DOCSLIB.ORG

I STUDIES on the COORDINATION CHEMISTRY of VANADIUM

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
I STUDIES on the COORDINATION CHEMISTRY of VANADIUM STUDIES ON THE COORDINATION CHEMISTRY OF VANADIUM, BARIUM AND COBALAMINS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Riya Mukherjee May, 2011 i Dissertation written by Riya Mukherjee B.Sc., University of Calcutta, Calcutta, India, 2000 M.Sc., University of Calcutta, Calcutta, India, 2002 Ph.D., Kent State University, 2011 Approved by ___________________________________ , Chair, Doctoral Dissertation Committee Nicola E. Brasch, Ph.D. ___________________________________ , Advisor, Doctoral Dissertation Committee Nicola E. Brasch, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Scott D. Bunge, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Derek S. Damron, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Soumitra Basu, Ph.D. ___________________________________, Graduate Faculty Representative John R. D. Stalvey, Ph.D. Accepted by _______________________________, Chair, Department of Chemistry & Biochemistry Michael J. Tubergen, Ph.D. ___________________________________ , Dean, College of Arts and Sciences John R. D. Stalvey, Ph.D. ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………………..X LIST OF TABLES…………………………………………………………………..XVII LIST OF SCHEMES……………………………………………………………….....XX DEDICATION…………………………………………………………………...…..XXII ACKNOWLEDGEMENTS………………………………………………………..XXIII ABSTRACT……………………………………………………………………….....XXV LIST OF PUBLICATIONS…………………………………………………..……..XXX CHAPTER 1: INTRODUCTION AND BACKGROUND….………………………..1 1.1.Vitamin B12 (cobalamin)……………………………………………………………....1 1.1.1. B12−dependent enzyme reactions……………………………………………....1 1.1.2. Absorption, transport, cellular uptake and intracellular processing of cobalamins……………………………………………………….......................4 1.1.3. Structure………………………………………………………………………..5 1.1.4. Oxidation states of the cobalt atom in cobalamins……………………………..7 1.1.5. Abiological syntheses of cobalamins…………………………………………...8 1.1.6. Characterization of cobalamins…………………………………………………9 1.1.6.1. X−ray crystallography……………………………………………………...9 1.1.6.2. Spectroscopic techniques………………………………………………….10 1.1.7. Non−enzymatic roles of cobalamins in alleviating chronic inflammation……13 iii 1.2. Vitamin B12−bioconjugates in targeted drug delivery………………………………14 1.3. Coordination chemistry of vanadium……………………………………………….16 1.3.1. Vanadium complexes formed in aqueous solution……………………………18 1.3.2. Vanadium in biology and medicine…………………………………………...20 CHAPTER 2: STRUCTURAL AND SPECTROSCOPIC EVIDENCE FOR THE FORMATION OF POLYNUCLEAR V(III)/CARBOXYLATO COMPLEXES IN AQUEOUS SOLUTION….………………………….22 2.1. Introduction…………………………………………………………………………22 2.2. Experimental………………………………………………………………………...24 2.2.1. Materials……………………………………………………………………….24 2.2.2. Instrumentation and Procedures…………………………………...…………..25 2.2.3. Preparation of V(III)/carboxylato solutions for NMR and UV−visible spectrosopic measurements………………………………………26 2.2.4. PFG−NMR diffusion coefficient measurements……………………………...27 3+ 2.2.5. Syntheses of complexes [V3(3−O)(−OOCCH2Br)6(OH2)3] (1) 3+ and [V3(3−O)(−OOCCH2CH3)6(OH2)3] (2) in aqueous solution………...27 2.2.6. X−ray crystallography experiment…………………………………………….28 2.3. Results and discussion……………………………………………………...………30 2.3.1. Syntheses and characterization of complexes 1 and 2 by X-ray crystallography………………………………………………………….30 2.3.2. NMR spectroscopic studies on the formation of V(III)/carboxylato complexes in aqueous solution………………………………………………………….....34 2.3.3. UV-visible spectroscopic studies on the formation of V(III)/carboxylato complexes in aqueous solution……………………………44 iv 2.4. Summary…………………………………………………………………………....48 CHAPTER 3: SELF−ASSEMBLY OF A NOVEL TWO−DIMENSIONAL BARIUM/THIODIACETATE COORDINATION POLYMER IN AQUEOUS SOLUTION……………………………………………....51 3.1 Introduction…………………………………………………………………………..51 3.2. Experimental………………………………………………………………………...52 3.2.1. Materials………………………………………………………………………..52 3.2.2. Instrumentation………………………………………………………………....53 3.2.3. Synthesis of {Ba[S(CH2COO)2(H2O)3]•2H2O}(1)………………………….....54 3.2.4. X−ray crystallography………………………………………………………….54 3.3. Results and discussion………………………………………………………………57 3.3.1. Synthesis and characterization of 1…………………………………………….57 3.3.2. Structural characterization of 1 by X−ray diffraction…………………………..61 3.4. Summary…………………………………………………………………………….66 CHAPTER 4: STUDIES ON VANADIUM−VITAMIN B12 BIOCONJUGATES INCORPORATING A HYDROXYPYRIDINONE LINKER AS POTENTIAL THERAPEUTICS FOR TREATING DIABETES…………………………………………………………….68 4.1. Introduction………………………………………………………………………....68 4.2. Experimental………………………………………………………………………..71 4.2.1. Materials………………………………………………………………………71 4.2.2. Instrumentation………………………………………………………………..71 4.2.3. PFG−NMR diffusion coefficient measurement………………………………73 v 4.2.4. Attempted separation of complexes 2 (VO2(OH/H)2L) and 3 (VO2L2) by chromatography…………………………………………………………………73 4.2.5. In−vivo blood glucose lowering properties in the STZ−rat model for Type 1 diabetes…………………………………………………………………………..74 4.3. Results and discussion………………………………………………………………75 4.3.1. Characterization of complex 1 (3−(3−hydroxy−2−methyl−1H−pyridin−4−one) 1 propylcobalamin) by H NMR and UV-visible spectroscopy……………….....75 4.3.2 Systematic study of the binding of NaVO3 to 1 by NMR, UV-vis and FTIR spectroscopy…………………………………………………………………….78 4.3.3. Measurements of the diffusion coefficients of complexes 2 and 3 by PFG NMR experiments……………………………………………………………………..86 4.3.4 In vivo blood glucose−lowering properties complex 2 in the STZ−rat model for Type 1 diabetes………………………………………………………………….88 4.4. Summary…………………………………………………………………….............90 CHAPTER 5: SYNTHESIS, SYNCHROTRON X−RAY DIFFRACTION AND KINETIC STUDIES ON THE FORMATION AND DECOMPOSITION OF A NOVEL THIOLATOCOBALAMIN OF CAPTOPRIL…………………………………………………………..92 5.1. Introduction…………………………………………………………………………92 5.2. Experimental………………………………………………………………………...94 5.2.1. Materials………………………………………………………………………..94 5.2.2. Instrumentation………………………………………………………………...95 5.2.3. Synthesis of CapSCbl………………………..………………………………...96 5.2.4. Crystallization of CapSCbl…………………………………………………….97 5.2.5. X−ray diffraction studies on CapSCbl………………………………………....97 vi 5.2.6. Kinetic measurements on the formation of CapSCbl from aquacobalamin/ hydroxycobalamin and captopril……………………………………………....101 5.2.7. Kinetic measurements on the acid−catalyzed decomposition of CapSCbl…...102 5.3. Results and discussion……………………………………………………………..103 5.3.1. Synthesis and characterization of CapSCbl…………………………………...103 5.3.2. Evidence of cis−trans isomerization of the captopril ligand in CapSCbl by 1H NMR spectroscopy………………………………………………………...106 5.3.3. Further characterization of CapSCbl by X−ray crystallography……...……....111 5.3.3.1. Evidence for the cis−trans isomerization of the captopril ligand in CapSCbl in the solid state…………………………………………….....114 5.3.3.2. Crystal packing in CapSCbl……………………………………………..115 5.3.4. Kinetic studies on the formation of CapSCbl…………………………………118 5.3.5. Kinetic studies on the acid−catalyzed decomposition of CapSCbl in aqueous solution………………………………………………………………………...126 5.4. Summary…………………………………………………………………………...131 CHAPTER 6: KINETIC STUDIES ON THE REACTION OF COB(II)ALAMIN WITH PEROXYNITRITE………………………………………….133 6.1. Introduction………………………………………………………………………...133 6.2. Experimental……………………………………………………………………….136 6.2.1. Materials………………………………………………………………………136 6.2.2. Instrumentation………………………………………………………………..136 6.2.3. Synthesis of Na+ONOO−……………………………………………………...138 6.2.4. Synthesis of cob(II)alamin (Cbl(II))…………………………………………..139 vii 6.2.5. Solution preparation…………………………………………………………...139 6.2.6. Determination of the stoichiometry of the reaction between Cbl(II) and ONOO(H)……………………………………………………………………..140 6.2.7. Kinetic measurements on the reaction of Cbl(II) with ONOO(H)……………140 6.2.8. Generation of the calibration curves for 3−nitrotyrosine and 3−hydroxytyrosine ................................................................................................................................141 • 6.2.9. Reaction of Cbl(II) with NO2 ………………………………………………...141 6.3. Results and discussion……………………………………………………………..142 6.3.1. Determination of the acid dissociation constant and the rate constant for spontaneous decomposition of ONOOH…………………………………….142 6.3.2. Determination of the molar extinction coefficients of Cbl(II)……………….144 6.3.3. Determination of the reaction stoichiometry………………………………...144 6.3.4. Kinetic studies on the reaction between Cbl(II) and ONOO(H)…………….149 6.3.5. Studies on the reaction between Cbl(II) and peroxynitrite in the presence of tyrosine……………………………………………………………………….157 6.3.6. Attempt to determine the rate constant of the reaction between Cbl(II) and • NO2 (g)……………………………………………………………………....164 6.4. Summary………………………………………………………………………….167 CHAPTER 7: KINETIC AND MECHANISTIC STUDIES ON THE REACTION BETWEEN COB(I)ALAMIN AND PEROXYNITRITE………...169 7.1. Introduction………………………………………………………………………..169 7.2. Experimental……………………………………………………………………….170 7.2.1. Materials………………………………………………………………………170 7.2.2. Instrumentation………………………………………………………………..170 viii 7.2.3. Synthesis of cob(I)alamin (Cbl(I))…………………………………………….170 7.2.4. Preparation of solutions……………………………………………………….171 7.2.5. Determination of the stoichiometry of the reaction between Cbl(I) and ONOO(H)……………………………………………………………………..172 7.2.6. Cbl(I) does not react with fully decomposed ONOO(H)……………………...172 − 7.2.7. Determining the amount
Load more

Recommended publications
  • Acid Dissociation Constant - Wikipedia, the Free Encyclopedia Page 1
    Acid dissociation constant - Wikipedia, the free encyclopedia Page 1 Help us provide free content to the world by donating today ! Acid dissociation constant From Wikipedia, the free encyclopedia An acid dissociation constant (aka acidity constant, acid-ionization constant) is an equilibrium constant for the dissociation of an acid. It is denoted by Ka. For an equilibrium between a generic acid, HA, and − its conjugate base, A , The weak acid acetic acid donates a proton to water in an equilibrium reaction to give the acetate ion and − + HA A + H the hydronium ion. Key: Hydrogen is white, oxygen is red, carbon is gray. Lines are chemical bonds. K is defined, subject to certain conditions, as a where [HA], [A−] and [H+] are equilibrium concentrations of the reactants. The term acid dissociation constant is also used for pKa, which is equal to −log 10 Ka. The term pKb is used in relation to bases, though pKb has faded from modern use due to the easy relationship available between the strength of an acid and the strength of its conjugate base. Though discussions of this topic typically assume water as the solvent, particularly at introductory levels, the Brønsted–Lowry acid-base theory is versatile enough that acidic behavior can now be characterized even in non-aqueous solutions. The value of pK indicates the strength of an acid: the larger the value the weaker the acid. In aqueous a solution, simple acids are partially dissociated to an appreciable extent in in the pH range pK ± 2. The a actual extent of the dissociation can be calculated if the acid concentration and pH are known.
    [Show full text]
  • Determination of Binding Constant and Stoichiometry for Antibody-Antigen Interaction with Surface Plasmon Resonance
    Current Proteomics, 2006, 3, 271-282 271 Determination of Binding Constant and Stoichiometry for Antibody-Antigen Interaction with Surface Plasmon Resonance Shiming Lin1,3,*, Adam Shih-Yuan Lee2, Chih-Chen Lin2 and Chih-Kung Lee3 1Centre for Optoelectronic Biomedicine, National Taiwan University, Taipei, Taiwan; 2Department of Chemistry, Tamkang Univer- sity, Tamsui, Taiwan and 3Institute of Applied Mechanics, National Taiwan University, Taipei, Taiwan Abstract: A surface plasmon resonance (SPR) biosensor technology has recently been applied biochemically and clinically to the study of immunologic recognition and the evaluation of binding parameters for various interactions between antibodies (Abs) and antigens (Ags) at liquid-solid interface. The simple interaction between hapten and Ab fragment, e.g., variable single-chain fragment and antigen- binding fragment, can be described sufficiently by a 1:1 stoichiometry in SPR. However, the determination of the binding constant of an anti-protein Ab is usually complicated by the multivalence of the protein Ag. The SPR-based method enables direct determination of binding constants for a variety of specific Ab-Ag interactions in real-time. It also allows estimation of the binding stoichiometry and binding ratio for low-, intermediate-, and high-affinity Ab-Ag interaction systems. The present review is designed to indicate the theo- retical background of SPR-based biosensor technology as well as to present the great variety of measurement modes of interaction kinet- ics that can be performed with these techniques. Quantitative aspects of the Ab-Ag interaction kinetics are reviewed, focusing especially on mono- and multi-valent Ab-Ag interaction modes using a SPR biosensor. Four model binding systems developed recently for use with SPR biosenser are described with principles and examples: (i) one to one interaction mode, (ii) nonequivalent two-site interaction mode, (iii) multiple equivalent-site interaction mode and (iv) multisite interaction mode.
    [Show full text]
  • Preparation and Spectral Properties of Oxomolybdenum(V) Complexes. Harry Edmond Pence II Louisiana State University and Agricultural & Mechanical College
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1968 Preparation and Spectral Properties of Oxomolybdenum(v) Complexes. Harry Edmond Pence II Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Pence, Harry Edmond II, "Preparation and Spectral Properties of Oxomolybdenum(v) Complexes." (1968). LSU Historical Dissertations and Theses. 1411. https://digitalcommons.lsu.edu/gradschool_disstheses/1411 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. This dissertation has been microfilmed exactly as received 68-10,753 PENCE n , Harry Edmond, 1937- PREPARATION AND SPECTRAL PROPERTIES OF OXOMOLYBDENUM(V) COMPLEXES. Louisiana State University and Agricultural and Mechanical College, Ph.D., 1968 Chemistry, inorganic University Microfilms, Inc., Ann Arbor, Michigan PREPARATION AND SPECTRAL PROPERTIES OF OXOMOLYBDENUM ( V) COMPLEXES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Chemistry by Harry Edmond Pence II B.S., Bethany College, Bethany, W.Va., 1958 M.S., West Virginia University, Morgantown, W.Va., 1962 February, 1968 To Ginn ACKNOWLEDGMENTS The final creation of this dissertation has been assisted by many different individuals and it is appropriate to attempt to indicate some of these contributors and offer the sincere thanks of the author,, The most important component of this assistance has been the continual encouragement offered by parents and family.
    [Show full text]
  • Amavadin- BASED VANADIUM COMPLEXES STRUCTURAL INVESTIGATIONS TON HUBREGTSE STRUCTURALINVESTIGATIONS
    amavadin- BASED VANADIUM COMPLEXES STRUCTURAL INVESTIGATIONS TON HUBREGTSE STRUCTURAL INVESTIGATIONS STRUCTURAL UITNODIGING VOOR HET BIJWONEN VAN DE OPENBARE VERDEDIGING VAN HET PROEFSCHRIFT OF EN DE STELLINGEN OP AMAVADIN-BASED VANADIUM COMPLEXES VANADIUM AMAVADIN-BASED DINSDAG 17 APRIL 2007 OM 12.30 UUR IN DE SENAATSZAAL ITNODIGING VAN DE TECHNISCHE UNIVERSITEIT DELFT U MEKELWEG 5 DELFT Voorafgaand aan de verdediging is er om 12.00 uur een toelichting voor niet-chemici. Na afloop van de plechtigheid bent u van harte welkom op de receptie in hetzelfde gebouw. Ton Hubregtse Anna Blamanlaan 8 2104 SE Heemstede 023-5283330 [email protected] T PARANIMFEN: . HUBREGTSE Huub Hubregtse [email protected] 06-46277320 Robert de Vries 2007 [email protected] belonging to the thesis ‘Structural investigations of amavadin-based vanadium complexes’ by Ton Hubregtse 1. Strongly acidic ion-exchange resins should not be used to purify molecules that rely on non-covalent bonds. E. M. Armstrong; D. Collison; N. Ertok; C. D. Garner, Talanta , 2000 , 53 , 75–87. H. Kneifel; E. Bayer, J. Am. Chem. Soc. , 1986 , 108 , 3075–3077. 2. The rule that states that the exception proves the rule is proven because there is no exception to this rule that can prove it. 3. The NMR data of Smith et al. can much better be explained when it is considered, given the three possible ligand stereoisomers and the two possible vanadium configurations, that six enantiomeric pairs of the [V( R,S-hidba) 2]-anion can be formed instead of three. P. D. Smith et al. , J. Chem. Soc., Dalton Trans. , 1997 , 4509–4516.
    [Show full text]
  • Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R
    Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R. Sanders, Dept. of Biochemistry, Vanderbilt University (Updated 3/2017) Table of Contents Introduction 1 The simplest case: 1:1 stoichiometry 3 A short introduction to binding kinetics 3 The variables of binding studies 5 Relationship between thermodynamics and kinetics of binding 5 The attractiveness of studying binding using pure ligand(s) and receptor 7 The model for 1:1 binding 7 Fitting a model to data 9 A little more on 1:1 binding 9 Alternatives to direct and Scatchard plots 11 Measuring concentrations in binding studies 12 What if the receptor/ligand system is more complicated than 1:1? 13 Multiple sites for a single ligand, Kd some for all and constant 13 When 1 ligand binds to multiple receptors 14 Multiple equivalent sites that are homocooperative 15 Heterocooperativity 18 Two ligands compete for the same binding site 19 Survey of methods used to monitor binding 20 Equilibrium dialysis 21 Spectroscopic methods 21 UV spectrophotometry 21 Fluorescence 21 NMR 21 Circular dichroism 21 Binding/Dissociation is slow on spectroscopic time scale 21 Binding/Dissociation is fast on spectroscopic time scale 22 Enzyme kinetics and dose/response pharmacology 23 Calorimetry 24 Chromatographic methods 24 Filter-based methods 25 Gel mobility shift assays 26 Ligand competition assays 27 Checklist of system variable to consider when planning binding studies 28 Checklist of experimental variables to consider when planning binding studies 29 Acid/Base equilibria 30 Strong acids and bases 31 Weak acids and bases 31 Buffers 33 Choice of a buffer 34 Buffer table 37 Buffers: a summary 38 Chelating agents 38 Chelating agent table 39 Concentration units when working with membrane proteins and/or 40 membrane associated ligands.
    [Show full text]
  • Molecular Electronic Structures of Transition Metal Complexes I
    Structure and Bonding 142 Molecular Electronic Structures of Transition Metal Complexes I Bearbeitet von Peter Day, Jens Peder Dahl, David Michael P. Mingos 1. Auflage 2012. Buch. xvi, 216 S. Hardcover ISBN 978 3 642 27369 8 Format (B x L): 15,5 x 23,5 cm Gewicht: 514 g Weitere Fachgebiete > Chemie, Biowissenschaften, Agrarwissenschaften > Analytische Chemie > Komplexchemie Zu Inhaltsverzeichnis schnell und portofrei erhältlich bei Die Online-Fachbuchhandlung beck-shop.de ist spezialisiert auf Fachbücher, insbesondere Recht, Steuern und Wirtschaft. Im Sortiment finden Sie alle Medien (Bücher, Zeitschriften, CDs, eBooks, etc.) aller Verlage. Ergänzt wird das Programm durch Services wie Neuerscheinungsdienst oder Zusammenstellungen von Büchern zu Sonderpreisen. Der Shop führt mehr als 8 Millionen Produkte. Struct Bond (2012) 142: 17–28 DOI: 10.1007/430_2011_55 # Springer-Verlag Berlin Heidelberg 2011 Published online: 6 October 2011 Electronic Structures of Oxo-Metal Ions Jay R. Winkler and Harry B. Gray Abstract The dianionic oxo ligand occupies a very special place in coordination chemistry, owing to its ability to donate p electrons to stabilize high oxidation states of metals. The ligand field theory of multiple bonding in oxo-metal ions, which was formulated in Copenhagen 50 years ago, predicts that there must be an “oxo wall” between Fe–Ru–Os and Co–Rh–Ir in the periodic table. In this tribute to Carl Ballhausen, we review this early work as well as new developments in the field. In particular, we discuss the electronic structures of beyond-the-wall (groups 9 and 10) complexes containing metals multiply bonded to O- and N-donor ligands.
    [Show full text]
  • Analysis of Linked Equilibria
    CHAPTER SEVEN Analysis of Linked Equilibria JiaBei Lin, Aaron L. Lucius1 Department of Chemistry, The University of Alabama at Birmingham, Birmingham, Alabama, USA 1Corresponding author: e-mail address: [email protected] Contents 1. Introduction 161 2. Determination of Ln,0 for an Assembling System 168 3. Global Fitting of Sedimentation Velocity Data as a Function of Protein Concentration Kinetic Considerations 169 4. Global Analysis Using the 1-2-4-6 Model with Rapid Dissociating Oligomers 175 5. Global Analysis Using the 1-2-4-6 Model with Slow Dissociation of Oligomers 180 6. Global Analysis with Rate Constants in the Detectable Range 181 7. Conclusions 183 References 185 Abstract The ATPases associated with diverse cellular activities (AAA+) is a large superfamily of proteins involved in a broad array of biological processes. Many members of this family require nucleotide binding to assemble into their final active hexameric form. We have been studying two example members, Escherichia coli ClpA and ClpB. These two enzymes are active as hexameric rings that both require nucleotide binding for assem- bly. Our studies have shown that they both reside in a monomer, dimer, tetramer, and hexamer equilibrium, and this equilibrium is thermodynamically linked to nucleotide binding. Moreover, we are finding that the kinetics of the assembly reaction are very different for the two enzymes. Here, we present our strategy for determining the self-association constants in the absence of nucleotide to set the stage for the analysis of nucleotide binding from other experimental approaches including analytical ultracentrifugation. 1. INTRODUCTION Determining a binding constant for a protein–ligand interaction is quite possibly one of the most common experiments in biophysics.
    [Show full text]
  • Spectral Studies on Vanadyl Complexes. Thomas Russell Ortolano Louisiana State University and Agricultural & Mechanical College
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1964 Spectral Studies on Vanadyl Complexes. Thomas Russell Ortolano Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Ortolano, Thomas Russell, "Spectral Studies on Vanadyl Complexes." (1964). LSU Historical Dissertations and Theses. 992. https://digitalcommons.lsu.edu/gradschool_disstheses/992 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. This dissertation has been 65-3391 microfilmed exactly as received ORTOLANO, Thomas Russell, 1938- SPECTRAL STUDIES ON VANADYL COMPLEXES Louisiana State University, Ph.D., 1964 Chemistry, inorganic University Microfilms, Inc., Ann Arbor, Michigan SPECTRAL STUDIES ON VANADYL COMPLEXES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial- fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Chemistry by Thomas Russell Ortolano •S., Loyola University of the South, 1960 August, 1964 ACKNOWLEDGMENTS The writer wishes to express his sincere appreciation to Dr. Joel Selbin, under whose direction this work was per­ formed, for his helpful guidance throughout the course of these investigations. In addition, he would like to thank Dr. Sean P. McGlynn who served as his temporary advisor this past year while Dr. Selbin was on Sabbatical Leave in Rome. Considerable gratitude is also due his wife, June, for her two and a half years of patience and encouragement.
    [Show full text]
  • Uranium and Vanadium Binding Studies for the Selective Extraction of Uranium from Seawater
    Uranium and vanadium binding studies for the selective extraction of uranium from seawater By Bernard Frederick Parker A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor John Arnold, Chair Professor T. Don Tilley Professor Alexander Katz Summer 2017 1 Abstract Uranium and vanadium binding studies for the selective extraction of uranium from seawater by Bernard Frederick Parker Doctor of Philosophy in Chemistry University of California, Berkeley Professor John Arnold, Chair Chapter 1 An introduction to the uranium from seawater project. Chapter 2 A non-oxo V(V) complex with glutaroimide-dioxime (H3L), a ligand for recovering uranium from seawater, was synthesized from aqueous solution as Na[V(L)2]2H2O, and the structure determined by x-ray diffraction. It is the first non-oxo V(V) complex that has been directly synthesized in and crystallized from aqueous solution. The distorted octahedral structure contains two fully deprotonated ligands (L3-) coordinating to V5+, each in a tridentate mode. Using 17O-labelled vanadate, concurrent 17O/51V/1H/13C NMR, in conjunction with ESI-MS, unprecedentedly demonstrated the stepwise displacement of the oxo V=O bonds by glutaroimide-dioxime and verified the existence of the “bare” V5+/glutaroimide-dioxime - complex, [V(L)2] , in aqueous solution. In addition, the crystal structure of an intermediate 1:1 - V(V)/glutaroimide-dioxime complex, [VO2(HL)] , in which the oxo bonds of vanadate are only partially displaced, corroborates the observations by NMR and ESI-MS.
    [Show full text]
  • The Chemistry and Biochemistry of Vanadium and the Biological Activities Exerted by Vanadium Compounds
    Chem. Rev. 2004, 104, 849−902 849 The Chemistry and Biochemistry of Vanadium and the Biological Activities Exerted by Vanadium Compounds Debbie C. Crans,* Jason J. Smee, Ernestas Gaidamauskas, and Luqin Yang Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 Received June 6, 2003 Contents 4.2. Ribonuclease 866 4.2.1. Structural Characterization of Model 867 1. Introduction 850 Compounds for Inhibitors of Ribonuclease 2. Aqueous V(V) Chemistry and the 851 − 4.2.2. Characterization of the 867 Phosphate Vanadate Analogy Nucleoside-Vanadate Complexes that 2.1. Aqueous V(V) Chemistry 851 Form in Solution and Inhibit Ribonuclease 2.2. Mimicking Cellular Metabolites: 852 4.2.3. Vanadium−Nucleoside Complexes: 868 Vanadate−Phosphate Analogy Functional Inhibitors of Ribonuclease (Four-Coordinate Vanadium) 4.3. Other Phosphorylases 868 2.3. Structural Model Studies of Vanadate Esters 852 4.4. ATPases 869 2.4. Vanadate Esters: Functional Analogues of 853 4.4.1. Structural Precedence for the 869 Phosphate Esters Vanadate−Phosphate Anhydride Unit: 2.5. Vanadate Anhydrides: Structural Analogy 854 Five- or Six-Coordinate Vanadium with Condensed Phosphates 4.4.2. Vanadate as a Photocleavage Agent for 870 2.6. Potential Future Applications of 855 ATPases Vanadium-Containing Ground State Analogues in Enzymology 5. Amavadine and Siderophores 871 3. Haloperoxidases: V(V) Containing Enzymes and 855 5.1. Amavadine 871 Modeling Studies 5.1.1. Amavadine: Structure 871 3.1. Bromoperoxidase 855 5.1.2. Amavadine: Activities and Roles 872 3.2. Chloroperoxidase 856 5.2. Siderophores 873 3.3. From Haloperoxidases to Phosphatases 857 5.2.1.
    [Show full text]
  • US5167824.Pdf
    |||||||||||| USOO5167824A United States Patent (19) 11 Patent Number: 5,167,824 Cohen et al. 45 Date of Patent: Dec. 1, 1992 (54) SEPARATION BY CARRIER MEDIATED (56) References Cited TRANSPORT U.S. PATENT DOCUMENTS 75 Inventors: Charles Cohen, Medway; Robert A. 3. E. tal as a - a - a -26% Dishman, Concord; James S. Huston, 4,375,414 3/1983 Strahilevitz ......................... 210/638 Chestnut Hill; Robert L. Bratzler, 4,859,583 8/1989 Heller et al. ...................... 435/28 X Concord; David R. Dodds, Millis; Charles M. Zepp, Berlin, all of Mass. Primary Examiner-Frank Spear Attorney, Agent, or Firm-Testa, Hurwitz & Thibeault 73) Assignees: Creative BioMolecules, Inc., 57 ABSTRACT Hopkinton; Sepracor, Inc., Marlborough, both of Mass. Disclosed are processes and apparatus for separating a desired solute, such as an optically active isomer, from a complex mixture using carrier facilitated transport in (21) Appl. No.: 479,935 an immobilized liquid membrane or carrier facilitated solvent extraction. The carrier is a binding protein se (22 Filed: Feb. 14, 1990 lected and/or engineered to immunochemically revers ibly bind to the solute and to have a significant solubility 51 Int. Cl............................................... B01D 61/28 in the extracting solvent or immobilized liquid men 52 U.S. Cl. ..................................... 210/638; 210/644 brane. 58 Field of Search ....................... 210/638, 644, 632; 435/7.1, 28 12 Claims, 13 Drawing Sheets U.S. Patent Dec. 1, 1992 Sheet 1 of 13 5,167,824 U.S. Patent Dec. 1, 1992 Sheet 8 of 13 5,167,824 550 560 570 580 590 600 GGGTACATTTCCCCATACTCTGGGGTTACCGGCTACAACCAGAAGTTTAAAGGTAAGGCG G Y I S P Y S G W T G Y N Q K F K G K.
    [Show full text]
  • Ligand Interactions in Solution
    A cw-ENDOR investigation of metal- ligand interactions in solution Submitted in canditure for the degree of Doctor of Philosophy By Richard James Tucker, M.Chem Department of Chemistry University of Wales, Cardiff September 2005 UMI Number: U585544 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. Dissertation Publishing UMI U585544 Published by ProQuest LLC 2013. Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Declaration This work has not previously been accepted in substance for any degree and is not being concurrently submitted in candidature for any degree. Signed ^ ...... (candidate) Date n - 1 - oC This thesis is the result of my own investigations, except where otherwise stated. Other sources are acknowledged by footnotes giving explicit references. A bibliography is appended. Signed (candidate) Date 0 ( 0 I hereby give consent for my thesis, if accepted, to be available for photocopying and for inter-library loan, and for the title and summary to be made available to outside organisations. Signed .... (7/.. .. .^V^T?^r777T (candidate) D ate 9 .^ . Summary Electron Nuclear DOuble Resonance (ENDOR) spectroscopy has been employed in this Thesis to study a range of paramagnetic metal-ligand complex systems.
    [Show full text]