DOCSLIB.ORG

Phytoestrogens and Their's Health Effect

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phytoestrogens and Their's Health Effect ID Design Press, Skopje, Republic of Macedonia Open Access Macedonian Journal of Medical Sciences. 2019 Feb 15; 7(3):495-499. https://doi.org/10.3889/oamjms.2019.086 eISSN: 1857-9655 Review Article Phytoestrogens and Their Health Effect Desmawati Desmawati*, Delmi Sulastri Department of Nutrition, Medical Faculty, Andalas University, Padang 25163, West Sumatera, Indonesia Abstract Citation: Desmawati D, Sulastri D. Phytoestrogens and Phytoestrogens have structures that are very similar to endogen estradiol derived from plants. Phytoestrogens their Health Effect. Open Access Maced J Med Sci. 2019 sources are widespread in Asian regions including in Indonesia. Its have health benefits including reproductive Feb 15; 7(3):495-499. https://doi.org/10.3889/oamjms.2019.086 health, heart health, a role in weight loss, hormone-dependent tumours, bone and skin health, and the immune Keywords: Phytoestrogens; Phytochemicals; Health system. This review aimed to provide information on phytoestrogens’ effect on human health. *Correspondence: Desmawati Desmawati. Department of Nutrition, Medical Faculty, Andalas University, Padang, West Sumatera, Indonesia, 25163. E-mail: [email protected] Received: 09-Nov-2018; Revised: 31-Jan-2019; Accepted: 01-Feb-2019; Online first: 14-Feb-2019 Copyright: © 2019 Desmawati Desmawati, Delmi Sulastri. This is an open-access article distributed under the terms of the Creative Commons Attribution- NonCommercial 4.0 International License (CC BY-NC 4.0) Funding: This research did not receive any financial support Competing Interests: The authors have declared that no competing interests exist Introduction nuts, broccoli, cabbage and spinach. The main sources of lignans are flaxseed, and also in wheat flour, peanuts, fruits, berries, vegetables, tea and Phytoestrogens are estrogen-like compounds coffee. One example of lignans is matairesinol (non- derived from plants, which are structurally similar to estrogenic dimer) which can be converted by intestinal 17β-estradiol. Four phenolic compounds classified as microbes into enterolactone which is estrogenic and phytoestrogens are isoflavones, stilbene, coumestan, easily absorbed [1], [2], [3], [4]. and lignan [1], [2], [3], [4]. The source of phytoestrogens are nuts, Isoflavones are found in soybeans and other seeds, fruits and vegetables. Food sources include legumes, including in red clover. The main soybeans, garlic, celery, carrots, potatoes, rice, phytoestrogens in the form of isoflavones are wheat, red clover, sweet potatoes, fruits (apples, genistein, daidzein, glycitein, formononetin, and pomegranates and chaste berries) and coffee [3], [4]. biochanin A contained in soybeans. Phytoestrogens Isoflavones are found in legumes, especially that are classified as isoflavones are the most widely soybeans. Flaxseeds are the main source of lignans, studied. The amount of isoflavones needed to give and many contestants are found in clover, alfalfa and health effects is around 40-70 mg/day or an average soybean sprouts [1], [3]. Phytoestrogens in the diet of 50 mg/day. The average consumption of are digested, then metabolised by bacteria in isoflavones in Asian society is 15-50 mg per day, intestinal, absorbed in the intestinal and conjugated in while in Western countries only about 2 mg per day the liver. Furthermore, the phytoestrogens circulate in [5], [6]. the plasma until they are finally excreted in the urine [3]. The most common stilbene group is resveratrol, which is found in grapes and peanuts. The most important source of phytoestrogens Resveratrol consists of two isomers namely cis and is isoflavones found in soybeans and their processed trans. Trans has a higher estrogenic activity. Not all products. Phytoestrogen levels in pure soybeans are groups of comrades who have estrogenic activity. higher than those that have been processed because Contestants that have estrogenic activity come from of differences in bioavailability. Asian people consume _______________________________________________________________________________________________________________________________ Open Access Maced J Med Sci. 2019 Feb 15; 7(3):495-499. 495 Review Article _______________________________________________________________________________________________________________________________ more soy than Europeans and Americans [1], [7]. The estrogen. Elevated levels of the cytochrome P450 average daily intake of community phytoestrogens in enzyme are associated with breast, adrenal and East and Southeast Asia is estimated to be between prostate cancers [4]. 20-50 mg per day. While the average intake of Phytoestrogens also have biological effects phytoestrogens in adults in the United States is only without going through estrogen receptors. 0.15-3 mg per day, and in Europe, it is much lower at Phytoestrogens can activate serotoninergic receptors, around 0.49 to 0.66 mg per day [1]. insulin-like growth factor (IGF) receptors 1, free Bioavailability and pharmacokinetics of radical binding, induction of DNA methylation, affect isoflavones are influenced by the texture of food tyrosine kinases, cycle adenosine monophosphate ingredients the source or form of food consumed. (cAMP), phosphatidylinositol-3 kinase/Akt and Liquid food is absorbed faster and has a higher mitogen-activated protein (MAP) kinases, transcription concentration in plasma than solid food. Isoflavones in of nuclear factor-kappa β (NF-Kβ) factor, histone the form of aglycones are absorbed more quickly than modification and RNA expression and act as an in the form of glucoside conjugates [7]. intracellular regulator in the cell cycle and apoptosis [6]. This ability causes phytoestrogens to have an The isoflavones contained in soybeans are in antioxidant, antiproliferative, antimutagenic and the form of a complex mixture of glucoside antiangiogenic role and can improve health and conjugates. Then it is hydrolysed in the digestive tract longevity [3], [6], [11]. by the intestinal mucosa with the help of bacteria β- glucosidase to be aglycon, genistein and daidzein. Anglican can be absorbed directly or metabolised by Phytoestrogens and reproduction health microflora in the large intestine into active metabolites in the form of equol and inactive metabolites in the Phytoestrogens have different effects on the form of O-desmethylangolensin (ODMA) 3. Lignan is reproductive process. Genistein can stimulate converted to secoisolaricisinol-diglucoside (SDG), and progesterone stimulation in the ovaries, production of the constant is converted to coumestrol. The level of estradiol and cAMP production, oocyte maturation and absorption and metabolism in the body [5], [7], [8]. zygote development in the preimplantation stage. The ability to convert phytoestrogens to equol is Phytoestrogens derived from the green and Indian influenced by race. Japanese, Chinese and Korean turmeric can inhibit proliferation, increase apoptosis can convert equol higher than the Western population and affect steroid hormone release by animal ovarian which is estimated to produce only around 30-40%. cells. Isoflavones can also change animal sexual This is related to the role of genetics, the composition development, including changes in puberty, disruption of intestinal microbiota and diet [9]. of the oestrous cycle and ovarian function. Several studies suggest that there is an effect of isoflavones Phytoestrogens have structures that are very contained in infant formula milk on their reproductive similar to endogen estradiol and be able to bind with development, although phytoestrogen side effects on alpha and beta receptors of estrogen [6], [10]. Alpha reproductive health have not been widely reported and beta estrogen receptors have different functions. [11], [12]. Alpha estrogen receptors act in cell proliferation, whereas beta receptors are responsible for cell Phytoestrogens can also suppress the clinical apoptosis [6]. After the receptor binds to the ligand, symptoms of menopause caused by a decrease in the then moves from the cytoplasm to the cell nucleus, production of endogenous estrogen. Administration of binding and influencing the area that controls the DNA 100 mg of isoflavones per day in postmenopausal transcription process or small RNA, which in turn women can reduce vasomotor symptoms. The affects the expression of certain genes [3], [6]. advantage of this phytoestrogen is that it does not hurt Therefore, phytoestrogens have the potential effects the breast and endometrium [3], [11], [13]. Also, to regulated all process that influence by estrogen phytoestrogens also do not increase the risk of including the induction of sex hormones that bind to clotting in postmenopausal women [5]. This causes globulin and inhibit aromatase [3]. phytoestrogens to be a safe alternative to hormone replacement therapy [4]. Endogenous estrogen levels also affect the activity of phytoestrogens. In women of reproductive age, endogenous estrogen levels in high blood pressure. In this condition, lignans will compete with Phytoestrogens and Cardiovascular endogenous estrogen to bind to estrogen receptors so disease that they can inhibit estrogen activity. But at Several studies have proven the protective menopause, endogenous estrogen levels are low in effects of phytoestrogens on cardiovascular disease. estrogen production by the ovaries. When estrogen Phytoestrogens can reduce total cholesterol and levels are low, lignans are weak estrogen [4]. improve heart function. Genistein consumption of 200 Isoflavones, lignans and proteins also function
Load more

Recommended publications
  • Glossary of Terms
    Glossary of Terms Acceptable Daily Intake or Allowed Daily Intake (ADI) → Dose- Response Relationship/Curve Allergen The allergen is a material which triggers an allergic reaction. Allopathy The term allopathy was created by Christian Friedrich Samuel Hahnemann (1755– 1843) (from the Greek prefix άλλος, állos, “other”, “different” and the suffix πάϑος, páthos, “suffering”) in order to distinguish his technique (homeopathy) from the traditional medicine of his age. Today, allopathy means a medicine based on the principles of modern pharmacology. Anaphylactic shock Anaphylaxis (or an anaphylactic shock) is a whole-body, rapidly developing aller- gic reaction, which may lead to lethal respiratory and circulatory failure. Antibody Antibodies are proteins produced by the immune system to neutralize exogenous (external) substances. Chromatography, chromatogram Chromatography is the common name of different techniques used to separate mix- tures of compounds. HPLC stands for high-performance liquid chromatography. A chromatogram is the pattern of separated substances obtained by chromatography. Colloidal sol A colloidal sol is a suspension of very small solid particles in a continuous liquid medium. Colloidal sols are quite stable and show the Tyndall effect (light scatter- ing by particles in a colloid). They can be quite stable. Examples include blood, pigmented ink, and paint. Colloidal sols can change their viscosity quickly if they © Springer International Publishing Switzerland 2014 311 L. Kovács et al., 100 Chemical Myths, DOI 10.1007/978-3-319-08419-0 312 Glossary of Terms are thixotropic. Examples include quicksand and paint, both of which become more fluid under pressure. Concentrations: parts per notations In British/American practice, the parts-per notation is a set of pseudo-units to de- scribe concentrations smaller than thousandths: 1 ppm (parts per million, 10−6 parts) One out of 1 million, e.g.
    [Show full text]
  • A New Coumestan Glucoside from Eclipta Prostrata
    Natural Product Sciences 26(4) : 289-294 (2020) https://doi.org/10.20307/nps.2020.26.4.289 A New Coumestan Glucoside from Eclipta prostrata Young Ju Seo†, Hyun Woo Kil†, Taewoong Rho, and Kee Dong Yoon* College of Pharmacy and Integrated Research Institute of Pharmaceutical Sciences, The Catholic University of Korea, Bucheon-si, Gyeonggi-do 14662, Korea Abstract Eclipta prostrata is an annual herb, belonging to Asteraceae family, and has been traditionally used to improve immunity and treat hepatitis and bacterial disease in Korea. In this study, a new coumestan glucoside (1) along with ten known compounds (2 – 11) was isolated from E. prostrata. The chemical structures of isolates were elucidated to be wedelolactone-9-O--D-glucopyranoside (1), wedelolactone (2), demethylwedelolactone (3), apigenin (4), apigenin-7-sulfate (5), luteolin (6), luteolin-7-sulfate (7), luteolin-7-O--D-glucopyranoside (8), pratensein-7-O--D-glucopyranoside (9), 3,4-di-O-caffeoylquinic acid (10) and 3,5-di-O-caffeoylquinic acid (11) based on the spectroscopic evidence. Keywords Eclipta prostrata, Asteraceae, Phenolic compounds, Wedelolactone-9-O--D-glucopyranoside Introduction infrared spectroscopy (FT-IR). Eclipta prostrata is an annual herb, belonging to Experimental Asteracea family, and distributed in the tropical and subtropical areas, especially Asia and Africa.1 Eclipta General experimental procedures – The preparative prostrata has been traditionally used to improve immunity HPLC was performed using a Gilson HPLC system and treat hepatitis and bacterial diseases in Korea.2 In (Middleton, WI, USA) composed of a binary pump, a India, E. prostrata has been used to treat body pain, fever, liquid handler, and a UV/Vis detector with a Luna C18(2) hair loss, jaundice, liver enlargement and skin diseases.3 (21.2 × 250 mm I.D., 5 μm, Phenomenex, Torrance, CA, Recent biological evidence revealed that the E.
    [Show full text]
  • This Article Was Originally Published in Hormones, Brain and Behavior 2Nd
    This article was originally published in Hormones, Brain and Behavior 2nd edition, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non- commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who you know, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial Gore A C and Crews D Environmental Endocrine Disruption of Brain and Behavior. In: Donald W. Pfaff, Arthur P. Arnold, Anne M. Etgen, Susan E. Fahrbach and Robert T. Rubin, editors. Hormones, Brain and Behavior, 2nd edition, Vol 3. San Diego: Academic Press; 2009. pp. 1789-1816. Author's personal copy 56 Environmental Endocrine Disruption of Brain and Behavior A C Gore and D Crews, University of Texas at Austin, Austin, TX, USA ß 2009 Elsevier Inc. All rights reserved. Chapter Outline 56.1 Introduction to Endocrine Disruption 1790 56.1.1 Critical Issues about Endocrine Disruption 1791 56.1.1.1 Life stage and timing 1791 56.1.1.2 Latency of effects 1791 56.1.1.3 Sensitivity to EDCs 1792 56.1.1.4 Degradation and metabolism,
    [Show full text]
  • Supplementary Material Hydrogen-Rich Water-Alleviated
    10.1071/FP15204_AC © CSIRO 2015 Supplementary Material: Functional Plant Biology, 42(12), 1141–1157. Supplementary Material Hydrogen-rich water-alleviated ultraviolet-B-triggered oxidative damage is partially associated with the manipulation of the metabolism of (iso)flavonoids and antioxidant defence in Medicago sativa Yanjie XieA, Wei ZhangA, Xingliang DuanA, Chen DaiA, Yihua ZhangA, Weiti CuiA, Ren WangB and Wenbiao ShenA,C ACollege of Life Sciences, Laboratory Center of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. BInstitute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Nanjing 210014, China. CCorresponding author. Email: [email protected] 1 Table S1. The sequences of primers for real-time RT-PCR M. truncatula tentative consensus Primer name or accession number Sequences Forward: CTTGATGAGGTGAAGCGTAT PAL X58180 Reverse: ACCGTAACTGTCCGTGCC Forward: TGTTTGTGAATACATGGCACCTT CHS AW776018 Reverse: TGACTTTGGTTGACCCCATTCT Forward: TACTTGAGACCCTTGACTT CHI KF765782 Reverse: GGTGATTGCCTGTAGAAA Forward: CTTGATGAGGTGAAGCGTAT FLS XM_003601032 Reverse: ACCGTAACTGTCCGTGCC Forward: AATGGAGAAATCATAGAGGGCGAGCAG IFS AY167424 Reverse: GTTGATGAGCTCTGCCAAAGTCCATTC Forward: ACATGGAAAGCCTATGACTGTTC 6IOMT DQ419913 Reverse: ACACAACTCCAGTCCCACCTG Forward: TAATTGCTGATGCCAACG Cu/Zn-SOD AF056621 Reverse: ACCACAGGCTAATC TTCCAC Forward: TGTCATCAGCG GCGTA ATCAT Mn-SOD AY145894 Reverse: GGGCTTCCTTTGGTGGTTCA Forward: TCAATCGTACGTGGTGTGCT POD 1A X90692 Reverse: TGCACTTTGCTCGCTCACTA Forward: AGCTGCATTTGCTGCTCAAG POD 1B X90693
    [Show full text]
  • Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species
    Molecules 2014, 19, 3883-3897; doi:10.3390/molecules19043883 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species Eerdunbayaer 1, Mohamed A. A. Orabi 1,2, Hiroe Aoyama 1, Teruo Kuroda 3 and Tsutomu Hatano 1,* 1 Department of Natural Product Chemistry, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mails: [email protected] (E.); [email protected] (M.A.A.O.); [email protected] (H.A.) 2 Faculty of Pharmacy, Al-Azhar University, Assiut 71524, Egypt 3 Drug Discovery Technology Center, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-86-251-7936; Fax: +81-86-251-7926. Received: 28 February 2014; in revised form: 17 March 2014 / Accepted: 21 March 2014 / Published: 28 March 2014 Abstract: Since our previous study revealed that several licorice phenolics have antibacterial effects on methicillin-resistant Staphylococcus aureus (MRSA), and suppressive effects on the oxacillin resistance of MRSA, we further investigated effectiveness of licorice constituents on vancomycin-resistant Enterococcus (VRE) bacteria, and purified 32 phenolic compounds. Two flavonoids among them were characterized structurally, and identified their structures as demethylglycyrol (31) and 5,7-di-O-methylluteone (32), respectively. Examination of antibacterial effects of licorice phenolics showed that 3-arylcoumarins such as licoarylcoumarin (9) and glycycoumarin (26), and 2-arylcoumarones such as gancaonin I (17), have moderate to potent antibacterial effects on the VRE strains used in this study.
    [Show full text]
  • Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza Glabra L., Paeonia Lactiflora Pall., and Eriobotrya Japonica (Thunb.) Lindl
    Medicines 2019, 6, 43; doi:10.3390/medicines6020043 S1 of S35 Supplementary Materials: Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza glabra L., Paeonia lactiflora Pall., and Eriobotrya japonica (Thunb.) Lindl. Extracts Jun-Xian Zhou, Markus Santhosh Braun, Pille Wetterauer, Bernhard Wetterauer and Michael Wink T r o lo x G a llic a c id F e S O 0 .6 4 1 .5 2 .0 e e c c 0 .4 1 .5 1 .0 e n n c a a n b b a r r b o o r 1 .0 s s o b b 0 .2 s 0 .5 b A A A 0 .5 0 .0 0 .0 0 .0 0 5 1 0 1 5 2 0 2 5 0 5 0 1 0 0 1 5 0 2 0 0 0 1 0 2 0 3 0 4 0 5 0 C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( g /m l) Figure S1. The standard curves in the TEAC, FRAP and Folin-Ciocateu assays shown as absorption vs. concentration. Results are expressed as the mean ± SD from at least three independent experiments. Table S1. Secondary metabolites in Glycyrrhiza glabra. Part Class Plant Secondary Metabolites References Root Glycyrrhizic acid 1-6 Glabric acid 7 Liquoric acid 8 Betulinic acid 9 18α-Glycyrrhetinic acid 2,3,5,10-12 Triterpenes 18β-Glycyrrhetinic acid Ammonium glycyrrhinate 10 Isoglabrolide 13 21α-Hydroxyisoglabrolide 13 Glabrolide 13 11-Deoxyglabrolide 13 Deoxyglabrolide 13 Glycyrrhetol 13 24-Hydroxyliquiritic acid 13 Liquiridiolic acid 13 28-Hydroxygiycyrrhetinic acid 13 18α-Hydroxyglycyrrhetinic acid 13 Olean-11,13(18)-dien-3β-ol-30-oic acid and 3β-acetoxy-30-methyl ester 13 Liquiritic acid 13 Olean-12-en-3β-ol-30-oic acid 13 24-Hydroxyglycyrrhetinic acid 13 11-Deoxyglycyrrhetinic acid 5,13 24-Hydroxy-11-deoxyglycyirhetinic
    [Show full text]
  • Phytoestrogens in Foods in the Nordic Market
    TemaNord 2017:541 Phytoestrogens in foods on the Nordic market the Nordic on foods in 2017:541 Phytoestrogens TemaNord Nordic Council of Ministers Nordens Hus Ved Stranden 18 DK-1061 Copenhagen K www.norden.org Phytoestrogens in foods on the Nordic market Phytoestrogens are plant-derived compounds that may bind to estrogen receptors, but with less affinity than the natural ligand estradiol. They may be biologically active as such or after metabolization in our body. To investigate the occurrence and level of phytoestrogens, scientific literature was screened for data on isoflavones, lignans, stilbenes and coumestans in raw and processed foods of plant origin. The review presents data based both on analytical methods hydrolysing glucosides and non-destructive methods. Many phytoestrogens are phytoalexins. Their production is induced when plants are exposed to abiotic and/or biotic stress. This could explain the rather different levels reported in plants by various investigators, and indicates that many samples are required to describe the levels generally occurring in foodstuffs. The influence of food processing was also considered. Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson TemaNord 2017:541 Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson ISBN 978-92-893-5046-4 (PRINT) ISBN 978-92-893-5047-1 (PDF) ISBN 978-92-893-5048-8 (EPUB) http://dx.doi.org/10.6027/TN2017-541 TemaNord 2017:541 ISSN 0908-6692 Standard: PDF/UA-1 ISO 14289-1 © Nordic Council of Ministers 2017 Cover photo: Unsplash.com Print: Rosendahls Printed in Denmark Although the Nordic Council of Ministers funded this publication, the contents do not necessarily reflect its views, policies or recommendations.
    [Show full text]
  • Supporting Document 1
    Supporting document 1 Safety assessment – Application A1085 Food derived from Reduced Lignin Lucerne Line KK179 Summary and conclusions Background A genetically modified (GM) lucerne line, KK179, has been developed that has reduced biosynthesis of guaiacyl lignin (G lignin), a major subunit of lignin. Lignin is a non- carbohydrate phenolic polymer deposited in plant cell walls, particularly in the vascular tissue, and is a contributor to the quality of forage eaten by grazing animals. The Applicants claim that growers will have the option of being able to harvest KK179 several days later than conventional lucerne without appreciable loss of forage quality typical in conventional lucerne at the same growth stage. The reduced level of lignin in lucerne KK179 has been achieved through the introduction of a partial caffeoyl CoA 3-O-methyltransferase (CCOMT) gene sequence derived from lucerne (Medicago sativa). The gene transcript acts, via suppression of the endogenous CCOMT gene, to reduce the lignin level. It is not intended that KK179 enter the food supply. However, a food approval is sought in case this inadvertently occurs. In conducting a safety assessment of food derived from lucerne line KK179, a number of criteria have been addressed including: a characterisation of the transferred genetic material and its origin, function and stability in the lucerne genome; compositional analyses; and evaluation of intended and unintended changes. This safety assessment report addresses only food safety and nutritional issues associated with the GM line. It therefore does not address: environmental risks related to the environmental release of GM plants used in food production the safety of animal feed or animals fed with feed derived from GM plants the safety per se of food derived from the non-GM (conventional) plant.
    [Show full text]
  • Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy
    Send Orders for Reprints to [email protected] Anti-Cancer Agents in Medicinal Chemistry, 2014, 14, 000-000 1 Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy Tereza Nehybová1, Jan Šmarda1 and Petr Beneš1,2,* 1Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic and Masaryk Memorial Cancer Institute, RECAMO, Žlutý kopec 7, 656 53 Brno, Czech Republic; 2International Clinical Research Center, Center for Biological and Cellular Engineering, St. Anne's University Hospital, Brno, Czech Republic Abstract: Natural products are often used in drug development due to their ability to form unique and diverse chemical structures. Coumestans are polycyclic aromatic plant secondary metabolites containing a coumestan moiety, which consists of a benzoxole fused to a chromen-2-one to form 1-Benzoxolo[3,2-c]chromen-6-one. These natural compounds are known for large number of biological activities. Many of their biological effects can be attributed to their action as phytoestrogens and polyphenols. In the last decade, anticancer effects of these compounds have been described in vitro but there is only limited number of studies based on models in vivo. More information concerning their in vivo bioavailability, stability, metabolism, toxicity, estrogenicity, cellular targets and drug interactions is therefore needed to proceed further to clinical studies. This review focuses on coumestans exhibiting anticancer properties and summarizes mechanisms of their toxicity to cancer cells. Moreover, the possible role of coumestans in cancer prevention is discussed. Keywords: Cancer, cellular target, coumestrol, coumestan, glycyrol, psoralidin, therapy, wedelolactone. INTRODUCTION also acts as antioxidant [18, 36] and prevents bone resorption by Natural products are often used in drug development due to inhibiting differentiation and function of osteoclasts and by their ability to form unique and diverse chemical structures.
    [Show full text]
  • Food Toxicology Food Toxicology Edited by William Helferich and Carl K
    Food Toxicology Food Toxicology Edited by William Helferich and Carl K. Winter CRC Press Boca Raton London New York Washington, D.C. 2760/frame/FM Page 4 Monday, July 3, 2000 4:23 PM Library of Congress Cataloging-in-Publication Data Food toxicology / edited by William Helferich and Carl K. Winter. p. cm. Includes bibliographical references and index. ISBN 0-8493-2760-1 (alk. paper) 1. Food—Toxicology. I. Helferich, William. II. Winter, Carl K. RA1258 .F665 2000 615.9′54—dc21 00-037851 CIP This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage or retrieval system, without prior permission in writing from the publisher. All rights reserved. Authorization to photocopy items for internal or personal use, or the personal or internal use of specific clients, may be granted by CRC Press LLC, provided that $.50 per page photocopied is paid directly to Copyright Clearance Center, 222 Rosewood Drive, Danvers, MA 01923 USA. The fee code for users of the Transactional Reporting Service is ISBN 0-8492-2760-1/00/$0.00+$.50. The fee is subject to change without notice.
    [Show full text]
  • Estrogen Receptor Beta in Colorectal Cancer
    ndrom Sy es tic & e G n e e n G e f T o Journal of Genetic Syndromes Barone and Leo, J Genet Syndr Gene Ther 2013, 4:11 h l e a r n a r p u DOI: 10.4172/2157-7412.1000201 y o J & Gene Therapy ISSN: 2157-7412 Review Article Open Access Estrogen Receptor beta in Colorectal Cancer Prevention: Do we have Conclusive Proof? Michele Barone1* and Alfredo Di Leo2 1Gastroenterology Unit, Department of Medical and Surgical Science, University of Foggia, Foggia, Italy 2Gastroenterology Unit, Department of Emergency and Organ Transplantation, University of Bari, Bari, Italy Abstract Familial Adenomatous Polyposis (FAP) and Lynch syndrome are hereditary conditions that lead to Colorectal Cancer (CRC). FAP represents the ideal model for studying colorectal carcinogenesis since, in the same subject; “normal” mucosa coexists with low and high-grade dysplastic lesions as well as adenocarcinoma, offering the opportunity to compare different parameters in the various stages of the carcinogenetic process, free from individual variations. Epidemiological studies on women in pre-or postmenopausal age assuming oral contraceptive or hormone replacement therapy, respectively, strongly suggest a protective role of estrogens on CRC and colonic adenomatous polyps. Such findings have been confirmed by studying the behavior of the two high affinity Estrogen Receptors (ERs), estrogen receptors alpha (ER-α) and estrogen receptors beta (ER-β), both in humans with sporadic CRC, FAP and sporadic polyps. ERs reduction has also been associated to microsatellite instability, a DNA mutation encountered in Lynch syndrome and in 15-25% of sporadic CRC. ER-β, abundantly expressed in the normal colon, progressively decreases in adenomas and CRC in relation to the disease aggressiveness.
    [Show full text]
  • Nutritional Flavonoids Impact on Nuclear and Extranuclear Estrogen Receptor Activities
    Genes & Nutrition Vol. 1, No. 3/4, pp. 161-176, 2006 ISSN 1555-8932 print, Copyright © 2006 by New Century Health Publishers, LLC www.newcenturyhealthpublishers.com All rights of reproduction in any form reserved NUTRITIONAL FLAVONOIDS IMPACT ON NUCLEAR AND EXTRANUCLEAR ESTROGEN RECEPTOR ACTIVITIES Paola Galluzzo and Maria Marino Department of Biology, University “Roma Tre”, Viale G. Marconi 446, I-00146 Roma, Italy [Received March 14, 2006; Accepted April 30, 2006] ABSTRAABSTRAABSTRACTCTCT: Flavonoids are a large group of non-nutrient important are the plant secondary metabolites flavonoids. They compounds naturally produced from plants as part of their are present in all terrestrial vascular plants whereas, in mammals, defence mechanisms against stresses of different origins. They they occur only through dietary intake (Birt et al., 2001; Dixon, emerged from being considered an agricultural oddity only after 2004). More than 4,000 different flavonoids have been it was observed that these compounds possess a potential protective described and categorized into 6 subclasses as a function of function against several human degenerative diseases. This has the type of heterocycle involved: flavonols, flavones, flavanols, led to recommending the consumption of food containing high flavanonols, flavanones, and isoflavones (Table 1) (Birt et al., concentrations of flavonoids, which at present, especially as soy 2001; Manach et al., 2004). isoflavones, are even available as over-the-counter nutraceuticals. The increased use of flavonoids has occurred even though their mechanisms are not completely understood, in particular those TABLE 11:1TABLE Chemical structures of certain commonly occurring plant involving the flavonoid impact on estrogen signals. In fact, most flavonoid aglycones of the human health protective effects of flavonoids are described either as estrogen-mimetic, or as anti-estrogenic, while others do not involve estrogen signaling at all.
    [Show full text]