Expression of Class I Homeobox Genes in Fetal and Adult Murine Skin
Kristina Detmer, H. Jeffrey Lawrence, and Corey Largman San Francisco VA Medical Center, San Francisco, and the Department of Internal Medicine, UC San Francisco School of Medicine, San Francisco, California, U.S.A.
We examined the expression patterns of several class I ho peR) assay. Homeobox gene expression in skin is not con meobox genes in mouse fetal and adult skin. All the genes of fined to the Hox-B locus; the paralogous genes Hoxa-4, -b-4, the Hox-B locus, except Hoxb-l, are expressed in skin from -c-4, and -d-4 are all expressed. The amount of Hoxb-4, -b-2, murine fetuses of 17 and 18 d gestation, at which time the and -c-4 message in skin is relatively constant from the earliest epidermis is undergoing stratification and differentiation. gestational day examined (day 16) through birth at day 19. The amount of individual Hox gene message varies consider Expression of several homeobox genes is also seen in adult ably, but expression of all ~enes is detectable by RNase pro skin. Key words: homeobox/skin/epidermis.] Invest Derma tection except Hoxb-1 , which could not be detected even by toll0l:517-522, 1993 the reverse transcription-polymerase chain reaction (RT-
he vertebrate class I homeobox genes, and the homol In previous work we showed that Hoxb-6 (formerly referred to as ogous HOM-C genes in Drosophila, are a large family Ho.x 2.2) is expressed in fetal murine epidermis [14]. Expression of of developmental genes that appear to playa critical HOXB7 has been shown in embryonic human skin [11], whereas role in segment identity and pattern formation during H?xc-8 expression has been reported in adult mouse skin [15] . We embryogenesis (for reviews see Krumlauf [1,2]). :-""Ished to de.termine if other class I homeobox genes are expressed TheseT genes are expressed in complex overlapping regions in m mouse skm. We examined the expression of the entire Hox-B various embryonic tissues, particularly in the central nervous sys locus as well as t1~e four members of the Deformed {Dfd)-related tem. In addition, disruption of homeobox gene expression by con paralog 111 fetal skm. We also examined the temporal expression stitutive expression or homozygous deletion in transgenic animals pattern of some of these genes in fetal and adult skin. can result in lethal developmental anomalies [3-6]; however, not MATERIALS AND METHODS all tissues in which the gene is expressed are affected, perhaps as a result of at least partial functional redundancy among homeobox Tissue Harvest and RNA Isolation Protocols for animal use were ap genes. In mouse and man, class I homeobox genes are found ~n ~our proved by the San Francisco VAMC Animal Studies committee. Timed clusters (Hox loci) of 9 - 11 genes each. Based on sequence sumlar pregnant female Swiss-Webster mice (Simonson) were killed by cervical dislocation, after CO2 narcosis. Fetuses were dissected free of placental tissue iry, the genes on the clusters can be aligned with each other and wit~1 and decapitated. The skin from the entire trunk, but omitting the head, neck, the Drosophila HOM-C homeobox gene cluster (Fig 1). The prevI and limbs, was peeled away from underlying tissues and quick frozen in ously confusing nomenclature for homeobox genes has recently liquid N 2 • Examination of samples of the skin preparations from 18-d fetuse s been standardized, such that human and murine genes have the by frozen section revealed contamination by small amounts of fat and very same letter and number designation with the human genes capital occasional pieces of muscle. Newborn mice were killed by decapitation afrer ized (HOXB4 = Hoxb-4) [7]. Genes that occupy the same position being anesthesized in an ice/water bath and the skin recovered as from the in each complex are called paralogs. Although the precise functions fetuses. Fetal tissues were stored at -70· C for periods up to 3 d prior to RNA of these genes are unknown, their protein products appear to be isolation. Adult skin was processed immediately after sacrifice without first DNA-binding proteins [8J that function as transcription factors, being frozen. Total RNA was prepared from the skin samples by the guanidinium/ capable of both gene activation and repression [9, to). Althou~h acid/phenol method [16]. Each RNA preparation consisted of all the skins passing references to expressIOn of homeobox genes m f~tal skm from a litter of mice. Combined skins were thawed and minced in buffer have been made by some investigators [11,12], no systematic evalu containing 4 M guanidinium thiocyanate, 25 mM sodium citrate (pH 7.0) , ation of the expression of Hox genes in developing skin has been 0.5% sarcosyl, ~nd 0.1 M 2-mercaptoethanol. Samples were then immedi reported. Skin. is,. in fact, a complex ~nultilayered structure with a ately homogemzed to completely disrupt the tissue in a Polytron homogen variety of speclaltzed appendages (hair folltcles, sweat glands, etc.) Izer (Bnnkman I?struments, Westbury, NY). The resulting solutions were arrayed in spatial patterns [13]. It is therefore reasonable to expect extracted With aCId phenol and RNA isolated by isopropanol precipitation as that homeobox genes might playa role in fetal skin development descnbed. [16]. Whole embryo mRNA was isolated by homogenization in and in the continuing process of differentiation in the adult integu- guamdll1lUm tlllocyanate followed by centrifugation through a cesium chlonde pad as descnbed [17], followed by chromatography on oligo-dT ment. cellulose.
Manuscript received January 29, 1993; accepted for publication May 25, RNase Protection Analysis RNase protection assays were performed by 1993. standard methods [18]. Probes were synthesized by T7, T3, or SP6 polymer Reprint requests to: Dr. Corey Largman, Director, Molecular Hema- ase m the presence of32-P -labeled UTP (800 CijmM, Amersham). Probes topoiesis Research (151 H), San Francisco VA Medical Cenrer, 4150 Clem were purified by electrophoresis through 5% polyacrylamide/ 7M urea gels ent Street, San Francisco, CA 94121. and eluted. Total RNA (100-200,ug) from skin or whole embryo mRNA (4
0022-202X/93/S06.00 Copyright © 1993 by The Society for Investigative Dermatology, Inc.
517 518 DETMER ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Abd-n Abd-A Uhx Ant Scr Dfd ph lah HOM·C 5'
Chromosome Number 5' HOXA 7 (6)
5' HOXB 17 (11)
3' Hoxe 12 (15)
HOXD 2 (2)
Figure 1. Organization of the murine and human Hox Loci. The genomic loci for each of the homeobox clusters are shown in al ignment with the Drosophila HOM-C complex. Vertical groups of Hox genes are al igned to reflect maximal sequence identity between the homeobox domains of the respective genes [1 9,38], and are referred to as paralog groups. Until recently, murine genes were denoted in historical order using numerals, whereas cognate human genes were denoted by letters. The figure uses the newly standardized nomenclature [7]. which has replaced the four chromosomal locus designations of 1 through 4 with A through D, and which numbers the ge nes in order of their 3' to 5' location along the chromosome. Genes for which it is possible to assign a true homologous relationship between a Drosophila gene and murine/human paralogs are boldly outlined. The missing genes on each locus indicated by opel/ circles may represent unidentified genes, or genes that were lost during the course of evolution. The chromosomal location of the human genes is shown, with the corresponding locations of the murine genes in parentheses.
Jig) was mixed with 5 X 10' dpm each of test probe and a probe for murine the published sequence [21]. This region consists of coding sequence 5' to p-act;n and hybridized overnight at 45 ° C. After digestion with RNase A and the homeobox domain; Hoxb-6 contains a 192-nt fragment consisting of95 Tl, the protected fragments were precipitated with ethanol, separated by nt of homeobox sequence and a 5' intron and has been described previously electrophoresis through sequencing gels, and visualized by autoradiography. [14]; HOXB7 contains a 254-nt fragme nt consisting of nt 442-696 of rhe In each RNase protection experiment, a free probe lane was included to published cDN A sequence [11]. The probe consists of the complete homeo determine the migration position for undigested material. For each tran box domain and 66 nt of 5' coding sequence; HOXB8 contains a 245-nt script detected, the migration position of the protected fragment is substan region 3' to the homeobox domain; HOXB9 contains a 350-nt Hac III/ H ae tially smaller than that of the free probe due to the presence of cloning vector III fragment consisting of 77 nt of the homeobox domain and 282 nt of 3' sequences in the probe. This ensures that the bands detected do not represent coding sequence [22]; HOXC4 contains a 250-nc Xho I/Sma I fragment undigested probe. For each experiment, the tRNA control lane showed no consisting of the homeobox domain and 70 nt of 3' coding sequence [23]; protected fragment, again demonstrating that the observed bands were not and HOXD4 contains a 243-nt probe extending from nt 654 to nt 927 of the due to non-specific protection. published sequence [24]. This probe consists of the homeobox domain and 24 and 39 nt of 5' and 3' coding sequence, respectively. Template Preparation DNA fragments of appropriate length from human or murine homeobox genes subcloned into bluescript, pGEM, or Polymerase Chain Reaction The following primers were synthesized: Phagescript were used. The Hoxa-4 probe was derived from a PCR product Hoxb-1 forward primer 5'-GCAGGAATTCGATATCAAGCTCCCAG_ (see below), in which a T7 polymerase site was incorporated into one of the CTATGGGCCTTCTCAGTAT-3'; Hoxb-1 reverse primer 5' -CGCGTA primers. The identity of the expected 254-bp band generated by the amplifi ATACGACTCACTATAAGTGAGAGTGCTGGGTTCTGACGA - 3'; cation with the Hoxa-4 primers was confirmed by restriction mapping. The Hoxb-3 forward primer 51 -GCAGGAATTCGATATCAAGCTTACAC band was purified from a preparative Nusieve gel and transcribed with T7 AAGCGCGCAGCTGG TGGAG-3';Hoxb-3 reverse primer 5' -CGCGTA RNA polymerase to give a probe for RNase protection. Probes were derived ATACGACCTCACTAT ACCAGCCCCTTG GCCTTCTGGTCIT- 1 from murine (Hox b-5, -b-6, and-a-4) or human (HOXB1, -B2, -B3, -B4, -B7, 3'; Hoxa-4 forward primer 5 -AACCGCCTATACCCGGCAGCAAGT_ -B8, -B9, -C4, -D4) sequences. The human genes are the cognates of respec 3'; Hoxa-4 reverse primer 5'-CGCGTAATACGACTCACTATAGGTG tive murine genes (Fig 1). The human and murine cognates show a degree of TGGGCTGTGAGTTG-3'. The underlined sequences are complementary sequence identity sufficient to give well-defined protecte.d bands following to sequences 111 the gene of interest. The additional sequences in the reverse RNase digestion of murine RNA hybridized to human-derived probes. primer include the T7 polymerase binding site. The additional sequences in the forward primers contain restriction sites and were chosen to balance the Probe Description Each of the probes contained a substantial but variable melting profile of the reverse primers. amount of blue script or pGem polylinker preceding the HOX gene of inter mRNA (1 Jig) was reverse transcribed with 20 U Mouse Moloney Leuke· est. HOXB1 contains 196 of cDNA sequence from the region 3' to the mia Virus reverse transcriptase in 50 mM Tris, pH 8.3 , 60 mM KCl, 3 mM
homeobox [19]; HOXB2 contains a 451-nt sequence from Eco Rl (559) to MgCI2 , 5 U RNasin, 1 mg 12- 18 mer oli go dT primer, and 2 mM each Eag 1 (1010) of the published sequence [19] and consists of 128 nt of the dNTP for 2 h at 37'C. Aliquots were amplified in 10 mM Tris, pH 8.3, 50
homeobox and 323 nt of 3' coding sequence; HOXB3 contains a 379-nt mM KCl, 2.5 mM MgCI 2 , 20 mM eac h of the appropriate primer pair, 200 sequence from a Bcl II site (1063) to a Bam HI (1442) of the published mM each dNTP, and 0.25U Taq DNA polymerase. Amplification (30 sequence and consists of 43 nt of hom eo box and 336 nt of3' coding sequence cycles) was carried out in a DNA Thermal Cycler (Perkin Elmer Cetus) [1 9]; HOXB4 contains the first 256 nt (Eco Rl/Apa J) of the cDNA protein according to a program of 94°C-l min, 52°C_ l min, n"C-t min plus 4 coding sequence, which is 5' to the homeobox domain [20]; Hoxb-5 con seconds/cycle. Aliquots of the PCR reaction were separated on 3% Nusieve tains a 440-nt fragment extending from a Bam HI (208) to Hind III (648) of gels and stained with ethidium bromide. VOL. 101, NO.4 OCTOBER 1993 HOMEOBOX GENE EXPRESSION IN SKIN 519
RESULTS Z Z Expression of Hox-B Genes in Fetal Murine Skin Beginning -~ -~ 0 0 CFJ CFJ at 15 -16 d of gestation, we were able to separate fetal mouse skin >- >- (dermis plus epidermis) from underlying tissues. Because harvest of CI:: CI:: CQ CQ '""'~ '""'~ day 16 skin yielded comparatively less RNA, homeobox gene ex f-o E-o pression was initially surveyed by RNase protection analysis using ~ ~ '"-l '"-l '"-l RN A from fetal skin harvested at 17 and 18 d gestation. The results '"-l ...... of the experiments with probes for the Hox-B genes are shown in >- >- >- >- Fig 2. Protected fragments were seen for each of the Hox-B genes ~ ~ ~ ~ ~ Q Q Q z except Hoxb-1 , the 3' most gene of the locus. RNA from whole . . . '? N ." t"- oo CI:: embryos at 12 and 14 d gestation, included as a positive control in ...... each experiment, showed the sa me protected fragment in each case. The doublet observed for Hoxb-3 may represent partial RNase di Hox-B9 gestion of the protected fragment due to "breathing" of the ends of the complex, or possibly to alternatively spliced transcripts for this gene. To confirm that the Hoxb-1 gene was not expressed in fetalmur Hox-B8 ine skin, mRNA from skin harvested at 18 d gestation was subjected to RT-PCR. As shown in Fig 3, primers for Hox b-1 did not amplify cDNA from fetal skin, but a band for Hoxb-1 was detected after reverse transcription and amplification of RNA from whole em Hox-B7 bryos at 10 d gestation. Moreover, a band resulted when the skin cD N A was amplified in the presence of primers for either Hoxa-4 or H oxb-3. Taken together, these res ults indicate that Hoxb-1 is appar ently not expressed in skin at this deveiopment~1 stage. W e note Hox-B6 that skin was not taken from the head, neck, or luubs, and that the H oxb-1 gene may be expressed in these areas.
Expression of a Gene from the Hox-A, Hox-C, and Hox-D Hox-BS Loci We were interested in determining if the other Hox lOCI were active in fetal mouse skin. In some tissues, such as the develop ing spinal cord, .genes. from several Hox loci are expr~ss:d in the same region (reVIewed 111 [25]). In contrast, 111 hematopOIetIC cells, It Hox-B4 appears that different lineages tend to show activation of a sll1~le locus (reviewed in [26]). Accordingly, expression of the munne homolog of DJd on each locus was determined by RNase protection Hox-B3 (Fig 4). All four paralogs were expressed, indicating that homeo box gene expression in developing skin is not restricted to the Hox -B loclls. Each of the paralogs of Hoxb-4 gave a detectable sign a l at exposure times severa.1 times shorter th~n for Hoxb-4, sug Hox-B2 gesting that the other Hox lOCI may be more active than the Hox-B locus.
~ actin TilDe Course of Homcobox Gene Expression The develop mental pattern of expression for Hoxb-2, -b-4,. and -c-4 are shown in Fig 5. The amount of a partICular RNA specIes remams essentlal!y Figure 2 .. Eight of the nine ge nes of the Ho x-B locus are expressed in fetaI murtne skill. Total RNA (200/lg) from skin offetuses from days 17 and 18 of constant in fetal skin harvested at 16, 17, and 18 d gestatIOn, 111 gestatIon were analyzed by RNase protection for expression of the genes of newborn skin (day 19) , and adult skin (3 months). The apparent the Hox-B locus. For each assay, mRNA (4/lg) from whole embryos was small differences in mRNA levels are not observed in repeat experi used as a posItIve control (day 12 embryo samples were not hybridized with ments (compare Figs Sa and b). We have also observed constant the Hoxb-2, -b-3, or -b-7 probes). Following hybridization to 32-P-labeled exp ression of Hoxb-6 [14] , and Ho xb-5 and Hox b-9 in skin from day RNA probes for the Hox gene to be assayed and murine p-actin samples were 15 through newborn (data not shown), suggesting a coml11on ex digested with RNase ?nd the protected fragment separated by' polyacrylam pression pattern for all the Hox genes in this tissue. Ide gel electrophorcSlS. The figure is a composite showing the protected bands for each of the Hox ~robes and a representativc set of protected bands for the act111 probe. The 111dlvldual RNase protection experiments were autoradlOgraphed for the following times: Hoxb-2 (2.5 d), Hox b-3 (5 d); Hoxb-4 (2.5 d); Hoxb-5 (2.5 d); Hoxb-6 {2 .5 d); Hoxb-7 {2.5 d); Hoxb-8 (16 h); DISCUSSION and, Hox b-9 (2 .5 d), respectively. The skin is a complex organ displaying a continuous program of cell differentiation as well as a highly organized pattern of hair follicle growth. During murine embryogenesis, skin histogenesis pro gresses through a series of definable stages [27,28]. From day 8, the layer remain undifferentiated while in contact with the underlying embryo is covered by the periderm, an embryonic and fetal-specific dermis, but cells losing contact with the basement membrane will tissue distinct from the definitive epidermis [29] . A simple stratum undergo differentiation to form the mature epidermis. At day 14 the germinativum layer exists from the end of gastrulation, but remains epidermal la ye rs begin to appear, and follow a complex program of extremely thin until day 12. The dermis becomes detectable by differentiation leading to a highly stratified, water impermeable virtue of its higher cell density at day 12, whereas the boundary barrier at birth on day 19 [27] . between the dermis and the underlying mesenchyme is not well Our data indicate that a large number of class I homeobox genes defined until 16 d gestation [30]. The cells of the germinativul11 are expressed during this period of fetal skin development, from the 520 DETMER ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
flox-BJ flox-A4 lIox-B J Z...... Z ~ ~ 0 0 en en z z ;>< ;>< '" ~ ;;: ...:l ...:l '" ~ ~ 0 ~ ~ '"~ 0 0 :>- CO CO - Hox-B4 Hox-C4 Figure 3. Hoxb- l is not expressed in feta l murine skin. RT-PC R analysis was used to attempt to detect Hoxb-l ge ne express ion in fetal skin. Expres Hox-D4 sion of the Hoxa-4 and Hox h-3 genes was detected in the same fetal skin RNA sample that was not positive for Hoxb-l expression. The Hoxb-l primers were used to successfull y detect the message in a 10-d fetal embryo sa mple. -- - ~ actin .... ea rliest time at which we could obtain tissue (day 15) through birth Figure 4. Genes from each locus are expressed in fetal murine skin. RNase on day 19. W e observed no significant temporal differences in ho protection analysis was used to probe for expression of the genes of the meobox ge ne expression in fetal skin. Although it proved difficult deformed paralog (Hoxa-4, -b-4, -c-4, -d-4) . The fi gure is a composite show ing the protected fragment for each of the Hox ge nes assayed and a repre to harvest tiss ue before 16 d ges tation, we have been able to show sentative set of bands for the fJ- actin probe used as in internal control for the express ion of Hoxb-6 [14] and Hoxb-5 and Hoxb-9 (this work) at 15 d amount of RNA assayed and recovered. The individual RNase protection ges tation. Because Hoxb-9 is the 5' most gene of the Hox-B locus, it experiments were autoradiographcd for the following times: Hoxa-4 (3 h); is li ke ly that we have not detected the earliest stages of Hox-ge ne H oxb-4 (2.5 d) ; H oxc-4 (16 h); and Hoxd-4 (16 b), respectively . ac ti vation in developing skin if express ion in this tissue follows the general pattern seen in spinal cord, in which the 3' Hox genes are expressed ea rlier than the 5' genes of a specific locus [31). Although we assign the observed Hox gene expression to the skin layer, we ca nnot formally rule out expression in the fat cells associated with with continuous proliferative potential and the capacity to give rise our skin preparations. However, we have previously reported that to terminally differentiated cells [34]. A population of stem cells the Hob-6 gene is detected in the epidermis by i" situ hybridization may also be located in the thickened bulge of the hair follicle [14) . Ifl situ hybridization studies have revealed patterns of homeo [35]. The Hox gene expression seen in adult skin thus may be asso box ge ne expression in the developing spinal cord and hindbrain of ciated with the constant differentiation necessary to maintain the 12.5-d or younge r mouse embryos (for references see [32]). epidermis. Whereas in these studies Hox gene expression was not reported in Overlapping spatial gradients of expression of the individual the periderm or dermis, it remains unclear whether low level or genes of a Ho x locus in developing tissue is a recurring motif of locali zed Hox gene expression would have been detected. Addi murine embryogenesis. It has been theorized that pattern formation tional ill sitll hybridization studies will be required to establish the and hence cell fate in developing structures along the A/P axis is temporal expression patterns of homeobox genes during the earliest determined by the combined action of the homeobox genes ex stages of epidermal differentiation. pressed in a particular region (reviewed in [36)). In skin, the most The apparent lack of expression of Hox-B1 in fetal skin also sug obvious patterning occurs in the complex arrangements of hair fol gests, by analogy with hindbrain development, that earlier events in licles. Histiogenesis of the hair occurs via a series of interactions of skin formation need to be examined. The labial-class paralogs Hoxb- epidermis wi~h underlying dermis and at least eight stages of hair 1 and Hoxa- 1 are expressed in 7.5-8-d embryos [33]. but by 12.5 d development have been recognized [30) . Initially, a thickening of the genes ca n not be detected in the central nervous system, al the basal germinativum in response to signals from the dermis re though the other ge nes of the Hox loci can be detected. However, it sults in formation of a placode, from which the hair follicle will should be noted that within the fetal nervous system Hoxb-1 has a ultimately develop. Hair eruption occurs in the mouse 3 - 5 d post very reduced region of expression, in contrast to the relatively broad partum. Because our current studies were performed using RNA areas of activity of the other Hox-B genes. This suggests that Hoxb-1 derived from total skin (dermis plus epidermis), no conclusions can has a speciali zed function and may truly play no role in skin devel be drawn about the anterior/posterior boundaries of expression or opment. about localization of the expression of individual gene or gene clus In the adult animal , the epidermis is continuously renewed as ters in specific layers or structures within the epidermis or dermis. In the co rnified outermost layer is shed. The adult epidermis derives a previous study, ill sit!1 hybridization with a probe derived from from dividing keratinocytes in the basal layer, including stem cells Hoxb-6 ge nomic DNA shows apparent uniform expression in the VOL. 101 , NO.4 OCTOBER 1993 HOMEOBOX GENE EXPRESSION IN SKlN 521 z z z z will require a careful evaluation of transgenic mice bearing homo z z :< ;;; :;; ;;; ;;; ;;; Vl Vl Vl z Vl Vl z zygous deletions of these genes. '" ;;; B ...l ...l ...l ;;; A Vl ...l ...l ...l -< -< -< Vl Z -< .. 1- 1- 1- .. 1- ;;; '" 1- '"...l t;; :t Vl '" -< ...'" '".. 1- .."' 1- "'"" '" '".. .. ,.. ,.. >- 1- We thallk Dr. cllrparkash Sil'lgh Jor the gift oj the mllri'le Hoxb-S probe alld Dr . '".. >- ,.. -< -< -< Z.. ...l -< ;:;0 >- z .. 0 ::> z ...... 0 ..z Q Robb Knlm lauJ for helpflll disCIIssiolls . Several of the '",,"a" probes !Vere killdly :;; ~ ~ ~ ~ z -< ~ ;:;0 ~ ~ '"z ~ "' provided by Dr. Eduardo BOllcillclli. f-/ox-B4 all 404- This !Vork !Vas slIpportcd by thc Vete rall s Affa irs Rescarch Service (CL, HJL), -- A mericall Calleer Society crallt CH-459 (CL) , alld a Christ illc La II dsgraJ Re to. Z83- ",Hox-C4 f-/ox-C4 searc!. Alva rd (KD). Z4Z- to. ,90- • H ox-B2 REFERENCES 147- ~ actin 1. KrumloufR: Evol ution of the vertebrate Hox homeobox genes. Bioessays 14:245- 252, 1992 11 0- 2. McG innis W , Krumlauf 11.: Homeobox genes and axial patterning. Cell 68:283 - 302, 1992 3. lufkin T, Dierich A, leMur M, Mark M, C hambon P: Disruptiollofthe Hox 1.6 hOl11cobox gene results in defects in a region corresponding to its rostral domain of expression. Cell 66:11 05-1119, 1991 67- 4. C hisaka 0, Musci TS. Capecchi MR: Developmental defects of the car, cran ial nerves, and hindbrain resulting from targeted disruption of the mOuse homeo ... ~ actin box gene Hox 1.6. Naillre 355:516-520,1992 5. Balling R. Mutter G, Gruss P, Kessel M: Cranofacial abnormalities induced by ectopic expression of the homeobox gene Hox-1.1 in transgenic mice. Cell 58:337-347,1989 6. W olge muth OJ, Behringer RR, Mosroller MP, Brinster Rl, Palmiter RD: Trans 34- genic mice ovcrcxprcss in g the mouse hOl11cobox-containing gene Hox- 1.4 exhibit abnormal gut development. Na'"re 337:464 - 467,1989 Figure 5_ Hox gene expression remains constant during skin maturation. 7. Scott MP: Vertebrate homeobox gene nomenclature. Cell 71:55 1-553, 1992 A) RNase protection analysis of Hoxc-4 was performed on RNA samples 8. Desplan C, Theis j , O'Farrell PH: The Drosophila developmental gene, en (100 ).lg) from fetal and newborn tissue. B) RNase protection analysis was graded, encodes a sequence-specific DNA binding activity. Na illre 318: 630- 635, 1985 performed on RNA samples (100 Jig, Hoxb-4 and Hoxc-4; 200 ).lg, Hoxb-2) 9. Thali M, Muller MM, Delorenzi M, Matthias P, Bienz M: Drosophila homeotic from fetal, newborn, and adult murine skin. The figure is a composite genes encode transcriptional accivators similar to mammalian OTF-2. Nawre showing the protected bands for each Hox probe and a p-actin control 336:598 - 600, 1988 probe. 10. Winslo,,: GM, Hayas hi S, Krasnow M, Hogness OS, Scott MP: Transcriptional activation by the Antennapedia and Fushi t.razu proteins in cultured Drosoph ila cells. Cell 57: 1017- 1030, 1989 11. Simeone A, Mav ilio F, Acampora 0, Giampaolo A, Faiel la A, Zappavigna V. D'EspoSito M, Panllese M, Russo G, Boncinelli E, Peschle C: Two human homcobox genes, C l and C8: structure anal ysis and expression in embryonic fetal skin within the epidermal layers and over the body [14]. How development. Proc NIlt! Acad Sci USA 84:4914 -4918. 1987 ever Bieberich et al have reported that the Hoxc-8 ge ne is preferen 12. Whiting], Marshall H, Cook M, KrumlaufR, Rigby PW], Stott 0, All eman RK: tiall~ expressed in.the posteri?r areas of adult muri?e skin [15]. Multiple spatially specific enhancers arc required to reconstruct the pattern of Furthermore, in mice transge11lC fo r a construct conta111111g Hoxb-4 Hox 2.6 gene expression. Gelles & Develop 5:2048-2059, 199 1 13. Holbrook KA: Structural and biochemical organogenesis of skin and cutaneous regulatory regions fused to the lac-Z .gene,. staining in fetal skin is appendages in the feru s and neonate. In : Polin RA , Fox WW (cds.). Felal alld restricted to the placodes, areas of thlcken111g between the dermis Nea ll atal Physiology. W. B. Sau nder Co., Philadelphia, 1992 and epidermis that mark the sites of developing hair fo llicles [1 2), 14. Mathews CHE, Detmer K, Lawrence H], largman C: The HOX 2.2 homeobox indicating that in at least one case, homeobox gene expresSIOn IS gene is expressed in epidermal tissue during murine embryogenesis. Diffi:rctJlia lioll 52: 177 - 184, 1993 localized to specifi c structures within the skin. In addition, in situ 15. Bieberich Cj, Ruddle FH, Stenn KS: Differential expression of the Hox 3.1 gene hybridization using a Xe,lOpus homolog of the chicken Hoxc-6 gene in adu lt mouse skin (with discussion). A 1111 NY Acad Sci 642:346-534, reveals an anterior/posterior expression pattern in developing 1991 chicken feather buds (Chuong et ai, 1990). The authors also report 16. C h ~n1CzY ':ski P, Sacchi N: Single-step method of RNA isolation by acid guanidi ilium thlOcyanate-phenol-chloroform extraction. A 1101 Bioe/oem 162:156 - 159 an asymmetric expression pattern for Hoxd-8 in the developing 1987 ' feather bud. 17. Chirgwin ]M, Przybyla AE. MacDonald R], Rutter WJ: Isolation of biologically All the Dfd-related paralogs (Hoxa-4, -b-4, ~c-4 , and -d-4) are actIve nbonuciclc aCid from sourccs cnriched in ribonuclease. Biachem expressed in fetal skin. W e speculate that, as 111 the develop111g 18:5294-5299,1979 central nervous system, another ectodermally derived tissue, all four 18. Gilman M: Prepa ration of cytoplasmic RNA from tissue culture ce lls. In: Ausubel FMea (ed.). Cllrrent Prolowls ill Molerlliar Biolog),. Wiley & Sons, Boston, 1988. Hox loci are active with the possible exception of the labial-related pp 4.1.2- 4.1.6 paralogs (Hoxa-1, -b-1 , and -d-1) . In this regard, ourpreliminary 19. Acampora D, D'Esposito M, Faiell a A, Panne,e M, Migliaccio E, Morelli F. evidence indicates Hoxa-9 and -a-1 0 are also expressed 111 fetal Sk111. Stornaluolo A, Nitro V, Simeone A, Boncinelli E: The human HOX family. NllcI Acids Res 17: 10385-10402 1989 In other tissues, homeobox gene within a particular locus are ex 20. Peverali F, D'Esposito M, Acampo;a 0, Bunone G, Negri M, Faicella A. Stor pressed in overlapping domains, such that gradients of homeo?o nalUolo A, Pa nnese M, Migliaccio E, Simeone A, Del la Vall e G, Boncinelli E: main proteins are presumably found wlthll1 the same developll1.g Expression of HOX homcogcncs in human neuroblastoma cell culture lines. structure [32). In tissues displaying expression of genes from multi Differentiarioll 45:61 - 69, 1990 2 1. Krumlauf R, Holland PW. McVey jH, Hogan Bl: Developmental and spatial ple Hox loci, there is evidence of 10C\:,s sl:'ecificity within the tissue, patterns of exprcssion of the mousc homcobox gcnc. Hox 2.1. Deve/opHlc,,! such as restricted dorsa l/ventral loca l1 zatlOn [25,37). Thus, both the 99:603-617,1987 timing and the orga ni za ti on of the structures in the developing skin 22. Bogarad lD, Utset MF, Awgulcwitsch A, Miki T, Han CP, Ruddle FH: T he may be another instance of pattern formation modulated in part by developmental expression pattern of a new murine homeobox gene: Hox-2.5. DevBioI133:537-549, 1989 gene expression from the homeobox loci. Further studies of the 23. Simeone A, Pannese M, Acampora 0, D'Esposito M, Boncinelli E: At least three patte rns of Hox gene expression in skin, using in situ hybridization, human homcoboxs on chromosome 12 belong to the samc transcription unit. should prove very informative. However, the clearcut demonstra N"c/ Acids Res 16:5379-5390. 1988 tion of a biologic role fo r homeobox genes in skin morphogenesis 24. Mav ilio F, Simeone A, Giampaolo A, Faielb A, Zappavigna V, Acampora 0, 522 DETMER ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY Poi ana G, Russo G, Peschle C, Boncinelli E: Differential and stage-related 32. Kessel M, Gruss P: Homcotic transformations of murine vertebrae and concoIni expression in embryonic tissues of a new human homcobox gene. Nature tant alteration of HOX codes induced by retinoic acid. Cell 67:89-104, 324:664 - 668, 1986 1991 25. Gaunt SJ: Expression patterns of mouse Hox genes: clues to an understanding of 33. Murphy P, Hill RE: Expression of the mouse labial-like homeobox-containing developmental and evolutionary strategies. Bioessays 13:505 - 513, 1991 genes, Hox 2.9 and Hox 1.6 during segmentation of the hindbrain. Development 26. Lawrence HJ, L.1rgman C: Homeobox genes in normal hematopoiesis and leuke 111:61 -74, 1991 mias. Blood 80:2445 - 2453, 1992 34. Watt FM: Proliferation and terminal differentiation of human epidermal kerati 27. Hanson J: The histiogenesis of the epidermis in rat and mouse. ] A"at Lo"d noeytes in culture. Bioel,e", Soc Tra"s 16:666 - 668, 1988 81:174-197,1947 35. Cotsarelis G, Sun T-T, Lavker RM: Label-retaining ce lls reside in the bulge area 28. Rugh R: The MOllse. Its Reprodllctio" a"d Develop",e"t. Burgess Publishing Co., of pilosebaceous unit: implications for follicular stelll cells, hair cycle, and skin Minneapolis, MI, 1968 carcinogenesis. Cell 61: 1329 - 1337, 1990 29. M'Boneko V, Merker HJ: Development and morphology of the periderm of 36. Wright C, Hogan B: Another hit for gene targeting. Natll,. 350:458-459, mouse embryos (days 9-12 gestation). Acta Anat (Basel) 133:325-336, 1991 1988 37. Peterson RL, Jacobs OF, Awgulewitsch A: Hox-3.6: isolation and characteriza_ 30. Sengel P: Morphogenesis of Ski,l. Universiry Press, Cambridge, 1976 tion of a new murine homeobox gene located in the 5' region of the Hox-3 31. Dolle P, Duboule 0: Two gene members of the murine HOX-5 complex show cluster. Mech Dev 37:151-166,1992 regional and cell-type specific expression in developing limbs and gonads. 38. Kessel M, Gruss P: Murine developmental control genes. Seier"e 249:374-379, EMB08:1507-1515,1989 1990