Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-Targeted T Cells Joseph A

Letter https://doi.org/10.1038/s41586-018-0178-z

Disruption of TET2 promotes the therapeutic efficacy of CD19-targeted T cells Joseph A. Fraietta1,2,3,4, Christopher L. Nobles5, Morgan A. Sammons6,10, Stefan Lundh1,2, Shannon A. Carty2,11, Tyler J. Reich1,2, Alexandria P. Cogdill1,2, Jennifer J. D. Morrissette3, Jamie E. DeNizio7,8, Shantan Reddy5, Young Hwang5, Mercy Gohil1,2, Irina Kulikovskaya1,2, Farzana Nazimuddin1,2, Minnal Gupta1,2, Fang Chen1,2, John K. Everett5, Katherine A. Alexander6, Enrique Lin-Shiao6, Marvin H. Gee9, Xiaojun Liu1,2, Regina M. Young1,2, David Ambrose1,2, Yan Wang1,2, Jun Xu1,2, Martha S. Jordan2,3, Katherine T. Marcucci1,2, Bruce L. Levine1,2,3, K. Christopher Garcia9, Yangbing Zhao1,2, Michael Kalos1,2,3, David L. Porter1,2,7, Rahul M. Kohli5,7,8, Simon F. Lacey1,2,3, Shelley L. Berger6, Frederic D. Bushman5, Carl H. June1,2,3,4* & J. Joseph Melenhorst1,2,3,4*

Cancer immunotherapy based on genetically redirecting T cells intervention. Evaluation of the patient’s bone marrow one month has been used successfully to treat B cell malignancies1–3. In this later revealed extensive infiltration of CLL (Extended Data Fig. 1), strategy, the T cell genome is modified by integration of viral vectors and computed tomography (CT) scans showed minimal improve- or transposons encoding chimaeric antigen receptors (CARs) that ment in extensive adenopathy. Unexpectedly, two months after the direct tumour cell killing. However, this approach is often limited second infusion, the expansion of CAR T cells peaked in the periph- by the extent of expansion and persistence of CAR T cells4,5. Here we eral blood, followed by contraction (Fig. 1a). CTL019 cell outgrowth report mechanistic insights from studies of a patient with chronic occurred mostly in the CD8+ T cell compartment, which is typical in lymphocytic leukaemia treated with CAR T cells targeting the CD19 patients with CLL who respond to CAR T cell treatment (Extended protein. Following infusion of CAR T cells, anti-tumour activity was Data Fig. 2a). Delayed CAR T cell expansion was accompanied by evident in the peripheral blood, lymph nodes and bone marrow; this high-grade CRS and elevated circulating levels of interferon (IFN)-γ, activity was accompanied by complete remission. Unexpectedly, at granulocyte-colony stimulating factor (G-CSF), IL-6, IL-8 and IL-10 the peak of the response, 94% of CAR T cells originated from a single (Fig. 1b). Coincident with the onset of high fever, rapid clearance of clone in which lentiviral vector-mediated insertion of the CAR CLL was observed (Fig. 1c, d). Next-generation sequencing of rear- transgene disrupted the methylcytosine dioxygenase TET2 gene. rangement products at the immunoglobulin heavy chain (IGH) locus Further analysis revealed a hypomorphic mutation in this patient’s showed a 1-log reduction in tumour burden 51 days after the second second TET2 allele. TET2-disrupted CAR T cells exhibited an infusion, with complete eradication of this tumour clone from the epigenetic profile consistent with altered T cell differentiation and, blood one month later (Supplementary Table 2). CT scans showed a at the peak of expansion, displayed a central memory phenotype. marked improvement in mediastinal and axillary adenopathy (69% Experimental knockdown of TET2 recapitulated the potency- change; Fig. 1d). Patient-10 achieved a complete response with no evi- enhancing effect of TET2 dysfunction in this patient’s CAR T cells. dence of CLL in his marrow (Extended Data Fig. 1, Supplementary These findings suggest that the progeny of a single CAR T cell Table 2) and resolution of all abnormal adenopathy six months later induced leukaemia remission and that TET2 modification may be (Fig. 1d and data not shown). His most recent long-term follow-up useful for improving immunotherapies. evaluation (after more than 4.2 years) revealed the presence of CAR Here we describe an unusual case in which CAR T cell therapy was T cells in the peripheral blood, ongoing B cell aplasia (Extended Data used to treat chronic lymphocytic leukaemia (CLL) that sheds light on Fig. 2b–e) and no evidence of circulating disease or marrow infiltration the determinants of CAR-T cell efficacy and persistence. A seventy- (Extended Data Fig. 1). Immune cell populations in the blood were eight-year-old man with advanced relapsed/refractory CLL (Patient-10, normal in frequency, with no observed signs of lymphoproliferative Supplementary Table 1) enrolled in a clinical trial for CD19 CAR abnormalities (Extended Data Fig. 2f and data not shown). The patient T cell (CTL019) therapy (trial no. NCT01029366). He underwent two remains well in complete remission that has been sustained for more adoptive transfers of autologous CTL019 cells, approximately two than five years at the time of this report. months apart. Following the first infusion, he became persistently Deep sequencing of the T cell receptor beta repertoire indicated that febrile and was diagnosed with cytokine release syndrome (CRS). pre-infusion CD8+ CTL019 cells and the peripheral blood CD8 T cell Signs of CRS rapidly resolved following administration of interleukin compartment one month after the second infusion were polyclonal, (IL)-6 receptor-blocking therapy. Patient-10 continued to show pro- with multiple distinct TCRVβ clonotypes that were similar between the gressive leukaemia six weeks after receiving his first dose of CAR samples (Fig. 2a, Extended Data Fig. 3a). Approximately two months T cells (Fig. 1a–c). after the second infusion, TCRVβ5.1 family usage exhibited a skew- Because there was a concern that early blockade of IL-6-mediated ing of greater than 50%, with clonal dominance occurring in CD8+ signalling may have diminished the response to CAR T cell therapy, CTL019 cells (Fig. 2a, b). Subsequent analysis revealed that 94% of the this patient was retreated with the remainder of his CAR T cells 70 days CD8+ CAR T cell repertoire consisted of a single clone that was not after the first dose (Supplementary Table 1). Infusions were again com- detected at the time of transfer or one month after the second infusion plicated by CRS, but this resolved without anti-IL-6 receptor-blocking (Fig. 2c). The expansion of this clonal population of cells declined in

1Center for Cellular Immunotherapies, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 2Abramson Cancer Center, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 3Pathology and Laboratory Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 4Parker Institute for Cancer Immunotherapy, University of Pennsylvania, Philadelphia, PA, USA. 5Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 6Department of Cell and Developmental Biology, Epigenetics Program, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 7Department of Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 8Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 9Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA, USA. 10Present address: Department of Biology, University at Albany, State University of New York, Albany, 11 NY, USA. Present address: Department of Internal Medicine and Rogel Cancer Center, University of Michigan, Ann Arbor, MI, USA. *e-mail: [email protected]; [email protected]

abInfusion 1 (day 0) Infusion 1 (day 0) c Infusion 1 (day 0) Infusion 2 (day 70) Infusion 2 (day 70) Infusion 2 (day 70) 105 3,000 IFN-γ 105

) G-CSF –1 4 4 10 IL-6 10 2,000 IL-8 103 103 IL-10 1,000 2 2

10 CLL (cells per 10 microlitre blood) CAR (copies per microgram gDNA) Cytokines (pg ml 101 0 101 0200 400600 800 0200 400600 800 0200 400600 800 Time (days) Time (days) Time (days)

d BaselineDay 133 Day 256

Fig. 1 | Evaluation of clinical responses following adoptive transfer of cells before and after CTL019 therapy. d, Sequential CT imaging of CAR T cells in a patient with CLL. a, In vivo expansion and persistence chemotherapy-refractory lymphadenopathy. Red arrows indicate masses of CAR T cells. b, Longitudinal measurements of serum cytokines before that were progressively reduced following the second CAR T cell infusion. and after CAR T cell infusions. c, Total number of circulating B-CLL line with CAR T cell decay kinetics (Fig. 2d). Thus, leukaemia was results from the expansion of a diverse polyclonal or pauciclonal reper- eliminated in this patient primarily by the progeny of a single CAR toire within the transduced T cell population6. In Patient-10, cells bear- T cell that demonstrated massive in vivo expansion (approximately ing the TET2 integration event were present in the blood at a relative 29 population doublings in the peripheral blood). abundance of 14% at 4.2 years after the infusion (Fig. 3a). The clonal Longitudinal analysis of blood samples from Patient-10 revealed population thus contracted, with no signs of insertional oncogenesis. a highly abundant cell clone with an integration site in intron 9 of Because TET2 is a tumour suppressor gene, we are continuing to TET2, which was expanded in CAR T cells at the peak of clinical monitor this patient carefully. activity and not at earlier time points (Fig. 3a). This large degree of TET2 is a master regulator of blood cell formation. Haploinsuffciency T cell clonal dominance has not been observed in more than forty or deletion of TET2 is found in normal clonal haematopoiesis7 as well as leukaemia patients treated with CD19-directed T cells at the University the initiation of lymphoma and leukaemia, including naturally arising of Pennsylvania, as determined by lentiviral integration site analysis and human T-lymphotropic virus type 1 (HTLV-1)-associated (Extended Data Fig. 3b–d and data not shown). In CLL and acute malignancies8–11. Although TET2 inactivation may contribute to lymphblastic leukaemia (ALL), accumulation of CAR T cells in vivo increased self-renewal of haematopoietic stem and progenitor cells, its a b Whole blood Whole blood CD8+ CAR+ cells PBMC 1 month post-infusion 2 2 months post-infusion 2 2 months post-infusion 2 2 months post-infusion 2

5 10 1% 84%

104

103

102

101 TCRVβ5.1 TCRVβ5.1 TCRVβ5.1 CAR 102 103 104 105 TCRVβ13.1 TCRVβ5.1

c d Infusion 1 (day 0) CASSLDGSGQGSDYGYTF Infusion 2 (day 70)

102 102 102 40 6

g lo CAR

101 101 101 D 5 microgram 100 100 100 30

–1 –1 –1 cells cells cells 10 10 10 4 10

+ + + (copies per (copies –2 –2 –2 dominant 20 10 10 10 + 3 CAR –3 CAR –3 CAR –3

+ 10 + 10 + 10

) NA –4 –4 –4 10 10 10 10 2 CD8 CD8 CD8 10–5 10–5 10–5 TCRV β 5.1 clone (% positive cells)

2 months post-infusion 10–6 2 months post-infusion 10–6 2 months post-infusion 10–6 0 1 10–6 10–5 10–4 10–3 10–2 10–1 100 101 102 10–6 10–5 10–4 10–3 10–2 10–1 100 101 102 10–6 10–5 10–4 10–3 10–2 10–1 100 101 102 0 200 400 600 800 + + CD8 CAR cells Whole blood Whole blood Time (days) infusion product 1 month post-infusion 2 2 months post-infusion 2 Frequency in TCRVβ5.1 (%) Fig. 2 | Analysis of CAR T cell clonal expansion in a patient with different TCRVβ5.1 clones in CAR+ T cells at the peak of activity relative CLL who had a delayed therapeutic response. a, Frequency of TCRVβ to other time points. Red dots indicate the dominant TCRVβ5.1 clone gene segment usage in the blood of Patient-10 one month (left) and (representative of two independent experiments). d, Expansion kinetics two months (middle) after the second CAR T cell infusion. TCRVβ of the TCRVβ5.1+ dominant clone following a second infusion of CAR clonotype frequencies in sorted CAR T cells at the peak of expansion are T cells plotted in parallel with CTL019 levels. Percentages of positive cells also shown (right). b, Flow cytometric proportions of TCRVβ5.1- versus were calculated from the results of a quantitative PCR assay designed to TCRVβ13.1-positive (negative control) CAR T cells. c, Abundance of amplify clonotype-specific sequences.

a c Infusion CD8 CAR Sample Blood Undisrupted TET2 allele type: product T cells Cys-rich domain DSBH Unique sites: 1,04552233 387 88 14 21 442277 14 64 69 29 107 100 345 6 78 91011

Catalytic core domain

75 1129 1322 1481 1843 1936 Cys-rich DSBH Low complexity DSBH 1104 1478 1845 2002 50 Conserved Conserved domain 1 domain 2

25 Missense Relative abundance (%) C C mutation (c.5635G>C) C 53% VAF 0 C 001100 28 63 92 120 121 147 204 442 801 1,584 121 C G T G A G C R E Pre- Post- infusion infusion TET2 E1879Q Time (day) d 5-mC 5-hmC 5-fC 5-caC Low abundance DDI2 HNRNPUL2 MIR4494 POLR3K RTKN2 TET2 OH O O NH NH NH NH ADCY7 DUSP6 LOC102724357 NOVA1 PPP6C S100A4 ZNF34 2 2 2 2 CH3 CH2 CH C OH EEF1G ZNF443 HN HN HN HN Genes: ATF7IP LPIN2 OR2AG1 PRDM2 SIRT3 BRF1 EMB LYPLAL1 PDE6D RASGEF1B SPN ZNF799 O N TET2 O N TET2 O N TET2 O N CD2BP2 ERC1 MAP4K1 PITPNA RNF151 STK38 ZNF823

CSMD1 GAS2 MAP4K3 POLA2 RPS6KA1 TBL1Y DNA DNA DNA DNA 100 100 70 84 100 5-mC 80 5-hmC Wild-type TET2 (30%)

5-fC P = 0.0086 b TET2 allele disrupted by lentiviral integration 30 5 5-caC E1879Q TET2 (16%) Chimaera 1 Chimaera 2Chimaera 3 20 14 5 ***** ** 10 Modi ed cytosines (%) 7 11 5′ LTR EF1α 3′ LTR 4 TET2 0 910 (4q24) cPPT Exon Anti-CD19 CAR Exon ctor

HxD TET2 mpty ve 1879Q TET2 E E Wild-type TET2 Fig. 3 | Investigation of CAR lentiviral integration sites and TET2 (DSBH) domains are also shown (red arrow denotes an amino acid dysfunction in Patient-10. a, Longitudinal CAR T cell clonal abundance change resulting from a missense mutation). Representative results of next as marked by integration sites. Different colours (horizontal bars) indicate generation sequencing appear beneath the structural diagrams. Each grey major cell clones. A key to the sites, named for the nearest gene, is shown bar denotes a DNA fragment. A single-base G/C nucleotide substitution below the graph (abundances below 3% binned as ‘Low abundance’). is highlighted by dashed lines above the consensus sequence. d, Diagram b, Diagram of the vector at the TET2 integration site locus illustrating of the TET2-catalysed sequential oxidations of 5-mC to 5-hmC and to splicing into the vector provirus to yield truncated transcripts. Asterisks 5-fC and 5-caC (top). Genomic levels of 5-mC, 5-hmC, 5-fC, and 5-caC denote ectopic stop codons. LTR, long terminal repeat; cPPT, polypurine modifications produced by the E1879Q TET2 mutant shown as per cent of tract; EF1α, elongation factor 1-α promoter. c, Domain organization of total cytosine modifications. Percentages derived from the mean of three TET2 and location of a residue mutated in CAR+ and CAR− T cells from independent experiments are shown. P values were determined using a Patient-10. Cysteine (Cys)-rich and catalytic double-stranded β-helix two-tailed, paired Student’s t-test. disruption alone infrequently leads to overt oncogenesis10,12. Analysis No other mutations were found in the panel of 67 additional genes of polyadenylated TET2 RNA populations in clonal CAR T cells at the analysed. peak of expansion in Patient-10 showed the appearance of new chimae- TET2 encodes methylcytosine dioxygenase, an enzyme that ric RNAs that spliced from TET2 exon 9 into the vector and terminated, catalyses the conversion of 5-methylcytosine (5-mC) into truncating the encoded protein with premature stop codons (Fig. 3b, 5-hydroxymethylcytosine (5-hmC) and the rarer bases 5-formylcytosine Extended Data Fig. 4a, b). Although it is possible that expression of the (5-fC) and 5-carboxylcytosine (5-caC), thereby mediating DNA truncated fusion TET2 protein may have a dominant-negative effect, it demethylation14–19 (Fig. 3d, top panel). Methylation at the C5 position has been demonstrated that other TET2 mutant proteins do not exhibit of cytosine normally represses transcription, and therefore, demeth- such characteristics13. ylation is expected to activate gene expression. We interrogated the We next sequenced CAR+ and CAR− T cells from this subject and functional significance of the E1879Q mutation using plasmids encod- examined genes involved in haematologic malignancies (Extended ing wild-type TET2 or this TET2 variant that were transfected into Data Fig. 4c). In both samples, a missense variant in TET2 encoding HEK293T cells (Extended Data Fig. 5a–c). Overexpression of wild-type amino acid 1879 was found in the catalytic domain, converting the or mutant TET2 proteins was verified by western blotting (Extended wild-type residue, glutamic acid, to glutamine (Fig. 3c and data not Data Fig. 5b, c). Analysis of genomic DNA isolated from these shown). The c.5635C mutation was present in the allele of TET2 cells using both dot blotting (Extended Data Fig. 5a, b) and liquid without the integrated CAR transgene, as that allele contained the chromatography–tandem mass spectrometry (LC–MS/MS) (Extended wild-type reference sequence (c.5635G; Extended Data Fig. 4d). Data Fig. 5d, e) revealed that E1879Q compromises the step-wise

100 CAR+ CAR– CAR– 80 60

5 CD3/CD28 40 CAR+ 10 17% 3% 40% 25% 104 20 103 Per cent 0 102 2 3 4 5 0

of maximum 010 10 10 10 IFN γ CD107a 0102 103 104 105 5-hmC IFNG CD8 CD8+CAR– CD8+ CAR+ d Patient 1 Patient 2 Patient 10 Day 73 + – Naive-like (CCR7 CD45RO ) 5 Naive-like 100 Central memory (CCR7+CD45RO+) Day 147 10 – + microgram DNA) Effector memory (CCR7 CD45RO ) CAR (copies per Central memory 80 Effector (CCR7–CD45RO–) 104 CAR (copies per microgram DNA) Effector memory 60 103 Effector

40 Day 121 102 173,26014,376 43,321 CAR T cell level 20 101 (copies per microgram DNA) + + + Subset frequency (%) CD8 CAR HLA-DR 0 100 89 92 91 (%) 0 100 300 400 500 600 0 100 300 400 500 600 Time (days) e P < 0.0001 f P = 0.0003 P = 0.0005 g 1.00 100 100 100 30 Control (CD19-stimulated) TET2 (CD19-stimulated) 25 0.75 75 75 75 Control (mesothelin-stimulated) P = 0.0256 20 TET2 (mesothelin-stimulated) 0.50 50 50 50 15 T cells (% ) T cells (% ) T cells (% ) + + + Effector 10

0.25 25 25 25 (fold increase) TET2 expressio n Central memory CD 8 Effector memory CD 8 CD 8 5 Absolute cell number 0 0 0 0 0 Control TET2 Control TET2 Control TET2 Control TET2 0 7 12 17 shRNA shRNA shRNA shRNA Day Fig. 4 | Effect of TET2 alteration on the epigenetic landscape of CAR and frequencies of activated CAR T cells expressing HLA-DR (surface T cells. a, Total 5-hmC levels in CAR+ and CAR− T cells cultured from molecule indicative of T cell activation) at the peak of each patient’s Patient-10. Histograms depict the intensity of intracellular 5-hmC response are listed below the pie charts. e, TET2 expression in healthy staining. b, Genome browser views of ATAC enrichment at the IFNG donor CD8+ T cells transduced with a scrambled shRNA (control) or locus of T cells from Patient-10. c, Frequencies of IFNγ- and CD107a- TET2 shRNA. Error bars depict s.e.m. f, Frequencies of central memory expressing T cells expanded from Patient-10, unstimulated or stimulated (left), effector memory (middle) and effector (right) CD8+ T cells with anti-CD3/CD28 antibodies. Insets indicate frequencies of gated cell following shRNA-mediated knockdown of TET2 (n = 12; pooled results populations. d, Longitudinal differentiation phenotypes of CAR− (left) from 4 independent experiments). g, Proliferation of healthy donor and CAR+ (middle) CD8+ T cells from Patient-10. Black arrows denote CTL019 cells (n = 8; 3 independent experiments) in response to repetitive pre-infusion CAR T cells. Differentiation phenotype at the peak of in stimulation (denoted by black arrows) with K562 cells expressing CD19 or vivo activity is shown in two patients with CLL who showed long-term mesothelin (negative control). CAR T cells were transduced to express either complete responses (Patient-1 and Patient-2) compared to Patient-10 a scrambled control or TET2-specific shRNA. P values were determined (right). Pie slices represent T cell subset frequencies. The CTL019 cell level using a two-tailed, paired Student’s t-test. All error bars depict s.e.m. oxidation of 5-mC relative to wild-type TET2, with reductions in 5-fC in the setting of TET2 biallelic dysfunction included those correspond- and 5-caC occurring (Fig. 3d). Therefore, the clonal expansion of CAR ing to several regulators of T cell effector differentiation or exhaustion T cells in Patient-10 was comprised of a compound heterozygous such as IFNG, NOTCH2, CD28, ICOS and PRDM1 (Fig. 4b, Extended loss-of-function in TET2 on one allele and a hypomorphic E1879Q Data Fig. 6c, Supplementary Tables 4, 5b). Furthermore, transcription variant on the other allele. factor motifs within sites that changed accessibility could have affected CAR+Vβ5.1+ T cells from Patient-10 exhibited lower total levels of specific transcriptional circuits controlling CAR T cell fate and anti- 5-hmC compared to their CAR−Vβ5.1− T cell counterparts (Fig. 4a). tumour activity in this patient (Extended Data Fig. 6d, Supplementary This was presumably the result of disruption of the wild-type TET2 Table 6a, b). Functional analysis of CAR+ T cells with biallelically allele following lentiviral integration, as the TET2 E1879Q variant can altered TET2 cultured from this patient showed a diminished capacity form 5-hmC (Fig. 3d, Extended Data Fig. 5a, b). To investigate the to express IFNγ and CD107a (a degranulation marker) when activated effects of TET2 alteration on CAR T cell fate and function, we per- (Fig. 4c), consistent with a less differentiated state. Thus, lentiviral inte- formed assay for transposase-accessible chromatin using sequencing gration into TET2 together with a hypomorphic mutation on the sec- (ATAC–seq), which monitors DNA accessibility (Supplementary ond allele reprogrammed the epigenetic landscape of CAR T cells in a Table 3). The global epigenetic changes between CAR+ and CAR− manner that was consistent with altered T lymphocyte differentiation. T cells from Patient-10 were modest (Extended Data Fig. 6a). However, We next analysed the differentiation state of ex vivo CTL019 cells we found that genes with more accessible chromatin in CAR+ com- from Patient-10 and compared it to those of CAR T cells from six pared to CAR− T cells were enriched in pathways that regulate the other patients who responded to this therapy (Extended Data Fig. 7), cell cycle and T cell receptor signalling (Extended Data Fig. 6b, including two subjects with CLL (Patient-1 and Patient-2) who had Supplementary Tables 4, 5a). ATAC–seq peaks that were reduced or lost long-term durable remissions (of more than 6 years) and did not have

TET2 integrations (data not shown). At the peak of in vivo expan- on CAR+ T cells from Patient-10 than on cells from other patients sion and activation marker expression, 65% of the CAR T cells in (Extended Data Fig. 11b). A high frequency of Ki-67-positive CAR+ Patient-10 had a central memory phenotype (Fig. 4d, Extended Data T cells was observed at the peak of in vivo expansion in Patient-10 Fig. 7a) which differed from other responders whose repertoires were (Extended Data Fig. 11a), further suggesting that TET2 is required for dominated by CD8+ effector memory and effector CTL019 cells at the CAR-specific CD8+ T cell proliferation. These observations collectively height of the response (Fig. 4d, Extended Data Fig. 7b). Experimental support the idea that TET2 dysfunction promotes the development knockdown of TET2 (Fig. 4e) recapitulated the effect of its dysfunction of human memory CAR T cells that can elicit effective anti-tumour in Patient-10 on the differentiation state of both total and CAR+CD8+ responses. The remission observed in Patient-10 was likely to result as well as CD4+ primary T cells (Fig. 4f, Extended Data Fig. 8a, b), from the marked increase in the number of CTL019 cells with TET2 implicating TET2 as an epigenetic modulator of human T lymphocyte dysfunction, despite the reduction in certain effector functions. fate. TET2-mediated regulation of CD8+ T cell differentiation may not In summary, profound clonal expansion of a single CAR-transduced occur at the transcriptional level, as we did not observe differential T cell with biallelic TET2 dysfunction transformed a non-curative TET2 mRNA expression between naive and memory subsets (Extended response into a deep molecular remission in a seventy-eight-year-old Data Fig. 8c). patient with CLL. Characterization of this T lymphocyte population To investigate the effects of TET2 inhibition on CAR T cell function, revealed that changes to the epigenetic environment altered the dif- we performed an in vitro serial re-stimulation assay. Repeated stimu- ferentiation state and proliferative capacity of the cells and translated lation with CD19-expressing tumour cells enabled TET2 knockdown into a considerable therapeutic effect. Although our initial studies were CAR T cells to continue to expand in an antigen-dependent manner, based on an extensive analysis of one subject, recapitulation of the effect whereas re-stimulation of CAR T cells with unaltered TET2 resulted in of TET2 dysfunction on CAR T cell fate and anti-tumour activity in arrest of culture growth (Fig. 4g) without affecting viability (Extended relevant culture systems involving primary human T-lymphocytes sup- Data Fig. 8d). We next examined cytokine production following acute ports the discovery of a modifiable epigenetic pathway that can shape (Extended Data Fig. 9a) and chronic (Extended Data Fig. 9b, c) anti- the immune response. Thus, targeting the epigenome may improve gen stimulation. Consistent with our analysis of CD8+CAR+ T cells in the efficacy and persistence of CAR T cells. Finally, our results indi- Patient-10, IFNγ production following activation of CD3 and CD28 cate that the progeny of a single CAR T cell are sufficient to mediate was diminished in CD8+ as well as CD4+ T cells with reduced TET2 potent anti-tumour effects in advanced leukaemia, a finding that has levels (Extended Data Fig. 9a). A similar decrease was observed for substantial clinical implications regarding the delivery of bespoke cel- TNFα generation (Extended Data Fig. 9a). By contrast, acute produc- lular therapies. tion of both TNFα and IL-2 by CD4+ T cells was increased upon CAR- specific stimulation (Extended Data Fig. 9a). While repeated exposure Online content of bulk CTL019 cells to CD19-expressing tumours also led to decreased Any Methods, including any statements of data availability and Nature Research IFNγ elaboration (Extended Data Fig. 9b, c), TET2 inhibition resulted reporting summaries, along with any additional references and Source Data files, in the sustained production of various other cytokines following are available in the online version of the paper at https://doi.org/10.1038/s41586- multiple rounds of stimulation (Extended Data Fig. 9b). Thus, TET2 018-0178-z. may control human T cell subset-specific cytokine production in an Received: 19 February 2017; Accepted: 27 April 2018; antigen-receptor-dependent and/or co-stimulatory signal-dependent Published online xx xx xxxx. fashion. + On the basis of our evaluation of CAR T cells expanded from 1. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A. & June, C. H. Chimeric antigen Patient-10, we predicted that knockdown of TET2 would decrease receptor-modifed T cells in chronic lymphoid leukemia. N. Engl. J. Med. 365, effector molecule expression. Unexpectedly, CAR-specific stimula- 725–733 (2011). 2. Schuster, S. J. et al. Chimeric antigen receptor T cells in refractory B cell tion, but not CD3 and CD28 stimulation, increased the expression of lymphomas. N. Engl. J. Med. 377, 2545–2554 (2017). CD107a (Extended Data Fig. 10a). This may be attributed, at least in 3. Maude, S. L. et al. Tisagenlecleucel in children and young adults with B cell part, to enhanced cytolytic capacity mediated by 4-1BB over CD28 lymphoblastic leukemia. N. Engl. J. Med. 378, 439–448 (2018). 20 + 4. Porter, D. L. et al. Chimeric antigen receptor T cells persist and induce sustained co-stimulation due to NKG2D upregulation . Because CD8 T cell remissions in relapsed refractory chronic lymphocytic leukemia. Sci. Transl. differentiation is accompanied by decreased methylation and upregu- Med. 7, 303ra139 (2015). lated gene expression at effector gene loci, including GZMB (encoding 5. Savoldo, B. et al. CD28 costimulation improves expansion and persistence of 21 chimeric antigen receptor-modifed T cells in lymphoma patients. J. Clin. Invest. granzyme B) and IFNG , we subsequently investigated whether TET2 121, 1822–1826 (2011). inhibition influences critical components of the cytotoxic machinery. 6. Turtle, C. J. et al. CD19 CAR-T cells of defned CD4+:CD8+ composition in adult In contrast to IFNγ, TET2 reduction in CD8+ CAR+ T cells increased B cell ALL patients. J. Clin. Invest. 126, 2123–2138 (2016). 7. Busque, L. et al. Recurrent somatic TET2 mutations in normal elderly granzyme B and perforin expression (Extended Data Fig. 10b). These individuals with clonal hematopoiesis. Nat. Genet. 44, 1179–1181 (2012). changes were associated with the heightened cytotoxic activity of TET2 8. Teferi, A. et al. Detection of mutant TET2 in myeloid malignancies other than knockdown CAR T cells (Extended Data Fig. 10c). myeloproliferative neoplasms: CMML, MDS, MDS/MPN and AML. Leukemia 23, 1343–1345 (2009). The above findings suggest that TET2 dysfunction may produce 9. Delhommeau, F. et al. Mutation in TET2 in myeloid cancers. N. Engl. J. Med. 360, potent CAR T cells with properties of short-lived memory cells that 2289–2301 (2009). can expand and elicit effector responses, as well as long-lived, persistent 10. Quivoron, C. et al. TET2 inactivation results in pleiotropic hematopoietic memory cells. We thus examined additional effector or memory mark- abnormalities in mouse and is a recurrent event during human + + − lymphomagenesis. Cancer Cell 20, 25–38 (2011). ers in CD8 CAR and CAR T cells using post-infusion samples from 11. Yeh, C. H. et al. Mutation of epigenetic regulators TET2 and MLL3 in patients Patient-10 and other long-term responding patients with CLL. At the with HTLV-I-induced acute adult T cell leukemia. Mol. Cancer 15, 15 (2016). height of the response, tumour-reactive CAR+ T cells from Patient-10 12. Zang, S. et al. Mutations in 5-methylcytosine oxidase TET2 and RhoA cooperatively disrupt T cell homeostasis. J. Clin. Invest. 127, 2998–3012 (2017). possessed higher levels of granzyme B (Extended Data Fig. 11a) and 13. Aslanyan, M. G. et al. Clinical and biological impact of TET2 mutations and eomesodermin (Eomes; a transcription factor involved in the formation expression in younger adult AML patients treated within the EORTC/GIMEMA and maintenance of the CD8+ memory T cell pool; Extended Data AML-12 clinical trial. Ann. Hematol. 93, 1401–1412 (2014). 14. Tahiliani, M. et al. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine Fig. 11b) compared to matched CAR− T cells, unlike the other complete + + in mammalian DNA by MLL partner TET1. Science 324, 930–935 (2009). responders. All clinically active CD8 CAR T cells in these patients 15. Kriaucionis, S. & Heintz, N. The nuclear DNA base 5-hydroxymethylcytosine is expressed CD27, a co-stimulatory receptor involved in the generation present in Purkinje neurons and the brain. Science 324, 929–930 (2009). 16. Ito, S. et al. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal of T cell memory (Extended Data Fig. 11b). The frequency of CTL019 and inner cell mass specifcation. Nature 466, 1129–1133 (2010). cells expressing KLRG1, a marker of T lymphocyte senescence that is 17. Pfafeneder, T. et al. The discovery of 5-formylcytosine in embryonic stem cell known to be regulated by DNA methylation21, was significantly lower DNA. Angew. Chem. 50, 7008–7012 (2011).

18. He, Y. F. et al. Tet-mediated formation of 5-carboxylcytosine and its excision by Author contributions J.A.F., C.L.N., M.A.S., S.A.C., J.J.D.M., R.M.Y., M.S.J., K.T.M., TDG in mammalian DNA. Science 333, 1303–1307 (2011). B.L.L., K.C.G., Y.Z., M.K., D.L.P., R.M.K., S.F.L., S.L.B., F.D.B, C.H.J. and J.J.M. 19. Ito, S. et al. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and designed experiments. J.A.F., C.L.N., M.A.S., S.L., S.A.C., T.R., A.P.C., J.J.D.M., 5-carboxylcytosine. Science 333, 1300–1303 (2011). J.E.D., S.R., Y.H., M.G., I.K., F.N., M.G., F.C., J.K.E., K.A.A., E.L.-S., M.H.G., X.L., 20. Zhang, H. et al. 4-1BB is superior to CD28 costimulation for generating CD8+ D.A., Y.W. and J.X. performed experiments and/or analysed data. J.A.F., F.D.B., cytotoxic lymphocytes for adoptive immunotherapy. J. Immunol. 179, C.H.J. and J.J.M. wrote and edited the manuscript, with all authors providing 4910–4918 (2007). feedback. 21. Scharer, C. D., Barwick, B. G., Youngblood, B. A., Ahmed, R. & Boss, J. M. Global DNA methylation remodeling accompanies CD8 T cell efector function. Competing interests J.A.F., C.L.N., R.M.Y., B.L.L., M.K., D.L.P., S.F.L., F.D.B., C.H.J. J. Immunol. 191, 3419–3429 (2013). and J.J.M. hold patents related to CTL019 cell therapy. These authors declare no additional competing interests. The remaining authors declare no competing Acknowledgements L. Tian, V. Gonzalez, N. Kengle, J. Scholler, Y. Wu, A. Bagg, interests. C. Pletcher, B. Carreno, A. Bigdeli and A. Chew are acknowledged for research support. D. Campana and C. Imai provided the CD19-directed CAR under Additional information material transfer agreements. B. Jena and L. Cooper provided the CAR Extended data is available for this paper at https://doi.org/10.1038/s41586- anti-idiotypic antibody. The OSU-CLL cell line was a kind gift from J. C. 018-0178-z. Byrd. This work was supported by funding from NCI T32CA009140 (J.A.F.), Supplementary information is available for this paper at https://doi.org/ P01CA214278 (C.H.J.), AI104400, AI 082020, AI045008, AI117950 (F.D.B), 10.1038/s41586-018-0178-z. NIAID K08AI101008 (S.A.C.), NIGMS R01GM118501 (R.M.K.), R01CA165206 Reprints and permissions information is available at http://www.nature.com/ (D.L.P. and C.H.J.), a Stand Up to Cancer Phillip A. Sharp Innovation in reprints. Collaboration Award (S.L.B. and C.H.J.) and Novartis. Correspondence and requests for materials should be addressed to C.H.J. or J.J.M. Reviewer information Nature thanks M. Maus and the other anonymous Publisher’s note: Springer Nature remains neutral with regard to jurisdictional reviewer(s) for their contribution to the peer review of this work. claims in published maps and institutional affiliations.

Methods TCRVβ deep sequencing. Genomic DNA from pre-infusion T cells, peripheral Patient samples. Patients were enrolled in institutional review board (IRB)- blood samples or sorted post-infusion T cells was isolated using the DNeasy Blood approved clinical protocol: ‘Genetically engineered lymphocyte therapy in treating and Tissue Kit (Qiagen). TCRVβ deep sequencing was carried out by immunoSEQ patients with B cell leukemia or lymphoma that is resistant or refractory to chemo- (Adaptive Biotechnologies). Only productive TCR rearrangements were used in therapy’ (ClinicalTrials.gov number: NCT01029366) which was designed to evalu- the assessment of TCR clonotype frequencies. ate the safety and efficacy of the adoptive transfer of autologous T cells expressing Integration site analysis. Vector integration sites were detected from genomic CD19 chimaeric antigen receptors (CAR19) that incorporate TCR-ζ and 4-1BB DNA as described previously26–29. Genomic sequences were aligned to the human costimulatory domains (CTL019). Participants provided written informed consent genome by BLAT (hg38, version 35, >95% identity) and statistical methods for in accordance with the Declaration of Helsinki and the International Conference analysing integration site distributions were carried out as previously described30. on Harmonization Guidelines for Good Clinical Practice. All regulations were The SonicAbundance method was used to infer the abundance of cell clones from followed according to this United States (US) Food and Drug Administration integration site data28. All samples were analysed independently in quadruplicate (FDA)-approved clinical protocol. The current study is a secondary investigation to suppress founder effects in the PCR and stochastics of sampling. using patient samples collected from existing clinical trials. Therefore, the sample Detection of TET2 chimaeric transcripts. RNA was isolated from cells and used sizes in this report were determined by the original clinical trial designs and sample as template with the One-Step RT–PCR Kit (Qiagen). Primers were designed to availability; no additional inclusion/exclusion criteria were applied. target the exon 9 and 10 boundaries of TET2, flanking the vector integration site Cell lines. NALM-6, K562 and HEK293T cell lines were originally obtained from and sequences internal to the anti-CD19BBζ CAR lentiviral vector. These included the American Type Culture Collection (ATCC). OSU-CLL cells22 were obtained various regions of the vector sequence (Extended Data Fig. 4a). Reactions were from Ohio State University. Cells were expanded in RPMI medium containing carried out as per the manufacturer’s specifications. Thermocycling temperatures 10% fetal bovine serum (FBS), penicillin and streptomycin at a low passage and and time for reverse transcription as well as PCR activation were conducted using tested for mycoplasma using the MycoAlert detection kit as per the manufac- the following cycling conditions: 30 s at 94 °C for melting, 30 s at 57 °C for primer turer’s (Lonza) instructions. Authentication of cell lines was performed by the annealing and 1.5 min at 72 °C for primer extension (35 cycles). A final extension University of Arizona (USA) Genetics Core based on criteria established by the at 72 °C was held for 10 min for each sample. PCR products were visualized on International Cell Line Authentication Committee. Short tandem repeat (STR) ethidium bromide agarose gels (1.5% by weight) via electrophoresis and ultraviolet profiling revealed that these cell lines were well above the 80% match threshold. imaging. NALM-6 and OSU-CLL cells were engineered to constitutively express click beetle Next-generation sequencing of post-infusion CAR T cell samples. CAR+ green (CBG) luciferase/enhanced GFP (eGFP). K562 cells were transduced with a and CAR− CD8+ T cells were purified from post-infusion PBMC samples cor- lentiviral vector encoding human CD19 (K562-CD19), and negative control cells responding to the peak of in vivo expansion in Patient-10. T cells were sorted were K562 cells expressing mesothelin (K562-mesothelin)23. Following transgene using a FACSAria (BD) and genomic DNA was isolated from these lymphocytes introduction, cells were sorted on a FACSAria (BD) to obtain a >99% pure pop- as described above. A custom targeted next-generation sequencing panel of 68 ulation. Mycoplasma and authentication testing were routinely performed before genes associated with haematologic malignancies was then used (TruSeq Custom and after molecular engineering. Amplicon, Illumina), and sequencing was carried out on an Illumina MiSeq CAR T cell manufacturing and correlative studies. Peripheral blood T cells (Illumina). A minimal mean depth of 2,110 reads was achieved for the specimens for CTL019 cell manufacturing were obtained by leukapheresis as previously sequenced, with the assay and bioinformatics performed as previously described31. described1,4. The processing, flow cytometric evaluation, quantification of The data presented are based on human reference sequence UCSC build hg 19 cytokines and quantitative PCR analyses (that is, detection of CAR19 and the (NCBI build 37.1). TCRVβ5.1+ dominant clone) on pre- and post-CTL019 infusion samples were Identifying the TET2 allele hosting vector integration. A PCR assay was devel- conducted as previously reported24. Next-generation sequencing of immuno- oped to amplify the region of DNA (approximately 4 kb) between the vector integra- globulin heavy chain (IGH) rearrangements was carried out on DNA isolated tion and the locus of the c.5635G>C mutation. Primers were designed to anneal to from blood and marrow samples. In brief, primers specific for the variable and the vector sequence (MKL-3: 5′-CTTAAGCCTCAATAAAGCTTGCCTTGAG-3′) joining gene segments of the third complementarity-determining region of the and multiple locations downstream of the mutation, chr4:105,276,145 IGH were used for amplification and deep sequencing to identify the leukaemic (50 bp: 5′ GCTGGTAAAAGACGAGGGAGATCCTG-3′, 99 bp: 5′-GGCTT clone relative to baseline samples (Adaptive Biotechnologies). The frequency of CCCAAAGAGCCAAGCCATG-3′, 120 bp: 5′-CACGGGCTTTTTCA the leukaemic clone in each sample was calculated using the number of total and GCCATTTTGGC-3′). Genomic DNA samples from sorted CAR+ and CAR− unique productive reads. CD8+ T cells corresponding to the peak of clonal expansion in Patient-10 were Population doublings of clonal CAR T cells in the blood (assuming a 5-litre selected for amplification. PCR reactions were carried out with Long Amp Taq n volume of peripheral blood) were calculated using the equation At = A02 , in which polymerase (New England BioLabs) and 100–400 ng of DNA isolated from n is the number of population doublings, A0 is the input number of cells (assuming samples, according to the manufacturer’s recommendations. Amplification was a single TET2-disrupted cell), and At is the number of CAR T cells at day 121 (peak conducted as follows: 94 °C for 30 s, 30 cycles of (94 °C for 30 s, 60 °C for 30 s, and CAR T cell expansion; 95.445 CD3+ CD8+ CAR+ cells per microlitre whole blood). 65 °C for 3 min 20 s), and a final extension of 65 °C for 10 min. Amplified prod- These correlative assays were carried out at time points defined by the clinical ucts were separated by electrophoresis on a 1% ethidium bromide agarose gel and protocol in parallel with disease response evaluations. This clinical trial was a prominent bands of 4 kb in size were isolated using the QIAquick Gel Extraction single-treatment study; comparisons between patients in the current study were Kit (Qiagen). Isolated bands were ligated into pCR2.1 and cloned into TOP-10 defined by the observed clinical responses. Investigators were blinded to clinical chemically competent cells using the TOPO TA Cloning Kit (Invitrogen). Purified responses as correlative assays were conducted using de-identified subject samples. plasmids were sequenced with M13 forward and reverse primers using standard Flow cytometry. Routine assessments of CAR T cell expansion and persistence as Sanger technology. Sequencing results were aligned to the vector sequence and well as measurement of B-CLL burden in the blood and marrow were conducted reference genome. according to our previously published methods using a six-parameter Accuri C6 Characterization of the TET2 E1879Q mutation. The previously character- flow cytometer (BD)1,4. T cell immunophenotyping was performed by surface ized and crystalized human TET2-CS variant (1129–1936 Δ1481–1843) with staining with flow cytometry antibodies immediately following pre-incubation an N-terminal FLAG-tag was expressed using a pLEXm expression vector32,33. with Aqua Blue dead cell exclusion dye (Invitrogen). The Alexa Fluor 647– The E1879Q mutation or mutation of the catalytic H1382Y and D1384A (HxD conjugated monoclonal antibody that was used to detect the CAR molecule mutant) were generated by standard means. HEK293T cells were cultured in has previously been described25. Commercially available flow cytometry antibodies DMEM with GlutaMAX (Thermo Fisher Scientific) and 10% FBS (Sigma). Cells against the following antigens used in the study are as follows: CD3 allophycocya- were transfected with wild-type (WT), mutant hTET2-CS or an empty pLEXm nin (APC) H7, CCR7 PE/CF594, CD107a APC, (BD Biosciences); CD45RO bril- vector control using Lipofectamine 2000 (Thermo Fisher Scientific) according liant violet (BV)570, CD8 BV650, CD4 BV785, perforin BV421, Ki-67 Alexa Fluor to the manufacturer’s protocol. Medium was changed 24 h after transfection, and (AF)700, TNFα BV605 (Biolegend); TCRVβ5.1 APC, IFNγ PE, IL-2 PerCP-eFluor cells were collected by trypsinization 48 h after transfection and resuspended in 710, Eomes FITC (eBioscience); Granzyme B PE/cyanine5.5 (Invitrogen). For phosphate-buffered saline. Genomic DNA was isolated from four-fifths of the cells intracellular staining, cells were fixed and permeabilized using the Foxp3 Fixation/ using the DNeasy Blood and Tissue Kit (Qiagen) and the remaining one-fifth of Permeabilization Kit (eBioscience) or the Cytofix/Cytoperm Kit (BD Biosciences). the cells were lysed using CytoBuster Protein Extraction Reagent (EMD Millipore) The GolgiStop protein transport inhibitor containing monensin and GolgiPlug for western blot analysis. protein transport inhibitor containing brefeldin A (BD Biosciences) were used DNA blots for cytosine modifications were carried out according to estab- when staining for intracellular cytokine production. All flow cytometry reagents lished protocols34. Purified DNA from HEK293T cells was diluted to 15 ng/µl in were titrated before use. Samples were acquired on an LSRFortessa (BD) and data Tris–EDTA (TE) buffer, pH 8.0 for twofold dilutions of each sample. One-quarter were analysed using FlowJo software (TreeStar). volume of 2 M NaOH–50 mM EDTA was added to each sample. The DNA was

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. RESEARCH Letter denatured for 10 min at 95 °C and transferred quickly to ice, followed by the addi- performed with Metascape (http://metascape.org). Only high-confidence peaks tion of 1:1 ice cold 2 M ammonium acetate. Polyvinylidene difluoride (PVDF) were used for gene ontology and DNA motif analyses. For these evaluations, peaks membranes were cut to size, wet with MeOH and equilibrated in TE buffer and with an enrichment score less than 5 were filtered out as previously established39. then assembled into the PR 648 Slot Blot Manifold (GE Healthcare Life Sciences). CAR T cell differentiation and expansion potency assays. Bulk primary human Each well was washed with 400 µl TE drawn through with gentle vacuum, and T cells were activated with paramagnetic beads coated with anti-CD3 and anti-CD28 genomic DNA was loaded, followed by another TE wash. Membranes were blocked monoclonal antibodies as previously described40 and transduced with lentiviral for 2 h in 5% milk-TBST, washed thrice with TBST, and blotted at 4 °C overnight vectors encoding the CD19BBζ CAR and shRNA hairpin sequences targeting TET2 with primary antibodies against each modified cytosine (1:5,000 mouse anti-5-mC or a scrambled control with GFP co-expression (Cellecta). Knockdown efficiency (Abcam); 1:10,000 rabbit anti-5-hmC (Active Motif); 1:5,000 rabbit anti-5-fC in CTL019 cells following shRNA transduction was determined by real-time quan- (Active Motif); 1:10,000 rabbit anti-5-caC (Active Motif)). Blots were then washed, titative PCR with Taqman gene expression assays (Applied Biosystems) for TET2 incubated with a 1:2,000 dilution of a secondary horse anti-mouse-horseradish (assay Hs00325999_m1) and GAPDH (assay (Hs03929097_g1), which served as a peroxidase (HRP; Cell Signaling Technology) or 1:5,000 goat anti-rabbit-HRP loading and normalization control. Following 14 days of culture, the differentiation (Santa Cruz Biotechnology) for 2 h, washed and imaged using the Immobilon phenotype of these cells was determined by flow cytometry. GFP+CAR+ T cells Western Chemiluminescent HRP Substrate (Millipore) and the Amersham Imager were sorted on a FACSAria (BD) and combined 1:1 with irradiated K562 cells engi- 600 (GE Healthcare Life Sciences). neered to express CD194 or mesothelin as a negative control. CTL019 cells were For protein detection, clarified cell lysates were run on 8% sodium dodecyl serially re-stimulated with irradiated K562 targets three times, with absolute counts sulphate polyacrylamide (SDS–PAGE) gels. Gels were transferred together onto a and viability assessments taken at regular intervals over 17 days. Cell counts and PVDF membrane using the iBlot 2 Gel Transfer Device (Thermo Fisher Scientific). viability measurements were obtained using the LUNA Automated Cell Counter Membranes were blocked for 2 h at room temperature with 5% (w/v) milk in Tris- (Logos Biosystems). Supernatants were collected 24 h after each stimulation for buffered saline with 0.1% (v/v) Tween-20 (TBST), washed three times with TBST longitudinal measurements of cytokine levels in cultures, as previously described41. and blotted either with primary 1:10,000 anti-FLAG M2 (Sigma) or 1:1,000 anti- Intracellular cytokine, perforin and granzyme B analysis. CD8+ T cells from Hsp90α/β (Santa Cruz Biotechnology) antibodies at 4 °C overnight. Following Patient-10 were stimulated 3:1 with paramagnetic beads coated with anti-CD3 and incubation, membranes were washed and blotted with a 1:5,000 dilution of sec- anti-CD28 monoclonal antibodies for 6 h in the presence of CD107a monoclonal ondary goat anti-mouse-HRP antibodies (Santa Cruz Biotechnology) for 2 h, antibody and the golgi inhibitors brefeldin A and monensin. Cells were washed washed and imaged with Immobilon Western Chemiluminescent HRP Substrate and stained with live/dead viability dye, followed by surface staining for CD3, (Millipore) on an Amersham Imager 600 (GE Healthcare Life Sciences). CD8 and TCRVβ5.1. These lymphocytes were subsequently fixed/permeabilized For LC–MS/MS, 1–2 µg of genomic DNA from each sample was degraded and intracellularly stained for IFNγ. CAR T cells generated from healthy donors to component nucleosides with 1 U DNA Degradase Plus (Zymo Research (TET2 knockdown or control) were stimulated in the same way with CD3/CD28 Corporation) at 37 °C overnight. The nucleoside mixture was diluted tenfold into beads or beads coated with an anti-idiotypic antibody against CAR19. Cells were 0.1% formic acid, and injected onto an Agilent 1200 Series HPLC with a 5 µm, then stained for surface antigens (CD3, CD4, CD8 and CAR19). After fixation and 2.1 × 250 mm Supelcosil LC-18-S analytical column (Sigma) equilibrated to 45 °C permeabilization, intracellular staining for IFNγ, TNFα and IL-2 was performed. in buffer A (5 mM ammonium formate, pH 4.0). The nucleosides were separated For perforin and granzyme B analysis, CTL019 cells that had been transduced in a gradient of 0–15% buffer B (4 mM ammonium formate, pH 4.0, 20% (v/v) with a TET2 or scrambled control shRNA were expanded for 14 days and cryopre- methanol) over 8 min at a flow rate of 0.5 ml per minute. Tandem MS was per- served. These CAR T cells were then thawed and rested for 4 h, followed by live/ formed by positive ion mode ESI on a 6460 triple-quadrupole mass spectrometer dead and surface staining for CD3, CD8 and CAR19. Intracellular staining for (Agilent) with a gas temperature of 250 °C, a gas flow of 12 l/min, a nebulizer perforin and granzyme was carried out following fixation and permeabilization. pressure of 35 psi, a sheath gas temperature of 300 °C, a sheath gas flow of Cells were analysed on an LSRFortessa (BD). 11 l/min, a capillary voltage of 3,500 V, a fragmentor voltage of 70 V and a delta EMV Cytotoxicity assay. Healthy donor CTL019 cells transduced with a shRNA directed of +1,000 V. Collision energies were optimized to 10 V for 5-mC and 5-fC; 15 V for against TET2 or a scrambled control were co-cultured with CBG luciferase-expressing 5-caC; and 25 V for 5-hmC. Multiple reaction monitoring (MRM) mass transitions NALM-6 and OSU-CLL cell lines at the indicated ratios for 16 h41. Cell extracts were 5-mC 242.11→126.066 m/z; 5-hmC 258.11→124.051; 5-fC 256.09→140.046; were created using the Bright-Glo Luciferase Assay System (Promega Corporation) 5-caC 272.09→156.041; and T 243.10→127.050. Standard curves were generated and substrate was added according to the manufacturer’s instructions. Luciferase using standard nucleosides (Berry & Associates) ranging from 2.5 μM to 610 pM measurements were taken on a SpectraMax luminescence microplate reader (12.5 pmol to 3 fmol total). Digested oligonucleotides containing equimolar (Molecular Devices), and specific lysis was calculated as previously described41. amounts of each modified cytosine were used as quality control samples. The Analysis of TET2 gene expression levels in T cell subsets. TET2 expression levels sample peak areas were fit to the standard curve, as adjusted by the quality control were determined by analysing a published gene expression dataset (https://www. samples to determine the amount of each modified cytosine in the genomic DNA ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE23321) for CD8+ T cell subsets sample. Amounts are expressed as the percentage of total cytosine modifications. (naive, stem cell memory, central memory and effector memory) isolated from Measurement of total 5-hydroxymethylcytosine levels. CD8+ T cells were puri- three healthy human subjects42. Genechip (Affymetrix) data were processed with fied from post-infusion PBMC samples using the EasySep Human CD8+ T cell the Bioconductor Oligo software package43 (release 3.6, Bioconductor) using the Immunomagnetic Negative Selection Kit (StemCell Technologies) and expanded RMA method44. ex vivo using a previously reported rapid expansion protocol35. Following culture, Statistical analyses. Normality was assessed for all data using the D’Agostino– CD8+CAR+TCRVβ5.1+ and CD8+CAR−TCRVβ5.1− T cells were sorted on a Pearson omnibus test. For integration site data analysis, genomic feature data com- FACSAria (BD). Cells were permeabilized and treated with 300 µg/ml DNase I parisons were carried out as previously described using χ2, Fisher’s exact tests, or a for 60 min at 37 °C. After washing, samples were incubated with an anti-5-hmC combination of Bayesian model averaging, conditional logit and regression27,45,46. monoclonal antibody or an isotype control for 30 min, followed by staining with an Assessments of T cell differentiation and function in shRNA-mediated TET2 Alexa Fluor 647-conjugated secondary antibody, as previously described36. Cells knockdown experiments were performed using a paired Student’s t-test. Estimates were immediately acquired on an LSRFortessa (BD). of variation within each group of data are presented as error bars. Analyses were Global chromatin profiling by ATAC–seq. Following culture, performed with SAS (SAS Institute), Stata 13.0 (StataCorp) or GraphPad Prism 6 CD8+CAR+TCRVβ5.1+ and CD8+CAR−TCRVβ5.1− T cells were sorted on a (GraphPad Software). Cytokine heat maps were constructed using Morpheus soft- FACSAria (BD). ATAC–seq was carried out as previously described37,38. Two rep- ware (Broad Institute; accessed at https://software.broadinstitute.org/morpheus/). licates were performed for each ex vivo expanded CD8+CAR+TCRVβ5.1+ and All tests were two-sided. Exact P values are reported. P < 0.05 was considered CD8+CAR−TCRVβ5.1− T cell culture. In brief, nuclei were isolated from 200,000 statistically significant. sorted CD8+ T cells for each replicate, followed by the transposition reaction in Reporting summary. Further information on experimental design is available in the presence of Tn5 transposase (Illumina) for 45 min at 37 °C. Purification of the Nature Research Reporting Summary linked to this paper. transposed DNA was subsequently completed with the MinElute Kit (Qiagen) Data availability. Sequencing data are available at the NCBI Sequence Read and fragments were barcoded with dual indexes (Illumina Nextra). Paired-end Archive (accession number SRP136348; analyses of lentiviral integration sites, sequencing (2 × 75-bp reads) was carried out using the Illumina NextSeq 500. TET2 chimaeric transcripts and alleles as well as mutations associated with Raw sequencing data were processed and aligned to the GRC37/hg19 reference hematologic malignancies), Adaptive Biotechnologies’ immuneACCESS database genome using Bowtie 2 and regions of significant enrichment were identified using (https://doi.org/10.21417/B72D1Q; TCRVβ and BCR IgH immunosequencing) MACS v1.4.2. Merged peak lists were created using BedTools. ATAC sequencing and Gene Expression Omnibus (accession number GSE112494; ATAC–seq). Any tag enrichment and DNA motif analysis across the merged peak list were carried other data that support the findings of the study will be made available upon rea- out using HOMER (http://homer.salk.edu). Gene Ontology pathway analysis was sonable request.

22. Hertlein, E. et al. Characterization of a new chronic lymphocytic leukemia cell 35. Jin, J. et al. Simplifed method of the growth of human tumor infltrating line for mechanistic in vitro and in vivo studies relevant to disease. PLoS ONE 8, lymphocytes in gas-permeable fasks to numbers needed for patient treatment. e76607 (2013). J. Immunother. 35, 283–292 (2012). 23. Barrett, D. M. et al. Treatment of advanced leukemia in mice with mRNA 36. Carty, S. A. et al. The loss of TET2 promotes CD8+ T cell memory diferentiation. engineered T cells. Hum. Gene Ther. 22, 1575–1586 (2011). J. Immunol. 200, 82–91 (2018). 24. Maude, S. L. et al. Chimeric antigen receptor T cells for sustained remissions in 37. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y. & Greenleaf, W. J. leukemia. N. Engl. J. Med. 371, 1507–1517 (2014). Transposition of native chromatin for fast and sensitive epigenomic profling of 25. Jena, B. et al. Chimeric antigen receptor (CAR)-specifc monoclonal antibody to open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods detect CD19-specifc T cells in clinical trials. PLoS ONE 8, e57838 (2013). 10, 1213–1218 (2013). 26. Brady, T. et al. A method to sequence and quantify DNA integration for 38. Pauken, K. E. et al. Epigenetic stability of exhausted T cells limits durability of monitoring outcome in gene therapy. Nucleic Acids Res. 39, e72 (2011). reinvigoration by PD-1 blockade. Science 354, 1160–1165 (2016). 27. Berry, C., Hannenhalli, S., Leipzig, J. & Bushman, F. D. Selection of target sites 39. Xu, J. et al. Landscape of monoallelic DNA accessibility in mouse embryonic for mobile DNA integration in the human genome. PLOS Comput. Biol. 2, e157 stem cells and neural progenitor cells. Nat. Genet. 49, 377–386 (2017). (2006). 40. Laport, G. G. et al. Adoptive transfer of costimulated T cells induces 28. Berry, C. C. et al. Estimating abundances of retroviral insertion sites from DNA lymphocytosis in patients with relapsed/refractory non-Hodgkin lymphoma fragment length data. Bioinformatics 28, 755–762 (2012). following CD34+-selected hematopoietic cell transplantation. Blood 102, 29. Berry, C. C., Ocwieja, K. E., Malani, N. & Bushman, F. D. Comparing DNA 2004–2013 (2003). integration site clusters with scan statistics. Bioinformatics 30, 1493–1500 41. Fraietta, J. A. et al. Ibrutinib enhances chimeric antigen receptor T cell (2014). engraftment and efcacy in leukemia. Blood 127, 1117–1127 (2016). 30. Scholler, J. et al. Decade-long safety and function of retroviral-modifed 42. Gattinoni, L. et al. A human memory T cell subset with stem cell-like properties. chimeric antigen receptor T cells. Sci. Transl. Med. 4, 132ra53 (2012). Nat. Med. 17, 1290–1297 (2011). 31. Daber, R., Sukhadia, S. & Morrissette, J. J. Understanding the limitations of next 43. Carvalho, B. S. & Irizarry, R. A. A framework for oligonucleotide microarray generation sequencing informatics, an approach to clinical pipeline validation preprocessing. Bioinformatics 26, 2363–2367 (2010). using artifcial data sets. Cancer Genet. 206, 441–448 (2013). 44. Irizarry, R. A. et al. Summaries of Afymetrix GeneChip probe level data. Nucleic 32. Liu, M. Y. et al. Mutations along a TET2 active site scafold stall oxidation at Acids Res. 31, e15 (2003). 5-hydroxymethylcytosine. Nat. Chem. Bio. 13, 181–187 (2017). 45. Brady, T. et al. Integration target site selection by a resurrected human 33. Hu, L. et al. Crystal structure of TET2-DNA complex: insight into TET-mediated endogenous retrovirus. Genes Dev. 23, 633–642 (2009). 5mC oxidation. Cell 155, 1545–1555 (2013). 46. Ocwieja, K. E. et al. HIV integration targeting: a pathway involving Transportin-3 34. Liu, M. Y., DeNizio, J. E. & Kohli, R. M. Quantifcation of oxidized and the nuclear pore protein RanBP2. PLoS Pathog. 7, e1001313 (2011). 5-methylcytosine bases and TET enzyme activity. Methods Enzymol. 573, 47. Moskowitz, D. M. et al. Epigenomics of human CD8 T cell diferentiation and 365–385 (2016). aging. Sci. Immunol. 2, eaag0192 (2017).

Bone marrow positive for CLL

Bone marrow positive for CLL: 90% of 60% cellularity

Bone marrow positive for CLL: 70% of 50% cellularity

Bone marrow positive for CLL: 80% of 60% cellularity

Bone marrow positive for CLL: 90% of 60% cellularity Bone marrow negative for CLL 85% CLL in bone marrow; FISH positive: Bone marrow Bone marrow Bone marrow TP53 deletion negative negative negative ATM deletion for CLL for CLL for CLL

YEAR 1 YEAR 2 YEAR 3 YEAR 4 YEAR 5

Infusion 1 (Day 0) Infusion 2 (Day 70)

CAR T-cells CAR T-cells CAR T-cells detected in detected in detected in bone marrow bone marrow bone marrow (16.68 copies/ (242.1 copies/ (98.9 copies/ μg DNA) μg DNA) μg DNA)

Lymph node biopsy: CAR T-cells not detected

CAR T-cells detected in bone marrow (29980.7 copies/ μg DNA)

Extended Data Fig. 1 | Timeline of disease clearance by CAR T cells in results of bone marrow assessments, tumour cytogenetics and CAR T cell Patient-10. An outline of clinical findings in Patient-10, including the persistence. CTL019 cell infusion time points are indicated by red arrows.

Extended Data Fig. 2 | See next page for caption.

Extended Data Fig. 2 | CAR T cell detection and profiling of immune (Ct) value obtained from three replicates and a standard deviation (SD) cell populations in Patient-10 and other responders. a, Pre- and post- is listed. Calculations of CAR T cell abundance are reported as average infusion kinetics of CAR T cell expansion (CD3+, CD8+ and CD8−) marking per cell as well as transgene copies per microgram of genomic are shown in Patient-10 compared to other responders. The number of DNA. e, Frequencies of circulating B cells in Patient-10 compared to a circulating CTL019 cells was calculated based on frequencies of CD3+, healthy subject. Pre-gating was performed to exclude dead cells as well CD8+ and CD8− CAR T cell populations and absolute cell counts. as doublets, and all gating thresholds were based on fluorescence minus b, Flow cytometry gating strategy to identify peripheral blood CAR T cells one (FMO) controls (representative of two independent experiments). in Patient-10. c, Relative percentages of CTL019 cells in the CD4 and f, Enumeration of various immune cell populations in the blood of CD8 compartments of this patient. T cells from a healthy subject served Patient-10. The frequency of each population is listed in a separate column as a negative control. d, The persistence of CAR T cells in the peripheral that corresponds to its phenotypic marker. blood of Patient-10 was determined by qPCR. The average threshold cycle

a Patient-10 CTL019 Infusion Product

CD8- CAR T-cells CD8+ CAR T-cells

TCRVβ02-01 TCRVβ05-01 TCRVβ05-08 TCRVβ06-09 TCRVβ03-01 TCRVβ05-03 TCRVβ06-01 TCRVβ07-02 TCRVβ04-01 TCRVβ05-04 TCRVβ06-02/TCRVβ06-03 TCRVβ07-03 TCRVβ04-02 TCRVβ05-05 TCRVβ06-04 TCRVβ07-04 TCRVβ04-02/TCRVβ04-03 TCRVβ05-06 TCRVβ06-07 TCRVβ07-06

TCRVβ07-07 TCRVβ10-02 TCRVβ12-03/TCRVβ12-04 TCRVβ16-01 TCRVβ07-08 TCRVβ10-03 TCRVβ12-05 TCRVβ18-01 TCRVβ07-09 TCRVβ11-01 TCRVβ13-01 TCRVβ19-01 TCRVβ09-01 TCRVβ11-02 TCRVβ14-01 TCRVβ20-01 TCRVβ10-01 TCRVβ11-03 TCRVβ15-01 TCRVβ23-01

TCRVβ24-01 TCRVβ27-01 TCRVβ29-01 TCRVβ25-01 TCRVβ28-01 TCRVβ30-01 b Complete Responders (CR) Patient 3 Patient 4 Patient 45 100

75 undanc e undanc e 50 (% ) (% ) e Ab e Ab

25 Relativ Relativ 0 0 14 21 28 56 112 0 14 21 28 0 14 21 28 Time (Day)

Low Abundance HELLS NUP188 Low Abundance IZUMO3 SNORD3P3 Low Abundance IPCEF1 SAE1 BRWD1 HERC4 PPFIA1 ARNT KLHL11 STIP1 AP1S2 KIAA1109 SAFB2 Gene C11orf98 JRKL−AS1 ST3GAL3 CARD8 LINC01473 UXT−AS1 ATAD2B MYCBP2 SPECC1L Names: C19orf48 MBP TAC3 DNMT3A RAB18 WHAMMP3 CDK11B OGFOD1 UBR4 CLEC16A MEF2A TMEM123 GALC RARG YLPM1 CDYL2 PDCD4 WDR62 CLK4 MTMR3 TRIO GNB1 RNGTT ZC3H18 ERCC6L2 PIKFYVE ZNF565 DCUN1D4 NBEAL1 UNK GOLGA8O SEPT9 ZNF286B HNRNPUL2 RABEP1 ZZEF1 c d Partial Responders (PR) Patient 3 (CR) Patient 5 Patient 12 6 100 10 Patient 4 (CR) Patient 45 (CR) 105 75 Patient 5 (PR) 104 Patient 12 (PR) undanc e undanc e 50 103 (% ) (% ) CAR e Ab e Ab 102 25 Copies/µg gDNA Relativ Relativ 101 0 100 0 14 21 28 0 9142859 01020 50 100150 200 Time (Day) Time (Day)

Low Abundance FAM217B RTN3 Low Abundance HSPBP1 MCU ANP32B GNB1 SF3A2 BBS9 HSPH1 MFSD1 Gene AP1G1 GNL3 SLC8A1−AS1 CHD3 LINC01599 POGZ CWF19L2 MAN2A1 SMG1 CLEC16A LINC01934 PTPN12 Names: DAG1 MIR4445 STK4 DENND4C LOC105372476 SPPL3 DPYD NAA30 TRIM37 GNAI2 LRRK2 TIMELESS EFR3A RFX7 ZNF609 GRK3 MAP4 TNFSF14 Extended Data Fig. 3 | Clonal composition of CAR T cells from major cell clone, as marked by lentiviral integration sites. c, Integration Patient-10 and other subjects treated with CTL019. a, TCRVβ site analysis in CAR T cells from two partially responding patients. distribution in CD8− (left) and CD8+ (right) CAR T cells in the cellular d, In vivo expansion of CAR T cells in the above patients as determined infusion product of Patient-10. b, Relative frequencies of CAR T cell by quantifying the average CAR transgene copies per microgram DNA at clones in three patients who had complete responses to CTL019 therapy, each time point. summarized as stacked bar graphs. Each colour (horizontal bar) denotes a

5’ LTR3EF1α ’ LTR Reaction: 1 234567891011 TET2 910 Forward Primer: F1 F2 F3 F4 F5 F5 F1 F1 F1 F1 F1 (4q24) cPPT Exon Exon Reverse Primer: R6 R3 R4 R5 R2 R1 R2 R3 R4 R5 R1 Anti-CD19 CAR Band Size (kB): 114128 128115 137116 ***** Amplification F1 F2 F3 F4 F5 Strategy : R1 R2 R3 R4 R5 R1 R2 R6 kB 3.0 Primer Target Direction Sequence 2.0 F1 TET2 exon 9 Forward GACTTGCACAACATGCAGAA 1.5 R6 TET2 exon 10 Reverse GTATAAAGGCAGAACGTGAAGC 1.0 Chimera 2 R1 Vector R element Reverse AGCAGTGGGTTCCCTAGTTA R3 Vector cPPT element Reverse TGCCATTTGTACTGCTGTCTTA 0.5 Chimera 1 R4 Vector EF1α promoter Reverse CAAGGGCCATAACCCGTAAA R5 Vector 4-1BB region (CAR) Reverse GCCATCTTCCTCTTGAGTAGTT R2 Vector LTR poly(A) signal Reverse GGCAAGCTTTATTGAGGCTT Chimera 3 F2 Vector cPPT element Forward AGGAATTTGGCATTCCCTACA F3 Vector EF1α promoter Forward GGAGAACCGTATATAAGTGCAGTAG F4 Vector 4-1BB region (CAR) Forward CCTTCTCCTGTCACTGGTTATC F5 Vector R element Forward GAAGGGCTAATTCACTCCCAA TET2 Vector Chimeric RNA RNA RNA

Chimera Splice Site Donor Sequence Acceptor Sequence Reaction Targets 1 1st ACAUUG GUAAGU CUCUAG CAGUGG 1: TET2 exon 9 and 10 junction 7: TET2 exon 9 to LTR U5 region nd 1 2 GACUGG UGAGUA GUUAGG CAGGGA 2: Vector cPPT element 8: TET2 exon 9 to cPPT element 2 1st ACAUUG GUAAGU UUUCAG GUGUCG 3: Vector EF1α promoter 9: TET2 exon 9 to EF1α promoter 4: Vector 4-1BB region (CAR) st 10: TET2 exon 9 to 4-1BB region (CAR) 3 1 ACAUUG GUAAGU UAACAG GUAGGA 5: Vector LTR U5 region 11: TET2 exon 9 to LTR R region 3C2nd AACUA AUGUAG GGGGAC UGGAAG 6: Vector LTR R region

c d Anti-CD19 CAR Next-Generation Sequencing Multi-Gene Mutation Panel Hematologic Malignancies ABL1CEBPA GATA2MAP2K1NPM1 RUNX1TP53 ASXL1CSF1R GNAS MAPK1 NRAS SETBP1 TPMT ATMCSF3R HNRNPKMIR142PDGFRASF1 U2AF1 BCOR DDX3XIDH1 MPLPHF6SF3A1 U2AF2 TET2 345 6 78 91011 BCORL1 DNMT3A IDH2 MYCPOT1SF3B1 WT1 (4q24) BIRC3ETV6IL7RMYCNPRPF40B SMC1A XPO1 BRAF EZH2 JAK2 MYD88PTENSRSF2 ZMYM3 CALR FAM5CKIT NF1PTPN11STAG2 ZRSR2 CBLFBXW7 KLHL6NOTCH1 RAD21TBL1XR1 Allele Sequence: T G C A G C T C A C G C TTT CDKN2A FLT3 KRAS NOTCH2 RIT1 TET2

Reverse Complement: AAA G C G T G A G C T G C A Wildtype Sequence: AAA G C G T G A G C T G C A Extended Data Fig. 4 | Detection of TET2 chimaeric transcripts in gel and stained with ethidium bromide. Expected sizes of amplicons are Patient-10 CAR T cells and DNA sequencing for mutation detection. listed above the gel. Truncated transcripts are highlighted by blue boxes. a, The strategy for detection of polyadenylated RNA corresponding to A key to the RT–PCR reactions is shown below the diagram. *Band size truncated TET2 transcripts is depicted. Boxes represent the genomic not determined (two independent experiments). c, Genes interrogated regions between TET2 exons 9 and 10 with the integrated vector present. by the next generation sequencing panel used to analyse DNA isolated Blue and red arrows indicate general locations of the forward and reverse from CD8+CAR+ T cells and CAR− T cells in Patient-10 at the peak of his primers, which are listed below the diagram. LTR, long terminal repeat; response. d, Sanger sequencing of specific amplifications corresponding to cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences the allele that was disrupted by integration of the CAR lentivirus is shown. corresponding to the splice junctions for the three chimaeric messages The mutation that was detected by next generation sequencing of total (five total junctions) are listed in the bottom chart. Underlines indicate genomic DNA from CAR+ T cells (Fig. 3c) is not present in the TET2 allele consensus splice donors and acceptors. b, Visualization of chimaeric TET2 hosting the lentiviral integration site. RT–PCR products. PCR products were separated on a native agarose

a c 5-mC 5-hmC 5-fC 5-caC Western Antibody Validation OH O O NH2 NH2 NH2 NH2

CH3 CH2 CH C OH Anti-FLAG Anti-Hsp90 Anti-FLAG Anti-Hsp90 HN HN HN HN kDa O N TET2 O N TET2 O N TET2 O N 180 130 DNA DNA DNA DNA 100 70 55

HxD TET2 HxD TET2 Empty VectorWildtype TET2E1879Q TET2 Empty VectorWildtype E1879QTET2 TET2 40 5-mC hTET2 35 5-hmC Hsp90 Chemiluminescent Image Digital Image 5-fC 5-caC

b d DNA Blots Western Blots LC-MS/MS Standard Curves 10 9 5-mC 10 8 5-hmC HxD TET2 HxD TET2 Empty VectoWildtyper TET2E1879Q TET2 Empty VectorWildtype E1879QTET2 TET2 5-fC 10 7 600ng 5-caC 10 6 300ng

5-mC Peak Area 10 5 150ng 10 4

3 10 0 1 2 3 4 5 600ng 10 10 10 10 10 10 Amount of Nucleoside (fmol) 5-hmC 300ng e 150ng Raw and Normalized LC-MS/MS Data Anti-FLAG (hTET2) Peak Areas5-mC5-hmC 5-fC 5-caC Empty Vector (1)20,156,324 --- 600ng Empty Vector (2)11,963,548 --- Empty Vector (3)12,508,852 --- 5-fC 300ng Wildtype TET2 (1)3,129,967 61,498 238,426 2,921 Wildtype TET2 (2)6,442,997 85,691 331,456 2,101 Wildtype TET2 (3)7,787,826 84,194 314,389 2,713 150ng E1879Q TET2 (1)14,350,779 170,991 404,648 4,008 E1879Q TET2 (2)7,080,722 84,132 166,821 - E1879Q TET2 (3)7,228,118 74,472 129,216 1,736 HxD TET2 (1)16,137,499 --- 600ng HxD TET2 (2)12,183,964 ---

5-caC 300ng Normalized Amounts (fmol) 5-mC 5-hmC 5-fC 5-caC Total (fmol) Empty Vector (1)1,066 ---1,066 150ng Empty Vector (2)633 ---633 Empty Vector (3)661 ---661 Anti-Hsp90 Wildtype TET2 (1)166 18 45 47 275 Wildtype TET2 (2)341 24 63 34 461 Wildtype TET2 (3)412 24 59 43 539 E1879Q TET2 (1)759 49 76 64 948 E1879Q TET2 (2)374 24 31 -430 E1879Q TET2 (3)382 21 24 28 456 HxD TET2 (1)853 ---853 HxD TET2 (2)644 ---644

% of Modified Cytosines 5-mC 5-hmC 5-fC 5-caC Empty Vector (1)100 000 Empty Vector (2)100 000 Empty Vector (3)100 000 Wildtype TET2 (1)60616 17 Wildtype TET2 (2)74514 7 Wildtype TET2 (3)76411 8 E1879Q TET2 (1)805 87 E1879Q TET2 (2)876 70 E1879Q TET2 (3)845 56 HxD TET2 (1)100 000 HxD TET2 (2)100 000 Extended Data Fig. 5 | See next page for caption.

Extended Data Fig. 5 | Analysis of DNA methylation variants from blot. Both chemiluminescence (left) and digital (right) images were HEK293T cells overexpressing TET2. a, Depiction of sequential captured, demonstrating that these antibodies exhibit specificity for oxidations of 5-mC to 5-hmC, 5-fC and 5-caC catalysed by TET2 (top). the expected FLAG tag and Hsp90 based on molecular weight markers. Dot blots for 5-mC, 5-hmC, 5-fC and 5-caC in genomic DNA (gDNA) d, 5-mC, 5-hmC, 5-fC and 5-caC nucleosides were analysed at fixed isolated from HEK293T cells transfected with the E1879Q TET2 mutant concentrations using LC–MS/MS to generate standard curves. The area are shown. Assay controls include an empty vector, wild-type TET2 and a under the curve (AUC) was calculated for each MS/MS fragment. In the catalytically inactive (HxD) TET2 mutant (bottom left). A western case of 5-hmC, the slope was further adjusted because of quality control blot using anti-FLAG antibody to detect hTET2 in the above cells is analysis of an equimolar mixture of oligonucleotides, each containing also shown. Hsp90α/β was used as a loading control (bottom right). a single modification. e, Analysis of gDNA from individual biological Brightness and contrast were adjusted evenly across blots. b, Original, replicates within each HEK293T cell group. The top chart lists the raw uncropped DNA (left) and western (right) blots. A dilution series was AUCs that were converted to relative amounts of modified cytosine used for semiquantitative analysis of DNA methylation variants. (middle) according to their signal intensities from the respective standard Representative results of three independent experiments are shown. curves. The percentage of each modified cytosine calculated for each c, Validation of anti-FLAG and anti-Hsp90α/β antibodies. Serial dilutions sample is shown in the bottom chart. Results are from three independent of lysates (0.008, 0.04, 0.2, 0.8, 4.0 µg µl−1) obtained from HEK293T experiments. cells transfected with wild-type TET2. Gels were probed by western

a d

High-Confidence 10 CAR+ CAR- Peaks 8 )

2 10 I III 6 4 in CAR + NFY ELF1 II 8 GABPα Elk4 2 Elk1 Sp1 TF Motifs Gained CAR+ CAR- 0 1,548 13,201 816 6 -2 NFAT Bach2 IRF1 -4 NFκB Fold Enrichment 4 -6 CTCF in CAR + -8 TF Motifs Lost AT AC Peak Enrichment (Log -10 2 -50-40 -30 -20 -100 IIIIII -Log (P value) b 10

Pathways and processes associated with more open ATAC peak regions in CD8+ CAR+ compared to CD8+ CAR- T-cells from Patient 10

Regulation of mitotic cell cycle Regulation of mitotic nuclear division PID PLK1 Pathway T-cell receptor signaling pathway Glyoxylate metabolic process Carbohydrate derivative biosynthetic process Amide biosynthetic process Hallmark mTORC1 signaling Negative regulation of protein modification process Purine-containing compound catabolic process Cellular response to lipid Vitamin B6 metabolism Post-translational protein targeting to membrane Activation of store-operated calcium channel activity Regulation of Rho protein signal transduction Cellular response to DNA damage stimulus Protein targeting to ER Response to ionizing radiation Nucleus organization Viral process

-Log10(P value) c

Pathways and processes associated with more closed ATAC peak regions in CD8+ CAR+ compared to CD8+ CAR- T-cells from Patient 10

Leukocyte cell-cell adhesion Positive regulation of immune system process Hallmark TNFα signaling via NFκB Hallmark IL-2 STAT5 signaling Alpha-beta T-cell activation Cytokine production Myeloid cell differentiation Positive regulation of cell differentiation Regulation of cellular component movement Inflammatory response Calcineurin-regulated NFAT-dependent transcription in lymphocytes T-cell receptor signaling pathway Hallmark inflammatory response Leukocyte migration Negative regulation of immune system process Tissue remodeling Taxis IL-2 production Negative regulation of phosphorus metabolic process Circulatory system development

-Log10(P value) Extended Data Fig. 6 | See next page for caption.

Extended Data Fig. 6 | Global chromatin profiling of CAR+ and motifs in chromatin regions gained or lost in CAR+ compared to CAR− CAR− T cells from Patient-10. a, Venn diagrams of high-confidence T cells from Patient-10. Transcription factor motifs that were potentially differential ATAC–seq regions (left) and enrichment of those peaks in more accessible in increased ATAC–seq peaks of CAR+ T cells included regions of the diagrams (right) in CAR+ and CAR−CD8+ T cells expanded E26 transformation-specific (ETS) (GABPα, ELF1, Elk4) and zinc finger from Patient-10 (two biological replicates analysed in two independent (ZF) transcription factor (Sp1) binding sites that are known to be enriched experiments). Boxes extend from the 25th to 75th percentiles, the middle in human CD8+ T cells before differentiation occurs47. Transcription line denotes the median and whiskers show minimum and maximum. factor motifs that were potentially less accessible owing to reduced ATAC– b, Gene Ontology terms associated with chromatin regions that are seq peaks in CAR+ T cells from Patient 10 (NF-κB, IRF1, NFAT–AP1 and significantly more open in CD8+CAR+ T cells from Patient-10 compared CTCF) are enriched in terminally differentiated effector and exhausted to their matched CD8+CAR− T cell counterparts. c, Ontology analysis for T cells and have known key roles in forming the epigenetic landscape that chromatin regions that are less accessible in CD8+CAR+ T cells than in programs their biology38. CD8+CAR− T cells. d, Enrichment of transcription factor (TF) binding

a Patient-10 Day 73 Day 121Day 147 Day 442 Day 526

21% 92% 11%0%0% CD8+ CAR+

HLA-DR CD8

0% 1% 0% 65% 0% 8% 1% 15% 6% 17% T- cells

1% 97% 4% 31% 2% 90% 6% 78% 13%64% CCR7 CD45RO

105 5% 17% 3% 2% 3% 104

103 CD8+ CAR- T 102 0 HLA-DR 0103 104 105 CD8

105 18% 12% 12% 15% 11% 10% 25% 10% 35% 15% -cell s 104 103 102 0 38% 32% 33% 40% 42% 37% 41%24% 29%21% CCR7 0102 103 104 105 CD45RO

b CAR+ Partial Responder Pre-Infusion CAR- CAR+ CTL019 cells

105 20% 104 100% 103 CAR- 0 105 2% 8% 104 CAR 0103 104 105 Complete Responder 3 CD8 10 CAR- CAR+ 0 6% 84% 0103 104 105 Naive-like (CCR7+CD45RO-) CCR7 Central Memory (CCR7+CD45RO+) CD45RO Effector Memory (CCR7-CD45RO+) Effector (CCR7-CD45RO-) CAR

Complete Responder (Patient-1) Partial Responder

Pre-Infusion CAR- CAR+ CAR- CAR+ CTL019 cells

Complete Responder (Patient-2) Complete Responder

CAR- CAR+ CAR- CAR+ Copies/µg gDNA CAR Subset Frequency (% )

Time (Days) Extended Data Fig. 7 | The differentiation state of CAR T cells in frequencies of the gated cell populations. b, Example gating strategy Patient-10 compared to other responders over time. a, Representative used to determine the differentiation phenotype of CD8+CAR+ and contour plots of flow cytometric data depicting the frequency of CAR+ CAR− T cells from a complete responder (top left). Line graphs depict the and CAR−CD8+ T cells in Patient-10 that express HLA-DR. The differentiation state of these cell populations in other responding patients proportions of these cells that express CD45RO and CCR7 as determinants over time and are plotted with corresponding CAR T cell levels in the of differentiation status are shown. Contour plot insets indicate the blood, as determined by qPCR.

a b CD8+ CAR T-cells

P = 0.0057 Control 100 100 100 P = 0.0096 shRNA 4% 11% 75 75 75

50 50 50

Pre-gated: Effector 25 25 25 CD3+CD8+GFP+ Central Memory Effector Memory

5 24% 61% CAR+ CD8+ T Cells (% ) CAR+ CD8+ T Cells (% ) 0 0

10 CAR+ CD8+ T Cells (% ) 0 ControlTET2 Control TET2 Control TET2 104 TET2 shRNA shRNA shRNA 103 shRNA 0 CD4+ CAR T-cells 5 3 10 0% 55% -10 P = 0.0038 P = 0.0258 CAR 100 100 100 Forward scatter 104 103 75 75 75

0 1% 44% 50 50 50 3 0 3 4 5 CCR7 -10 10 10 10 Effector 25 25 25

CD45RO Central Memory Effector Memory

CAR+ CD4+ T Cells (% ) 0 CAR+ CD4+ T Cells (% ) 0 CAR+ CD4+ T Cells (% ) 0 Control TET2 Control TET2 Control TET2 shRNA shRNA shRNA cd

Variant 1 (Chromosome 4:106182915−106200958) 800

600 100

400 Control shRNA 75 TET2 shRNA 200

0 50 Variant 2 (Chromosome 4:106067032−106164808) ability (%) 800 Healthy Donor 1 Healthy Donor 2 Cell Vi 25 600 Healthy Donor 3

400 0 200 0712 17

TET2 mRNA (probe intensity) 0 Naive Stem Cell Central Effector Memory Memory Memory Time (Days)

Extended Data Fig. 8 | Effect of TET2 expression on T cell the expression levels of TET2 in naive and memory CD8+ T cell subsets differentiation and viability. a, Representative flow cytometry plots from three healthy donors. Two variants encoding different isoforms have showing the differentiation state of healthy donor CD8+CAR+ T cells after been identified for this gene in humans. Expression levels of each TET2 transduction with a scrambled shRNA (control) or shRNA targeting TET2. variant were estimated by measuring the probe intensity from microarray Insets define frequencies of gated populations. b, Frequencies of healthy analysis. d, Viability of CAR+ T cells transduced with a TET2 shRNA or subject CAR+CD8+ (top) and CAR+CD4+ (bottom) T cells according to scrambled control and restimulated with K562 cells expressing CD19 differentiation phenotype following control or TET2 shRNA transduction (n = 12; pooled results from three independent experiments). Each arrow (n = 10; pooled results from four independent experiments). P values were indicates the time point at which CAR T cells were exposed to antigen. determined using a two-tailed, paired Student’s t-test. c, Comparison of Error bars depict s.e.m.

a CD3CD4 CD8 CD3/CD28 Stimulation (6 Hours)

40 80 P = 0.0232 40 IFNγ ) P = 0.0401

(% P = 0.0388 TNFα P = 0.0512 Control shRNA TET2 shRNA 30 P = 0.0108 60 30 IL-2

14%8% -cells CD3/CD28 20 40 20 +T P = 0.0156 10 20 10

5 10 34% Cytokine 0 0 0 4 IFNγ 10 Control shRNA + - + - + - + - + - + - + - + - + - CD8 TET2 shRNA + + + + + + - + - + - + 103 ------

5 0 10 2% 15% CAR Stimulation (6 Hours) 4 10 CAR CAR 0103 104 105 40 40 40 ) 3

GFP (shRNA) 10 (% P = 0.0012 30 30 P = 0.0373 P = 0.0007 30 0 IL-2 -cells 3 4 5 20 20 20 010 10 10 +T CD4 10 10 10 Cytokine 0 0 0 Control shRNA + - + - + - + - + - + - + - + - + - TET2 shRNA - + - + - + - + - + - + - + - + - + bc CAR T-cell Re-stimulation

P = 0.0068 P = 0.0144 60000 Control shRNA TET2 shRNA ) 40000 (pg/ml γ

N 20000 Stimulation 1 Stimulation 2 Stimulation 3 IF shRNA Control TET2 Control TET2 Control TET2 IL-17A Inflammatory IL-10 Regulatory 0 IL-21 Stimulatory 1813 IL-4 Regulatory CCL20 Chemoattractive GM-CSF Stimulatory IL-33 Inflammatory 8000 IL-15 Stimulatory IL-2 Stimulatory TNFα Effector 6000 IL-9 Stimulatory IL-28A Stimulatory IL-23 Inflammatory (pg/m l) 4000

α P = 0.06

IL-25 Stimulatory F

IL-17F Inflammatory TN 2000 IL-12p70 Stimulatory IL-13 Regulatory IL-5 Stimulatory 0 IFNγ Effector 1813 IL-22 Regulatory TNFβ Effector IL-31 Inflammatory IL-1β Inflammatory IL-6 Inflammatory 60000 IL-27 Regulatory ) 40000 Cytokine Concentration (pg/ml) P = 0.0233

(pg/ml P = 0.0185

0 120,000 -2 20000 IL

0 1813

Day Extended Data Fig. 9 | See next page for caption.

Extended Data Fig. 9 | CAR T cell cytokine profiles following TET2 profiles for CAR T cells transduced with a TET2 shRNA or scrambled inhibition. a, Representative flow cytometry of acute intracellular control and serially restimulated with irradiated K562 cells expressing cytokine production by healthy donor (n = 6; three independent CD19 are shown. Colours represent scaled cytokine data corresponding experiments) CAR T cells transduced with a TET2 shRNA or a scrambled to each stimulation time point. Hierarchal clustering was used to generate control shRNA (left). Production of IFNγ, TNFα and IL-2 by total CD3+, the cluster dendrogram and cytokine response groups. c, Production of CD4+ and CD8+ CAR T cells is shown. These cells were stimulated with IFNγ (top), TNFα (middle) and IL-2 (bottom) by TET2 knockdown or beads coated with anti-CD3 and anti-CD28 antibodies (top right) or control CAR T cells (n = 6; three independent experiments) following CAR anti-idiotypic antibodies (bottom right). Boxes represent the 25th to restimulation with CD19 antigen. Black arrows indicate when CAR T cells 75th percentiles, the middle line denotes the median and whiskers depict were exposed to CD19-expressing K562 cells. Error bars denote s.e.m. All minimum and maximum. b, Heat map and cluster analysis of cytokine P values were determined using a two-tailed, paired Student’s t-test.

a Control shRNA TET2 shRNA Unstimulated 7% 11% CD3/CD28 CAR P = 0.0597 P = 0.0040 100

48% 53% CD3/CD28 ) 50

25 CAR+ CD8+ CD107a+ 105 26% 45%

104 CA R 0 103 ControlTET2 ControlTET2

0 (% shRNA shRNA CD107a 0103 104 105 CD8

100 Control P = 0.0270 P = 0.0052 80 TET2 60 25000 7500 40 20 20000

0 5000 -103 0 103 104 105 15000 Granzyme B 100 10000 2500

80 Perforin in CD8+ (MFI) 60 Granzyme B in CD8+ (MFI) 5000 40 0 0 % 20 ControlTET2 ControlTET2 of 0 Maximum 0103 104 105 shRNA shRNA Perforin

OSU-CLLNALM-6 P = 0.0369 Control shRNA CTL019 cells 100 P = 0.0023 P = 0.0611 P = 0.0066 TET2 shRNA CTL019 cells 80 P = 0.0456 Untransduced T-cells ysi s P = 0.0091 60 cL P = 0.0215

40 P = 0.0643 P = 0.0476 pecifi

%S 20 P = 0.4226

0 1:10 1:31:1 3:110:1 1:10 1:31:1 3:110:1 Effector:Target Ratio Extended Data Fig. 10 | Effect of TET2 knockdown on the cytotoxic Pooled data from CAR T cells of n = 5 healthy donors are summarized on machinery of CAR T cells. a, Flow cytometry plots showing the frequency the right. c, Cytotoxic capacity of CTL019 cells (transduced with a TET2 of TET2 knockdown or control CAR T cells expressing CD107a (a marker or scrambled control shRNA) after overnight co-culture with luciferase- of cytolysis) following CD3 and CD28 or CAR-specific stimulation (left). expressing OSU-CLL (left) or NALM-6 (right) cells. Untransduced T cells Summarized data from analysis of CAR T cells manufactured from n = 6 were included as an additional group to control for non-specific lysis. different healthy donors is shown (right). b, Representative histograms P values were determined using a two-tailed, paired Student’s t-test. All illustrating expression levels of granzyme B and perforin in CAR T cells in data were pooled from three independent experiments. the setting of TET2 inhibition as compared to its counterpart control (left).

ab CAR- CAR+ CAR- CAR+ CAR- CAR+

CAR- 12% 88% CAR- 58% 89% 60% 12% Patient-1 0 CAR+ CAR+ Responde r (Patient-1) 56% 89% 71% 96% 69% 70% Complete Responde r (Patient-2) Complete 1% 7% 91% 100% 40% 39% Responde r (Patient-9 ) 100 105 0.5% 1% 99% 100% 69% 74% Complete 80 104 60 40 103 20 0 % of % of 0 Ki-67 CD27 KLRG1 Maximum 0102 103 104 105 0102 103 104 105 Maximum Granzyme B Granzyme B Eomes CD8 Extended Data Fig. 11 | Effector and memory molecule expression by complete responders. b, Representative histograms of intracellular Eomes CAR T cells from Patient-10 compared to those from other responding expression (left), and contour plots depicting frequencies of CD27- subjects. a, Expression of granzyme B (left) and the frequency of CAR− (middle) and KLRG1-expressing (right) lymphocytes in the same cell and CAR+ T cells co-expressing granzyme B/Ki-67 (right panel) at the populations of these patients. These results are representative of three peak of in vivo CTL019 expansion in Patient-10 compared to three other experiments repeated independently with comparable findings.

Jan Joseph Melenhorst, Ph.D. and Carl H. Corresponding author(s): June, M.D. Initial submission Revised version Final submission Life Sciences Reporting Summary Nature Research wishes to improve the reproducibility of the work that we publish. This form is intended for publication with all accepted life science papers and provides structure for consistency and transparency in reporting. Every life science submission will use this form; some list items might not apply to an individual manuscript, but all fields must be completed for clarity. For further information on the points included in this form, see Reporting Life Sciences Research. For further information on Nature Research policies, including our data availability policy, see Authors & Referees and the Editorial Policy Checklist.

` Experimental design 1. Sample size Describe how sample size was determined. The current study is a secondary investigation using patient samples collected from existing clinical trials. Therefore, the sample sizes in this report were determined by the original clinical trial designs and sample availability 2. Data exclusions Describe any data exclusions. Please see the above response. No additional inclusion/exclusion criteria were applied. 3. Replication Describe whether the experimental findings were All in vitro experiments were repeated with primary cells from different subjects in reliably reproduced. each separate experimental run. All attempts at replication of these experiments were successful. 4. Randomization Describe how samples/organisms/participants were The clinical trials were single-treatment studies; the comparison groups of patients allocated into experimental groups. in the current study were defined by the observed clinical responses. 5. Blinding Describe whether the investigators were blinded to Investigators were blinded to clinical responses as correlative assays were group allocation during data collection and/or analysis. conducted using de-identified subject samples. Note: all studies involving animals and/or human research participants must disclose whether blinding and randomization were used.

6. Statistical parameters For all figures and tables that use statistical methods, confirm that the following items are present in relevant figure legends (or in the Methods section if additional space is needed). n/a Confirmed

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement (animals, litters, cultures, etc.) A description of how samples were collected, noting whether measurements were taken from distinct samples or whether the same sample was measured repeatedly A statement indicating how many times each experiment was replicated The statistical test(s) used and whether they are one- or two-sided (note: only common tests should be described solely by name; more complex techniques should be described in the Methods section) A description of any assumptions or corrections, such as an adjustment for multiple comparisons

The test results (e.g. P values) given as exact values whenever possible and with confidence intervals noted June 2017 A clear description of statistics including central tendency (e.g. median, mean) and variation (e.g. standard deviation, interquartile range) Clearly defined error bars

See the web collection on statistics for biologists for further resources and guidance.

1 ` Software nature research | life sciences reporting summary Policy information about availability of computer code 7. Software Describe the software used to analyze the data in this Flow cytometry data were analyzed using FlowJo software. For ATAC Seq. data, study. BedTools, HOMER and Metascape were used. Analysis of TCR VB and BCR IgH sequencing was done using the ImmunoSeq Analyzer.

For manuscripts utilizing custom algorithms or software that are central to the paper but not yet described in the published literature, software must be made available to editors and reviewers upon request. We strongly encourage code deposition in a community repository (e.g. GitHub). Nature Methods guidance for providing algorithms and software for publication provides further information on this topic.

` Materials and reagents Policy information about availability of materials 8. Materials availability Indicate whether there are restrictions on availability of B. Jena and L. Cooper (MD Anderson Cancer Center) provided the CAR anti- unique materials or if these materials are only available idiotype detection reagent. for distribution by a for-profit company. 9. Antibodies Describe the antibodies used and how they were validated Information about flow cytometry antibodies can be found in the methods section. for use in the system under study (i.e. assay and species). All clinical and research samples were analyzed in the Product Development and Correlative Sciences laboratories at the University of Pennsylvania and antibodies were validated in these laboratories. Western blot antibodies against FLAG and Hsp90 were validated using serial dilutions of HEK293T cell lysates as shown in Supplementary Figure 1c. 10. Eukaryotic cell lines a. State the source of each eukaryotic cell line used. NALM-6, K562 and HEK293T cell lines were originally obtained from the American Type Culture Collection (ATCC). The OSC-CLL line was derived and provided by investigators at Ohio State University.

b. Describe the method of cell line authentication used. Cell line authentication was performed by the University of Arizona (USA) Genetics Core based on criteria established by the International Cell Line Authentication Committee. Short tandem repeat (STR) profiling revealed that these cell lines were above the 80% match threshold.

c. Report whether the cell lines were tested for Low passage working banks of cells were tested for mycoplasma using the mycoplasma contamination. MycoAlert detection kit according to the manufacturer’s (Lonza) instructions. Mycoplasma testing and authentication are routinely performed before and after molecular engineering.

d. If any of the cell lines used are listed in the database NALM-6, OSU-CLL, K562 and HEK293T cell lines are not listed in the latest version of commonly misidentified cell lines maintained by of the database of commonly misidentified cell lines maintained by ICLAC (Version ICLAC, provide a scientific rationale for their use. 8.0, released 1 December 2016).

` Animals and human research participants Policy information about studies involving animals; when reporting animal research, follow the ARRIVE guidelines 11. Description of research animals Provide details on animals and/or animal-derived N/A materials used in the study.

Policy information about studies involving human research participants 12. Description of human research participants June 2017 Describe the covariate-relevant population We did not perform covariate analyses in this secondary correlative investigation. characteristics of the human research participants.

2 November 2017 nature research | flow cytometry reporting summary 1 s of Jan Joseph Melenhorst, Ph.D. and Carl H. June, Carl H. June, Ph.D. and Melenhorst, Jan Joseph M.D. Corresponding author(s): Corresponding Data were analyzed using FlowJo software (TreeStar). Data were analyzed using FlowJo software flow plot (insets). Cell frequencies/abundances are listed in the Gating strategies are depicted in Extended Data Figure 2. Primary human PBMC or T-cells were isolated from the peripheral blood of CLL Primary human PBMC or T-cells were isolated was performed by surface patients and healthy donors. Immunophenotyping following pre-incubation with staining with flow cytometry antibodies immediately For intracellular staining, cells were Aqua Blue dead cell exclusion dye (Invitrogen). Kit fixed and permeabilized using the Foxp3 Fixation/Permeabilization Biosciences). The GolgiStop protein (eBioscience) or the Cytofix/Cytoperm Kit (BD GolgiPlug protein transport inhibitor transport inhibitor containing monensin and used when staining for intracellular containing brefeldin A (BD Biosciences) were cytokine production. 19-parameter special order Samples were acquired on a custom 17-color, of the expansion and LSRFortessa (BD Biosciences). Routinemeasurements B-CLL burden were conducted with persistence of CAR T-cells, as well as peripheral Biosciences). a six-parameter Accuri C6 flow cytometer (BD

identical markers).

populations within post-sort fractions. the flow cytometry data. Methodological details Data presentation 4. A numerical value for number of cells or percentage (with statistics) is provided. for number of cells or percentage (with 4. A numerical value 2. The axis scales are clearly visible. Include numbers along axes only for bottom left plot of group (a 'group' is an analysi axes only for bottom left plot of group clearly visible. Include numbers along 2. The axis scales are plots. plots with outliers or pseudocolor 3. All plots are contour 1. The axis labels state the marker and fluorochrome used (e.g. CD4-FITC). the marker and fluorochrome used 1. The axis labels state

Tick this box to confirm that a figure exemplifying the gating strategy is provided in the Supplementary Information. Tick this box to confirm that a figure exemplifying the gating strategy is provided

9. Describe the gating strategy used. 8. Describe the abundance of the relevant cell 8. Describe the abundance of the relevant

7. Describe the software used to collect and analyze 7. Describe the software used to collect 6. Identify the instrument used for data collection. 6. Identify the instrument used for data

5. Describe the sample preparation. For all flow cytometry data, confirm that: For all flow cytometry

` `

Form fields will expand as needed. Please do not leave fields blank. Please do not will expand as needed. Form fields Flow Cytometry Reporting Summary Reporting Cytometry Flow