effort on banana and plantain, aimed at the development, evaluation and dissemination of improved banana cultivars and at the conservation and use of Musa diversity. To promote and strengthen collaboration and partnerships in banana-related activities at the national, regional and global levels. To strengthen the ability of NARS to conduct research and development activities on bananas and plantains. To coordinate, facilitate and support the production, collection and exchange of information and documentation related to banana and plantain. INIBAP is a network of the International Plant Genetic Resources Institute (IPGRI), a Future Harvest center. The International Plant Genetic Resources Institute (IPGRI) is an independent international scientific organization that seeks to advance the conservation and use of plant genetic diversity for the well-being of present and future generations. It is one of the 16 Future Harvest Centres supported by the Consultative Group on International Agricultural Research (CGIAR), an association of public and private members who support efforts to mobilize cutting-edge science to reduce hunger and proverty, improve human nutrition and health, and protect the environment. IPGRI has its headquarters in Maccarese, near Rome, Italy, with offices in more than 20 other countries worldwide. The Institute operates through three programmes: (1) the Plant Genetic Resources Programme, (2) the CGIAR Genetic Resources Support Programme and (3) the International Network for the Improvement of Banana and Plantain (INIBAP).
    [Show full text]
  • Radopholus Similis
    Feb 20Pathogen of the month – Feb 2020 F M F sp v M a b c d e f g Fig. 1. (a) Mature and juvenile nematodes expressing auto-fluorescent globules/lip region and egg with no autofluorescence; (b) and (c) female (F) and male (M) nematodes highlighting the differences in morphology in the lip region (black arrows) and reproductive organs i.e. (sp) spicules and (v) vulva; (d) female nematode undergoing molting; (e) Nematophagous fungal growth within a dead burrowing nematode on 1% (w/v) water agar plate; (f) root lesions in R. similis infected banana roots and (g) banana plant toppling due to burrowing nematode damage. Scale bars represent 100 mm, 20 mm, 50 mm and 200 mm in (a), (b), (c) and (e) respectively. Common Name: Burrowing nematode Disease: Spreading decline (citrus); toppling or blackhead disease (banana); yellows disease (black pepper) Classification: K: Animalia P: Nematoda C: Secementea O: Tylenchida F: Pratylenchidae First observed in Fiji in 1893, the burrowing nematode, Radopholus similis infects the roots of many commercial crops such as banana, ginger and citrus. A draft genome is available and sequence analysis suggests that it is closely related to cyst nematodes than to root knot or other migratory endoparasitic nematodes such as Pratylenchus. Recent work on R. similis isolates from Fiji and Australia differed in pathogenicity on ginger and banana, indicating pathotype differences between isolates. Biology and Ecology: All larval stages and adult females Distribution: It is found in most tropical and subtropical of Radopholus similis are infective and feed on root cortical regions of the world.
    [Show full text]
  • Sudan University of Science and Technology College of Graduate
    Sudan University of Science and Technology College of Graduate Studies Studies on Plant Parasitic Nematodes on Banana in Sennar and Kassala States دراﺳﺎت ﻋﻠﻰ اﻟﻨﯿﻤﺎﺗﻮدا اﻟﻤﺘﻄﻔﻠﺔ ﻋﻠﻰ ﻧﺒﺎت اﻟﻤﻮز ﻓﻰ وﻻﯾﺘﻰ ﺳﻨﺎر وﻛﺴﻼ A thesis submitted in to the Sudan University of Science and Technology in Fulfillment of the requirement for M.Sc. (Agric) in crop protection (Plant Pathology) By Duria Abdelsalam Eltahir Elshakh Supervisor: Dr. Ibrahim Saeed Mohammed 2014 ﺑﺳم ﷲ اﻟرﺣﻣن اﻟرﺣﯾم Sudan University of Science and Technology College of Graduate Studies Studies on Plant Parasitic Nematodes on Banana in Sennar and Kassala States دراﺳﺎت ﻋﻠﻰ اﻟﻨﯿﻤﺎﺗﻮدا اﻟﻤﺘﻄﻔﻠﺔ ﻋﻠﻰ ﻧﺒﺎت اﻟﻤﻮز ﻓﻰ وﻻﯾﺘﻰ ﺳﻨﺎر وﻛﺴﻼ A thesis submitted in the requirement of the Degree of M.Sc. Agric. In Crop Protection (Plant Pathology) By Duria Abdelsalam Eltahir Elshakh B.Sc. in Crop Protection University of Zagazig, Egypt(1986) Main Supervisor: Dr. Ibrahim Saeed Mohammed Co. Supervisor: Prof. Gamal Abdalla Elbadri 2014 Dedication To the soul of my father Lovely mother Intimate husband Brothers and sisters To all those who search of knowledge 3 ACKNOWLEDGMENT Thanks and praise to the Beneficent and Merciful God who provided me with health, strength and patience to have this drop from the renewable flood of knowledge. I am gratefully to my supervisors, Doctor Ibrahim Saeed Mohammed and Professor Gamal Abdalla Elbadri for all the encouragement, helpful guidance and continued support. Special thankS to my Co. supervisor Professor. Gamal Abdalla Elbadri under who's the supervision of work has been successfully carried out with his invaluable advices, unlimited helpful and for this correction of this study.
    [Show full text]
  • Functional Diversity of Soil Nematodes in Relation to the Impact of Agriculture—A Review
    diversity Review Functional Diversity of Soil Nematodes in Relation to the Impact of Agriculture—A Review Stela Lazarova 1,* , Danny Coyne 2 , Mayra G. Rodríguez 3 , Belkis Peteira 3 and Aurelio Ciancio 4,* 1 Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, 2 Y. Gagarin Str., 1113 Sofia, Bulgaria 2 International Institute of Tropical Agriculture (IITA), Kasarani, Nairobi 30772-00100, Kenya; [email protected] 3 National Center for Plant and Animal Health (CENSA), P.O. Box 10, Mayabeque Province, San José de las Lajas 32700, Cuba; [email protected] (M.G.R.); [email protected] (B.P.) 4 Consiglio Nazionale delle Ricerche, Istituto per la Protezione Sostenibile delle Piante, 70126 Bari, Italy * Correspondence: [email protected] (S.L.); [email protected] (A.C.); Tel.: +359-8865-32-609 (S.L.); +39-080-5929-221 (A.C.) Abstract: The analysis of the functional diversity of soil nematodes requires detailed knowledge on theoretical aspects of the biodiversity–ecosystem functioning relationship in natural and managed terrestrial ecosystems. Basic approaches applied are reviewed, focusing on the impact and value of soil nematode diversity in crop production and on the most consistent external drivers affecting their stability. The role of nematode trophic guilds in two intensively cultivated crops are examined in more detail, as representative of agriculture from tropical/subtropical (banana) and temperate (apple) climates. The multiple facets of nematode network analysis, for management of multitrophic interactions and restoration purposes, represent complex tasks that require the integration of different interdisciplinary expertise. Understanding the evolutionary basis of nematode diversity at the field Citation: Lazarova, S.; Coyne, D.; level, and its response to current changes, will help to explain the observed community shifts.
    [Show full text]
  • Past and Present of the Nematode Radopholus Similis (Cobb)
    CROP PROTECTION Past and present of the nematode Radopholus similis (Cobb) Thorne with emphasis on Musa: a review Pasado y presente del nematodo Radopholus similis (Cobb) Thorne con énfasis en musáceas: una revisión Charles Volcy1 ABSTRACT RESUMEN This review presents a historical background on different as- En la presente reseña, se hace un recorrido histórico sobre pects of the nematode Radopholus similis (Cobb) Thorne, an diferentes aspectos del nematodo Radopholus similis (Cobb) important pathogen of Musa, black pepper and anthurium. Thorne, importante patógeno de musáceas, de la pimienta It examines the history of its discovery and its name, new negra y del anturio. Se analiza la historia de su descubrimiento approaches to its taxonomy and its genome, and the process y de su nombre, los nuevos planteamientos sobre su taxonomía of dissemination and pathogenic variability. Finally, it docu- y su genoma, su proceso de diseminación y su variabilidad ments the evolution of the control measures in banana, from patogénica. Finalmente, se documenta la evolución de las me- chemical control to bio-protection and managing the habitat didas de control en banano, desde el control químico hasta la of the pathogen. bioprotección y el manejo del hábitat del patógeno. Key words: history, taxonomy, pathogenicity, management. Palabras clave: historia, taxonomía, patogenicidad, manejo. Introduction Origin and spread of R. similis Radopholus similis (Cobb), with the name “nematodo The discovery, the first morphometric description, and the barrenador” in Spanish and burrowing nematode or “Fiji first names of this nematode were the fruits of research by banana-root nematode” in English, is one of the ten most the American Nathan Cobb August in Australia after the important phyto-helminths in the tropics (Haegeman et pathological examination of banana roots collected in Fiji al., 2010).
    [Show full text]
  • Integrated Management of Banana Nematodes: Lessons from a Case Study in the French West Indies
    From Science to Field Banana Case Study – Guide Number 4 Integrated management of banana nematodes: Lessons from a case study in the French West Indies Jean-Michel Risède, CIRAD, France Tino daMbas, ITBAN, France Christian ChabRieR, CIRAD, France Raphaël aChaRd, CIRAD, France Marc doRel, CIRAD, France Patrick QuénéheRvé, IRD, France Association of bananas with the perennial legume Neonotonia wightii. © Jean-Michel Risède, CIRAD, France. Food Quality and Safety From Science to Field Banana Case Study – Guide Number 4 integrated management of banana nematodes: lessons from a case study in the French West indies Plant-parasitic nematodes are tiny worms that live mainly in soil and roots. In the case of banana plants, the most damaging species spend most of their life cycle in root and corm tissues. Their mouth cavity contains a hollow stylet with which they puncture the cell and remove the contents. Plurispecific communities of millions of individuals can develop in corm and root tissues of which they alter the physical and functional integrity. Nematode proliferation can disrupt nutrient and water uptake, delay growth and cause banana plants to topple over. In the French West Indies, toppling over is the main damage caused by nematodes. As in many other banana-producing regions around the world, 10 years ago in the French West Indies methods for the control of nematodes in export bananas relied on the use of synthetic carbamate and organophosphate nematicides. For the most part classified as toxic or highly toxic, in recent years many of these products have gradually been banned. Alter- native integrated plant-parasitic nematode management has consequently been developed in banana cropping systems in the French West Indies with the support of different stake- holders (growers, researchers, extension officers etc).
    [Show full text]
  • (Musa Spp.) to the Burrowing Nematode Radopholus Similis
    Phenalenone-type phytoalexins mediate resistance of banana plants (Musa spp.) to the burrowing nematode Radopholus similis Dirk Hölschera,b,1,2, Suganthagunthalam Dhakshinamoorthyc,1, Theodore Alexandrovd,e,f,g, Michael Beckerh, Tom Bretschneideri, Andreas Buerkertb, Anna C. Creceliusj, Dirk De Waelec,k, Annemie Elsenl, David G. Heckelm, Heike Heklaun, Christian Hertwecki, Marco Kaio, Katrin Knopj, Christoph Krafftp, Ravi K. Maddulao, Christian Matthäusp, Jürgen Poppp,q, Bernd Schneidera, Ulrich S. Schubertj,r, Richard A. Sikoras, Aleš Svatošo, and Rony L. Swennenc,t,u aNuclear Magnetic Resonance Research Group, oMass Spectrometry Research Group, mDepartment of Entomology, Max Planck Institute for Chemical Ecology, 07745 Jena, Germany; bDepartment of Organic Plant Production and Agroecosystems Research in the Tropics and Subtropics, University of Kassel, 37213 Witzenhausen, Germany; cLaboratory of Tropical Crop Improvement, Division of Crop Biotechnics, Faculty of Bioscience Engineering, Department of Biosystems, University of Leuven, 3001 Leuven, Belgium; dCenter for Industrial Mathematics, Department of Mathematics, University of Bremen, 28359 Bremen, Germany; eSteinbeis Innovation Center for Scientific Computing in Life Sciences, 28359 Bremen, Germany; fScientific Computing in Life Sciences (SCiLS) GmbH, 28359 Bremen, Germany; gSkaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, CA 92093; hDepartment of Applications Matrix-Assisted Laser Desorption/Ionization - Time of Flight (MALDI-TOF),
    [Show full text]
  • Monoxenic Culture of Banana-Parasitic Nematodes on Musa Acuminafa Cv
    Journal of Nematology 22(4):608-611. 1990. O The Society of Nematologists 1990. Monoxenic Culture of Banana-Parasitic Nematodes on Musa acuminafa cv. Poyo shoots 8 THIERRYMATEILLE’ Key words: Radopholus simzlis, Helicotylenclius mul- report of mass production of H. fararo- ticinctus, Hoplolaimus pararobustus, banana, in vitro. bustus on aseptic plants or plant tissues in culture. However, Dasgupta et al. (4) reared A~~~~ nematodes parasitizing bananas Hoplola~musi9zdicus on excised roots of sor- throughout the world, Radopholus similis ghum* The Objective Of this andHe~ico~y~enchusmulticinctus are the was to determine whether R. similis, H. mul- widespread and damaging species, Besides ticinctus, and H*pararobustus could be prop- these two nematodes, Hoplolaimus pararo- agated on rooted banana shoots bustus is encountered frequently in Ivory in tissue Coast and has been increasing in banana Aseptic leafy shoots of banana, Musa SUU- growing areas for the past 25 years (6,lO). W. to the Caven- In vitro culture systems could facilitate dish were transferred onto a screening for resistance and rearing of large rooting medium in test tubes (ll). numbers of monoxenic nematodes for ex- were incubated for 2 weeks under a 12- periments. The most common techniques Photoperiod at 30 c a 12-hour used to rear R. similis monoxenically in- dark period at 2’1 C. Radoflaolus similis volve callus tissues, usually carrot (1 3). Root (CObb, 1893) Thorlle, 1949, pararobus- callus from okra, grapefruit, and alfalfa (12) tus (Schuurmans St~khoven Teunissen, and leaf callus from citrus (9) also have 1938)Sher, 1963, andH. multicinctus(Cobb, been utilized.
    [Show full text]
  • Preventing Nematodes from Spreading: a Case Study with Radopholus Similis (Cobb) Thorne in a Banana field
    ARTICLE IN PRESS Crop Protection ] (]]]]) ]]]– ]]] Contents lists available at ScienceDirect Crop Protection journal homepage: www.elsevier.com/locate/cropro Preventing nematodes from spreading: A case study with Radopholus similis (Cobb) Thorne in a banana field Christian Chabrier a,Ã, Patrick Que´ne´herve´ b a CIRAD, UPR Syste`mes Bananes et Ananas, Poˆle de Recherche Agroenvironnemental de la Martinique, BP 214,97 232 Le Lamentin, Martinique b IRD, UMR IRD-CIRAD-UM2: Re´sistance des Plantes aux Bioagresseurs, Poˆle de Recherche Agroenvironnemental de la Martinique, BP 214,97 232 Le Lamentin, Martinique article info abstract Article history: During the last decade, new crop systems have been developed in the French West Indies to avoid repeated Received 17 December 2007 applications of nematicides in banana fields. These combine fallow or rotation crops and nematode-free in Received in revised form vitro plants. In many fields, however, after 2–4 years, the burrowing nematodes Radopholus similis 8 March 2008 progressively re-infest banana fields, leading growers to re-apply nematicides. Among different hypotheses Accepted 10 March 2008 for re-infestation, we studied the possibility that nematodes were disseminated by runoff water. The study was conducted in an experimental field on plots that were defined by ditches or marked with flags and Keywords: weeded or not, prior to replanting with in vitro plants. Results showed that 50–80 cm deep ditches Contamination dynamics efficiently prevent R. similis dissemination and that dispersion by water runoff is the major route of Burrowing nematode contamination. In contrast, weed management during the fallow period had little influence.
    [Show full text]
  • Radopholus Citrophilus and Radopholus Similis
    EPPO quarantine pest Prepared by CABI and EPPO for the EU under Contract 90/399003 Data Sheets on Quarantine Pests Radopholus citrophilus and Radopholus similis IDENTITY Taxonomic position: Nematoda: Tylenchida: Pratylenchidae Notes on taxonomy and nomenclature: R. similis is an original member of the EPPO A2 quarantine list. Reported from several EPPO countries, it is locally established in a few. It has now been divided into two species (Esser et al., 1984; Huettel et al., 1984): R. similis sensu stricto, formerly the banana race, attacking bananas but not citrus, corresponding to the original A2 list entry, and R. citrophilus, formerly the citrus race, attacking bananas and citrus. The latter is absent from Europe and so is now considered a member of the A1 list. It may be noted that the separation of the two sibling species is not universally accepted (Esser et el., 1988). • Radopholus citrophilus Name: Radopholus citrophilus Huettel et al. Synonyms: Radopholus similis citrus race Common names: Citrus spreading decline nematode (English) Bayer computer code: RADOCI EPPO A1 list: No. 161 EU Annex designation: II/A1 • Radopholus similis Name: Radopholus similis (Cobb) Thorne Synonyms: Tylenchus similis Cobb (synonym of R. similis sensu lato) Radopholus similis banana race (synonym of R. similis sensu stricto) Common names: Burrowing nematode, banana toppling disease nematode (English) Anguillule mineuse du bananier (French) Nemátodo coco, nematodo barrenador (Spanish) Bayer computer code: RADOSI EPPO A2 list: No. 126 EU Annex designation: II/A2 HOSTS Both species have a wide host range, attacking monocotyledonous plants: Musaceae (bananas, Strelitzia), Araceae (Philodendron, Anthurium), Marantaceae (Calathea), and some dicotyledons (e.g.
    [Show full text]
  • A Review on Biology and Management of Radopholus Similis
    Advances in Life Science and Technology www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.36, 2015 A Review on Biology and Management of Radopholus similis Gebrehiwot Nega Gebremichael Arba Minch University, Department of Plant Science, P. O. Box. 21, Arba Minch, Ethiopia Abstract The burrowing nematode (Radopholus similis ) is an amphimictic species characterized by accentuated sexual dimorphism. Burrowing nematode has migratory endoparasitic habits and it develops and reproduces inside plant tissues of host roots. Fertilization is normally assumed to be bisexual, since females recovered from populations with males usually have sperm in their spermatheca, but reproduction by parthenogenesis does take place. The life cycle of the pathogen is completed in about 21 days at 25°C, and each female lays an average of four to five eggs each day for 2 weeks. This nematode burrows in the cortex of the root, destroying them and causing the formation of cavities then after eggs lay inside the cracks. R. similis of major economic importance and interactions with other pathogens enhance crop damage and yield loss. Phytosanitary measures are of prime importance in reducing the negative impact of plant-parasitic nematodes before they introduce. But once burrowing nematodes have become established in a field, the only option left is to try reducing their preplant density and further spread by the use of combination of different management methods such as crop rotation, cover crops, fallowing, removal of infested material, organic amendments, soil solarisation, hot water treatment, biological, host resistance and chemical methods. Generally knowing the biology of R. similis and its different management strategies contribute more to the reduction of the burrowing nematode and thus, sustainable banana production.
    [Show full text]