DOCSLIB.ORG

US5167824.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US5167824.Pdf |||||||||||| USOO5167824A United States Patent (19) 11 Patent Number: 5,167,824 Cohen et al. 45 Date of Patent: Dec. 1, 1992 (54) SEPARATION BY CARRIER MEDIATED (56) References Cited TRANSPORT U.S. PATENT DOCUMENTS 75 Inventors: Charles Cohen, Medway; Robert A. 3. E. tal as a - a - a -26% Dishman, Concord; James S. Huston, 4,375,414 3/1983 Strahilevitz ......................... 210/638 Chestnut Hill; Robert L. Bratzler, 4,859,583 8/1989 Heller et al. ...................... 435/28 X Concord; David R. Dodds, Millis; Charles M. Zepp, Berlin, all of Mass. Primary Examiner-Frank Spear Attorney, Agent, or Firm-Testa, Hurwitz & Thibeault 73) Assignees: Creative BioMolecules, Inc., 57 ABSTRACT Hopkinton; Sepracor, Inc., Marlborough, both of Mass. Disclosed are processes and apparatus for separating a desired solute, such as an optically active isomer, from a complex mixture using carrier facilitated transport in (21) Appl. No.: 479,935 an immobilized liquid membrane or carrier facilitated solvent extraction. The carrier is a binding protein se (22 Filed: Feb. 14, 1990 lected and/or engineered to immunochemically revers ibly bind to the solute and to have a significant solubility 51 Int. Cl............................................... B01D 61/28 in the extracting solvent or immobilized liquid men 52 U.S. Cl. ..................................... 210/638; 210/644 brane. 58 Field of Search ....................... 210/638, 644, 632; 435/7.1, 28 12 Claims, 13 Drawing Sheets U.S. Patent Dec. 1, 1992 Sheet 1 of 13 5,167,824 U.S. Patent Dec. 1, 1992 Sheet 8 of 13 5,167,824 550 560 570 580 590 600 GGGTACATTTCCCCATACTCTGGGGTTACCGGCTACAACCAGAAGTTTAAAGGTAAGGCG G Y I S P Y S G W T G Y N Q K F K G K. A Pf M BStEII Dra 610 620 630 640 650 660 ACCCTTACTGTCGACAAATCTTCCTCAACTGCTTACATGGAGCTGCGTTCTTTGACCTCT L T W D K S S S T A Y M. E L R S L T S Sal 670 680 690 700 710 720 GAGGACTCCGCGGTATACTATTGCGCGGGCTCCTCTGGTAACAAATGGGCCATGGATTAT E D S A V Y Y C A G S S G. N. K. W. A. M. D Y SaCII NCOI 730 740 750 760 TGGGGTCATGGTGCTAGCGTTACTGTGAGCTCTTAACTGCAG W G H G A S W T V S S k FIG. 6-2 U.S. Patent Dec. 1, 1992 Sheet 9 of 13 5,167,824 Fig. 7A FIG. 7B FIG.s 7c NH 3. NH3 3 NH3. 3 / y 4 M 4. 4 YN- 2 O 2 O 6 O 2 w--COOT 22 a 'coo- 2 2 2O COO NH 3 14- a 22 M 2O COO U.S. Patent Dec. 1, 1992 Sheet 12 of 13 5,167,824 2 5 2 O 45 O 5 O is is is AOG LWAOL/WD A/6O7W COWCAW/A47/OW/M/ FIG. I.0 O -11 - O -9 -8 -7 -6 AOG LWBOUWD AGO/W COWCAW7A77OW/My FIG. II 5,167,824 1. 2 counts for many of the difficulties encountered in re SEPARATION BY CARRIER MEDIATED solving racenic mixtures. However, these small struc TRANSPORT tural differences may be profound in biological systems, e.g., if the compounds are involved in enzyme-cat BACKGROUND OF THE INVENTION alyzed reactions or bind specifically to cellular recep This invention relates to separation of individual sol tors. Thus, the L-amino acids are metabolized in hu utes from a mixture. More specifically, the invention mans but the corresponding D analogs are not. Only relates to exploitation of carrier mediated transport D-glucose can be phosphorylated and processed into mechanisms in immobilized liquid membrane and re glycogen or degraded by the glycolytic and oxidative lated separation systems. 10 pathways of intermediary metabolism. Similarly, beta There is a continuing need for more efficient methods blockers, pheromones, prostaglandins, steroids, flavor of separating the solutes in mixtures of structurally ing and fragrance agents, pharmaceuticals, pesticides, related bioactive compounds. Synthesis of bioactive herbicides, and many other compounds exhibit critical materials such as pharmaceuticals and pesticides using stereospecificity. In the field of pesticides, for example, organic chemistries often requires separations on a pre 15 Tessier has shown that only two of the eight stereoiso parative scale. The products of expression of engi mers of deltamethrin, a pyrethroid insecticide, have any neered microorganisms and cell lines typically comprise biological activity. (Chemistry and Industry, Mar. 19, a single valuable species in admixture with a host of 1984, p. 199). Other forms of optical isomers are known extraneous proteins, lipids, nucleic acids, and polysac which are of commercial interest. charides. Isolation of pure or substantially pure product 20 Stereochemical purity is also important in the field of on a commercial scale from such mixtures presents a pharmaceuticals, where 12 of the 20 most prescribed significant engineering challenge. Chromatography, drugs exhibit chirality. A case in point is provided by differential precipitation, filtration, and other separation naproxen, or (--) S-2-(6-methoxy-2-naphthyl) propionic technologies are used to remove selectively unwanted acid, used for instance in the management of arthritis. In species. Often, the late-purification stages are most diffi 25 cult and can be achieved only by means of affinity chro this case, the S(--) enantiomer of the drug is known to matography using polyclonal or monoclonal antibodies be 28 times more therapeutically potent than its R(-) which selectively immunochemically bind with the counterpart. Still another example of chiral pharmaceu product. ticals is provided by the family of beta-blockers; the Molecular biology has advanced as a technology 30 L-form of propranolol is known to be 100 times more sufficient to permit production of a variety of valuable potent than the D-enantiomer. biologically active proteins Pending U.S. application Synthesis of chiral compounds by standard organic Ser. Nos. 052,800 and 342,449, and PCT Application synthetic techniques generally leads to a racemic mix US88/01737, disclose biosynthetic multifunctional pro ture which, in the aggregate, may have a relatively low teins comprising plural bioactive domains, one of which 35 specific bioactivity since certain of the stereoisomers in is capable of binding to a preselected compound. The the mixture are likely to be biologically or functionally binding domain is patterned after the antibody binding inactive. As a result, relatively larger quantities of the site and can mimic the binding properties of a light or material must be used to obtain an effective dose, and heavy chain protein, or comprises a single chain con manufacturing costs are increased due to the co-produc struct comprising both light and heavy chains. Such tion of stereochemically "incorrect' and hence, inac constructs may be used in affinity chromatography tive ingredients. Also, the inactive enantiomer may procedures and may have significant cost advantages have unwanted side effects. over monoclonal antibodies. A widely used approach to purifying optical isomers Among the most difficult purification tasks is the is the selective precipitation of the desired compound separation of stereoisomers. Many organic compounds 45 from a racemic mixture. See, for example, U.S. Pat. No. exist in optically active forms, i.e., they have the ability 3,879,451, 4,257,976, 4,151,198, 4,454,344; Harrison et to rotate the plane of plane polarized light. In describing al, J. Med. Chem. 13:203 (1970); Felder et al, UK Patent an optically active compound, the prefixes D and L, or Application No. GB2025968A (1980), and U.S. R and S are used to denote the absolute configuration of 4,285,884. Separation of diastereomers also can be car the molecule about its chiral center(s). The prefixes 50 ried out by chromatography. See, for example, Pollock designate the sign of rotation of plane polarized light by et al, J. Gas Chromatogr. 3:174 (1965); Mikes et al., J. the compound, with (-) or L. meaning that the com Chromatogr. 112:205 (1976); and Hare et al, U.S. Pat. pound is levorotatory. For a given chemical structure, No. 4,290,893. Enzymes have been used for the resolu D and L stereoisomers are mirror images of one an tion of stereoisomers on a preparative scale. For in other. A specific stereoisoner may also be referred to as stance, enzymatic treatment has been applied to the an enantiomer, and a mixture of such isoners is often resolution of racemic mixtures of anino esters. See U.S. called an enantiomeric or racemic mixture. The term Pat. No. 3,963,573, U.S. Pat. No. 4,262,092, Clement "racemic mixture' as used herein, refers to a mixture of and Porter, J. Chen. Ed., 48:695 (1971), and Matta et al at least first and second stereoisomers in any proportion. J. Org. Chem, 39:2291 (1974). Additional examples of Optical activity is typically the result of molecular 60 enzyme-mediated resolution as applied to the produc asymmetry about tetrahedral carbon atoms that are tion of optically purified pharmaceuticals include Sih linked to four different moieties. Where there is only U.S. Pat. No. 4,584,370, Aragozzini et al, Biotechnol one asymmetric carbon atom, or "chiral center', there Letters, 8:95 (1980), Yokozeki et al, EPO No. 0122794 are two possible stereoisomers or enantiomers. Where A2, and Sih, Tetrahedron Letters, 27:1763 (1986). Mul there are n chiral centers, the number of potential ste tiphase and extractive enzyme membrane bioreactors reoisomers increases to 2. The structural differences that selectively produce pure or substantially purified between stereoisomers are subtle and of little conse optically active compounds from achiral precursors or quence in ordinary chemical reactions, and this ac mixtures are disclosed by Matson in U.S. Pat. No. 5,167,824 3 4. 4,800,162. The term "resolution' as used herein, refers as used herein, unless antithetical to its context, refers to separation of a first mixture into second and third broadly to reversible binding of the type that is ubiqui mixtures wherein the proportions of the solutes in the tous in biological systems.
Load more

Recommended publications
  • Acid Dissociation Constant - Wikipedia, the Free Encyclopedia Page 1
    Acid dissociation constant - Wikipedia, the free encyclopedia Page 1 Help us provide free content to the world by donating today ! Acid dissociation constant From Wikipedia, the free encyclopedia An acid dissociation constant (aka acidity constant, acid-ionization constant) is an equilibrium constant for the dissociation of an acid. It is denoted by Ka. For an equilibrium between a generic acid, HA, and − its conjugate base, A , The weak acid acetic acid donates a proton to water in an equilibrium reaction to give the acetate ion and − + HA A + H the hydronium ion. Key: Hydrogen is white, oxygen is red, carbon is gray. Lines are chemical bonds. K is defined, subject to certain conditions, as a where [HA], [A−] and [H+] are equilibrium concentrations of the reactants. The term acid dissociation constant is also used for pKa, which is equal to −log 10 Ka. The term pKb is used in relation to bases, though pKb has faded from modern use due to the easy relationship available between the strength of an acid and the strength of its conjugate base. Though discussions of this topic typically assume water as the solvent, particularly at introductory levels, the Brønsted–Lowry acid-base theory is versatile enough that acidic behavior can now be characterized even in non-aqueous solutions. The value of pK indicates the strength of an acid: the larger the value the weaker the acid. In aqueous a solution, simple acids are partially dissociated to an appreciable extent in in the pH range pK ± 2. The a actual extent of the dissociation can be calculated if the acid concentration and pH are known.
    [Show full text]
  • Determination of Binding Constant and Stoichiometry for Antibody-Antigen Interaction with Surface Plasmon Resonance
    Current Proteomics, 2006, 3, 271-282 271 Determination of Binding Constant and Stoichiometry for Antibody-Antigen Interaction with Surface Plasmon Resonance Shiming Lin1,3,*, Adam Shih-Yuan Lee2, Chih-Chen Lin2 and Chih-Kung Lee3 1Centre for Optoelectronic Biomedicine, National Taiwan University, Taipei, Taiwan; 2Department of Chemistry, Tamkang Univer- sity, Tamsui, Taiwan and 3Institute of Applied Mechanics, National Taiwan University, Taipei, Taiwan Abstract: A surface plasmon resonance (SPR) biosensor technology has recently been applied biochemically and clinically to the study of immunologic recognition and the evaluation of binding parameters for various interactions between antibodies (Abs) and antigens (Ags) at liquid-solid interface. The simple interaction between hapten and Ab fragment, e.g., variable single-chain fragment and antigen- binding fragment, can be described sufficiently by a 1:1 stoichiometry in SPR. However, the determination of the binding constant of an anti-protein Ab is usually complicated by the multivalence of the protein Ag. The SPR-based method enables direct determination of binding constants for a variety of specific Ab-Ag interactions in real-time. It also allows estimation of the binding stoichiometry and binding ratio for low-, intermediate-, and high-affinity Ab-Ag interaction systems. The present review is designed to indicate the theo- retical background of SPR-based biosensor technology as well as to present the great variety of measurement modes of interaction kinet- ics that can be performed with these techniques. Quantitative aspects of the Ab-Ag interaction kinetics are reviewed, focusing especially on mono- and multi-valent Ab-Ag interaction modes using a SPR biosensor. Four model binding systems developed recently for use with SPR biosenser are described with principles and examples: (i) one to one interaction mode, (ii) nonequivalent two-site interaction mode, (iii) multiple equivalent-site interaction mode and (iv) multisite interaction mode.
    [Show full text]
  • Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R
    Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R. Sanders, Dept. of Biochemistry, Vanderbilt University (Updated 3/2017) Table of Contents Introduction 1 The simplest case: 1:1 stoichiometry 3 A short introduction to binding kinetics 3 The variables of binding studies 5 Relationship between thermodynamics and kinetics of binding 5 The attractiveness of studying binding using pure ligand(s) and receptor 7 The model for 1:1 binding 7 Fitting a model to data 9 A little more on 1:1 binding 9 Alternatives to direct and Scatchard plots 11 Measuring concentrations in binding studies 12 What if the receptor/ligand system is more complicated than 1:1? 13 Multiple sites for a single ligand, Kd some for all and constant 13 When 1 ligand binds to multiple receptors 14 Multiple equivalent sites that are homocooperative 15 Heterocooperativity 18 Two ligands compete for the same binding site 19 Survey of methods used to monitor binding 20 Equilibrium dialysis 21 Spectroscopic methods 21 UV spectrophotometry 21 Fluorescence 21 NMR 21 Circular dichroism 21 Binding/Dissociation is slow on spectroscopic time scale 21 Binding/Dissociation is fast on spectroscopic time scale 22 Enzyme kinetics and dose/response pharmacology 23 Calorimetry 24 Chromatographic methods 24 Filter-based methods 25 Gel mobility shift assays 26 Ligand competition assays 27 Checklist of system variable to consider when planning binding studies 28 Checklist of experimental variables to consider when planning binding studies 29 Acid/Base equilibria 30 Strong acids and bases 31 Weak acids and bases 31 Buffers 33 Choice of a buffer 34 Buffer table 37 Buffers: a summary 38 Chelating agents 38 Chelating agent table 39 Concentration units when working with membrane proteins and/or 40 membrane associated ligands.
    [Show full text]
  • I STUDIES on the COORDINATION CHEMISTRY of VANADIUM
    STUDIES ON THE COORDINATION CHEMISTRY OF VANADIUM, BARIUM AND COBALAMINS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Riya Mukherjee May, 2011 i Dissertation written by Riya Mukherjee B.Sc., University of Calcutta, Calcutta, India, 2000 M.Sc., University of Calcutta, Calcutta, India, 2002 Ph.D., Kent State University, 2011 Approved by ___________________________________ , Chair, Doctoral Dissertation Committee Nicola E. Brasch, Ph.D. ___________________________________ , Advisor, Doctoral Dissertation Committee Nicola E. Brasch, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Scott D. Bunge, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Derek S. Damron, Ph.D. ___________________________________, Member, Doctoral Dissertation Committee Soumitra Basu, Ph.D. ___________________________________, Graduate Faculty Representative John R. D. Stalvey, Ph.D. Accepted by _______________________________, Chair, Department of Chemistry & Biochemistry Michael J. Tubergen, Ph.D. ___________________________________ , Dean, College of Arts and Sciences John R. D. Stalvey, Ph.D. ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………………..X LIST OF TABLES…………………………………………………………………..XVII LIST OF SCHEMES……………………………………………………………….....XX DEDICATION…………………………………………………………………...…..XXII ACKNOWLEDGEMENTS………………………………………………………..XXIII ABSTRACT……………………………………………………………………….....XXV LIST OF PUBLICATIONS…………………………………………………..……..XXX
    [Show full text]
  • Analysis of Linked Equilibria
    CHAPTER SEVEN Analysis of Linked Equilibria JiaBei Lin, Aaron L. Lucius1 Department of Chemistry, The University of Alabama at Birmingham, Birmingham, Alabama, USA 1Corresponding author: e-mail address: [email protected] Contents 1. Introduction 161 2. Determination of Ln,0 for an Assembling System 168 3. Global Fitting of Sedimentation Velocity Data as a Function of Protein Concentration Kinetic Considerations 169 4. Global Analysis Using the 1-2-4-6 Model with Rapid Dissociating Oligomers 175 5. Global Analysis Using the 1-2-4-6 Model with Slow Dissociation of Oligomers 180 6. Global Analysis with Rate Constants in the Detectable Range 181 7. Conclusions 183 References 185 Abstract The ATPases associated with diverse cellular activities (AAA+) is a large superfamily of proteins involved in a broad array of biological processes. Many members of this family require nucleotide binding to assemble into their final active hexameric form. We have been studying two example members, Escherichia coli ClpA and ClpB. These two enzymes are active as hexameric rings that both require nucleotide binding for assem- bly. Our studies have shown that they both reside in a monomer, dimer, tetramer, and hexamer equilibrium, and this equilibrium is thermodynamically linked to nucleotide binding. Moreover, we are finding that the kinetics of the assembly reaction are very different for the two enzymes. Here, we present our strategy for determining the self-association constants in the absence of nucleotide to set the stage for the analysis of nucleotide binding from other experimental approaches including analytical ultracentrifugation. 1. INTRODUCTION Determining a binding constant for a protein–ligand interaction is quite possibly one of the most common experiments in biophysics.
    [Show full text]
  • Misinterpretations in Evaluating Interactions of Vanadium Complexes with Proteins and Other Biological Targets
    inorganics Review Misinterpretations in Evaluating Interactions of Vanadium Complexes with Proteins and Other Biological Targets João Costa Pessoa * and Isabel Correia Centro de Química Estrutural and Departamento de Engenharia Química, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa, Portugal; [email protected] * Correspondence: [email protected] Abstract: In aqueous media, VIV- and VV-ions and compounds undergo chemical changes such as hydrolysis, ligand exchange and redox reactions that depend on pH and concentration of the vanadium species, and on the nature of the several components present. In particular, the behaviour of vanadium compounds in biological fluids depends on their environment and on concentration of the many potential ligands present. However, when reporting the biological action of a par- ticular complex, often the possibility of chemical changes occurring has been neglected, and the modifications of the complex added are not taken into account. In this work, we highlight that as soon as most vanadium(IV) and vanadium(V) compounds are dissolved in a biological media, they undergo several types of chemical transformations, and these changes are particularly extensive at the low concentrations normally used in biological experiments. We also emphasize that in case of a biochemical interaction or effect, to determine binding constants or the active species and/or propose mechanisms of action, it is essential to evaluate its speciation in the media where it is acting. This is because the vanadium complex no longer exists in its initial form. Keywords: vanadium; proteins; DNA; fluorescence; binding constants; mechanism of action Citation: Pessoa, J.C.; Correia, I.
    [Show full text]
  • Strategies Using Bio-Layer Interferometry Biosensor Technology for Vaccine Research and Development
    biosensors Review Strategies Using Bio-Layer Interferometry Biosensor Technology for Vaccine Research and Development Rejane L. Petersen ID Pall Fortebio, 47661 Fremont Boulevard, Fremont, CA 94538, USA; [email protected] Received: 14 September 2017; Accepted: 28 October 2017; Published: 31 October 2017 Abstract: Bio-layer interferometry (BLI) real-time, label-free technology has greatly contributed to advances in vaccine research and development. BLI Octet platforms offer high-throughput, ease of use, reliability, and high precision analysis when compared with common labeling techniques. Many different strategies have been used to immobilize the pathogen or host molecules on BLI biosensors for real-time kinetics and affinity analysis, quantification, or high-throughput titer. These strategies can be used in multiple applications and shed light onto the structural and functional aspects molecules play during pathogen-host interactions. They also provide crucial information on how to achieve protection. This review summarizes some key BLI strategies used in human vaccine research and development. Keywords: BLI; vaccine; biosensor; label-free; real-time 1. Introduction Real-time label-free (RT-LF) technologies have greatly contributed to the research, development, and production of vaccines in recent years. Biosensor technologies based on Surface Plasmon Resonance (SPR), Surface Plasmon Resonance Imaging (SPRi), and Bio-Layer Interferometry (BLI) have proven the practicality and effectiveness of monitoring molecular interactions, as binding events can be monitored in real-time without the requirement of supplementary and costly labeling. These RT-LF biosensor techniques are very powerful and useful for the characterization of molecular interactions during most stages of vaccine production and development. Extensive information is available for multiple platforms of SPR [1].
    [Show full text]
  • Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R
    Biomolecular Ligand-Receptor Binding Studies: Theory, Practice, and Analysis Charles R. Sanders, Dept. of Biochemistry, Vanderbilt University Table of Contents Introduction 1 The simplest case: 1:1 stoichiometry 3 A short introduction to binding kinetics 4 The variables of binding studies 5 Relationship between thermodynamics and kinetics of binding 6 The attractiveness of study binding using pure ligand(s) and receptor 7 The model for 1:1 binding 8 Fitting a model to data 9 A little more on 1:1 binding 10 Alternatives to direct and Scatchard plots 12 Measuring concentrations in binding studies 13 What if the receptor/ligand system is more complicated than 1:1? 14 Multiple sites for a single ligand, Kd some for all and constant 14 When 1 ligand binds to multiple receptors 15 Multiple equivalent sites that are homocooperative 16 Heterocooperativity 19 Two ligands compete for the same binding site 20 Survey of methods used to monitor binding 20 Equilibrium dialysis 21 Spectroscopic methods 22 UV spectrophotometry 22 Fluorescence 22 NMR 22 Circular dichroism 22 Binding/Dissociation is slow on spectroscopic time scale 23 Binding/Dissociation is fast on spectroscopic time scale 23 Enzyme kinetics and dose/response pharmacology 24 Calorimetry 25 Chromatographic methods 26 Filter-based methods 27 Gel mobility shift assays 27 Ligand competition assays 29 Checklist of system variable to consider when planning binding studies 29 Checklist of experimental variables to consider when planning binding studies 30 Acid/Base equilibria 31 Strong acids and bases 32 Weak acids and bases 33 Buffers 35 Choice of a buffer 37 Buffer table 39 Buffers: a summary 40 Chelating agents 40 Chelating agent table 41 Concentration units when working with membrane proteins and/or 42 membrane associated ligands.
    [Show full text]
  • A Review on Various Analytical Methods Used in Determination of Dissociation Constant
    Innovare International Journal of Pharmacy and Pharmaceutical Sciences Academic Sciences ISSN- 0975-1491 Vol 6, Issue 8, 2014 Review Article A REVIEW ON VARIOUS ANALYTICAL METHODS USED IN DETERMINATION OF DISSOCIATION CONSTANT BEBEE PATHARE, VRUSHALI TAMBE, VANDANA PATIL Department of pharmaceutics, P. E. S’s, Modern College of Pharmacy [for ladies], Borhadewadi, Moshi, Pune 412105 India. Email: [email protected] Received: 30 Jun 2014 Revised and Accepted: 04 Aug 2014 ABSTRACT Determination of dissociation constant for a drug capable of ionization within a pH range of 1 to 10 is important since solubility and consequently absorption, can be altered by orders of magnitude with changing pH. The dissociation constant [pKa] value, are essential for understanding many fundamental reactions in chemistry. These values reveal the deprotonation state of a molecule in a particular solvent. There is great interest in using experimental methods to calculate the pKa values for many different types of molecules. In this review the most valuable methods for determining accurate pKa values are presented. There are many diverse strategies for determining dissociation constant, so the main aim of the review is to discuss the available analytical methods. Keywords: Dissociation constant, pH, potentiometric measurement, capillary electrophoresis, Deprotonation. INTRODUCTION by locating the inflection point. [16] It is customary to express the dissociation constant of both acidic and basic drug by pKa values. The knowledge of ionization constants is important in the The lower the pKa of an acidic drug, stronger the acid.[17] understanding of certain chemical phenomena particularly for developing new APIs, the pKa has become of great importance Ionization constant [pKa] is one of the important physicochemical because the transport of drugs into cells and across other properties of drugs to understand their site of absorption, membranes is a function of physicochemical properties, and of the distribution to various organs and excretion.
    [Show full text]
  • Topic 4: Equilibrium Binding and Chemical Kinetics Outline
    Topic 4: Equilibrium binding and chemical kinetics Outline: Applications, applications, applications … • use Boltzmann to look at receptor-ligand binding • use Boltzmann to look at PolII-DNA binding and gene transcription • law of mass action and chemical equilibrium • revisit receptor-ligand binding using law of mass action • cooperative binding and switch like response Ligand binding to a receptor Consider the problem of a ligand binding to a receptor. Q: What is the probability that the receptor is bound by ligand? The answer will depend on the ligand concentration and on the energy differnce for a ligand to be bound or unbound to the receptor Definining the problem Free ligand in solution has energy, 휀푠표푙 and when bound to receptor, 휀푏 Use the Boltzmann distribution to calculate P(bound) Need to enumerate states - like what you did in the assignment Ω boxes (# of states) Using Boltzmann: Boltzmann says that the probability of a state is: (add up all the way that state can occur x Boltzmann weight) / (all states x Boltzmann weight) Using results from previous slide: Ω퐿−1 푒−휀푏/푘푇 푒−(퐿−1)휀푠표푙/푘푇 퐿 −Δ휀/푘푇 퐿 − 1 ! (Ω)푒 푝푏표푢푛푑 = 퐿 퐿−1 = Ω Ω 퐿 −Δ휀/푘푇 푒−퐿휀푠표푙/푘푇 + 푒−휀푏/푘푇 푒−(퐿−1)휀푠표푙/푘푇 1 + 푒 퐿! 퐿 − 1 ! Ω where Δ휀 = 휀푏 − 휀푠표푙 < 0 Equilibrium binding constant, K We can express this result in terms of concentration: 푙 = 퐿/푉 and 푙0 = Ω/푉 so Δ휀 푙 − 푒 푘푇 푙0 푝푏표푢푛푑 = Δ휀 푙 − 1+ 푒 푘푇 푙0 or 푙 퐾 푝 = 퐷 푏표푢푛푑 푙 1 + 퐾퐷 where we have defined the equilibrium dissociation constant, 퐾퐷 Δ휀/푘푇 퐾퐷 = 푙0 푒 and has units of concentration, 3 where if the boxes are
    [Show full text]