DOCSLIB.ORG

Myogenin Is a Specific Marker for Rhabdomyosarcoma: an Immunohistochemical Study in Paraffin-Embedded Tissues S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Myogenin Is a Specific Marker for Rhabdomyosarcoma: an Immunohistochemical Study in Paraffin-Embedded Tissues S Myogenin is a Specific Marker for Rhabdomyosarcoma: An Immunohistochemical Study in Paraffin-Embedded Tissues S. Kumar, M.D., E. Perlman, M.D., C.A. Harris, B.Sc., M. Raffeld, M.D., M. Tsokos, M.D. Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda Maryland (SK, CAH, MR, MT), and Johns Hopkins Hospital, Baltimore, Maryland (EP) specific marker for rhabdomyoblastic differentia- Myogenin belongs to a group of myogenic regula- tion. It gives consistent and easily interpretable re- tory proteins whose expression determines com- sults in routinely fixed tissues. mitment and differentiation of primitive mesenchy- mal cells into skeletal muscle. The expression of KEY WORDS: Myogenin, Rhabdomyosarcoma, myogenin has been demonstrated to be extremely Paraffin-embedded tissue, Immunohistochemistry. specific for rhabdomyoblastic differentiation, which Mod Pathol 2000;13(9):988–993 makes it a useful marker in the differential diagno- sis of rhabdomyosarcomas (RMS) from other malig- The differential diagnosis of rhabdomyosarcomas nant small round cell tumors of childhood. Com- (RMS) from other poorly differentiated pediatric mercially available antibodies capable of detecting round cell tumors, including the Ewing’s sarcoma myogenin in routinely processed formalin-fixed family of tumors (ESFT), neuroblastomas, and hema- paraffin-embedded (FFPE) tissue are now available. topoietic neoplasms can be difficult on histologic In this study, we evaluated myogenin expression grounds alone, although the use of an antibody panel using the monoclonal myf-4 antibody (Novocastra including mic-2, desmin, and hematopoietic lineage- Labs) on FFPE in a large number of pediatric tu- specific antibodies now allows an accurate diagnosis mors in order to define the clinical utility of this in the majority of cases. The expression of markers marker. A total of 119 tumors were studied. These specific for rhabdomyoblastic differentiation is partic- included 48 alveolar RMS (ARMS), 20 embryonal ularly useful in defining lineage in some poorly differ- RMS (ERMS), one spindle cell RMS, 16 Ewing’s sar- entiated/undifferentiated tumors and antibodies to comas (ES), six nephroblastomas, two ectomesen- MyoD1 and myogenin proteins have been found to chymomas, seven precursor hematopoietic neo- be of most use in this regard (1–5). Although staining plasms, five olfactory neuroblastomas, three for MyoD1 was the first to be used in the diagnostic neuroblastomas, six desmoplastic small round cell setting, nonspecific cytoplasmic staining often makes tumors, and five rhabdoid tumors. Distinct nuclear interpretation of results problematic when fixed tis- staining for myogenin was noted in all 69 RMS. sue sections are used (3, 6, 7). Antibodies to myf-4, the Notably, the number of positive tumor cells differed human homologue of myogenin, are also available between the ARMS and ERMS. In ARMS, the major- and have been evaluated in a few studies (3, 6–8). ity of tumor cells (75 to 100%) were positive, in However, these studies have included relatively few contrast to ERMS, in which the positivity ranged cases of RMS, particularly of alveolar subtype (3, 6, 8) ,from rare ؉ to 25% in all but three tumors. Addi- or are reported only in abstract form (6). In addition tionally, myogenin positivity was seen in two of two some have been performed only on frozen sections ectomesenchymomas and in two nephroblastomas (9). In this study, we report our findings with a new, with myogenous differentiation. All other tumors commercially available anti-myogenin antibody in a were clearly negative. Our results indicate that large series of RMS and other pediatric sarcomas to staining for myogenin is an extremely reliable and define the utility of this marker in the routine diag- nostic setting. Copyright © 2000 by The United States and Canadian Academy of Pathology, Inc. VOL. 13, NO. 9, P. 988, 2000 Printed in the U.S.A. MATERIALS AND METHODS Date of acceptance: April 6, 2000. Address reprint requests to: Shimareet Kumar, M.D., Anatomic Pathology, Children’s National Medical Center, 111 Michigan Avenue, NW, Washing- Cases were retrieved from the files of the Labora- ton, DC 20010-2970; fax: 202-884-4030. tory of Pathology, National Cancer Institute, National 988 Institutes of Health, Bethesda, Maryland and The nuclei staining positive: rare positive to 25%, 1ϩ;25 Johns Hopkins Hospital, Baltimore, Maryland. A total to 50%, 2ϩ;50to75%,3ϩ; and 75 to 100%, 4ϩ. of 119 tumors were evaluated, as summarized in Ta- ble 1. These included 69 cases of RMS (48 alveolar RESULTS subtype/ARMS; 20 embryonal subtype/ERMS; one spindle cell RMS) and 50 other tumors, consisting of Diagnosis was based on a combination of routine 16 ESFT, two ectomesenchymomas, six nephroblas- histologic and immunophenotypic criteria as well tomas, seven precursor hematopoietic neoplasms (in- as, in some cases, correlation with ultrastructural cluding four lymphoblastic lymphomas), six desmo- and molecular findings. The alveolar RMS were plastic small round cell tumors (DSRCT), five composed of nests of undifferentiated primitive- olfactory neuroblastomas (ONB), three neuroblasto- appearing small round blue cells in solid nests or mas/ganglioneuroblastomas (NB/GNB), and five rh- with a focal alveolar pattern. In some cases, cells abdoid tumors. Formalin-fixed paraffin-embedded with more abundant eosinophilic cytoplasm or (FFPE) blocks or unstained sections were available for multinucleated giant cell forms were evident. The all of the cases. Routine morphologic and immuno- PAX3/FKHR fusion transcript was detected in 16 of phenotypic studies were performed on 4-␮m thick 22 cases evaluated by RT-PCR. The embryonal RMS hematoxylin- and eosin-stained sections. Staining for were composed of round to spindled cells, often myogenin was also evaluated in a variety of fetal and with eosinophilic cytoplasm, arranged in compactly adult tissues (including skeletal muscle, heart, liver, cellular to more loose areas with a myxoid stroma. lung, kidney, gastrointestinal tract, spleen, lymph The results of staining for myogenin are summa- nodes, and brain). rized in Table 1. Nuclear staining for myogenin was Immunoperoxidase staining for myogenin was seen in all 48 ARMS (Fig. 1, 2, 3), 20 ERMS (Fig. 4), performed using the myf-4 antibody (L026, 1:10, as well as in the spindle cell RMS. The results of mouse monoclonal, Novocastra Labs, Burlingame, grading in the RMS cases are summarized in Table CA), according to the manufacturer’s recom- 2. Grade 4ϩ staining with 75 to 100% of nuclei mended protocol. Antigen retrieval was done in a staining positive was present in 44 ARMS, two cases pressure cooker for 40 min in 10 mM citrate buffer showed 3ϩ staining and in another two cases only with 0.1% Tween 20 at pH 6.0. Slides were incu- 20% of nuclei stained, consistent with 1ϩ staining. bated overnight with the primary antibody, fol- In contrast, in the ERMS group, 17 of 20 cases lowed by detection using standard protocol on an showed 1ϩ staining, with the number of positive automated immunostainer (Ventana Medical Sys- staining nuclei ranging from rare positive to 25%. In tems, Tuscon, AZ), according to the manufacturer’s three ERMS, staining was graded as 2ϩ, with 25 to instructions. Other immunoperoxidase stains in- 50% nuclei positive. None of the ERMS showed cluded actin (HHF35, ENZO, Farmingdale, NY), Grade 3ϩ or 4ϩ staining. The single case classified desmin (D33), Der 11, NSE, 12E7 (p30/32mic2) (all as spindle cell RMS showed 3ϩ staining. In 66 of the from DAKO, Carpinteria, CA), AE1/3 (Boehringer 69 RMS, desmin-stained slides were available for Mannheim, Indianapolis, IN), and S100 (Biogenex, review and all cases stained desmin-positive. In San Ramon, CA). some of the more primitive appearing ARMS, how- Staining for myogenin was graded from 1ϩ to 4ϩ ever, the number of myogenin-positive cells clearly as follows, based on the percentage of tumor cell exceeded the desmin positivity (Fig. 5). TABLE 1. Results of Immunostaining with myf-4 in Various Pediatric Tumors Diagnosis (# of Cases) myf-4 Rhabdomyosarcoma (69) 69/69ϩ Alveolar (48) 48/48ϩ Embryonal (20) 20/20ϩ Spindle cell (1) 1/1ϩ Other pediatric sarcomas (50) 0/50ϩ ESFT (16) 0/14ϩ Nephroblastoma (6) 2/6ϩa Ectomesenchymoma (2) 2/2ϩ DSRCT (6) 0/6ϩ Rhabdoid (5) 0/5ϩ Precursor hematopoeitic neoplasms (7) 0/7ϩ NB/GNB (4) 0/4ϩ Olfactory neuroblastoma (5) 0/5ϩ ESFT, Ewing’s sarcoma family of tumors; DSRCT, desmoplastic small round cell tumor; NB/GNB, neuroblastoma/ganglioneuroblastoma. FIGURE 1. Tumor cells with intense nuclear positivity infiltrate in a These two nephroblastomas had myogenous differentiation. solid nests as well as line spaces in an alveolar rhabdomyosarcoma. Myogenin Expression in RMS (S. Kumar, et al.) 989 FIGURE 2. A case of solid alveolar rhabdomyosarcoma with the FIGURE 4. Scattered but distinctly myogenin-positive cells in an majority of cells showing nuclear staining (4ϩ staining). embryonal rhabdomyosarcoma. Nuclei in some of the multinucleated rhabdomyoblasts are also positive. TABLE 2. Grading of Myogenin Expression in ARMS & ERMS Staining for myf-4 Diagnosis Grade 1 Grade 2 Grade 3 Grade 4 ARMS (48) 2 0 2 44 ERMS (20) 17 3 0 0 RMS, rhabdomyosarcoma; ARMS, alveolar RMS; ERMS, embryonal RMS. FIGURE 3. Staining for myf-4 in an alveolar rhabdomyosarcoma metastatic to the lymph node. Distinct nuclear positivity is seen in tumor cells within the subcapsular sinus whereas adjacent small lymphocytes are negative. Myogenin-positive cells were identified in the two ectomesenchymomas, correlating with the desmin positive areas. In one case, the majority of the tumor was composed of undifferentiated cells that expressed only mic-2, whereas, in focal areas, the mic-2 positive cells also co-expressed myoge- FIGURE 5. The number of tumor cells staining for myogenin (A) are nin, desmin and actin, as illustrated in Figure 6, more numerous than those marking with desmin (B) in a solid alveolar A-C. Staining for myogenin (as well as desmin) was rhabdomyosarcoma.
Load more

Recommended publications
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Role of the Nuclear Receptor Rev-Erb Alpha in Circadian Food Anticipation and Metabolism Julien Delezie
    Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism Julien Delezie To cite this version: Julien Delezie. Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism. Neurobiology. Université de Strasbourg, 2012. English. NNT : 2012STRAJ018. tel- 00801656 HAL Id: tel-00801656 https://tel.archives-ouvertes.fr/tel-00801656 Submitted on 10 Apr 2013 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE CNRS UPR 3212 · Institut des Neurosciences Cellulaires et Intégratives THÈSE présentée par : Julien DELEZIE soutenue le : 29 juin 2012 pour obtenir le grade de : Docteur de l’université de Strasbourg Discipline/ Spécialité : Neurosciences Rôle du récepteur nucléaire Rev-erbα dans les mécanismes d’anticipation des repas et le métabolisme THÈSE dirigée par : M CHALLET Etienne Directeur de recherche, université de Strasbourg RAPPORTEURS : M PFRIEGER Frank Directeur de recherche, université de Strasbourg M KALSBEEK Andries
    [Show full text]
  • Transcriptomic Characterisation of the Molecular Mechanisms Induced by Rgma During Skeletal Muscle Hyperplasia and Hypertrophy
    Transcriptomic Characterisation of the Molecular Mechanisms Induced by RGMa During Skeletal Muscle Hyperplasia and Hypertrophy Aline Gonçalves Lio Copola Universidade Federal de Minas Gerais Íria Gabriela Dias dos Santos Universidade Federal de Minas Gerais Luiz Lehmann Coutinho Universidade de São Paulo Luiz Eduardo Vieira Del Bem Universidade Federal de Minas Gerais Paulo Henrique de Almeida Campos Junior Federal University of São João del-Rei Júlia Meireles Nogueira Universidade Federal de Minas Gerais Alinne do Carmo Costa Universidade Federal de Minas Gerais Gerluza Aparecida Borges Silva Universidade Federal de Minas Gerais Erika Cristina Jorge ( [email protected] ) Universidade Federal de Minas Gerais Research Article Keywords: Axon Guidance, myogenesis, hypertrophy, hyperplasia, skeletal muscle differentiation, transcriptomic analysis Posted Date: June 29th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-646954/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/25 Abstract Background: The repulsive guidance molecule a (RGMa) is a GPI-anchor axon guidance molecule rst found to play important roles during neuronal development. RGMa expression patterns and signalling pathways via Neogenin and/or as BMP coreceptors indicated that this axon guidance molecule could also be working in other processes and diseases, including during myogenesis. Previous works have consistently shown that RGMa is expressed in skeletal muscle cells and that its overexpression induces both nuclei accretion and hypertrophy in muscle cell lineages. However, the cellular components and molecular mechanisms induced by RGMa during the differentiation of skeletal muscle cells are poorly understood. In this work, the global transcription expression prole of RGMa-treated C2C12 myoblasts during the differentiation stage, obtained by RNA- seq, were reported.
    [Show full text]
  • Temporal Change in Gene Expression in the Rat Dentate Gyrus Following Passive Avoidance Learning
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by MURAL - Maynooth University Research Archive Library Journal of Neurochemistry, 2007, 101, 1085–1098 doi:10.1111/j.1471-4159.2006.04418.x Temporal change in gene expression in the rat dentate gyrus following passive avoidance learning Niamh C. O’Sullivan,* Paul A. McGettigan,* Graham K. Sheridan,* Mark Pickering,* Lisa Conboy,* John J. O’Connor,* Paul N. Moynagh,* Desmond G. Higgins, Ciaran M. Regan* and Keith J. Murphy* *Applied Neurotherapeutics Research Group, UCD Schools of Biomolecular and Biomedical Science, UCD Conway Institute, University College Dublin, Belfield, Dublin, Ireland Applied Neurotherapeutics Research Group, UCD Schools of Medicine and Medical Science, UCD Conway Institute, University College Dublin, Belfield, Dublin, Ireland Abstract identified the likely transcription factors controlling gene A learning event initiates a cascade of altered gene expression in each post-training period. The role of NFjB, expression leading to synaptic remodelling within the hippo- implicated in the early post-training period was subsequently campal dentate gyrus, a structure vital to memory formation. confirmed with activation and nuclear translocation seen in To illuminate this transcriptional program of synaptic plasticity dentate granule neurons following training. mRNA changes we used microarrays to quantify mRNA from the rat dentate for four genes, LRP3 (0 h), alpha actin (3 h), SNAP25 and gyrus at increasing times following passive avoidance NSF (6–12 h), were validated at message and/or protein learning. Approximately, 500 known genes were transcrip- level and shown to be learning specific. Thus, the memory- tionally regulated across the 24 h post-training period.
    [Show full text]
  • The Master Regulator Gene PRDM2 Controls C2C12 Myoblasts
    Open Access Insights in Biology and Medicine Research Article The master regulator gene PRDM2 controls C2C12 myoblasts proliferation ISSN 2639-6769 and Differentiation switch and PRDM4 and PRDM10 expression Di Zazzo Erika1#, Bartollino Silvia1*# and Moncharmont Bruno1 1Department of Medicine and Health Sciences “V. Tiberio”, University of Molise, Italy #These authors contributed equally to this work *Address for Correspondence: Silvia Bartollino, Abstract Department of Medicine and Health Sciences, “V. Tiberio”, University of Molise Via F. De Sanctis, The Positive Regulatory Domain (PRDM) protein family gene is involved in a spectrum variety of biological 86100 Campobasso, Italy, Tel.: +39 0874404886, processes, including proliferation, differentiation and apoptosis: its member seem to be transcriptional E-mail: [email protected] regulators highly cell type and tissue peculiar, towards histones modifi cations or recruitment of specifi c Submitted: 11 August 2017 interaction patters to modify the expression of target genes. In this study we analyzed the expression profi le of Approved: 20 September 2017 different member of PRDM gene family focusing our attention on the role of PRDM2, PRDM4 and PRDM10 genes Published: 25 September 2017 in mouse C2C12 cell line, during the differentiation of myoblasts into myotubes and speculate about the role of the protein Retinoblastoma protein-interacting zinc fi nger protein 1-RIZ1, coded by PRDM2 gene, as a regulator Copyright: 2017 Di Zazzo E, et al. This is an open access article distributed under the of the proliferation/differentiation switch. Creative Commons Attribution License, which permits unrestricted use, distribution, and Results showed a reduction of PRDM2, PRDM4 and PRDM10 expression level during the commitment of the reproduction in any medium, provided the differentiation of myoblasts into myotubes.
    [Show full text]
  • In Vitro Effects of Biologically Active Vitamin D on Myogenesis: a Systematic Review
    SYSTEMATIC REVIEW published: 09 September 2021 doi: 10.3389/fphys.2021.736708 In vitro Effects of Biologically Active Vitamin D on Myogenesis: A Systematic Review Kathryn H. Alliband, Sofia V. Kozhevnikova, Tim Parr, Preeti H. Jethwa* and John M. Brameld Division of Food Nutrition and Dietetics, School of Biosciences, University of Nottingham Sutton Bonington Campus, Loughborough, United Kingdom Vitamin D (VD) deficiency is associated with muscle weakness. A reduction in the incidence of falls in the elderly following VD supplementation and identification of the VD receptor within muscle cells suggests a direct effect of VD on muscle, but little is known about the underlying mechanisms. Here we systematically searched the literature to identify effects of active VD [1,25(OH)2D3] on skeletal muscle myogenesis in vitro, with no restriction on year of publication. Eligibility was assessed by strict inclusion/exclusion criteria and agreed by two independent investigators. Twelve relevant pa-pers were identified using four different cell types (C2C12, primary mouse satellite cells, primary Edited by: chick myoblasts, and primary human myoblasts) and a range of myogenic markers Fátima Regina Mena Barreto Silva, Federal University of Santa (myoD, myogenin, creatine kinase, myosin heavy chain, and myotube size). A clear Catarina, Brazil inhibitory effect of 1,25(OH)2D3 on proliferation was reported, while the effects on Reviewed by: the different stages of differentiation were less consistent probably due to variation Tiziana Pietrangelo, University of Studies G. d’Annunzio in cell type, time points and doses of 1,25(OH)2D3 used. However, myotube size Chieti and Pescara, Italy was consistently increased by 1,25(OH)2D3.
    [Show full text]
  • Transcriptional Control by the Smads
    Downloaded from http://cshperspectives.cshlp.org/ on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptional Control by the SMADs Caroline S. Hill The Francis Crick Institute, Lincoln’s Inn Fields Laboratory, London WC2A 3LY, United Kingdom Correspondence: [email protected] The transforming growth factor-b (TGF-b) family of ligands elicit their biological effects by initiating new programs of gene expression. The best understood signal transducers for these ligands are the SMADs, which essentially act as transcription factors that are activated in the cytoplasm and then accumulate in the nucleus in response to ligand induction where they bind to enhancer/promoter sequences in the regulatory regions of target genes to either activate or repress transcription. This review focuses on the mechanisms whereby the SMADs achieve this and the functional implications. The SMAD complexes have weak affinity for DNA and limited specificity and, thus, they cooperate with other site-specific transcription factors that act either to actively recruit the SMAD complexes or to stabilize their DNA binding. In some situations, these cooperating transcription factors function to integrate the signals from TGF-b family ligands with environmental cues or with information about cell lineage. Activated SMAD complexes regulate transcription via remodeling of the chromatin template. Consistent with this, they recruit a variety of coactivators and corepres- sors to the chromatin, which either directly or indirectly modify histones and/or modulate chromatin structure. he transforming growth factor-b (TGF-b) Although the SMADs are not the only signal Tfamily of ligands, which include the TGF- transducers downstream of the receptors, they bs, the activins, NODAL, bone morphogenetic will be the only transducers discussed here, as proteins (BMPs), and growth and differentia- they are the subject of this review.
    [Show full text]
  • Screening Identifies Small Molecules That Enhance the Maturation Of
    RESEARCH ARTICLE Screening identifies small molecules that enhance the maturation of human pluripotent stem cell-derived myotubes Sridhar Selvaraj1†, Ricardo Mondragon-Gonzalez1,2†, Bin Xu3, Alessandro Magli1,4, Hyunkee Kim1, Jeanne Laine´ 5, James Kiley1, Holly Mckee1, Fabrizio Rinaldi6, Joy Aho6, Nacira Tabti5, Wei Shen1,3,4, Rita CR Perlingeiro1,4* 1Lillehei Heart Institute, Department of Medicine, University of Minnesota, Minneapolis, United States; 2Departamento de Gene´tica y Biologı´a Molecular, Centro de Investigacio´n y de Estudios Avanzados del IPN (CINVESTAV-IPN), Ciudad de Me´xico, Mexico; 3Department of Biomedical Engineering, University of Minnesota, Minneapolis, United States; 4Stem Cell Institute, University of Minnesota, Minneapolis, United States; 5De´partement de Physiologie, Sorbonne Universite´s, Faculte´ de Me´decine site Pitie´-Salpeˆtrie`re, Paris, France; 6Stem Cell Department, Bio-Techne, Minneapolis, United States Abstract Targeted differentiation of pluripotent stem (PS) cells into myotubes enables in vitro disease modeling of skeletal muscle diseases. Although various protocols achieve myogenic differentiation in vitro, resulting myotubes typically display an embryonic identity. This is a major hurdle for accurately recapitulating disease phenotypes in vitro, as disease commonly manifests at later stages of development. To address this problem, we identified four factors from a small molecule screen whose combinatorial treatment resulted in myotubes with enhanced maturation, as shown by the expression profile of myosin heavy chain isoforms, as well as the upregulation of genes related with muscle contractile function. These molecular changes were confirmed by global chromatin accessibility and transcriptome studies. Importantly, we also observed this maturation in *For correspondence: three-dimensional muscle constructs, which displayed improved in vitro contractile force generation [email protected] in response to electrical stimulus.
    [Show full text]
  • The DNA Binding Activity of TAL-1 Is Not Required to Induce Leukemia/ Lymphoma in Mice
    Oncogene (2001) 20, 3897 ± 3905 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc The DNA binding activity of TAL-1 is not required to induce leukemia/ lymphoma in mice Jennifer O'Neil1, Marilisa Billa1, Sarah Oikemus1 and Michelle Kelliher*,1 1University of Massachusetts Medical School, Department of Molecular Genetics and Microbiology and the Cancer Center, 373 Plantation Street, Worcester, Massachusetts, MA 01605, USA Activation of the basic helix ± loop ± helix (bHLH) gene (Kelliher et al., 1996; Condorelli et al., 1996), further TAL-1 (or SCL) is the most frequent gain-of-function demonstrating the oncogenicity of tal-1. Yet, the mutation in pediatric T cell acute lymphoblastic mechanism(s) of tal-1-induced leukemogenesis remains leukemia (T-ALL). Similarly, mis-expression of tal-1 in unclear. the thymus of transgenic mice results in the development In human leukemic Jurkat cells, tal-1 does not of clonal T cell lymphoblastic leukemia. To determine homodimerize, but forms stable heterodimers with the the mechanism(s) of tal-1-induced leukemogenesis, we ubiquitously expressed bHLH E2A proteins, E12 and created transgenic mice expressing a DNA binding E47 (Hsu et al., 1994b). Members of the E2A family mutant of tal-1. Surprisingly, these mice develop disease, include E2-2, HEB and the products of the E2A gene demonstrating that the DNA binding properties of tal-1 E47 and E12 (Murre et al., 1989; Henthorn et al., 1990; are not required to induce leukemia/lymphoma in mice. Hu et al., 1992). Tal-1/E2A heterodimers preferentially However, wild type tal-1 and the DNA binding mutant recognize the E-box consensus sequence CAGATG both form stable complexes with E2A proteins.
    [Show full text]
  • Vitamin D Inhibits Myogenic Cell Fusion and Expression of Fusogenic Genes
    nutrients Article Vitamin D Inhibits Myogenic Cell Fusion and Expression of Fusogenic Genes Tohru Hosoyama 1,*, Hiroki Iida 1,2, Minako Kawai-Takaishi 1 and Ken Watanabe 3 1 Department of Regenerative Medicine, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan; [email protected] (H.I.); [email protected] (M.K.-T.) 2 Department of Orthopaedic Surgery, Nagoya University Graduate School of Medicine, Nagoya, Aichi 466-8560, Japan 3 Department of Bone and Joint Disease, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-562-46-2311 Received: 16 June 2020; Accepted: 18 July 2020; Published: 23 July 2020 Abstract: Vitamin D, a fat-soluble vitamin, is an important nutrient for tissue homeostasis and is recently gaining attention for its role in sarcopenia. Although several studies have focused on the role of vitamin D in muscle homeostasis, the molecular mechanism underlying its action on skeletal muscle remains unclear. This study investigated the role of vitamin D in myogenesis and muscle fiber maintenance in an immortalized mouse myogenic cell line. A high concentration of active vitamin D, 1α,25(OH)2D3, decreased the expression of myogenic regulatory factors (MRFs), myf5 and myogenin in proliferating myoblasts. In addition, high concentration of vitamin D reduced myoblast-to-myoblast and myoblast-to-myotube fusion through the inhibition of Tmem8c (myomaker) and Gm7325 (myomerger), which encode muscle-specific fusion-related micropeptides. A similar inhibitory effect of vitamin D was also observed in immortalized human myogenic cells. A high concentration of vitamin D also induced hypertrophy of multinucleated myotubes by stimulating protein anabolism.
    [Show full text]
  • The Regulation of Myogenin Gene Expression Duringthe Embryonic Development of Tile Mouse
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press The regulation of myogenin gene expression duringthe embryonic development of tile mouse Siu-Pok Yee and Peter w.J. Rigby Laboratory of Eukaryotic Molecular Genetics, Medical Research Council, National Institute for Medical Research, The Ridgeway, Mill Hill, London, NW7 1AA UK The myogenic program can be activated in cultured cells by each of four basic-helix-loop-helix (bHLH) transcription factors, the expression of which is strictly controlled, both temporally and spatially, during embryonic development. To begin to understand the mechanisms by which these regulators ~re regulated themselves, we have used transgenic animals to define the minimal sequences required for the complete recapitulation of the temporal and spatial expression pattern of the myogenin gene during embryogenesis. We show that this can be achieved with only 133 bp of 5'-flanking DNA and identify two essential motifs, which are consensus binding sites for the bHLH proteins and for the proteins of the RSRF family. We show further that these sequences, when juxtaposed to a heterologous promoter, are capable of imposing the myogenin expression pattern. We conclude that the proper regulation of myogenin requires a bHLH protein, most probably Myf-5, the only myogenic bHLH factor known to be present in the embryo at the time that myogenin is activated, and an RSRF-Iike binding activity. Furthermore, the expression pattern of a mutant myogenin promoter lacking the RSRF site reveals the existence of at least two populations of cells within the myotomes and of novel rostrocaudal gradients of expression.
    [Show full text]
  • (Myodn) Recovers the Differentiation of Skeletal Muscle Myoblasts
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434717; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Myogenetic oligodeoxynucleotide (myoDN) recovers the differentiation of 2 skeletal muscle myoblasts deteriorated by diabetes mellitus 3 4 Shunichi Nakamura1, Shinichi Yonekura2,3, Takeshi Shimosato1,2,3, 5 Tomohide Takaya1,2,3* 6 7 1Department of Agriculture, Graduate School of Science and Technology, 8 Shinshu University, Nagano, Japan; 9 2Department of Agricultural and Life Sciences, Faculty of Agriculture, 10 Shinshu University, Nagano, Japan; 11 3Department of Biomolecular Innovation, Institute for Biomedical Sciences, 12 Shinshu University, Nagano, Japan 13 14 *For correspondence: 15 Tomohide Takaya 16 [email protected]. 17 18 Running title: myoDN recovers diabetic myoblast differentiation 19 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434717; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 2 20 Abstract 21 Sarcopenic obesity is a complication of decreased muscle mass and strength 22 associated with obesity, and sarcopenia associated with diabetes mellitus 23 (DM) is a serious risk factor that may result in mortality. Deteriorated 24 differentiation of muscle precursor cells, called myoblasts, in DM patients is 25 considered to be one of the causes of muscle atrophy.
    [Show full text]