The Orphan Nuclear Receptor SHP Inhibits Apoptosis During the Monocytic Differentiation by Inducing P21waf1

Total Page:16

File Type:pdf, Size:1020Kb

The Orphan Nuclear Receptor SHP Inhibits Apoptosis During the Monocytic Differentiation by Inducing P21waf1 EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 41, No. 6, 429-439, June 2009 The orphan nuclear receptor SHP inhibits apoptosis during the monocytic differentiation by inducing p21WAF1 KyeongJin Kim1, Yoon Ha Choi2, pendent kinase inhibitor p21; monocytes; nuclear re- Hyeong Hoe Kim3,4 and JaeHun Cheong1,4 ceptor subfamily 0, group B, member 2 1Department of Molecular Biology Pusan National University Introduction Busan 609-735, Korea 2Department of Life Science The molecular mechanisms regulating cell differen- Division of Molecular and Life Science tiation involve a fine and complex balance of proteins and signal transduction pathways that Pohang University of Science and Technology modulate the progression through control of cell Pohang 790-784, Korea cycle and cell survival (Scott et al., 1994; Cory, 3Department of Experimental Medicine 1995). Human macrophages are differentiated into College of Medicine, Pusan National University noncycling cells arrested at the G1 checkpoint that Busan 601-721, Korea 4 derive from peripheral blood cycling human mono- Corresponding authors: Tel, 82-51-510-2277; cytes. Although little is known regarding the mole- Fax, 82-51-513-9258; E-mail, [email protected] (J.H. Cheong), cular mechanisms governing the monocyte differen- Tel, 82-51-240-7414; E-mail, [email protected] (H.H. Kim) tiation to macrophage, promonocytic human cell DOI 10.3858/emm.2009.41.6.048 lines, can be triggered to differentiate to human macrophages by defined stimuli (Oberg et al., Accepted 22 January 2009 1993; Henkel et al., 1999). Agents such as phorbol esters (PMA) induce their exit from the cell cycle at Abbreviation: SHP, small heterodimer partner G1, leading to their differentiation, which is characterized by the appearance of macrophage-like features such as cell surface integrins, adherence to plastic, and the production of reactive oxygen Abstract intermediates (Freytag, 1988; Baeuerle and Henkel, 1994; Casini and Pelicci, 1999). U937, human Small heterodimer partner (SHP) is an atypical member leukemic lymphoma cell line with monoblastic of nuclear receptor superfamily that lacks a DNA-bind- characteristics, can be induced to differentiate ing domain. In previous study, we showed that SHP, towards morphologically mature macrophage-like c-jun, p65 of NF-κB subunits, and p21WAF1 ex- cells after treatment with PMA (Larsson et al., 1988; pression was increased during monocytic differ- Lubbert et al., 1991). entiaton with the exposure of human leukemia cells to Treatment of myeloid leukemia cells with PMA is a differentiation agent, PMA. In this study, c-Jun and associated with changes in the expression of p65 were shown to mediate the transcriptional activa- certain early- and late-response genes and level of tion of the SHP promoter. In addition, SHP induced the modification of several transcription factors by cell cycle regulatory protein levels and cooperatively signal pathway. PMA down-regulates c-myc trans- cripts in HL-60 cells and induces expression of the increased an induction of p21WAF1 expression with c-jun gene (Sherman et al., 1990; Szabo et al., p65. Furthermore, SHP protected differentiated cells 1991). Activation of Jun/AP-1 contributes to induc- from etoposide-induced cellular apoptosis through tion of c-jun transcription and monocytic differen- the induction and cytoplasmic sequestration of tiation (Angel et al., 1988; Szabo et al., 1991). The p21WAF1. Complex formation between SHP and differentiated macrophages, in contrast to cycling p21WAF1 was demonstrated by means of coimmuno- monocyte, contain significant levels of NF-κB in the precipitation. These results suggest that SHP pro- nuclei. The differentiation to macrophages triggered longs a cellular survival of differentiating monocytes by plastic adherence or phorbol esters leads to a through the transcriptional regulation of target genes progressive degree of NF-κB nuclear translocation, of cell survival and differentiation. a hallmark of differentiated macrophages. NF-κB plays a key role in cell differentiation by conferring Keywords: apoptosis; cell differentiation; cyclin-de- cell survival that in the case of macrophages is 430 Exp. Mol. Med. Vol. 41(6), 429-439, 2009 mediated through p21WAF1/Cip1 (Pennington et al., for the early stages of the differentiation program 2001). (Jiang et al., 1994; Steinman et al., 1994; Halevy et Small heterodimer partner (SHP) is an atypical al., 1995; Andres and Walsh, 1996). orphan nuclear receptor that lacks a conventional In this study, SHP-overexpressed cell represents DNA binding domain and consists only of putative resistance to apoptosis; moreover, p21 protein is ligand binding domain (Seol et al., 1996). SHP is significantly accumulated in the cytoplamic com- expressed in a wide variety of tissues, with highest partment as a basal level and induced rapidly by expression in heart, brain, liver, lung, and adrenal the apoptosis signal in the SHP-overexpressed cell gland (Johansson et al., 2000). It has been reported line. Additionally, it was confirmed that SHP was that SHP represses the transcriptional activity of a induced from an early phase of monocytic diffe- number of nuclear receptors such as constitutive rentiation prior to a dramatic increase of p21. androstane receptor (CAR), esterogen receptor Together, this study shows that SHP increased by (ER), thyroid hormone receptor (TR), Retinoid X signal of differentiation or apoptosis plays a role to receptor (RXR), hepatocyte nuclear factor 4α (HNF protect monocytic cells from cell death through 4α), androgen receptor (AR), liver receptor homolog rapid and significant accummulation of p21 in the 1 (LRH-1), ER-related receptor-γ (ERRγ), glucocor- cytoplasmic compartment. ticoid receptor (GR), and liver X receptor (LXR) (Seol et al., 1996; Lee et al., 2000; Johansson et al., 2000; Gobinet et al., 2001; Borgius et al., 2002; Results Brendel et al., 2002; Lee and Moore, 2002; Sanyal et al., 2002). Although SHP is well known as the c-Jun and NF-κB p65 increase the transcriptional repressor of various NRs, recently it is identified activation of the SHP promoter that SHP roles as a novel transcription coactivator To investigate the influence on the basal level of of nuclear factor, NF-κB and appears to functions cellular proteins related to monocytic differen- as a distinct regulatory component of the trans- tiation, U937 cells were stimulated with PMA and criptional activities of NF-κB in oxidized LDL-treated, assayed with immunoblotting. As shown as Figure resting macrophage cells (Kim et al., 2001b). It 1A, c-Jun was induced and phosphorylated during was reported that during the procedure of promo- the progression of differentiation. Furthermore, the nocyte cell differentiation of HL-60 leukemia cells level of p65 of NF-κB subunits, SHP, and p21WAF1 toward the monocyte lineage by phorbol ester, were increased by the treatment of PMA. To gain mRNA and protein levels of SHP were increased in insight that the differentiation signaling effects on a time-dependent manner. It seems that SHP plays the transcriptional activation of the SHP promoter, a fundamental role in the processes of monocytic transient transfection assay was analyzed using differentiation (Choi et al., 2004). However, precise the SHP promoter as a reporter construct with functions of SHP in monocytic differentiation have PMA. The result of Figure 1B shows that promoter not been clearly elucidated. In the previous report, activity of SHP is positively regulated by the the role for SHP in the protection of cells against treatment of PMA as a dose-dependent manner. Nur77-mediated apoptosis has been proposed Cycling primary human monocytes have no (Yeo et al., 2005). Anti-apoptosis function of SHP NF-κB in their nuclei. However, their differentiation would be related with the resistance of phorbol into macrophages triggered by PMA significantly ester-differentiated monocytes against apoptosis. leads to nuclear translocation of NF-κB. Its trans- A number of transcription factors have been location into the nucleus by the PMA stimuli implicated in monocyte differentiation together with regulates various genes including monocytic diffe- the transcriptional regulation of the downstream rentiation and cell survival programs (Pennington target gene expression, including p21WAF1 (hereafter et al., 2001). To investigate whether NF-κB regu- referred to as p21) (Freytag, 1988; Nguyen et al., lates transcriptional level of SHP, p65 expression 1993; Scott et al., 1994; Nerlov and Graf, 1998; vector and SHP luciferase-based reporter were Wang et al., 1998; Kelly et al., 2000). p21 inhibits cotransfected. As a result, p65 increased the cell cycle progression by binding to G1 cyclin-CDK transactivation of the SHP promoter and p65 and complexes through its N-terminal domain. In addi- c-Jun increased the expression level of SHP tion, recent studies have shown that p21 promotes synergistically (Figure 1C). It is supported by the the association of Cdk4 with D-type cyclins, and report that SHP plays a role as a coactivator of p65 targets Cdk4 and cyclin D1 to the nucleus (LaBaer in macrophage cells (Kim et al., 2001b). Taken et al., 1997). Thus, the cell cycle inhibitory activity together, these results may indicate that the of p21 is intimately correlated with its nuclear loca- expression level of SHP is associated with trans- lization and this property appears to be responsible criptional induction. SHP inhibits apoptosis via p21 induction 431 p21 induced by SHP in the late monocytic SHP synergistically
Recommended publications
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Role of the Nuclear Receptor Rev-Erb Alpha in Circadian Food Anticipation and Metabolism Julien Delezie
    Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism Julien Delezie To cite this version: Julien Delezie. Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism. Neurobiology. Université de Strasbourg, 2012. English. NNT : 2012STRAJ018. tel- 00801656 HAL Id: tel-00801656 https://tel.archives-ouvertes.fr/tel-00801656 Submitted on 10 Apr 2013 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE CNRS UPR 3212 · Institut des Neurosciences Cellulaires et Intégratives THÈSE présentée par : Julien DELEZIE soutenue le : 29 juin 2012 pour obtenir le grade de : Docteur de l’université de Strasbourg Discipline/ Spécialité : Neurosciences Rôle du récepteur nucléaire Rev-erbα dans les mécanismes d’anticipation des repas et le métabolisme THÈSE dirigée par : M CHALLET Etienne Directeur de recherche, université de Strasbourg RAPPORTEURS : M PFRIEGER Frank Directeur de recherche, université de Strasbourg M KALSBEEK Andries
    [Show full text]
  • Transcriptomic Characterisation of the Molecular Mechanisms Induced by Rgma During Skeletal Muscle Hyperplasia and Hypertrophy
    Transcriptomic Characterisation of the Molecular Mechanisms Induced by RGMa During Skeletal Muscle Hyperplasia and Hypertrophy Aline Gonçalves Lio Copola Universidade Federal de Minas Gerais Íria Gabriela Dias dos Santos Universidade Federal de Minas Gerais Luiz Lehmann Coutinho Universidade de São Paulo Luiz Eduardo Vieira Del Bem Universidade Federal de Minas Gerais Paulo Henrique de Almeida Campos Junior Federal University of São João del-Rei Júlia Meireles Nogueira Universidade Federal de Minas Gerais Alinne do Carmo Costa Universidade Federal de Minas Gerais Gerluza Aparecida Borges Silva Universidade Federal de Minas Gerais Erika Cristina Jorge ( [email protected] ) Universidade Federal de Minas Gerais Research Article Keywords: Axon Guidance, myogenesis, hypertrophy, hyperplasia, skeletal muscle differentiation, transcriptomic analysis Posted Date: June 29th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-646954/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/25 Abstract Background: The repulsive guidance molecule a (RGMa) is a GPI-anchor axon guidance molecule rst found to play important roles during neuronal development. RGMa expression patterns and signalling pathways via Neogenin and/or as BMP coreceptors indicated that this axon guidance molecule could also be working in other processes and diseases, including during myogenesis. Previous works have consistently shown that RGMa is expressed in skeletal muscle cells and that its overexpression induces both nuclei accretion and hypertrophy in muscle cell lineages. However, the cellular components and molecular mechanisms induced by RGMa during the differentiation of skeletal muscle cells are poorly understood. In this work, the global transcription expression prole of RGMa-treated C2C12 myoblasts during the differentiation stage, obtained by RNA- seq, were reported.
    [Show full text]
  • Temporal Change in Gene Expression in the Rat Dentate Gyrus Following Passive Avoidance Learning
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by MURAL - Maynooth University Research Archive Library Journal of Neurochemistry, 2007, 101, 1085–1098 doi:10.1111/j.1471-4159.2006.04418.x Temporal change in gene expression in the rat dentate gyrus following passive avoidance learning Niamh C. O’Sullivan,* Paul A. McGettigan,* Graham K. Sheridan,* Mark Pickering,* Lisa Conboy,* John J. O’Connor,* Paul N. Moynagh,* Desmond G. Higgins, Ciaran M. Regan* and Keith J. Murphy* *Applied Neurotherapeutics Research Group, UCD Schools of Biomolecular and Biomedical Science, UCD Conway Institute, University College Dublin, Belfield, Dublin, Ireland Applied Neurotherapeutics Research Group, UCD Schools of Medicine and Medical Science, UCD Conway Institute, University College Dublin, Belfield, Dublin, Ireland Abstract identified the likely transcription factors controlling gene A learning event initiates a cascade of altered gene expression in each post-training period. The role of NFjB, expression leading to synaptic remodelling within the hippo- implicated in the early post-training period was subsequently campal dentate gyrus, a structure vital to memory formation. confirmed with activation and nuclear translocation seen in To illuminate this transcriptional program of synaptic plasticity dentate granule neurons following training. mRNA changes we used microarrays to quantify mRNA from the rat dentate for four genes, LRP3 (0 h), alpha actin (3 h), SNAP25 and gyrus at increasing times following passive avoidance NSF (6–12 h), were validated at message and/or protein learning. Approximately, 500 known genes were transcrip- level and shown to be learning specific. Thus, the memory- tionally regulated across the 24 h post-training period.
    [Show full text]
  • The Master Regulator Gene PRDM2 Controls C2C12 Myoblasts
    Open Access Insights in Biology and Medicine Research Article The master regulator gene PRDM2 controls C2C12 myoblasts proliferation ISSN 2639-6769 and Differentiation switch and PRDM4 and PRDM10 expression Di Zazzo Erika1#, Bartollino Silvia1*# and Moncharmont Bruno1 1Department of Medicine and Health Sciences “V. Tiberio”, University of Molise, Italy #These authors contributed equally to this work *Address for Correspondence: Silvia Bartollino, Abstract Department of Medicine and Health Sciences, “V. Tiberio”, University of Molise Via F. De Sanctis, The Positive Regulatory Domain (PRDM) protein family gene is involved in a spectrum variety of biological 86100 Campobasso, Italy, Tel.: +39 0874404886, processes, including proliferation, differentiation and apoptosis: its member seem to be transcriptional E-mail: [email protected] regulators highly cell type and tissue peculiar, towards histones modifi cations or recruitment of specifi c Submitted: 11 August 2017 interaction patters to modify the expression of target genes. In this study we analyzed the expression profi le of Approved: 20 September 2017 different member of PRDM gene family focusing our attention on the role of PRDM2, PRDM4 and PRDM10 genes Published: 25 September 2017 in mouse C2C12 cell line, during the differentiation of myoblasts into myotubes and speculate about the role of the protein Retinoblastoma protein-interacting zinc fi nger protein 1-RIZ1, coded by PRDM2 gene, as a regulator Copyright: 2017 Di Zazzo E, et al. This is an open access article distributed under the of the proliferation/differentiation switch. Creative Commons Attribution License, which permits unrestricted use, distribution, and Results showed a reduction of PRDM2, PRDM4 and PRDM10 expression level during the commitment of the reproduction in any medium, provided the differentiation of myoblasts into myotubes.
    [Show full text]
  • Myogenin Is a Specific Marker for Rhabdomyosarcoma: an Immunohistochemical Study in Paraffin-Embedded Tissues S
    Myogenin is a Specific Marker for Rhabdomyosarcoma: An Immunohistochemical Study in Paraffin-Embedded Tissues S. Kumar, M.D., E. Perlman, M.D., C.A. Harris, B.Sc., M. Raffeld, M.D., M. Tsokos, M.D. Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda Maryland (SK, CAH, MR, MT), and Johns Hopkins Hospital, Baltimore, Maryland (EP) specific marker for rhabdomyoblastic differentia- Myogenin belongs to a group of myogenic regula- tion. It gives consistent and easily interpretable re- tory proteins whose expression determines com- sults in routinely fixed tissues. mitment and differentiation of primitive mesenchy- mal cells into skeletal muscle. The expression of KEY WORDS: Myogenin, Rhabdomyosarcoma, myogenin has been demonstrated to be extremely Paraffin-embedded tissue, Immunohistochemistry. specific for rhabdomyoblastic differentiation, which Mod Pathol 2000;13(9):988–993 makes it a useful marker in the differential diagno- sis of rhabdomyosarcomas (RMS) from other malig- The differential diagnosis of rhabdomyosarcomas nant small round cell tumors of childhood. Com- (RMS) from other poorly differentiated pediatric mercially available antibodies capable of detecting round cell tumors, including the Ewing’s sarcoma myogenin in routinely processed formalin-fixed family of tumors (ESFT), neuroblastomas, and hema- paraffin-embedded (FFPE) tissue are now available. topoietic neoplasms can be difficult on histologic In this study, we evaluated myogenin expression grounds alone, although the use of an antibody panel using the monoclonal myf-4 antibody (Novocastra including mic-2, desmin, and hematopoietic lineage- Labs) on FFPE in a large number of pediatric tu- specific antibodies now allows an accurate diagnosis mors in order to define the clinical utility of this in the majority of cases.
    [Show full text]
  • In Vitro Effects of Biologically Active Vitamin D on Myogenesis: a Systematic Review
    SYSTEMATIC REVIEW published: 09 September 2021 doi: 10.3389/fphys.2021.736708 In vitro Effects of Biologically Active Vitamin D on Myogenesis: A Systematic Review Kathryn H. Alliband, Sofia V. Kozhevnikova, Tim Parr, Preeti H. Jethwa* and John M. Brameld Division of Food Nutrition and Dietetics, School of Biosciences, University of Nottingham Sutton Bonington Campus, Loughborough, United Kingdom Vitamin D (VD) deficiency is associated with muscle weakness. A reduction in the incidence of falls in the elderly following VD supplementation and identification of the VD receptor within muscle cells suggests a direct effect of VD on muscle, but little is known about the underlying mechanisms. Here we systematically searched the literature to identify effects of active VD [1,25(OH)2D3] on skeletal muscle myogenesis in vitro, with no restriction on year of publication. Eligibility was assessed by strict inclusion/exclusion criteria and agreed by two independent investigators. Twelve relevant pa-pers were identified using four different cell types (C2C12, primary mouse satellite cells, primary Edited by: chick myoblasts, and primary human myoblasts) and a range of myogenic markers Fátima Regina Mena Barreto Silva, Federal University of Santa (myoD, myogenin, creatine kinase, myosin heavy chain, and myotube size). A clear Catarina, Brazil inhibitory effect of 1,25(OH)2D3 on proliferation was reported, while the effects on Reviewed by: the different stages of differentiation were less consistent probably due to variation Tiziana Pietrangelo, University of Studies G. d’Annunzio in cell type, time points and doses of 1,25(OH)2D3 used. However, myotube size Chieti and Pescara, Italy was consistently increased by 1,25(OH)2D3.
    [Show full text]
  • Transcriptional Control by the Smads
    Downloaded from http://cshperspectives.cshlp.org/ on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptional Control by the SMADs Caroline S. Hill The Francis Crick Institute, Lincoln’s Inn Fields Laboratory, London WC2A 3LY, United Kingdom Correspondence: [email protected] The transforming growth factor-b (TGF-b) family of ligands elicit their biological effects by initiating new programs of gene expression. The best understood signal transducers for these ligands are the SMADs, which essentially act as transcription factors that are activated in the cytoplasm and then accumulate in the nucleus in response to ligand induction where they bind to enhancer/promoter sequences in the regulatory regions of target genes to either activate or repress transcription. This review focuses on the mechanisms whereby the SMADs achieve this and the functional implications. The SMAD complexes have weak affinity for DNA and limited specificity and, thus, they cooperate with other site-specific transcription factors that act either to actively recruit the SMAD complexes or to stabilize their DNA binding. In some situations, these cooperating transcription factors function to integrate the signals from TGF-b family ligands with environmental cues or with information about cell lineage. Activated SMAD complexes regulate transcription via remodeling of the chromatin template. Consistent with this, they recruit a variety of coactivators and corepres- sors to the chromatin, which either directly or indirectly modify histones and/or modulate chromatin structure. he transforming growth factor-b (TGF-b) Although the SMADs are not the only signal Tfamily of ligands, which include the TGF- transducers downstream of the receptors, they bs, the activins, NODAL, bone morphogenetic will be the only transducers discussed here, as proteins (BMPs), and growth and differentia- they are the subject of this review.
    [Show full text]
  • Screening Identifies Small Molecules That Enhance the Maturation Of
    RESEARCH ARTICLE Screening identifies small molecules that enhance the maturation of human pluripotent stem cell-derived myotubes Sridhar Selvaraj1†, Ricardo Mondragon-Gonzalez1,2†, Bin Xu3, Alessandro Magli1,4, Hyunkee Kim1, Jeanne Laine´ 5, James Kiley1, Holly Mckee1, Fabrizio Rinaldi6, Joy Aho6, Nacira Tabti5, Wei Shen1,3,4, Rita CR Perlingeiro1,4* 1Lillehei Heart Institute, Department of Medicine, University of Minnesota, Minneapolis, United States; 2Departamento de Gene´tica y Biologı´a Molecular, Centro de Investigacio´n y de Estudios Avanzados del IPN (CINVESTAV-IPN), Ciudad de Me´xico, Mexico; 3Department of Biomedical Engineering, University of Minnesota, Minneapolis, United States; 4Stem Cell Institute, University of Minnesota, Minneapolis, United States; 5De´partement de Physiologie, Sorbonne Universite´s, Faculte´ de Me´decine site Pitie´-Salpeˆtrie`re, Paris, France; 6Stem Cell Department, Bio-Techne, Minneapolis, United States Abstract Targeted differentiation of pluripotent stem (PS) cells into myotubes enables in vitro disease modeling of skeletal muscle diseases. Although various protocols achieve myogenic differentiation in vitro, resulting myotubes typically display an embryonic identity. This is a major hurdle for accurately recapitulating disease phenotypes in vitro, as disease commonly manifests at later stages of development. To address this problem, we identified four factors from a small molecule screen whose combinatorial treatment resulted in myotubes with enhanced maturation, as shown by the expression profile of myosin heavy chain isoforms, as well as the upregulation of genes related with muscle contractile function. These molecular changes were confirmed by global chromatin accessibility and transcriptome studies. Importantly, we also observed this maturation in *For correspondence: three-dimensional muscle constructs, which displayed improved in vitro contractile force generation [email protected] in response to electrical stimulus.
    [Show full text]
  • The DNA Binding Activity of TAL-1 Is Not Required to Induce Leukemia/ Lymphoma in Mice
    Oncogene (2001) 20, 3897 ± 3905 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc The DNA binding activity of TAL-1 is not required to induce leukemia/ lymphoma in mice Jennifer O'Neil1, Marilisa Billa1, Sarah Oikemus1 and Michelle Kelliher*,1 1University of Massachusetts Medical School, Department of Molecular Genetics and Microbiology and the Cancer Center, 373 Plantation Street, Worcester, Massachusetts, MA 01605, USA Activation of the basic helix ± loop ± helix (bHLH) gene (Kelliher et al., 1996; Condorelli et al., 1996), further TAL-1 (or SCL) is the most frequent gain-of-function demonstrating the oncogenicity of tal-1. Yet, the mutation in pediatric T cell acute lymphoblastic mechanism(s) of tal-1-induced leukemogenesis remains leukemia (T-ALL). Similarly, mis-expression of tal-1 in unclear. the thymus of transgenic mice results in the development In human leukemic Jurkat cells, tal-1 does not of clonal T cell lymphoblastic leukemia. To determine homodimerize, but forms stable heterodimers with the the mechanism(s) of tal-1-induced leukemogenesis, we ubiquitously expressed bHLH E2A proteins, E12 and created transgenic mice expressing a DNA binding E47 (Hsu et al., 1994b). Members of the E2A family mutant of tal-1. Surprisingly, these mice develop disease, include E2-2, HEB and the products of the E2A gene demonstrating that the DNA binding properties of tal-1 E47 and E12 (Murre et al., 1989; Henthorn et al., 1990; are not required to induce leukemia/lymphoma in mice. Hu et al., 1992). Tal-1/E2A heterodimers preferentially However, wild type tal-1 and the DNA binding mutant recognize the E-box consensus sequence CAGATG both form stable complexes with E2A proteins.
    [Show full text]
  • Vitamin D Inhibits Myogenic Cell Fusion and Expression of Fusogenic Genes
    nutrients Article Vitamin D Inhibits Myogenic Cell Fusion and Expression of Fusogenic Genes Tohru Hosoyama 1,*, Hiroki Iida 1,2, Minako Kawai-Takaishi 1 and Ken Watanabe 3 1 Department of Regenerative Medicine, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan; [email protected] (H.I.); [email protected] (M.K.-T.) 2 Department of Orthopaedic Surgery, Nagoya University Graduate School of Medicine, Nagoya, Aichi 466-8560, Japan 3 Department of Bone and Joint Disease, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-562-46-2311 Received: 16 June 2020; Accepted: 18 July 2020; Published: 23 July 2020 Abstract: Vitamin D, a fat-soluble vitamin, is an important nutrient for tissue homeostasis and is recently gaining attention for its role in sarcopenia. Although several studies have focused on the role of vitamin D in muscle homeostasis, the molecular mechanism underlying its action on skeletal muscle remains unclear. This study investigated the role of vitamin D in myogenesis and muscle fiber maintenance in an immortalized mouse myogenic cell line. A high concentration of active vitamin D, 1α,25(OH)2D3, decreased the expression of myogenic regulatory factors (MRFs), myf5 and myogenin in proliferating myoblasts. In addition, high concentration of vitamin D reduced myoblast-to-myoblast and myoblast-to-myotube fusion through the inhibition of Tmem8c (myomaker) and Gm7325 (myomerger), which encode muscle-specific fusion-related micropeptides. A similar inhibitory effect of vitamin D was also observed in immortalized human myogenic cells. A high concentration of vitamin D also induced hypertrophy of multinucleated myotubes by stimulating protein anabolism.
    [Show full text]
  • The Regulation of Myogenin Gene Expression Duringthe Embryonic Development of Tile Mouse
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press The regulation of myogenin gene expression duringthe embryonic development of tile mouse Siu-Pok Yee and Peter w.J. Rigby Laboratory of Eukaryotic Molecular Genetics, Medical Research Council, National Institute for Medical Research, The Ridgeway, Mill Hill, London, NW7 1AA UK The myogenic program can be activated in cultured cells by each of four basic-helix-loop-helix (bHLH) transcription factors, the expression of which is strictly controlled, both temporally and spatially, during embryonic development. To begin to understand the mechanisms by which these regulators ~re regulated themselves, we have used transgenic animals to define the minimal sequences required for the complete recapitulation of the temporal and spatial expression pattern of the myogenin gene during embryogenesis. We show that this can be achieved with only 133 bp of 5'-flanking DNA and identify two essential motifs, which are consensus binding sites for the bHLH proteins and for the proteins of the RSRF family. We show further that these sequences, when juxtaposed to a heterologous promoter, are capable of imposing the myogenin expression pattern. We conclude that the proper regulation of myogenin requires a bHLH protein, most probably Myf-5, the only myogenic bHLH factor known to be present in the embryo at the time that myogenin is activated, and an RSRF-Iike binding activity. Furthermore, the expression pattern of a mutant myogenin promoter lacking the RSRF site reveals the existence of at least two populations of cells within the myotomes and of novel rostrocaudal gradients of expression.
    [Show full text]