|||||||||||| USOO5167824A United States Patent (19) 11 Patent Number: 5,167,824 Cohen et al. 45 Date of Patent: Dec. 1, 1992

(54) SEPARATION BY CARRIER MEDIATED (56) References Cited TRANSPORT U.S. PATENT DOCUMENTS 75 Inventors: Charles Cohen, Medway; Robert A. 3. E. tal as a - a - a -26% Dishman, Concord; James S. Huston, 4,375,414 3/1983 Strahilevitz ...... 210/638 Chestnut Hill; Robert L. Bratzler, 4,859,583 8/1989 Heller et al...... 435/28 X Concord; David R. Dodds, Millis; Charles M. Zepp, Berlin, all of Mass. Primary Examiner-Frank Spear Attorney, Agent, or Firm-Testa, Hurwitz & Thibeault 73) Assignees: Creative BioMolecules, Inc., 57 ABSTRACT Hopkinton; Sepracor, Inc., Marlborough, both of Mass. Disclosed are processes and apparatus for separating a desired solute, such as an optically active isomer, from a complex mixture using carrier facilitated transport in (21) Appl. No.: 479,935 an immobilized liquid membrane or carrier facilitated solvent extraction. The carrier is a binding protein se (22 Filed: Feb. 14, 1990 lected and/or engineered to immunochemically revers ibly bind to the solute and to have a significant solubility 51 Int. Cl...... B01D 61/28 in the extracting solvent or immobilized liquid men 52 U.S. Cl...... 210/638; 210/644 brane. 58 Field of Search ...... 210/638, 644, 632; 435/7.1, 28 12 Claims, 13 Drawing Sheets

U.S. Patent Dec. 1, 1992 Sheet 1 of 13 5,167,824

U.S. Patent Dec. 1, 1992 Sheet 8 of 13 5,167,824

550 560 570 580 590 600 GGGTACATTTCCCCATACTCTGGGGTTACCGGCTACAACCAGAAGTTTAAAGGTAAGGCG G Y I S P Y S G W T G Y N Q K F K G K. A Pf M BStEII Dra

610 620 630 640 650 660 ACCCTTACTGTCGACAAATCTTCCTCAACTGCTTACATGGAGCTGCGTTCTTTGACCTCT L T W D K S S S T A Y M. E L R S L T S Sal

670 680 690 700 710 720 GAGGACTCCGCGGTATACTATTGCGCGGGCTCCTCTGGTAACAAATGGGCCATGGATTAT E D S A V Y Y C A G S S G. N. K. W. A. M. D Y SaCII NCOI

730 740 750 760 TGGGGTCATGGTGCTAGCGTTACTGTGAGCTCTTAACTGCAG W G H G A S W T V S S k

FIG. 6-2 U.S. Patent Dec. 1, 1992 Sheet 9 of 13 5,167,824

Fig. 7A FIG. 7B FIG.s 7c NH 3. NH3 3 NH3. 3 / y 4 M 4.

4 YN- 2 O 2 O 6 O 2 w--COOT 22 a 'coo- 2 2 2O

COO NH 3 14- a 22 M

2O

COO

U.S. Patent Dec. 1, 1992 Sheet 12 of 13 5,167,824

2 5

2 O

45

O

5

O is is is AOG LWAOL/WD A/6O7W COWCAW/A47/OW/M/ FIG. I.0

O -11 - O -9 -8 -7 -6 AOG LWBOUWD AGO/W COWCAW7A77OW/My FIG. II

5,167,824 1. 2 counts for many of the difficulties encountered in re SEPARATION BY CARRIER MEDIATED solving racenic mixtures. However, these small struc TRANSPORT tural differences may be profound in biological systems, e.g., if the compounds are involved in enzyme-cat BACKGROUND OF THE INVENTION alyzed reactions or bind specifically to cellular recep This invention relates to separation of individual sol tors. Thus, the L-amino acids are metabolized in hu utes from a mixture. More specifically, the invention mans but the corresponding D analogs are not. Only relates to exploitation of carrier mediated transport D-glucose can be phosphorylated and processed into mechanisms in immobilized liquid membrane and re glycogen or degraded by the glycolytic and oxidative lated separation systems. 10 pathways of intermediary metabolism. Similarly, beta There is a continuing need for more efficient methods blockers, pheromones, prostaglandins, steroids, flavor of separating the solutes in mixtures of structurally ing and fragrance agents, pharmaceuticals, pesticides, related bioactive compounds. Synthesis of bioactive herbicides, and many other compounds exhibit critical materials such as pharmaceuticals and pesticides using stereospecificity. In the field of pesticides, for example, organic chemistries often requires separations on a pre 15 Tessier has shown that only two of the eight stereoiso parative scale. The products of expression of engi mers of deltamethrin, a pyrethroid insecticide, have any neered microorganisms and cell lines typically comprise biological activity. (Chemistry and Industry, Mar. 19, a single valuable species in admixture with a host of 1984, p. 199). Other forms of optical isomers are known extraneous proteins, lipids, nucleic acids, and polysac which are of commercial interest. charides. Isolation of pure or substantially pure product 20 Stereochemical purity is also important in the field of on a commercial scale from such mixtures presents a pharmaceuticals, where 12 of the 20 most prescribed significant engineering challenge. Chromatography, drugs exhibit chirality. A case in point is provided by differential precipitation, filtration, and other separation naproxen, or (--) S-2-(6-methoxy-2-naphthyl) propionic technologies are used to remove selectively unwanted acid, used for instance in the management of arthritis. In species. Often, the late-purification stages are most diffi 25 cult and can be achieved only by means of affinity chro this case, the S(--) enantiomer of the drug is known to matography using polyclonal or monoclonal antibodies be 28 times more therapeutically potent than its R(-) which selectively immunochemically bind with the counterpart. Still another example of chiral pharmaceu product. ticals is provided by the family of beta-blockers; the Molecular biology has advanced as a technology 30 L-form of propranolol is known to be 100 times more sufficient to permit production of a variety of valuable potent than the D-enantiomer. biologically active proteins Pending U.S. application Synthesis of chiral compounds by standard organic Ser. Nos. 052,800 and 342,449, and PCT Application synthetic techniques generally leads to a racemic mix US88/01737, disclose biosynthetic multifunctional pro ture which, in the aggregate, may have a relatively low teins comprising plural bioactive domains, one of which 35 specific bioactivity since certain of the stereoisomers in is capable of binding to a preselected compound. The the mixture are likely to be biologically or functionally binding domain is patterned after the antibody binding inactive. As a result, relatively larger quantities of the site and can mimic the binding properties of a light or material must be used to obtain an effective dose, and heavy chain protein, or comprises a single chain con manufacturing costs are increased due to the co-produc struct comprising both light and heavy chains. Such tion of stereochemically "incorrect' and hence, inac constructs may be used in affinity chromatography tive ingredients. Also, the inactive enantiomer may procedures and may have significant cost advantages have unwanted side effects. over monoclonal antibodies. A widely used approach to purifying optical isomers Among the most difficult purification tasks is the is the selective precipitation of the desired compound separation of stereoisomers. Many organic compounds 45 from a racemic mixture. See, for example, U.S. Pat. No. exist in optically active forms, i.e., they have the ability 3,879,451, 4,257,976, 4,151,198, 4,454,344; Harrison et to rotate the plane of plane polarized light. In describing al, J. Med. Chem. 13:203 (1970); Felder et al, UK Patent an optically active compound, the prefixes D and L, or Application No. GB2025968A (1980), and U.S. R and S are used to denote the absolute configuration of 4,285,884. Separation of diastereomers also can be car the molecule about its chiral center(s). The prefixes 50 ried out by chromatography. See, for example, Pollock designate the sign of rotation of plane polarized light by et al, J. Gas Chromatogr. 3:174 (1965); Mikes et al., J. the compound, with (-) or L. meaning that the com Chromatogr. 112:205 (1976); and Hare et al, U.S. Pat. pound is levorotatory. For a given chemical structure, No. 4,290,893. Enzymes have been used for the resolu D and L stereoisomers are mirror images of one an tion of stereoisomers on a preparative scale. For in other. A specific stereoisoner may also be referred to as stance, enzymatic treatment has been applied to the an enantiomer, and a mixture of such isoners is often resolution of racemic mixtures of anino esters. See U.S. called an enantiomeric or racemic mixture. The term Pat. No. 3,963,573, U.S. Pat. No. 4,262,092, Clement "racemic mixture' as used herein, refers to a mixture of and Porter, J. Chen. Ed., 48:695 (1971), and Matta et al at least first and second stereoisomers in any proportion. J. Org. Chem, 39:2291 (1974). Additional examples of Optical activity is typically the result of molecular 60 enzyme-mediated resolution as applied to the produc asymmetry about tetrahedral carbon atoms that are tion of optically purified pharmaceuticals include Sih linked to four different moieties. Where there is only U.S. Pat. No. 4,584,370, Aragozzini et al, Biotechnol one asymmetric carbon atom, or "chiral center', there Letters, 8:95 (1980), Yokozeki et al, EPO No. 0122794 are two possible stereoisomers or enantiomers. Where A2, and Sih, Tetrahedron Letters, 27:1763 (1986). Mul there are n chiral centers, the number of potential ste tiphase and extractive enzyme membrane bioreactors reoisomers increases to 2. The structural differences that selectively produce pure or substantially purified between stereoisomers are subtle and of little conse optically active compounds from achiral precursors or quence in ordinary chemical reactions, and this ac mixtures are disclosed by Matson in U.S. Pat. No. 5,167,824 3 4. 4,800,162. The term "resolution' as used herein, refers as used herein, unless antithetical to its context, refers to separation of a first mixture into second and third broadly to reversible binding of the type that is ubiqui mixtures wherein the proportions of the solutes in the tous in biological systems. It is not limited to classical second and third mixtures are different from that in the antigen-antibody complex formation but rather includes first mixture, the proportion being greater in one and ligand receptor interactions, enzyme substrate interac necessarily smaller in the other. tions, and other protein-protein bindings or associations Permeation of solutes through liquids has been ex involving complementary stereochemical interfit, ploited for separation of certain ions using an immiscible charge pairing, hydrogen bonding, and thermodynamic liquid film as a membrane to mediate transport. In these interactions. so-called "immobilized liquid membranes', a micropo 10 In one embodiment, the liquid phase is immobilized rous solid support holds the liquid as a continuous bar within the membrane, and the apparatus includes means rier between the feed and product streams. The liquid is for passing a product stream into reactive contact with held in place by capillarity and assumes the geometry of the liquid phase at a second interface at the membrane the support. A novel variation of this technology ex opposite the first interface. The product stream serves ploits coupled transport. An extracting agent in the 5 to dissolve the solute at the second interface as the membrane selectively complexes a metal ion in the complex of the solute and the binding protein dissoci feedstream, then diffuses across the membrane and re ates. The mass action at the interfaces and diffusion leases the ion into a stripping stream. Regenerated, the between them result in the creation of concentration extracting agent then shuttles back to the feed side of gradients across the immobilized liquid membrane fa the membrane to repeat the process. The acidity of the 20 voring diffusion of the binding protein/solute complex feed and stripping streams is adjusted to favor complex from the feed interface to the product interface, and ation and decomplexation reactions at the solution diffusion of the uncomplexed binding protein in the membrane interfaces and to provide a concentration reverse direction. gradient of the coupling ion as a driving force. Typical In another embodiment, the apparatus comprises a coupled transport modules are constructed using hol 25 second membrane, the liquid phase is in contact with low fibers with diameters on the order of 100 to 1000 both membranes, and the apparatus includes means for um and are used, for example, to recover metals from circulating the liquid phase convectively between the plating wastes. interfaces at the respective membranes such as a pump. The primary object of this invention is the provision A product stream in interactive contact with the second of apparatus and processes for the rapid separation of 30 membrane collects product as the binding protein/so solutes useful in preparative contexts to resolve com lute complex dissociates. plex mixtures including solutions of proteins and iso In preferred aspects, the binding protein is a biosyn meric or racemic mixtures, and can be scaled readily to thetic construct having a binding domain which mimics permit any desired throughput. Another object is to the structure of one or both of the protein chains defin provide such apparatus and processes that can be 35 ing the binding pocket of an immunoglobulin. The con adapted to purify any unique species, provided only that struct may comprise a second domain for imparting the species is capable of being uniquely reversibly com optimal solubility properties to the binding protein in plexed by a proteinaceous binding site. the liquid phase. Preferably, the binding protein is con structed as disclosed herein so as to have a high specific SUMMARY OF THE INVENTION ity for the solute of interest and an appropriate affinity. This invention provides processes and systems for This approach facilitates association and dissociation at separating a preselected solute in a solution comprising the reactive interfaces and promotes high resolution. In a mixture of solutes which exploits carrier mediated a preferred embodiment, the liquid phase is aqueous, or transport in immobilized liquid membranes or mem at least hydrophilic, and the product and feed streams brane solvent extractors. The processes are useful in the 45 are hydrophobic. production of many pure organic compounds including These and other objects and features of the invention various proteins, and polypeptides, nonprotein pharma will be apparent from the drawing, description, and ceuticals, fragrances, flavoring agents, agricultural claims which follow. chemicals such as pesticides and herbicides, and other chemical classes. The invention finds perhaps its opti 50 BRIEF DESCRIPTION OF THE DRAWING mal use in the resolution of racemic mixtures to produce FIG. 1 is a schematic illustration of a first embodi pure or substantially purified optically active organic ment of the system and process of the invention which acids, alcohols, esters, amides, amines, nitriles, hydanto exploits diffusive transport of binding protein and bind ins, and other chiral compounds. ing protein/solute complex; In its broadest aspects the invention comprises appa 55 FIG. 2 is a schematic illustration of a second embodi ratus for separating a solute from a mixture. The appara ment of the system and process of the invention which tus comprises a porous membrane, a liquid phase in exploits convective transport of binding protein and contact with the membrane, and means for passing a binding protein/solute complex; feed solution into interactive contact with the liquid FIG. 3 is a schematic drawing of the structure of Fv. phase at an interface on a surface of or within the mem 60 proteins (and DNA encoding them) illustrating VH and brane. The feed solution comprises a mixture including VL domains, each of which comprises four framework the solute to be separated disposed in a solvent substan regions (FR) and three complementarity determining tially immiscible with the liquid phase. Dissolved in the regions (CDR). Boundaries of CDRs are indicated, by liquid phase is a binding protein which is substantially way of example, for monoclonal 26-10, a well known insoluble in the feed solution. The binding protein has a 65 and characterized murine monoclonal specific for di binding specificity for the solute in preference to other goxin. solutes in the feed and reversibly immunochemically FIG. 4 is the nucleic acid and encoded amino acid binds the solute. The phrase "immunochemical bond" sequence of a host DNA (VH) designed to facilitate 5,167,824 5 6 insertion of CDRs of choice. The DNA was designed to These techniques permit the production of binding pro have unique 6-base sites directly flanking the CDRs so teins useful in the context of this invention and option that relatively small oligonucleotides defining portions ally having solubility and binding properties which of CDRs can be readily inserted, and to have other sites optimize the processes disclosed herein, to facilitate manipulation of the DNA to optimize bind Approaches to exploiting the unique properties of ing properties in a given construct. The framework such synthetic binding proteins in practical separation regions of the molecule correspond to murine FRs. processes necessarily involve membrane contacting FIGS. 5 and 6 are multifunctional proteins (and DNA /separating steps. In particular, microporous membrane encoding them) comprising a single chain biosynthetic systems used in immobilized liquid membrane and mem antibody binding site (BABS) construct with the speci O brane solvent extraction separation techniques comprise ficity of murine monoclonal 26-10, linked through a preferred process configurations. These membrane spacer to the FB fragment of protein A, here fused as a based separation processes provide efficient methods leader. The Eco RI site is not part of the expressed for bringing into simultaneous contact three liquid solu chain, and the MET residue 1 is removed in vivo in E. tions: (i) the feed liquid stream comprising the mixture coli expression. The spacer comprises the 11 C-terminal 15 of solutes to be processed, (ii) the solution of binding amino acids of the FB followed by Ser-Asp-Pro (a di protein which exhibits binding selectivity towards the lute acid cleavage site). The single chain BABS com particular solute to be recovered and purified, and (iii) prises sequences mimicking the VH and VL (5) and the the product stream in which the selected solute is to be VL and VH (6) of murine monoclonal 26-10. The VL in recovered. Major design objectives of such systems are construct 5 is altered at residue 4 where valine replaces 20 to promote rapid solute transfer between the solutions methionine present in the parent 26-10 sequence. These while confining the binding protein to prevent its loss. constructs contain a binding site for digoxin and its At the same time, the unique physical and chemical analogs and a leader which promotes water solubility. properties of synthetic binding proteins make techni Their structure may be summarized as; cally and economically feasible liquid membrane and 25 solvent extraction based processes that otherwise have (5) FB-Asp-Pro-VH-(Gly4-Ser)3-VL, and little utility in these difficult separation tasks. It is this (6) FB-Asp-Pro-VL-(Gly-Ser)3-VH, uniquely effective combination of novel attributes of certain types of liquid membrane and solvent extraction where (Gly4-Ser)3 is a polypeptide linker. technology together with certain properties of syn In FIGS. 5, the amino acid sequence of the expression 30 thetic binding proteins that is the basis for the present product starts after the GAATTC sequence, which invention. codes for an EcoRI splice site, translated as Glu-Phe on A particularly important category of separation pro the drawing. cesses of the invention involves optical resolution, i.e., FIGS. 7A-7D are schematic representations of some the separation of a particular stereoisomer or enantio of the classes of binding proteins useful in the apparatus 35 mer from a mixture of such stereoisomers. Here, the and process of the invention; ability to rationally design and produce a synthetic FIG. 8 is a graph of percent of maximum counts binding protein which simultaneously exhibits both bound of radioiodinated digoxin versus concentration desirable binding properties (e.g., selectivity at the chi of binding protein adsorbed to the plate comparing the ral center with appropriate physical properties such as binding of native 26-10 (curve 1) and the construct of 0 size and solubility) provides a powerful means of ob FIG. 5 and FIG. 7B renatured using two different pro taining chiral selector molecules for use in any given cedures (curves 2 and 3). FIG. 9 is a schematic representation of the DNA and optical resolution process. At the same time, the use of amino acid sequence of a leader peptide (MLE) protein such enantioselective binding proteins becomes practi 45 cal by their incorporation into membrane-based pro with corresponding DNA sequence and some major cesses of the types described below. restriction sites; - FIGS. 10 and 11 are plots of digoxin binding curves. Referring to FIG. 1 an immobilized liquid membrane (A) shows 26-10 BABS binding isotherm and Sips plot 50 consists of a microporous, typically polymeric sup (inset), and (B) shows 26-10 Fab binding isotherm and port membrane 52 impregnated with a liquid phase Sips plot (inset); and 50 which is retained in the pores of the support 50 by capil FIG. 12 is a graph of product stream solute concen lary action. Such liquid membranes combine the desir tration vs. time illustrating the effect on transport across able permeation properties of the liquid phase, such as a liquid membrane of the presence of a protein which high permeant solubility and diffusivity, with the me binds the solute reversibly. chanical properties. and geometry of the microporous Like reference characters in the respective drawn 55 support membrane. Opposite sides of the liquid mem figures indicate corresponding parts. brane 50 are served by feed stream 54 and product stream 60, both of which are immiscible with liquid DESCRIPTION phase 50. A reversibly reactive binding protein which This invention combines certain features of hereto acts as a carrier species (C) is dissolved within the liquid fore disparate technologies to advance the art of separa membrane thereby permitting operation of a chemically tion and purification of valuable chemicals such as pesti selective process here described as carrier mediated cides, biologicals, and drugs, with particular reference transport. In such transport, as schematically illustrated to the resolution of racemic or other types of isomeric in FIG. 1, a carrier species C, comprising a binding mixtures. Practical application of the invention is made protein, is dissolved in the solvent disposed in the sup possible by the development of recombinant DNA 65 port membrane 52. The carrier C reacts reversibly with techniques to produce proteins, cassette mutagenesis a particular solute of interest (A) from the feed stream techniques, analysis of function-structure relationships, 54 to form a membrane soluble complex (CA) at the and other technologies of the type disclosed herein. interface 56 of the liquid membrane 50 and feed stream 5,167,824 7 8 54. Various species (A,X,Y) from feed stream 54 enter wettability by aqueous solutions, another important liquid membrane. 50. Some fraction of these diffuse property of the membrane polymer will be its chemical across membrane 50, traverse liquid membrane/product resistance to such organic solvents as may contact it stream interface 58, and enter product stream 60. The during the process of the invention. presence of complex C which sequesters solute A pro 5 The morphologies or microstructures characteristic duces a driving force for solute A to enter the liquid of membranes suitable as immobilized liquid membrane membrane. supports and solvent extraction membranes include Under the influence of diffusion, the complex CA those typical of both microfiltration and ultrafiltration forms a concentration gradient across liquid membrane membranes. Microfiltration membranes typically pos 50. At interface 58, where the local concentration of O sess pores ranging in diameter from about 0.01 um to free solute A is lowest, the complex dissociates, thereby about 10 un, preferably about 0.02 um to 2 um. Mi allowing the transported solute to partition into and to crofiltration membranes frequently are isotropic, i.e., be removed by a product stream 60 across the interface have a fairly uniform pore size across the thickness of 58. Because complex formation is involved in the trans the membrane. In contrast, ultrafiltration membranes port process, the selectivity can be high. Further, if the 5 are asymmetric and are typically characterized by a thin carrier is isomer/enantiomer selective, then the process "skin' layer on the order of 0.1 to 0.2 m in thickness, is capable of performing chiral separations. supported atop a much thicker (100 to 200 um) and Another embodiment of the invention is schemati highly porous substrate region. The skin of such asym cally depicted in FIG. 2. This embodiment is based on metric ultrafiltration membranes typically has pore sizes circulating a solution of binding protein between two 20 in the range of about 1 to about 200 nm. Finally, asym membrane separators 52, 52' by convection using pump metric membranes that combine the features of the 62 as opposed to diffusion through an immobilized liq "skin' typical of ultrafiltration membranes with the uid membrane. In this instance, the membrane separa more nearly isotropic "substrate' region typical of mi tors 52, 52' serve the purpose of providing emulsion and crofiltration membranes will also be suitable and in entrainment-free liquid/liquid contacting area between 25 some cases preferable in the practice of the invention. the feed stream 54 and circulating liquid phase 64 and All of these suitable membrane types are referred to between the liquid phase 64 and product stream 60 herein simply as "microporous'. while at the same time geometry is referred to herein as The geometry of the support membrane, i.e., flat solvent extraction. The essential principles of the sys sheet, tubular, hollow fiber, or other, is not critical to tem are similar to that of FIG. 1 except that diffusive 30 the invention. It is essential only that the membrane transport of complex CA and diffusive return of com have two surfaces, each of which may be contacted in a plex C across the liquid membrane 50 of FIG. 1 is re continuous fashion with separate process streams. Mod placed by convective circulation between membranes ules containing large numbers of hollow fibers will 52 and 52". frequently be preferred since the hollow-fiber geometry Immobilized liquid membranes and solvent extraction 35 provides a high surface area membrane in a compact systems may be based on either aqueous or organic package at low cost. Finally, the present invention will solutions, depending on what type of solution preferen be workable over a broad range of membrane thicknes tially "wets" the membrane, i.e., depending on whether ses-e.g., from about 5 to about 500 um. In general, the microporous support membrane 52 (and 52) is hy thinner membranes provide higher transmembrane drophilic or hydrophobic, and depending on the nature 40 fluxes of the solute to be separated from the mixture, but of the feed stream and solute to be separated. Both also are more difficult to manufacture, handle, and aqueous-based and organic-based membranes are of maintain in working condition. From a practical view interest in the practice of this invention. Because some point, membranes useful in the practice of this invention of the particulars of their use differ, the two types of typically will be from about 10 to about 100 m thick, systems are discussed separately below. 45 Immobilized liquid membranes may be impregnated Having described the general nature of the immobi or loaded with liquid simply by contacting the micropo lized liquid membrane and solvent extraction processes, rous support in its dry condition with a solution capable each will now be discussed in greater detail. of wetting its pores. For instance, membrane liquid may Most non-membrane proteins and "engineered' syn be supplied to the lumen- and/or shell side compart thetic binding proteins are more water-soluble than 50 ments in a hollow-fiber membrane module, with the they are organic-soluble and operate naturally in an result that capillarity will draw liquid into the pores of aqueous milieu, The situation where the membrane is the initially dry support membrane. Excess liquid may hydrophilic and serves to immobilize an aqueous solu then be removed from the surface of the membrane by tion of binding protein will be described first. a flushing procedure, and immiscible liquid process 55 streams then may be introduced to the lumen and shell Membranes compartments. Preferred polymers from which hydrophilic micro The liquid in the hydrophilic immobilized liquid porous membranes may be fabricated include but are membrane will be an aqueous solution of a preferen not limited to regenerated cellulose, cellulose esters, tially water-soluble binding protein. The binding pro polyacrylonitrile and copolymers thereof (especially 60 tein is chosen, designed, and synthesized so as to be the hydrophilic ones including but not limited to co capable of selectively forming a complex with the par polymers incorporating acrylamide, acrylate, and/or ticular "target' solute (or group of solutes) to be sepa methacrylate functionalities), polyurethane-containing rated from the mixture. The binding protein serves as copolymers, and blends with the polyarylsulfones and the "carrier" species in a process of carrier-mediated polyarylethersulfones (more particularly, polysulfone 65 transport which operates within the immobilized liquid and polyethersulfone, and blends thereof with such membrane or solvent extraction apparatus as generally hydrophilic copolymers as polyethylene-oxide, polye disclosed above. Where the binding protein is capable thyleneglycol, and polyvinyl-alcohol). In addition to its of binding enantioselectively to a single stereoisomer in 5,167,824 10 a mixture (e.g., a racemic mixture or 50:50 mixture of isobutyl ketone. In choosing a solvent for this embodi two stereoisoners), it serves as a chiral selector and ment of the process, important considerations over and carrier in a facilitated transport process capable of ef. above its ability to dissolve the solutes of interest in fecting an optical resolution of chiral solutes. The speci clude its chemical compatibility with the membrane fications of and means for obtaining binding properties support material and with the solutes present in the feed of a binding protein useful as a "carrier' molecule in the mixture, limited aqueous-phase solubility (i.e., immisci process of the present invention are discussed in some bility with water), negligible impact on operability of detail below. the aqueous phase carrier protein, interfacial tension (as discussed further below), toxicity, viscosity, limited Feed Solutions, Product Solvents, and Operational 10 solubility of water within it (important to liquid mem Parameters brane stability), and ability to be isolated from the sol Many of the solutes which can be separated by the utes of interest once the primary solute separation has process of the present invention are relatively hydro been effected. phobic (lipophilic), and thus are preferentially soluble in In the case of chiral resolution, the feed solution organic solutions. Indeed, many of the chiral pharma 15 presented to the separator typically will consist of a ceuticals and biomolecules that one may seek to resolve mixture of stereoisomers, one of which will be con exhibit limited water solubility. However, as discussed plexed preferentially by the binding protein carrier in more detail below, this is an advantage in a properly species contained within the liquid membrane. The designed system. concentration of solutes in the feed stream may vary It is not possible to provide a comprehensive list of 20 over wide limits without affecting the performance of the materials that can be separated using the process and the present invention. Concentrations will be fixed pri apparatus of the invention. Generally, the only require marily by the magnitude of the aqueous-to-organic par ment is that the material be soluble in some hydrophilic tition or solubility coefficient S. or hydrophobic solvent and have molecular features Once the solute has been removed from the feed that can be recognized by a binding protein. 25 mixture and selectively transported across the immobi Where one or more of the solutes in a mixture exists lized liquid membrane, it is recovered by its partitioning as a solid at the temperature and pressure of separation, into a second water-inniscible stream, the product it will be convenient to dissolve the mixture in a water stream. This stream is in contact with the immobilized immiscible organic solvent for feeding to the membrane liquid membrane, and will frequently and preferably separator in the form of a homogeneous solution. Alter 30 consist of the same water-immiscible organic solvent natively, in the case where the solute mixture (e.g., a and in the feed stream. racemic mixture) exists as a water-immiscible liquid at The concentrations of the target and other contami separation process conditions, the mixture may be sup nating solutes in the aqueous membrane liquid have plied as the neat organic liquid or liquid mixture. The important consequences for both the transmembrane term "solute", as used in the description hereafter and in 35 flux as well as its selectivity. As shown below, the con the claims, is intended to embrace such organic liquids. centrations CA1 and CA2, i.e., the equilibrium concentra In both cases, it is critical to the operation of the inven tions of solute A at the feed (A1) and product (A2) tion that the organic-phase feed mixture be essentially interface will determine the optimal binding affinity for immiscible with the aqueous solution of synthetic bind the carrier protein. Further, the solubilities of solute in ing protein contained within the pores of the immobi the aqueous membrane liquid also determine the so lized liquid membrane, since otherwise the feed solution called "passive' or unfacilitated flux of both the target might enter into and displace the binding protein solu and other solutes across the membrane according to the tion. solution/diffusion process described hereafter by equa As discussed above, target solutes separated by the tion (4). In order to maximize the selectivity of the present process typically exhibit some limited solubility 45 membrane process, it will generally be desirable to in both organic and aqueous phases. However, solutes minimize the passive diffusion component, since the separable by this hydrophilic membrane embodiment latter is relatively non-selective as compared to the typically will be substantially more organic-soluble than facilitated diffusion component which is based on the water-soluble. The relative solubilities of solutes may be high selectivity of the synthetic binding protein. Ac described in a quantitative manner by means of an aque 50 cordingly, solvents and solutes should generally be ous-to-organic partition coefficient or solubility coeffi chosen so as to minimize the aqueous solubility of the cient (S), which may be defined simply as the ratio of latter. In accordance with the relationship aqueous to organic phase solute concentrations existing at equilibrium when the mutually immiscible liquid CA1, CA2=organic-phase concentrations)XS phases are contacted. The relatively hydrophobic target 55 solutes separable with this embodiment of the invention the solubility or partition coefficients of the solutes are characterized by relatively small values of the equi generally should be low in practicing this particular librium partition or solubility coefficient S, e.g., about embodiment of the invention. When separating chemi 105 to about 1.0, Target solutes exhibiting partition coef. cally dissimilar solutes, both chemical selectivity and ficients over a very broad range will be separable by the partition coefficient should be considered in choosing process of the present invention. an appropriate water-immiscible solvent. When stereo Water-immiscible organic solvents useful for dis isomers are to be separated, only the magnitude of the solving such hydrophobic solutes include but are not partition coefficient will be important. limited to aliphatic and aromatic hydrocarbons such as It also will be desirable to keep the concentration of hexane and toluene; chlorinated solvents such as methy 65 the target solute in the product stream as low as possible lene chloride and chloroform; water-immiscible alco in order to maximize the transmembrane flux. This hols including amyl alcohol, octanol, and decanol; es point is discussed below with respect to equations (2), ters including amyl acetate; and ketones such as methyl (4), and (5). Practical considerations related to product 5,167,824 11 12 stream flow rate and recovery of dilute solute from the design, are not unique to the present invention, and are product stream will, in practice, dictate a lower limit for well understood by those skilled in the art. this solute concentration. The effective diffusivities (D) of both "free” solute as The flow rate of the product stream should be higher well as that of the protein/solute complex in the immo than that of the feed stream, typically by a ratio of at 5 bilized liquid membrane depend on both solution and least about 1.5:1 to as high as 20:1 in order to dilute the membrane properties. Thus: target solute. This flow rate ratio is selected so as to result in a significant transmembrane solute concentra tion difference, thereby providing a sufficient driving force for the facilitated transport process. O where Dois the free solution diffusivity of species "i", e Operating pressure is an additional important consid- . is the membrane porosity, and T is the membrane tortu eration because preferential wettability of the mem osity (i.e., the ratio of the diffusion path length to mem brane support by the aqueous liquid phase cannot by brane thickness). High porosity and low tortuosity are itself insure adequate membrane integrity and stability. desirable membrane characteristics. Typically, mem In particular, the pressure of the feed solution must be 15 branes useful in the practice of the invention will exhibit maintained within limits so as to prevent intrusion of the porosities in the range of 50 to 95%, and tortuosity organic phase into the pores of the hydrophilic mem factors of from about 1.1 to 4. brane. This maximum difference between the pressure The facilitation factor F expresses the extent to which of the organic feed stream and the aqueous membrane carrier-mediated transport increases the selective per solution is given by the equation of Young and LaPlace, 20 meation flux over and above simple passive diffusion which predicts that the entry or intrusion pressure AP is D as given by the equation: directly proportional to the interfacial tension y and cosine of the contact angle 8 between the organic and D=SDA (5) aqueous phases, and inversely proportional to the pore radius Rpore: 25 For the case of rapid reaction kinetics, the facilitation factor is given by the equation: AP=2ycos 8/Rpore (l) F=(DCA/D)KCT/(1--KCl)(1--KCA2) (6) When the membrane pore size is of the order of a few where tenths of a micron (um) or smaller, the intrusion pres DCA is the effective diffusivity of the solute/carrier sure is typically on the order of tens of psi. For example, 30 complex in the liquid membrane; the intrusion pressure predicted by equation (1) for a K is the equilibrium binding constant describing the membrane with 0.1 um diameter pores completely wet association between carrier and solute, and equals the by an aqueous solution exhibiting an interfacial tension quotient of the on and off rate constants, K1/K2; with an organic phase of 10 dynes/cm is approximately CT is the solubility of carrier (in both its "free' and 44 psi. Thus, allowable feed stream operating pressures 35 complexed forms) in the liquid membrane; will typically be no greater than about 10psi with such CA1 is the concentration of solute in the liquid at that membranes and fluids in order to provide some margin surface of the membrane in contact with the feed of safety. stream; (interface 56, FIG. 1); and 40 CA2 is the (lower) concentration of solute in the liquid Carrier Protein at that surface of the membrane in contact with the Review of the physical relationships characteristic of product stream (interface 58, FIG. 1). facilitated transport provides considerable guidance for From the foregoing and other equations provided the design of suitable synthetic binding proteins. For below, it is possible to specify the particular physical, example, in the situation where the kinetics of both and chemical properties of synthetic binding proteins, binding and release of solute by the carrier species are 45 solutes, and organic solvents that optimize the process rapid as compared to the time for facilitated diffusion of of the present invention. Further, it is possible to under the carrier-solute complex across the liquid membrane, stand why use of synthetic binding proteins in combina the permeability P of a solute through a liquid mem tion with facilitated-transport in immobilized liquid brane containing a carrier species capable of complex membranes is especially powerful. ing with it is given by the equation: 50 For example, as regards the desired physical proper ties of the binding protein, it is clear from equation (6) P=SD(1 + F) (2) that the degree of facilitation (as expressed by the facili where tation factor F) is maximized by large values of the S is the solubility or partition coefficient as defined 55 effective diffusivity of the carrier/solute complex as above; well as that of the free solute, and by high concentra D is the effective diffusivity of solute A in the mem tions of the carrier species CT. The facilitated diffusion brane; and flux is proportional to the maximum molar concentra F is the facilitation factor. tion of the carrier protein in the fixed intrapore space of 60 a liquid membrane. Given similar solubilities in weight The transmembrane flux J of solute varies in direct concentration (mg/ml) for different carrier molecules, proportion to the permeability and solute concentration the lowest molecular weight species will have the high difference AC across it, and inversely with the mem est molar concentration and hence the largest number of brane thickness L, as indicated below: carrier molecules in the liquid membrane. This consid Vs PAC/L (3) 65 eration makes engineered binding proteins (as opposed Other factors such as process-stream boundary layer to native forms such as monoclonal antibodies and natu resistances to diffusion also may affect the transmem ral receptors) particularly attractive in facilitated trans brane flux, but have little influence on binding protein port processes, since such engineered proteins can ex 5,167,824 13 14 hibit the binding specificity and avidity of native bind verse seconds, with the corresponding Damkohler ing proteins at a fraction of their molecular weight. numbers ranging from about 106 to about 1. Thus, More particularly, whereas antibodies of the IgG class synthetic binding proteins can be designed and/or se are characterized by molecular weights of order lected by this criterion for which neither binding nor 150,000 daltons, it is now possible to produce synthetic release kinetics are limiting. The above calculation proteins with molecular weights that are nearly ten-fold clearly indicates that finite "off" rates will generally be smaller. At present, biosynthetic binding sites with ex of greater concern than "on" rates. A significant advan cellent binding properties are available with water solu tage of the novel synthetic binding proteins exploited in bilities at least as high as about 5 mg/mL or about preferred embodiments of the present invention is the O.OOO2 M. 10 Additionally, the ability to genetically engineer ancil ability independently to manipulate and select for a lary domains onto synthetic binding proteins in addition binding protein with an optimum combination of bind to the binding domain can improve further their solubil ing equilibrium constant K and association/dissociation ity in a given solvent and reduce tendency toward ag rate constants k2 and ki, as discussed below. gregation. 15 The Binding Protein The relatively low molecular weight characteristic of synthetic binding proteins favors not only high solubil While conventional monoclonal antibodies can be ity but also higher diffusivity, making carrier-mediated used in the process and apparatus of the invention, from membrane transport processes significantly more effi the foregoing it will be apparent that their high molecu cient. However, it should be noted that high carrier 20 lar weight and large size make such proteins less than protein concentrations also can have the effect of in optimal. Fortunately the art of producing chimeric creasing viscosity, and diffusivity typically varies in antibodies missing all or part of the constant region, versely with solution viscosity. FVs, FV' dimers, and other such constructs is well Ideally, the kinetics of both protein/solute binding developed. See, for example, U.S. Pat. No. 4,816,567 (i.e., the "on' rate) and of protein/solute dissociation 25 and U.S. Pat. No. 4,642,334. However, the currently (i.e., the "off" rate) should be large, i.e., both the se preferred methods for making biosynthetic antibody cond-order rate constant k2 describing the "on' rate and binding sites (BABS), for altering their affinity and the first-order rate constant k1 describing the "off" rate specificity by cassette mutagenesis, and for tailoring should be large. These are related through the affinity their solubility properties are disclosed in copending of the binding protein, with the ratio of “on” and "off 30 U.S. application Ser. No. 052,800 filed May 21, 1987, rate constants k2/k being equal to the protein binding U.S. Ser. No. 342,449 filed Feb. 6, 1989, and in pub constant K. If these reaction rates are slow as compared lished PCT Application US88/01737, the disclosures of to the rate of diffusion of the protein/solute complex which are herein incorporated by reference. across the liquid membrane, then the facilitated trans These biosynthetic polypeptides define structure ca port process will be kinetically controlled. In this event 35 pable of selective antigen recognition and preferential the transmembrane flux and the selectivity of the sepa antigen binding, and preferably also one or more pep ration are still achieved but can be significantly lower tide-bonded additional protein or polypeptide regions than predicted by the above equations. or domains designed to have a preselected property. One semi-quantitative approach for estimating the For the practice of this invention, the second region or significance of binding and release kinetics to the per domain may be entirely eliminated, or may be included formance of such carrier mediated transport involves to influence the solubility properties of the binding calculating a dimensionless Damkohler number (D) protein for the liquid phase in either the immobilized which compares a characteristic reaction time (T,) with liquid membrane or solvent extraction embodiments. a characteristic transmembrane diffusion time (T) as This technology provides intact biosynthetic anti follows: 45 body binding sites analogous to VH-VL dimers, either D= T/T (7) non-covalently associated, disulfide bonded, or prefera bly linked by a polypeptide sequence to form a compos where ite VH-VL or V L-VH polypeptide which may be essen tially free of antibody constant region. The technology Tree 1/(k2" CT) (for the binding reaction) (8) 50 also provides proteins analogous to an independent VH or VL domain, dimers thereof or single chain dimers. Tl/k (for solute release), and (9) Any of these proteins may be provided in a form linked T=L/Di (10) to, for example, amino acids designed to promote water 55 solubility, or solubility in organic solvents, as the case For small values of the Damkohler number as defined may be. above for both the forward (or "on') and reverse (or The design of the BABS is based on the observation "off") reactions, reaction kinetics will not be limiting, that the variable domains of each of the heavy and light and permeation rates will be diffusion-controlled. chains of native immunoglobulin molecules collectively Synthetic binding proteins useful in the present in are responsible for antigen recognition and binding. vention typically will be characterized by rate constants Each of these domains contain subregions, called "com for the association reaction of order 5x 105 to 6x 108 plementarity determining regions' or CDRs, consisting liters per mole-sec, although higher and lower values of one of the hypervariable regions or loops and of are possible. Reasonable estimates of the Damkohler selected amino acids or amino acid sequences disposed number corresponding to these binding kinetics range in the framework regions (FRs) which flank that partic from about 10-8 to 10-3, suggesting that "on" rates will ular hypervariable region. Biosynthetic domains mim not be a significant limiting factor. Dissociation rate icking the structure of the two chains of an immuno constants might vary from about 0.1 to about 6000 in globulin binding site may be connected by a polypep 5,167,824 15 16 tide linker while closely approaching, retaining, and which together present a hydrophilic, relatively un often improving their collective binding properties. structured region. Linking amino acid sequences having As is now well known, Fv, the minimum antibody little or no secondary structure work well. fragment which contains a complete antigen recogni Either the amino or carboxyl terminal ends (or both tion and binding site, consists of a dimer of one heavy ends) of these chimeric, single chain binding sites may and one light chain variable domain in noncovalent be attached to an amino acid sequence which has the association. It is in this configuration that the three function of increasing solubility in the liquid phase of complementarity determining regions of each variable the immobilized liquid membrane or solvent extraction domain interact to define an antigen binding site on the apparatus. Because such structures are designed at the surface of the VH-VL dimer. Collectively, the six com 10 DNA level, specificities and affinity can be varied by plementarity determining regions (see FIG. 3) confer cassette mutagenesis as disclosed herein and in U.S. Pat. antigen binding specificity to the antibody. FRs flank No. 4,888,286 to optimize utility in the separation pro ing the CDRs have a tertiary structure which is essen cess. The synthetic proteins can be expressed in proca tially conserved in native immunoglobulins. These FRs ryotes such as E. coli and thus are less costly to produce serve to hold the CDRs in their appropriate orientation. 15 than immunoglobulins or fragments thereof which re The constant domains are not required for binding func quire expression in cultured animal cell lines. tion. Even a single variable domain (or half of an Fv FIGS. 7A-7D illustrate four examples of protein comprising only three CDRs specific for an antigen) has structures that can be produced by following the teach the ability to recognize and bind antigen, although at a ing disclosed herein and in the aforementioned patent lower affinity than an entire binding site (Painter et al. 20 documents. All are characterized by a biosynthetic (1972) Biochem. 11:1327-1337), and may be used as polypeptide defining a binding site 3, comprising amino carrier proteins. acid sequences comprising CDRs and FRs, often de The term CDR, as used herein, refers to amino acid rived from different immunoglobulins, or sequences sequences which together define the binding affinity homologous to a portion of CDRs and FRs from differ and specificity of the natural Fv region of a native im 25 munoglobulin binding site, or a synthetic polypeptide ent immunoglobulins. FIG. 7A depicts a single chain which mimics this function. CDRs typically are not construct comprising a polypeptide domain 10 having wholly homologous to hypervariable regions of natural an amino acid sequence analogous to the variable region Fvs, but rather also may include specific amino acids or of an immunoglobulin heavy chain, bound through its amino acid sequences which flank the hypervariable 30 carboxyl end to a polypeptide linker 12, which in turn is region and have heretofore been considered framework bound to a polypeptide domain 14 having an amino acid not directly determinitive of complementarity. The sequence analogous to the variable region of an immu term FR, as used herein, refers to amino acid sequences noglobulin light chain. Of course, the light and heavy flanking or interposed between CDRs. The CDR and chain domains may be in reverse order. Alternatively, FR polypeptide segments are designed based on se 35 the binding site may comprise two substantially homol quence analysis of the Fv region of preexisting antibod ogous amino acid sequences which are both analogous ies or of the DNA encoding them. to the variable region of an immunoglobulin heavy or The binding site region of BABS constructs com light chain. prises at least one, and preferably two domains, each of The linker 12 should be long enough (e.g., about 15 which have amino acid sequences homologous to por 40 amino acids or about 40A) to permit the chains 10 and tions of the CDRs of the variable domain of an immuno 14 to assume their proper conformation. The linker globulin light or heavy chain, and other sequences ho preferably comprises hydrophilic amino acid sequences. mologous to the FRs of the variable domain. The two The amino acids of the linker preferably are selected domain binding site construct also includes a polypep from among those having relatively small, unreactive tide linking the domains. Polypeptides so constructed 45 side chains. Alanine, serine, and glycine are preferred. bind a specific preselected antigen determined by the Generally, the properties of the linked domains are CDRs held in proper conformation by the FRs and the seriously degraded if the linker sequence is shorter than linker. Preferred structures have linked domains which about 35A in length, i.e., comprises less than about 10 together comprise structure mimicking a VH-VL or residues. Linkers longer than the approximate 40A dis VL-VH immunoglobulin two-chain binding site. CDR 50 tance between the N terminal of a native variable region regions of a mammalian immunoglobulin, such as those and the C-terminal of its sister chain may be used, but of mouse or rat are preferred, and typically are copies also potentially can diminish the BABS binding proper or patterned after a monoclonal antibody. In addition, ties. Linkers comprising between 12 and 18 residues are the chimeric polypeptide may comprise other amino preferred. The preferred length in specific constructs acid sequences. It may comprise, for example, a se 55 may be determined by varying linker length first by quence homologous to a portion of the constant domain units of 5 residues, and second by units of 1-4 residues of an immunoglobulin, but preferably is free of constant after determining the best multiple of the pentameric regions (other than FRs). starting units. The binding site region(s) of the chimeric proteins are Additional proteins or polypeptides may be attached thus single chain composite polypeptides comprising a to either or both the amino or carboxyl termini of the structure which in solution behaves like an antibody binding site to influence solubility and to produce prote binding site. The two domain, single chain composite ins of the type illustrated in FIGS. 7B-7D. As an exam polypeptide has a structure patterned after tandem VH ple, in FIG. 7B, a helically coiled polypeptide structure and VL domains, but with the carboxyl terminus of one 16 comprises a protein A fragment (FB) linked to the attached through a linking amino acid sequence to the 65 anino terminal end of a VF-like domain 10 via a spacer amino terminus of the other. The linker preferably sequence 18. The FB domain 16 has the effect of en spans a distance of at least about 40A, i.e., comprises at hancing water solubility. FIG. 7C illustrates a protein least about 14 amino acids, and comprises residues having a solubility enhancing polypeptide 20 linked via 5,167,824 17 18 a spacer sequence 22 to the carboxyl terminus of poly type described above. If necessary, point substitutions peptide 14 of binding protein segment 2. seeking to optimize binding properties may be made in The domains are attached by a spacer 18 (FIGS. 7B) the DNA using conventional cassette mutagenesis. covalently linking the C terminus of the protein 16 to It typically will be desirable that the specificity of the N-terminus of the first domain 10 of the binding binding of a particular target solute by the BABS pro protein segment 2, or by a spacer 22 linking the C-ter tein be made as high as possible by techniques described minus of the second binding domain 14 to the N-ter herein. However, as can be seen from equation (6), the minus of another protein (FIGS. 7C and 7D). The facilitation factor depends in a complex manner on the spacer may be an amino acid sequence analogous to equilibrium binding constant K, which is defined as linker sequence 12, or it may take other forms. O follows: FIG.7D depicts another type of reagent, comprising a BABS having only one set of three CDRs, e.g., analo K=(protein/solute complex)Mproteinsolute (11) gous to a heavy chain variable region, which retains a measure of affinity for the antigen. Attached to the By taking the first derivative of the facilitation factor F carboxyl end of the polypeptide 10 or 14 comprising the 15 with respect to the binding constant K in equation (6) FR and CDR sequences constituting the binding site 3 and setting the result to zero, an optimum value of the through spacer 22 is solubility enhancing polypeptide binding constant K may be calculated that maximizes 20 as described above. the facilitation-diffusion flux of solute across the mem brane. This optimum value for K is given simply as the Design and Manufacture 20 reciprocal of the geometric mean of the "feed-side' and The binding proteins are designed at the DNA level. "product-side' membrane-phase solute concentrations A preferred general structure of the DNA encoding the as shown below: proteins encodes an optional leader sequence used to promote expression in procaryotes having a built-in K (optimum)= 1/(CA1X CA2) (12) cleavage site recognizable by a site specific cleavage 25 agent, for example, an endopeptidase, used to remove where the two concentrations have been described the leader after expression. This is followed by DNA above. The lower these solute concentrations, the encoding a VH-like domain, comprising CDRs and higher will be the optimum affinity. These concentra FRs, a linker, a VL-like domain, again comprising tions will depend on feed concentrations, product-to CDRs and FRs, and an optional second domain for 30 feed stream flowrate ratios, and partition coefficients, solubility enhancement. This region of the DNA may (solvent selections), as discussed previously. encode, for example Gly, Ala, Ser, Thr, Asp, Glu, Lys, Accordingly, it can be seen that there exists an opti Arg, and/or His in various sequences of various lengths mum affinity between the BABS carrier protein and the to impart hydrophilic character and to promote water solute, and that the optimum value will depend on pro solubility. The chimeric or synthetic DNAs are then 35 cess conditions related to solute concentrations at the expressed in a suitable host system, and the expressed membrane interfaces. Values of K significantly much proteins are collected and renatured if necessary. After higher than this optimum value will result in "satura expression, folding, and cleavage of the leader, a protein tion' of the facilitated transport process and poor re results having a binding region whose specificity is lease of the transported solute from the carrier/solute determined by the CDRs. complex. On the other hand, values of K significantly The ability to design BABS useful in the invention much lower than this optimum value will result in for depends on the ability to determine the sequence of the mation of only small concentrations of the complex amino acids in the variable region of monoclonal anti between solute and BABS carrier protein, with the bodies of interest, or the DNA encoding them. Hy result that little carrier-mediated facilitation will take bridoma technology enables production of cell lines 45 place. secreting antibody to essentially any desired substance Ideally, the synthetic binding protein will exhibit an that produces an immune response. RNA encoding the affinity or equilibrium binding constant K which is light and heavy chains of the immunoglobulin can then within at least about an order of magnitude of the opti be obtained from the cytoplasm of the hybridoma. The mum binding constant as given by equation (12) above. 5' end portion of the mRNA can be used to prepare 50 Preferred affinities or binding constants will typically cDNA that permits V gene cloning and subsequent be in the range from about 10 to about 109 liters per sequencing, or the amino acid sequence of the hyper mole, the precise optimal value depending on solute variable and flanking framework regions can be deter concentrations as discussed above. An important advan mined by amino acid sequencing of the V region frag tage of synthetic binding proteins in these membrane ments of the H and L chains. Such DNA sequence 55 separation applications is the ability to vary the pro analysis is now conducted routinely and rapidly. This tein/solute affinity in a rational manner so as to maxi knowledge, coupled with observations and deductions mize the efficiency of the membrane separation pro of the generalized structure of immunoglobulin Fvs, cesses. Affinity constants can be reduced easily by permits one to design synthetic genes encoding FR and amino acid substitution in the CDR regions of the bind CDR sequences which likely will bind the antigen. ing site. Accordingly, one strategy is to select a high These synthetic genes are then prepared using known affinity mononclonal, and then to reduce its affinity by techniques, or using the technique disclosed below, site directed cassette mutagenesis to an appropriate inserted into a suitable host, and expressed, and the level as dictated by the foregoing parameters. expressed protein is purified. Depending on the host The construction of DNAs encoding proteins as dis cell, renaturation techniques may be required to attain 65 closed herein can be done using known techniques in proper conformation. The various proteins are then volving the use of various restriction enzymes which tested for binding ability, and one having appropriate make sequence specific cuts in DNA to produce blunt affinity is selected for incorporation into a system of the ends or cohesive ends, DNA ligases, techniques en 5,167,824 19 20 abling enzymatic addition of sticky ends to blunt-ended cleases results in 3' and 5' ends which can easily be DNA, construction of synthetic DNAs by assembly of matched up with and ligated to native or synthetic short or medium length oligonucleotides, cDNA syn CDRs of desired specificity; KpnI and BstxI are used thesis techniques, and synthetic probes for isolating for ligation of CDR1; Xba and Dral for CDR2; and immunoglobulin or other bioactive protein genes. Vari 5 BssHII and Cla for CDR3. ous promoter sequences and other regulatory DNA The expression of these synthetic DNA's can be sequences used in achieving expression, and various achieved in both prokaryotic and eucaryotic systems types of host cells are also known and available. Con via transfection with an appropriate vector. In E. coli ventional transfection techniques, and equally conven and other microbial hosts, the synthetic genes can be tional techniques for cloning and subcloning DNA are 10 expressed as fusion protein which is subsequently useful in the manufacture of proteins of the type dis cleaved. Expression in eucaryotes can be accomplished closed herein and known to those skilled in the art. by the transfection of DNA sequences encoding CDR Various types of vectors may be used such as plasmids and FR region amino acids into a myeloma or other and viruses including animal viruses and bacterio type of cell line. By this strategy intact hybrid Fv re phages. The vectors may exploit various marker genes 15 gions may be produced. which impart to a successfully transfected cell a detect able phenotypic property that can be used to identify Exemplary Design of Synthetic VH and VLMimics which of a family of clones has successfully incorpo A synthetic protein consisting of the FB fragment of rated the recombinant DNA of the vector. One pre protein A as a leader coupled to a single chain binding ferred method for obtaining DNA encoding the prote 20 site comprising the variable regions of the light and ins disclosed herein is by assembly of synthetic oligonu heavy chains of monoclonal 26-10 was designed at the cleotides produced in a conventional, automated, poly DNA level, expressed, purified, renatured, shown to nucleotide synthesizer followed by ligation with appro bind specifically with the preselected antigen (digoxin), priate ligases. and shown to act as a protein binding site in the process A method of producing the BABS of the invention is 25 to produce a synthetic DNA encoding a polypeptide of the invention. The detailed primary structure of this comprising FRs and intervening "dummy" CDRs, or construct is shown in FIG. 6; its tertiary structure is amino acids having no function except to define suitably illustrated schematically in FIG. 7B. situated unique restriction sites. This synthetic DNA is GENE DESIGN then altered by DNA replacement, in which restriction 30 and ligation is employed to insert synthetic oligonucleo Given known variable region DNA sequences, syn tides encoding CDRs defining a desired binding speci thetic VL and VH genes may be designed which encode ficity in the proper location between the FRs. This native or near native FR and CDR amino acid sequen approach facilitates empirical refinement of the binding ces from an antibody molecule, each separated by properties of the BABS. 35 unique restriction sites located as close to FR-CDR and This technique is dependent upon the ability to cleave CDR-FR borders as possible. Alternatively, genes may a DNA corresponding in structure to a variable domain be designed which encode native FR sequences which gene at specific sites flanking nucleotide sequences en are similar or identical to the FRs of an antibody mole coding CDRs. These restriction sites in some cases may cule from a selected species, each separated by be found in the native gene. Alternatively, non-native 40 "dummy" CDR sequences as discussed above. These restriction sites may be engineered into the nucleotide DNAs serve as starting materials for producing BABS, sequence resulting in a synthetic gene with a different as the native or "dummy" CDR sequences may be ex sequence of nucleotides than the native gene, but encod cised and replaced with sequences encoding the CDR ing the same variable region amino acids because of the amino acids defining a selected binding site. Any one of degeneracy of the genetic code. The fragments result 45 the VH and VL sequences described above may be ing from endonuclease digestion, and comprising FR linked together via an amino acid linker connecting the encoding sequences, are then ligated to non-native C-terminus of one chain with the N-terminus of the CDR-encoding sequences to produce a synthetic vari other. able domain gene with altered antigen binding specific These genes, once synthesized, may be cloned with ity. 50 or without additional DNA sequences coding for a FIG. 4 discloses the nucleotide and corresponding leader peptide which facilitates secretion or the solubil amino acid sequence (shown in standard single letter ity of the fusion polypeptide. The genes then can be code) of a synthetic DNA comprising a master frame expressed directly in an appropriate host cell, or can be work gene having the generic structure: further engineered before expression by the exchange of 55 FR, CDR, or "dummy" CDR sequences with new sequences. This manipulation is facilitated by the pres ence of the restriction sites which have been engineered where R1 and R2 are restricted ends which are to be into the gene at the FR-CDR and CDR-FR borders. ligated into a vector, and X1, X2, and X3 are DNA Significant flexibility in VH and VL design is possible sequences whose function is to provide convenient re because the amino acid sequences are determined at the striction sites for CDR insertion. This particular DNA DNA level, and the manipulation of DNA can be ac has murine FR sequences and unique, 6-base restriction complished easily. sites adjacent the FR borders so that nucleotide sequen By sequencing any antibody, or obtaining the se ces encoding CDRs from a desired monoclonal can be quence from the literature, in view of this disclosure one inserted easily. Restriction endonuclease digestion sites 65 skilled in the art can produce a BABS of any desired are indicated with their abbreviations; enzymes of specificity comprising any desired framework region. choice for CDR replacement are underscored. Diges Diagrams comparing the amino acid sequence of differ tion of the gene with the following restriction endonu ent V genes are valuable in suggesting which particular 5,167,824 21 22 amino acids should be replaced to determine the desired light immunoglobulin chains, or portions thereof, each complementarity. Expressed sequences may be tested of which optionally may be attached in the various for binding and refined by exchanging selected amino ways discussed above to a pendant protein which pro acids in relatively conserved regions, based on observa note solubility. tion of trends in amino acid sequence data and/or com Vectors containing a heavy chain V region (or V and puter modeling techniques. C regions) can be cotransfected with analogous vectors For example, the DNA sequence for murine VH and carrying a light chain V region (or V and C regions), VL 26-10 containing specific restriction sites flanking allowing for the expression of noncovalently associated each of the three CDRs was designed with the aid of a binding sites (or complete antibody molecules). commercially available computer program which per O forms combined reverse translation and restriction site Hydrophobic Liquid Membrane Supports searches ("RV.exe" by Compugene, Inc.). The known Given the above teaching of the embodiment of the amino acid sequences for VH and VL 26-10 polypep invention for the case of preferentially organic-soluble tides were entered, and all potential DNA sequences solutes, hydrophilic support membranes, and water-sol which encode those peptides and all potential restric 5 uble synthetic binding proteins, the operation of the tion sites were analyzed by the program. The program invention for the case where the target solute exhibits can, in addition, select DNA sequences encoding the high water solubility (i.e., high aqueous-to-organic par peptide using only codons preferred by E. coli if this tition or solubility coefficient S) should be readily ap bacterium is to be host expression organism of choice. parent. In this situation, the support membrane should The DNA sequences for the synthetic 26-10 VH and 20 be hydrophobic and the binding protein should be solu VL are designed so that one or both of the restriction ble and active in organic solvents (e.g., those recited sites flanking each of the three CDRs are unique. A six above as suitable feed and product-stream diluents). In base site (such as that recognized by Bsm I or BspM I) this case it will be important to engineer into the binding is preferred, but where six base sites are not possible, proteins stability in the chosen organic solvent and a four or five base sites are used. These sites, if not already 25 hydrophobic leader or tail which functions analogously unique, are rendered unique within the gene by elimi to the hydrophobic region of biological transmembrane nating other occurrences within the gene without alter receptors and is rich in hydrophobic amino acids such ing necessary amino acid sequences. Preferred cleavage as phenylananine, leucine, alanine, tryptophan, and sites are those that, once cleaved, yield fragments with proline, and may also contain isoleucine, valine, and sticky ends just outside of the boundary of the CDR 30 methionine. In this region, hydrophilic amino acids within the framework. However, such ideal sites are such as glutamic or aspartic acid, lysine, arginine, and only occasionally possible because the FR-CDR bound the like should be avoided or their use should be re ary is not an absolute one, and because the amino acid stricted. sequence of the FR may not permit a restriction site. In Organic solutions of synthetic binding proteins can be these cases, flanking sites in the FR which are more 35 employed as liquids in hydrophobic membrane struc distant from the predicted boundary are selected. tures in a manner entirely analogous to that described above, with the exception that the membrane polymer is EXPRESSION OF PROTEINS "wet" by the organic phase. Suitable hydrophobic The engineered genes can be expressed in appropriate membrane polymers include but are not limited to poly prokaryotic hosts such as various strains of E. coli and tetrafluoroethylene, polyvinylchloride, and other poly in eucaryotic hosts such as Chinese hamster ovary cell, olefins including polyethylene and polypropylene. murine myeloma, and human myeloma/transfectoma In most respects, the design considerations and oper cells. ating parameters pertinent to this embodiment of the For example, if the gene is to be expressed in E. coli, invention parallel precisely those described above for it may first be cloned into an expression vector. This is 45 the hydrophilic former embodiment. Basic operating accomplished by positioning the engineered gene principles are identical, and the identical design equa downstream from a promoter sequence such as trp or tions apply. However, because the feed and process tac, and a gene coding for a leader peptide. The result streams are aqueous, such parameters as the pH and/or ing expressed fusion protein accumulates in refractile concentration of salt in the aqueous feed and product bodies in the cytoplasm of the cells, and may be har 50 streams can be manipulated independently. In particu vested after disruption of the cells by French press or lar, it will be possible to control the feed stream pH sonication. The refractile bodies are solubilized, and the and/or salt concentration at values that favor the bind expressed proteins refolded and cleaved by the methods ing of target solute to the synthetic binding protein already established for many other recombinant prote while, at the same time, maintaining the pH and/or salt 1S. 55 concentration of the product stream at values that favor If the engineered gene is to be expressed in myeloma dissociation of the protein/solute complex. When the cells, the conventional expression system for immuno process is operated in this manner, there does not exist globulins, it is first inserted into an expression vector an "optimum" value for the binding constant Kwhich is containing, for example, the Ig promoter, a secretion analogous to that predicted for the previous embodi signal, immunoglobulin enhancers, and various introns. 60 ment by equation (12). Rather, it is the sensitivity of K This plasmid may also contain sequences encoding all to variations in pH, salt concentration, or some addi or part of a constant region, enabling an entire part of a tional solution parameter that becomes important to the heavy or light chain to be expressed. The gene is trans design and operation of the membrane process. fected into myeloma cells via established electropora tion or protoplast fusion methods. Cells so transfected Membrane Solvent Extraction can express VL or VH domains, VL2 or VH2 homodim This embodiment of the invention is closely related to ers, VL-VH heterodiners, VH-VL, V L-VH, VL-VL, or the above-described process of facilitated transport in VH-VH single chain polypeptides, complete heavy or immobilized liquid membranes. However, as noted 5,167,824 23 24 above with respect to the description of FIG. 2, it is (other than the requirement that the membrane possess based on circulating a solution of synthetic binding adequate mechanical strength) is that the pressure not protein between two membrane separators by convec exceed the intrusion pressure for penetration of mem tion using a pump or the like. brane pores by the non-wetting organic phase. The In one embodiment of this membrane-mediated ex intrusion pressure can be determined from the equation traction process, an organic-phase feed stream contain of Young and LaPlace as discussed above. ing a mixture of solutes is contacted with an aqueous It frequently will be preferable from a mass transfer solution of synthetic binding protein across a micropo viewpoint to employ hydrophobic membranes as phase rous membrane 52 (either hydrophilic or hydrophobic). separators with aqueous solutions of synthetic binding Selective transfer of solute across the phase-separating O proteins. While the invention is operable using either membrane 52 and attendant complexation with the type of membrane, transport rates typically will be binding protein in the circulating aqueous solution higher if the design avoids the necessity for the pro occur in this "extractor' or "absorber' unit, with the tein/solute carrier to diffuse across the phase-separating solute-rich aqueous solution subsequently being membranes. This is the case when an aqueous solution pumped to a second membrane 52 where contact be 15 of binding protein is used with a hydrophilic membrane. tween the circulating aqueous solution and the product It will further be apparent that this embodiment also stream takes place. Dissociation of complex and transfer is operable in the case of preferentially water-soluble of solute across the membrane 52' are thus made to solutes and circulating organic-phase solutions of syn occur in this second "back-extractor' or "desorber' thetic binding proteins. As with the analogous liquid unit (See FIG. 2) The resulting solute-lean aqueous 20 membrane process, the additional degree of freedom solution of synthetic binding protein is then recirculated represented by the ability independently to vary aque to the membrane absorber to complete the process cy ous feed-and-product stream solution parameters such cle. as pH and salt concentration may be used to advantage The essential principles of design and operation of in this event to modulate the affinity of the synthetic this embodiment of the invention closely parallel those 25 binding protein for the target solute and so improve the for facilitated-transport immobilized liquid membranes efficiency of turnover of said binding protein. discussed above. The principal exception is that the The invention will be further understood from the productivity of the process is determined not only by following, non limiting examples. the rates of solute uptake in and release by the carrier EXAMPLE 1 protein in the absorber and desorber, but by this param 30 eter in conjunction with the rate of circulation between This example demonstrates facilitated transport of the the two membrane phase separators. Solute transfer cardiac glycoside oleandrin, an analog of digoxin, between aqueous and organic phases in the absorber through a supported liquid membrane using the biosyn and desorber individually will be determined by pro thetic binding protein FB-sfv 26-10, made as described cesses of transmembrane and boundary layer diffusion 35 below. and the intrinsic kinetics of solute binding and release Production of BABS for Digoxin-like Cardiac by the synthetic binding protein substantially as de Glycosides scribed above. In effect, the process of transmembrane diffusion of a solute/protein complex between the two The digoxin binding site of the IgG2ak monoclonal surfaces of a single immobilized liquid membrane in antibody 26-10 has been analyzed by Mudgett-Hunter simultaneous contact with two process streams is sim and colleagues. The 26-10 V region sequences were ply replaced by a process wherein convective transport determined from both amino acid sequencing and DNA of binding protein and its solute complex takes place sequencing of 26-10 H and L chain mRNA transcripts between two membrane separators, each of which (D. Panka, J. Novotny, and M.N. Margolies, unpub contacts the absorbent solution with a single immiscible lished data). The 26-10 antibody exhibits a high digoxin process stream. binding affinity K-5.4x 109M and has a well-de As with immobilized liquid membranes, it will be fined profile of specificity to various digoxin analogs important to operate this embodiment within certain including oleandrin. This provided a baseline for com pressure ranges in order to maintain successfully a sta parison between the monoclonal and the biosynthetic ble aqueous/organic interface in the two membrane 50 binding sites mimicking its structure. separators. For example, if the membrane is hydrophilic . Protein Design: and therefore wet with the circulating aqueous solution Crystallographically determined atomic coordinates of synthetic binding protein, it will be desirable to main for Fab fragments of 26-10 were obtained from the tain a small positive pressure difference across the mem Brookhaven Data Bank. Inspection of the available brane (e.g., by means of a back-pressure regulator or 55 three-dimensional structures of Fv regions within their some other pressure control device), with the organic parent Fab fragments indicated that the Euclidean dis phase (i.e., the feed or product stream) being held at the tance between the C-terminus of the VH domain and the greater pressure. N-terminus of the VL domain is about 35 A. Consider When operated in this manner, the aqueous/organic ing that the peptide unit length is approximately 3.8A, phase boundary will be located at the surface of the 60 a 15 residue linker was selected to bridge this gap. The membrane in contact with the organic process stream, linker was designed so as to exhibit little propensity for and this location will be a stable one. Ultrafiltration of secondary structure and not to interfere with domain aqueous solution across the membrane will be pre folding. Thus, the 15 residue sequence (Gly-Gly-Gly vented by the opposing pressure difference (i.e., organ Gly-Ser)3 was selected to connect the VH carboxyl and ic-to-aqueous), but the hydrophilicity of the membrane 65 VL amino termini. will ensure that the membrane is preferentially wet by Binding studies with single chain binding sites having the aqueous phase. The principal restriction on the mag less than or greater than 15 residues demonstrate the nitude of the organic-to-aqueous pressure difference importance of the prerequisite distance which must 5,167,824 25 26 separate VH from VL; for example, a (Gly4-Ser)1 linker Fusion Protein Cleavage: does not demonstrate binding activity, and those with The MLE leader was removed from the binding site (Gly4-Ser).5 linkers exhibit lower activity compared to protein by acid cleavage of the Asp-Pro peptide bond those with (Gly4-Ser)3 linkers. engineered at the junction of the MLE and binding site Gene Synthesis: Design of the 744 base sequence for the synthetic sequences. The washed protein granules containing the binding site gene was derived from the Fv protein se fusion protein were cleaved in 6 M guanidine quence of 26-10 by choosing codons frequently used in HC+10% acetic acid, pH 2.5, incubated at 37° C. for E. coli Synthetic genes coding or the trp promoter 96 hrs. The reaction was stopped through precipitation operator, the modified trp LE leader peptide (MLE), O by addition of a 10-fold excess of ethanol with over the sequence of which is shown in FIG. 9, and VH were night incubation at -20°C., followed by centrifugation prepared generally as described above. The gene cod and storage at -20° C. until further purification. ing for VH was assembled from 46 chemically synthe Protein Purification: sized oligonucleotides, all 5 bases long, except for The acid cleaved binding site was separated from terminal fragments (13 to 19 bases) that included cohe 15 remaining intact fused protein species by chromatogra sive cloning ends. Between 8 and 15 overlapping oligo phy on DEAE cellulose. The precipitate obtained from nucleotides were enzymatically ligated into double the cleavage mixture was redissolved in 6 M guanidine stranded DNA, cut at restriction sites suitable for clon HCl --0.2 M Tris-HCl, pH 8.2, -0.1 M 2-mercaptoe ing (Nar, Xba, Sall, SacII, SacI), purified by PAGE thanol and dialyzed exhaustively against 6 Murea -2.5 on 8% gels, and cloned in puC which was modified to mM Tris-HCl, pH 7.5, + 1 mM EDTA. 2-Mercaptoe contain additional cloning sites in the polylinker. The cloned segments were assembled stepwise into the com thanol was added to a final concentration of 0.1 M, the plete gene mimicking VH by ligations in the pUC clon solution was incubated for 2 hrs at room temperature ing vector. and loaded onto a 2.5 X 45 cm column of DEAE cellu The gene mimicking 26-10 VL was assembled from 25 lose (Whatman DE 52), equilibrated with 6 M urea 12 long synthetic polynucleotides ranging in size from +2.5 mM Tris-HCl + 1 mM EDTA, pH 7.5. The intact 33 to 88 base pairs, prepared in automated DNA synthe fusion protein bound weakly to the DE 52 column such sizers (Model 6500, Biosearch, San Rafael, Calif.; Model that its elution was retarded relative to that of the bind 380A, Applied Biosystems, Foster City, Calif.). Five ing protein. The first protein fractions which eluted individual double stranded segments were made out of 30 from the column after loading and washing with urea pairs of long synthetic oligonucleotides spanning six buffer contained BABS protein devoid of intact fusion base restriction sites in the gene (AatI, BstEII, PpnI, protein. Later fractions contaminated with some fused HindIII, BglII, and PstI). In one case, four long over protein were pooled, rechromatographed on DE 52, lapping strands were combined and cloned. Gene frag and recovered single chain binding protein combined ments bounded by restriction sites for assembly that 35 with other purified protein into a single pool. were absent from the puC polylinker, such as Aati and Refolding: BstEII, were flanked by EcoRI and BamHI ends to The 26-10 binding site mimic was refolded as fol facilitate cloning. lows: the DE 52 pool, disposed in 6 Murea +2.5 mM The linker between VH and VL, encoding (Gly-Gly Gly-Gly-Ser)3, was cloned from two long synthetic Tris-HCl + 1 mM EDTA, was adjusted to pH 8 and oligonucleotides, 54 and 62 bases long, spanning SacI reduced with 0.1 M 2-mercaptoethanol at 37° C. for 90 and Aat I sites, the latter followed by an EcoRI cloning min. This was diluted at least 100-fold with 0.01 M. end. The complete single chain binding site gene was sodium acetate, pH 5.5, to a concentration below 10 assembled from the VH, VL, and linker genes to pro ug/ml and dialyzed at 4 C. for 2 days against acetate duce a construct, corresponding to aspartyl-prolyl-VH 45 buffer. dissociation constant is estimated cluded digoxin, digitoxin, digoxigenin, digitoxigenin, from the ligand concentration at 50% saturation. These gitoxin, ouabain, and acetyl strophanthidin. The BABS binding data are also plotted in linear form as Sips plots was found to bind with oleandrin in a separate experi (inset), having the same abscissa as the binding isotherm ment described below. After the addition of 125I 60 but with the ordinate representing log rv(n-r), defined digoxin (25 ml, 50,000 cpm; Cambridge Diagnostics, below. The average intrinsic association constant (K) Billerica, Mass.) to each well, the plates were incubated was calculated from the modified Sips equation (39), log overnight at 4 C., washed and counted. The relative (r/n-r)=a log C-a log Ko, where r equals moles of affinities for each digoxin analog were calculated by digoxin bound per mole of antibody at an unbound dividing the concentration of each analogue at 50% 65 digoxin concentration equal to C; n is the number of inhibition by the concentration of digoxin (or digoxige moles of digoxin bound at saturation of the antibody nin) that gave 50% inhibition. There is a displacement binding site, and a is an index of heterogeneity which of inhibition curves for the BABS to lower glycoside describes the distribution of association constants about 5,167,824 29 30 the average intrinsic association constant K. Least within 12 hours. Product of both types of preparation squares linear regression analysis of the data indicated showed digoxin binding activity very similar to the correlation coefficients for the lines obtained were 0.96 parent antibody, as indicated in FIG. 8. for the BABS and 0.99 for 26-10 Fab. A summary of Procedure 2 involves dilution of DE52 pool into 3M the calculated association constants are shown below in 5 urea, lmM oxidized glutathione, 0.lmM reduced gluta Table 3. thione, pH8, where it resides for 15 hours at room tem TABLE 3 perature, followed by dialysis into 50mM sodium phos phate, pH7. Subsequently, the active fusion protein is Method of Data Association Constant, Ko isolated by oubain-Sepharose chromatography as de Analysis K (BABS), M. K. (Fab), M. O Scatchard plot (3.2 - 0.9) x 107 (1.9 - 0.2) x 108 scribed above. Sips plot 2.6 x 10 1.8 x 108 Demonstration of Binding Abilities Binding 5.2 x 107 3.3 x 108 Properties of the binding site were probed by a modi isothern fication of an assay developed by Mudgett-Hunter et al. (J. Immunol. (1982) 129:1165-1172; Molec. Immunol. Collectively these data demonstrate that the BABS has 15 (1985) 22:477-488), so that it could be run on microtiter an affinity and specificity similar to its 26-10 parent plates as a solid phase sandwich assay. Binding data molecule, but has a molecular weight on the order of were collected using goat anti-murine Fab antisera ten timeslower. (gAmfab) as the primary antibody that initially coats the wells of the plate. These are polyclonal antisera Synthesis of a Fusion Protein which recognize epitopes that appear to reside mostly A nucleic acid sequence encoding the single chain on framework regions. The samples of interest are next binding site described above was fused with a sequence added to the coated wells and incubated with the gAm encoding the FB fragment of protein A as a leader. As Fab, which binds species that exhibit appropriate anti a spacer, the native amino acids comprising the last 11 genic sites. After washing away unbound protein, the amino acids of the FB fragment bonded to an Asp-Pro 25 wells are exposed to 125I-labelled (radioiodinated) di dilute acid cleavage site was employed. The FB binding goxin conjugates, either as 25I-dig-BSA or 125I-dig domain of the FB consists of the immediately preceding lysine. 43 amino acids which assume a helical configuration The data are plotted in FIG. 8, which shows the (see FIG. 7B). results of a dilution curve experiment in which the par The gene fragments are synthesized using a Biosearch ent 26-10 antibody was included as a control. The sites DNA Model 8600 Synthesizer as described above. Syn were probed with 125I-dig-BSA as described above, thetic oligonucleotides are cloned according to estab with a series of dilutions prepared from initial stock lished protocol described above using the pUC8 vector solutions, including both the slowly refolded (1) and transfected into E. coli. The completed fused gene set fast diluted/quickly refolded (2) single chain proteins. forth in FIG. 6 is then expressed in E. coli 35 After sonication, inclusion bodies were collected by The parallelism between all three dilution curves indi centrifugation, and dissolved in 6 M guanidine hydro cates that gAmFab binding regions on the BABS mole chloride (GuHCl), 0.2 M Tris, and 0.1 M 2-mercaptoe cule are essentially the same as on the Fv of authentic thanol (BME), pH 8.2. The protein was denatured and 26-10 antibody, i.e., the surface epitopes appear to be reduced in the solvent overnight at room temperature. the same for both proteins. Size exclusion chromatography was used to purify fu The sensitivity of these assays is such that binding sion protein from the inclusion bodies. A Sepharose 4B affinity of the Fv for digoxin must be at least 106. Exper column (1.5x80 cm) was run in a solvent of 6 M imental data on digoxin binding of protein prepared by GuhCl and 0.01 MNaOAc, pH 4.75. The protein solu procedure 2 yielded binding constants of about 2X 109 tion was applied to the column at room temperature in 45 M-1 The parent 26-10 antibody has an affinity of 0.5-1.0 ml amounts. Fractions were collected and pre 5.4x 109M1 Inhibition assays also indicate the binding cipitated with cold ethanol. These were run on SDS of 125I-dig-lysine antisera (gAmFab) as the primary gels, and fractions rich in the recombinant protein (ap antibody that initially coats the wells of the plate. These proximately 34,000D) were pooled. This offers a simple are polyclonal antisera which recognize epitopes that first step for cleaning up inclusion body preparations 50 appear to reside mostly on framework regions. The without suffering significant proteolytic degradation. samples of interest are next added to the coated wells An alternative purification (procedure involves dialysis and incubated with the gAm Fab, which binds species of solubilized protein into 2.5mM Tris, 1 mM EDTA, that exhibit appropriate antigenic sites. After washing and 5mM DTT, pH8. Passage through a DEAE cellu away unbound protein, the wells are exposed to 125I lose column (DE52) equilibrated with this buffer yields 55 labelled (radioiodinated) digoxin conjugates, either as fusion protein suitable for refolding by procedure 2. 125-dig-BSA or 125I-dig-lysine. For refolding, the protein was dialyzed against 100 The data are plotted in FIG. 8, which shows the ml of the same GuhCl-Tris-BME solution, and dialy results of a dilution curve experiment in which the par sate was diluted 11-fold over two days to 0.55 M ent 26-10 antibody was included as a control. The sites GuHCl, 0.01 M Tris, and 0.01 M BME. The dialysis were probed with 125I-dig-BSA as described above, sacks were then transferred to 0.0 M NaCl, and the with a series of dilutions prepared from initial stock protein was dialyzed exhaustively before being assayed solutions, including both the slowly refolded (1) and by RIA's for binding of 125I-labelled digoxin. The re fast diluted/quickly refolded (2) single chain proteins. folding procedure can be simplified by making a rapid The parallelism between all three dilution curves indi dilution with water to reduce the GuhC concentration 65 cates that gAmFab binding regions on the BABS mole to 1.1 M, and then dialyzing against phosphate buffered cule are essentially the same as on the Fv of authentic saline (0.15 MNaCl, 0.05M potassium phosphate, pH 7, 26-10 antibody, i.e., the surface epitopes appear to be containing 0.03% NaNs), so that it is free of any GuhCl the same for both proteins. 5,167,824 31 32 The sensitivity of these assays is such that binding successive i ml samples of the lumen reservoir were affinity of the Fv for digoxin must be at least 106. Exper taken. In order not to disturb the volume of the lumen imental data on digoxin binding of protein prepared by reservoir, the octanol taken in each sample was re procedure 2 yielded binding constants of about 2X 109 placed with 1 ml of buffer saturated octanol after draw M-1 The parent 26-10 antibody has an affinity of 5 ing each sample. The quantity of oleandrin contained in 5.4x 109M-1. Inhibition assays also indicate the bind each lumen reservoir sample was determined by HPLC. ing of 125I-dig-lysine can be inhibited by unlabelled Samples taken before 6 hours had elapsed did not dem digoxin, digoxigenin, digitoxin, digitoxigenin, gitoxin, onstrate detectable quantities of oleandrin. Samples acetyl strophanthidin, oleandrin, and ouabain in a way taken at 19 and 20 hours showed oleandrin concentra largely parallel to the parent 26-10 Fab. This indicates O tions in the lumen reservoir of 0.05 mg/ml and 0.04 that the specificity of the biosynthetic protein is sub mg/ml respectively. stantially identical to the original monoclonal. The fluid loops were then drained. 100 mls of buffer A hollow fiber device was constructed using containing 10.0 mgs of FB-sFv 26-10 produced as dis 100x17.8 cm PAN fibers, produced by Sepracor, Inc., closed above were then slowly ultrafiltered from the Marlborough, Mass. Each PAN fiber is a tubular mem 15 shell loop at a pressure of 10 psi. This filtration proved brane having a wall thickness of 50 um and an internal extremely slow, and the process was allowed to pro diameter of 205 um. Thus, this device contains a geo ceed for 24 hours. After this time, no bulk fluid, either metric surface area of 115 cm2 of PAN fiber. The associ aqueous or organic, was present in either loop. The ated fluid handling equipment comprised two peristaltic aqueous ultrafiltrate was observed at 280mm, and found pumps, one for the shell loop and one for the luman 20 to have an absorbance of 0.04. Since an optical density loop, a pressure gauge on the shell loop for determining of 1.0 at 280 nm indicates a protein concentration of 1.0 the pressure drop from the shell side to the lumen side, mg/ml, the filtrate contained 4.0 mgs protein. 6.0mgs of and a throttling valve for creating a positive pressure on FB-sfv 26-10 were therefore assumed to be contained the shell side. in the supported liquid membrane. The device was first washed with 1 L of water. This 25 Octanol saturated with buffer, but not containing washing involved convecting water through the lumen, oleandrin, was then convected through each loop, with through the shell, and through the PAN fibers from the 10 psi pressure differential across the supported shell-side to lumen. liquid membrane. Once uninterrupted convection Following the washing procedure, the liquid mem through each loop was established, the shell loop reser brane was put in place. A buffer solution of the same 30 voir was replaced with a reservoir containing 500 mls of composition as that in which the FB-sFv protein was octanol saturated with buffer, and containing 2.0 mg/ml dissolved (50 mM sodium chloride) was pumped oleandrin. The lumen reservoir was replaced with a through the fibers, from the shell-side to the lumen. reservoir containing 50 mls of buffer saturated octanol, Approximately 100 mls of buffer solution were con containing no oleandrin. Over a 24 hour period, no vected through the fibers. Both the lumen and shell 35 convective flow of octanol through the supported liq were then drained of bulk aqueous solution, and 1 uid membrane occurred. octanol previously saturated with the same buffer solu During this period, successive 1 ml samples of the tion was introduced into both the shell and lumen fluid lumen reservoir were taken. In order not to disturb the loops. After establishing uninterrupted convection of volume of the lumen reservoir, the octanol taken in 1-octanol through these loops, the throttling valve was 40 each sample was replaced with 1 ml of buffer saturated closed until a shell-to-lumen pressure drop of 10 psi was octanol after drawing each sample. The quantity of created across the fibers. The octanol in both the shell oleandrin contained in each lumen reservoir sample was and lumen loops were fed from separate reservoirs, both determined by HPLC. The data for the foregoing ex containing 100 mls of 1-octanol previously saturated periments is summarized in the Table below. with the same buffer used as the supported liquid mem 45 brane. The volumes of both reservoirs were carefully moni time oleandrin concentration tored under these conditions, and were observed not to (hrs) (mg/ml) change over 20 hours. Thus, the supported liquid mem brane did not permit octanol from the shell fluid loop to 50 0 O pass through the fibers to the lumen fluid loop, despite 19.0 0.050 20.0 0.040 the 10 psi pressure differential. 6.0 mgs. Binding Protein in Membrane Oleandrin is a cardiac glycoside having a molecular 0 O weight of 576, and an organic to aqueous partition coef. 0.5 0.06 ficient between 1-octanol and water of 338 (Cohnen et 55 1.0 0.025 al, Drug Res. 28 (II), Heft 12, 1978). This translates to 2.0 0.047 3.0 0.067 an aqueous to organic coeffient S of about 0.003. The 4.0 0.090 glycoside was dissolved to a final concentration of 2.0 6.0 0.19 mgs/ml (3.5 mM) in 500 mls of 1-octanol previously 7.0 0.134 saturated with buffer. This reservoir was then placed in 60 7.5 0.40 the shell fluid loop. A reservoir containing 50 ml of 23.0 0.335 buffer saturated 1-octanol, containing no oleandrin, was 24.0 0.350 placed in the lumen fluid loop, and circulation of these reservoirs through their respective fluid loops com These data, together with the data obtained when the menced. The pressure differential of 10 psi was main 65 supported liquid membrane did not contain any protein, tained across the supported liquid membrane. The vol is plotted on the attached FIG. 12. Using a polynomials umes of the reservoirs were noted, and again observed curve-fitting procedure, the first order polynomial not to change over a 20 hour period. During this period, (slope) of the curve of the change in oleandrin concen 5,167,824 33 34 tration in the absence of the binding protein is 0.0023 Monoclonal antibodies to the chiral center of na mg/ml/hr. The first order polynomial for the change in proxen (carbon 2 of the propionic acid moiety) are concentration of oleandrin in the presence of the bind raised against naproxen employing techniques well ing protein is 0.0215 mg/ml/hr, corresponding to the known to those skilled in the art. For example naproxen rate of change of the oleandrin concentration in the may be conjugated at the 6 position of its napthalene receiving reservoir at time zero. These numbers repre ring to hemocyanin. Procedures for generating murine sent the flux of oleandrin through the supported liquid hybridoma fusions are current versions of the Kohler membrane. In the presence of the 26-10 protein, an Milstein procedure. Monoclonal antibodies are initial increase of oleandrin flux of (0.0215/0.0023), or screened as follows: (1) all antibodies cross-reactive 9.3-fold, was observed. Over the 24 hour time period of 10 with hemocyanin alone are excluded, as are antibodies the experiment with facilitated transport, a turnover that bind the naproxin-henocyanin conjugate but not number of the protein molecules may be calculated. free naproxen (representing so-called link antibodies); Assuming a molecular weight of 32,000 for the binding (2) remaining clones are tested for reactivity with free protein molecule, the turnover number is 140. naproxen in ELISA or RIA assays, and positive clones The initial flux of oleandrin across the BABS-con 5 are screened further; (3) remaining hybridoma clones taining membrane was 4.9X 10-12 gmole/sec-cm2 and are tested for reactivity against (--) naproxen and the average flux during the 24-hour experiment was against (-) naproxen; (4) only those cell lines secreting 2.9x10-12 gmole/sec-cm2 These initial and average antibodies that react strictly against (--) naproxen are fluxes correspond to permeabilities (based on organic considered as potential candidates for the basis of BABS 20 protein construction; (5) affinities and kinetic parame phase concentration difference driving forces) of ters are determined for the candidate molecules, and a 3.4x 10-6 and 8.4-107 cm/sec, respectively. The intial monoclonal antibody with appropriate values is chosen facilitation factor was 8.3, and the corresponding 24 for application. Alternatively, single domain binding hour average value was 4.5. sites with lowered affinity can be generated by protein Thus, as expected, the FB-Fv 26-10 binds oleandrin in 5 chemistry or recombinant DNA methods from candi a manner quantitatively similar to its parent monoclonal dates surviving step (5) of the screening process, and antibody and may be used as a binding protein to facili these species can be rescreened by steps (3), (4), and (5) tate transport in an immobilized liquid membrane of to arrive at a group of lower affinity BABS candidates. oleandrin. The cDNA cloning and BABS construction of the mol EXAMPLE 2 ecule of choice follow the procedures described above. The support membrane consists of an asymmetric, In this example, a membrane process is described for ultrafiltration-type hollow-fiber membrane fabricated the separation of stereoisomers of naproxen esters. The via conventional solvent phase inversion techniques and process is based on the use of an enantioselective bio encapsulated via a solvent-resistant epoxy into a con synthetic antibody binding site (BABS) protein that 35 ventional hollow-fiber module containing large num serves as the carrier in a facilitated transport process bers of fibers. Hollow-fiber membranes and modules conducted in an immobilized liquid membrane. containing from 0.75 to 8.5 square meters of such fiber Naproxen is a chiral pharmaceutical of considerable are manufactured by Sepracor Inc., Marlborough, commercial importance. It is the S(--) isomer of 2-(6- Mass. from a hydrophilic polyacrylonitrile (PAN)- methoxy-2-naphthyl) propionic acid. It is widely used based copolymer containing several weight percent of a to control the symptoms of arthritis. The S(--) enantio methyl acrylate component. Similar hydrophilic, PAN mer of naproxen is known to be 28 times more potent as copolymer-based membranes are made for hemofiltra an anti-inflammatory than is its R(-) counterpart. tion applications by, for example, Asahi Medical Com Naproxen may be resolved in a multistep process that pany; they are packaged in 1.0 square meter modules involves forming a racemic mixture of the ester deriva 45 (e.g., Asahi's Model PAN 150 hemofilter). tive, separating the ester stereoisomers in a facilitated The liquid membrane support membrane is further transport process based on a BABS protein as the car characterized by a porosity e of 80% and a tortuosity T rier, and recovering the desired S(--) acid through of 1.6. The inner and outer diameters of the fiber are 200 chemical hydrolysis of the S(--) ester. Only the separa and 280 microns, respectively, corresponding to a hol tion step is described here. 50 low-fiber membrane wall thickness of 40 microns. Although the naproxen acid itself is water-soluble to The first step in the liquid membrane preparation an extent approaching perhaps 0.1 M at neutral pH, the involves preparing an appropriately buffered aqueous esters formed by reacting naproxen with simple alco solution of the BABS protein. Generally speaking, it hols are solids that are only sparingly soluble in water. will be desirable to use as concentrated a solution of the For instance, the solubility in water of the racemic ethyl 55 BABS protein as possible, at least insofar as its viscosity ester of naproxen (molecular weight 258) is not accu is not excessive. The BABS protein employed in this rately known but probably does not exceed 0.1 mM; for example is designed as explained above to have a water present purposes, we assume a racemate solubility of solubility of about 10 mg/mL, corresponding to a molar only 0.01 mM or 10 M. Because the ester is soluble in water solubility of approximately 0.0005 M. The viscos organic solvents such as toluene to the extent of moles 60 ity of this BABS protein solution at ambient tempera per liter, the aqueous-to-organic partition or solubility ture is only slightly greater than 1 centipoise, illustrat coefficient as defined above is about 10-5. Thus, the ing that the viscosity-associated limit on protein con naproxen ester resolution process of the present exam centration has not been approached. ple is based on a water-soluble BABS protein contained Effective diffusivities of the naproxen ethyl ester DA as an aqueous phase in the pores of a hydrophilic sup 65 and of the BABS/naproxen ester complex (DCA) may port membrane. The feed stream to the membrane sepa be estimated from equation (4) above using predictions rator consists of a 1 M racemic solution of the naproxen of the free-solution diffusivities of these species (esti ethyl ester dissolved in toluene. - mated at infinite dilution in water at about 7.5X 10-6 5,167,824 35 36 and 1.0X 10.6 cm2/sec, respectively, for the solute and 1. Apparatus for separating a solute from a mixture, the complex) and using values provided above for the the apparatus comprising: support membrane porosity and tortuosity. In this man a first membrane; ner, effective liquid membrane diffusivities of free sol a hydrophilic liquid phase immobilized within said ute and protein/solute complex of 3.8x 10-6 and first membrane; 5.0x10-7 cm2/sec are obtained, respectively. means for passing a hydrophobic feed solution into The BABS protein is selected as detailed above so as reactive contact with a first interface at a first sur to possess a nearly optimal affinity for S(--) naproxen face of said first membrane, said hydrophobic feed ethyl ester binding, and essentially complete enanti solution comprising a mixture including a desired oselectivity for binding the S(--) in preference to the 10 solute in a solvent substantially immiscible with R(-) isomer. It has been further explained above that said membrane immobilized hydrophilic liquid the optimum binding constant K depends, in general, on phase; aqueous-phase target solute concentrations at the feed a binding protein dissolved in and substantially con stream and product stream membrane interfaces C41 fined within said hydrophilic liquid phase within and CA2, which in turn are related to organic phase feed 15 said membrane, substantially insoluble in said hy stream and product stream concentrations through the drophobic feed solution, and having a binding partition or solubility coefficient. specificity for said solute in preference to other In the present instance, the concentration CA1 at equi solutes in said hydrophobic solution, for immuno librium with the initial or inlet concentration of the chemically binding said solute at said interface and S(--) naproxen ester in the toluene feed solution is 20 means for passing a product stream into reactive about 0.005 mM, or about one-half of the water solubil contact with said hydrophilic liquid phase immobi ity of the racemate (0.01 mM). Depletion of the ex lized within the membrane at a second interface tracted S(--) isomer as it is removed from the feed opposite said first interface of said first membrane during the resolution process further lowers the aver thereby to produce a concentration gradient of a age effective concentration C41 to about one-half of the 25 initial or inlet value, or to about 0.0025 mM. A stream of complex of the solute and binding protein across toluene is supplied to the opposite side of the membrane said first membrane sufficient to transport said in order to dilute and remove from the separator the complex from said first interface to said second S(+)-naproxen ester that permeates the membrane. The interface by diffusion, and flowrate of this product stream is adjusted to be several 30 to produce a concentration gradient of said binding. times greater than that of the racemic feed stream in protein across said first membrane sufficient to order to provide sufficient driving force for the facili transport said binding protein from said second tated transport process. Specifically, the average pro interface to said first interface by diffusion, said duct-side aqueous-phase concentration CA2 is main binding protein thereby serving to facilitate prefer tained at about 10% of that at the interface of the mem 35 ential transport of said solute across said membrane brane with the feed stream, or 0.25 uM. from said feed solution to said product stream. Equation (12) above predicts that the optimum value 2. Apparatus for separating a solute from a mixture, of the equilibrium binding will be given by the recipro the apparatus comprising: cal of the geometric mean of these concentrations CA1 first membrane; and CA2. In the present instance, this corresponds to an 40 a second membrane; optimum affinity of about 1.26 x 106 liters/mole. The a hydrophilic liquid phase disposed between said first BABS protein is also selected to have favorable solute and second membranes; binding and release kinetics, consistent with having means for passing a hydrophobic feed solution into small Damkohler numbers as calculated above. In ac reactive contact with said hydrophilic liquid phase cordance with equation (6), the facilitation factor F 45 at a first surface of said first membrane, said hydro obtained with this BABS protein as solute carrier is phobic feed solution comprising a mixture includ approximately 15. ing a desired solute in a solvent substantially immis The significance of this facilitation factor may be cible with said hydrophilic liquid phase; appreciated further with the aid of equation (2), which means for passing a product stream into reactive indicates that 15 times more S(--) ester permeates 50 contact with said hydrophilic liquid phase at a across the liquid membrane in the form of its complex second surface at said second membrane; with BABS than crosses the liquid membrane by pas a binding protein dissolved and substantially confined sive diffusion. The passive diffusion fluxes of the S(--) within said hydrophilic liquid phase, substantially and R(-) enantiomers are equal, with the result that the insoluble in said feed solution and said product S(+) naproxen ester stereoisomer permeates across the 55 solution, and having a binding specificity for said membrane 16 times more rapidly (as both the free solute solute in preference to other solutes in said feed and in the form of its complex with protein) than does solution, for immunochemically binding and ex the corresponding R(-) ester by passive diffusion tracting said solute from said feed solution at said alone. Accordingly, the enantiomeric excess of the first membrane, and for releasing solute into said S(--) naproxen ester product is about (16-1) / (16+1) product stream at said second membrane; and or 88%. means for convectively circulating said hydrophilic The S(--) naproxen ester flux of about 3.4x10-11 liquid phase between said first and second mem mole/sec-cm2 is consistent with that predicted with the branes, thereby to transport a complex of the solute aid of equations (2) and (3). and binding protein through the hydrophilic liquid The invention may be embodied in other specific phase from the first membrane to the second mem forms, and accordingly, other embodiments are within brane and to transport binding protein through the the following claims. hydrophilic liquid phase from said second men What is claimed is: brane to said first membrane and thereby to effect 5,167,824 37 38 selective net transport of said solute from said feed port said binding protein from said second interface solution to said product stream. to said first interface by diffusion. 3. The apparatus of claim 1 or 2 wherein said binding 8. A process for separating a solute from a mixture, protein comprises the process comprising the steps of a first domain defining a binding site comprising at a) maintaining between and in contact with at least least 3 CDR regions held in binding conformation first and second membranes a hydrophilic liquid by FR regions. phase comprising a dissolved binding protein hav 4. The apparatus of claim 3 wherein said binding ing a binding specificity for said solute; protein further comprises: b) passing a hydrophobic feed solution into reactive a second domain for imparting to said binding protein 10 contact with a first interface at one of said mem solubility in said hydrophilic liquid phase. branes to promote formation of an immunochemi 5. The apparatus of claim 1 or 2 wherein said binding cally bonded complex comprising said solute and protein has a binding specificity for one member of a said binding protein at said first interface, said hy pair of optically active proteins. drophobic feed solution comprising a mixture in 6. The apparatus of claim 1 or 2 wherein said binding 15 cluding said solute in a solvent substantially immis protein has an affinity for said solute between 10 and cible with said hydrophilic liquid phase; 109 M-1. c) passing a product stream into reactive contact with 7. A process for separating a solute from a mixture, said hydrophilic liquid phase at a second interface the process comprising the steps of at said second membrane to extract said solute into a) immobilizing a hydrophilic liquid phase within a 20 porous membrane, said hydrophilic liquid phase said product stream and to promote dissociation of comprising a dissolved binding protein having a said solute binding protein complex; and binding specificity for said solute; d) convectively circulating said hydrophilic liquid b) passing a hydrophobic feed solution into reactive phase between said first and second interfaces to contact with said hydrophilic liquid phase at a first 25 effect selective net transport of said solute from interface at said membrane to promote immuno said hydrophobic feed solution to said product chemical binding between said solute in said hydro Stream. phobic feed solution and said binding protein, said 9. The process of claim 7 or 8 wherein said binding hydrophobic feed solution comprising a mixture protein comprises including said solute in a solvent substantially in 30 a first domain defining a binding site comprising at miscible with said hydrophilic liquid phase; least three CDR regions held in binding confirma c) passing a product stream into reactive contact with tion by FR regions. said hydrophilic liquid phase at a second interface 10. The process of claim 9 wherein said binding pro at said membrane to dissolve said solute within said tein further comprises product stream, thereby to 35 a second domain for imparting to said binding protein promote dissociation of said binding protein solute solubility in said liquid phase. complex; 11. The process of claim 7 or 8 wherein said binding produce a concentration gradient of said complex protein as a binding specificity for one member of a pair within and across said membrane sufficient to of optically active compounds. transport said complex from said first interface to 40 12. The process of claim 7 or 9 wherein said binding said second interface by diffusion and protein has an affinity for said preselected solute be produce a concentration gradient of said binding tween 103 and 109M-1. protein across said membrane sufficient to trans k 45

50

55

65 UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 5, 167,824 DATED December 1, 1992 INVENTOR(S) : Charles Cohen et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In claim 2, line 5, (.. column 36, line 38), insert --a-- before "first membrane". In claim 5, last line ( . . column 37, line '124), replace "proteins" with --compounds--. In claim 9, lines 4-5 ( column 38, lines 31-32), replace "confirmation" with --conformation--. In claim 11, second line ( .. column 58, line 58), replace "as" with --has--. In claim 12, first line ( column 38, line 24O), replace '9" with --8--.

Signed and Sealed this Ninth Day of November, 1993

BRUCELEMAN Attesting Officer s Commissioner of Patents and Trademarks