Proc. Natl. Acad. Sci. USA Vol. 92, pp. 6354-6358, July 1995 Genetics Correction of chromosomal instability and sensitivity to diverse mutagens by a cloned cDNA of the XRCC3 DNA repair gene (irslSF/crosslinking agents/genetic complementation/chromosomal aberrations) ROBERT S. TEBBS*t, YING ZHAOt, JAMES D. TUCKER*, JULIA B. SCHEERER*, MICHAEL J. SICILIANOt, MONA HWANG*, NAN LIU*, RANDY J. LEGERSKIt, AND LARRY H. THOMPSON*§ *Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, Livermore, CA 94551-0808; and tDepartment of Molecular Genetics, University of Texas Cancer Center, Houston, TX 77030 Communicated by Evelyn Witkin, Princeton, NJ, March 24, 1995 ABSTRACT The mutagen-sensitive CHO line irslSF was thecin (5-fold), and the cross-linking agents mitomycin C (MMC), previously isolated on the basis of hypersensitivity to ionizing cisplatin, nitrogen mustard, and melphalan (all 20- to 60-fold) radiation and was found to be chromosomally unstable as well (refs. 6 and 7 and results presented here). irslSFwas also reported as cross-sensitive to diverse kinds of DNA-damaging agents. to have '50% reduced efficiency of both single-strand break The analysis of somatic cell hybrids formed between irslSF rejoining and repair replication, elevated spontaneous chromo- and human lymphocytes implicated a human gene (defined as somal aberrations (10-24% abnormal cells), hypomutability in XRCC3; x-ray repair cross-complementing), which partially response to x-rays, but a normal baseline for sister chromatid restored mitomycin C resistance to the mutant. A functional exchange (6). We describe here the cloning of a cDNA sequence cDNA that confers mitomycin C resistance was transferred to that corrects x-ray and cross-linking sensitivities, as well as irslSF cells by transforming them with an expression cDNA spontaneous chromosomal aberrations of irslSF, and we have library and obtaining primary and secondary transformants. localized the corresponding gene to human chromosome 14q32.3. Functional cDNA clones were recovered from a cosmid library prepared from a secondary transformant. Transformants also MATERIALS AND METHODS showed partial correction of sensitivity to cisplatin and y-rays, efficient correction of chromosomal instability, and Cell Culture and Mutagen Exposure. Wild-type CHO AA8, substantially improved plating efficiency and growth rate. irslSF, and transformants (TFs) were cultured in monolayer or The XRCC3 cDNA insert is -2.5 kb and detects an -3.0-kb suspension at 37°C as described (8). Cell survival curves in the mRNA on Northern blots. The cDNA was mapped by fluores- presence of MMC or cisplatin were obtained by exposing cence in situ hybridization to human chromosome 14q32.3, exponentially growing 10-ml cultures of 105 cells to the drug at which was consistent with the chromosome concordance data 37°C for 1 h in suspension. Treatment was terminated on ice, of two independent hybrid clone panels. and the cells were centrifuged and resuspended in fresh medium for plating. Plating efficiency was assessed in triplicate DNA repair is a universal process in living cells that maintains 10-cm dishes (300 cells each), and survival was measured by the structural integrity of chromosomal DNA molecules in the using triplicate dishes with various inocula. Cells were exposed face of damage arising from environmental insults, as well as to 137Cs 'y-rays in 15-ml polystyrene tubes at 104 cells per ml in from normal metabolic processes. Considerable progress has 10 ml of medium at a dose rate of 2.83 Gy/min. Cells were kept been made in identifying genes in human cells that determine on ice before and after exposure until they were plated. Dishes DNA-repair pathways, especially nucleotide and base excision were incubated sufficiently long to allow the majority of repair. Nucleotide excision repair (NER) is responsible for colonies to be clearly macroscopic in size-plates exposed to removing most types of bulky chemical adducts and the major high doses were incubated longer than those exposed to low photoproducts arising from UV radiation. The excision prod- doses. For chromosome aberration analysis, colcemid was uct is an oligonucleotide 27-29 bases in length (1). Base added to 0.1 ,ug/ml to cultures 4 h prior to harvest. The cells excision repair acts on smaller lesions including (m)ethylated, were then fixed three times in methanol/acetic acid (3:1, oxidized, and depurinated bases, as well as nonligatable breaks, vol/vol), dropped onto slides and air dried. After aging for and results in a repair patch of one or several nucleotides (2, 3). several days, the slides were stained in 5% Giemsa and coded. The use of mutant cell lines assigned to genetic complementation DNA Transfections. The human cDNA expression library in groups has been the main approach to identifying the individual vector pEBS7 (9) was isolated by using Qiagen column chro- enzymatic steps of the NER pathway (4). matography (Qiagen, Chatsworth, CA). Calcium phosphate/ In rodent cells a wide variety of mutants showing sensitivity DNA precipitates containing 15 ,ug (fraction 2, 2-4 kb) of this to ionizing radiation have been reported, and many of these DNA were used to transfect irslSF cells in 10-cm dishes (4 x mutants have complex phenotypes showing sensitivity to other 106 cells per dish) as described (10). Cells were then incubated kinds of DNA-damaging agents (5). The analysis of these for a 48-h expression period (approximately two doubling mutants and their complementing genes holds considerable times for irslSF; see Table 1), trypsinized, and plated at 1 x promise for identifying components of mammalian DNA 106 cells per dish in 25 ml of medium containing 15 nM MMC repair that remain poorly understood. Mutants isolated on the (Sigma) and 70 ,g of hygromycin B (Calbiochem) per ml. basis of hypersensitivity to one agent have often shown much Secondary transfections were done by using precipitates con- greater sensitivity to other agents. An example is the CHO taining 25 jig of high molecular weight genomic DNA (from mutant irslSF that was isolated as a moderately (2-fold) x-ray- sensitive mutant (6) but was found to have cross-sensitivity to UV Abbreviations: MMC, mitomycin C; NER, nucleotide excision repair; radiation (2.5-fold), ethyl methanesulfonate (2.3-fold), campto- TF, transformant; FISH, fluorescence in situ hybridization. tPresent address: Laboratory of Radiobiology and Environmental Health, University of California, San Francisco, CA 94143-0750. The publication costs of this article were defrayed in part by page charge §Biology and Biotechnology Research Program, L452, Lawrence payment. This article must therefore be hereby marked "advertisement" in Livermore National Laboratory, P.O. Box 808, Livermore, CA accordance with 18 U.S.C. §1734 solely to indicate this fact. 94551-0808. 6354 Downloaded by guest on September 28, 2021 Genetics: Tebbs et al. Proc. Natl. Acad. Sci. USA 92 (1995) 6355 TF F2.bl) per dish with 2 x 106 irslSF cells. Electroporation filter, and photographed without image processing onto Kodak was used to test cosmid and plasmid clones for correcting Ektachrome 160 slide film as described (17). activity; 6 x 106 irslSF cells were electroporated (BRL Cell Porator) with 10 ,ug of cosmid DNA or 5 ,ug of pXR3 plasmid (see below) DNA at 230 V/1600 ,F. RESULTS Cosmid Library Construction and Screening. Vector Su- Cloning a Functional cDNA That Confers MMC Resistance perCos 1 was prepared according to the manufacturer's sug- to irslSF. We exploited the MMC sensitivity of mutant irslSF gestions (Stratagene). Genomic DNA from secondary trans- to clone the complementing cDNA by transfecting cells with a formant 2T.4 was prepared as described (11) and ligated to cDNA expression library in pEBS7, which carries the gene for SuperCos 1 arms. The ligation mixture was packaged accord- hygromycin resistance and the cytomegalovirus viral promoter ing to the manufacturer's protocol by using Gigapack II Gold for the cDNA (9). Since pEBS7 may not replicate episomally packaging extract (Stratagene). Packaged cosmids were used in hamster cells, it was used as an integrating vector. Trans- to infect host bacteria DH5aMCR, which were then spread fected irslSF cells were selected in medium containing 70 ,ug onto filters (Whatman HATF045) on 15-cm dishes containing of hygromycin per ml and 15 nM MMC. From the equivalent Luria broth and 50 ,ug of kanamycin sulfate (Boehringer of 4.7 x 105 hygromycin-resistant TFs, two colonies showing Mannheim) per ml at 8 x 104 colony-forming units per dish. significant MMC resistance were isolated. Genomic DNA was Colonies were lysed, and the DNA was fixed to the filters as isolated from one primary TF (F2.bl) and used in a secondary described (8). PCR primers 5'-CTCTCGGAGGGCGAA- transformation to obtain four MMC-resistant clones from 2.7 GAAT and 5'-AGATGTTGGCGACCTCGTAA were used x 108 transfected cells selected in MMC and hygromycin. to synthesize a 616-bp hygromycin gene fragment, which was Transformants were analyzed by Southern blotting, and sec- labeled by using random primers (Boehringer Mannheim) and ondary TF 2T.4 showed a single BamHI restriction fragment used to probe the cosmid library. Cosmid Cosmid DNAs when probed with the hygromycin gene, while the primary TF Analysis. digested with restriction F2.bl contained bands not Genomic enzymes were separated by electrophoresis through a 0.8% multiple (results shown). agarose gel and analyzed by Southern blotting as described DNA from TF 2T.4 was used to construct a cosmid library, (11) with minor modifications. Oligonucleotides 5'-CTA- which was probed with a 616-bp fragment of the hygromycin GAGAACCCACTGCTTAACTGGC and 5'-TGTCACAC- gene. Since the hygromycin gene is located <1.5 kb from the CACAGAAGTAAGGTTCC (located 5' and 3', respectively, cDNA insert in vector pEBS7, it served as a linked marker for of the cloning site in vector pEBS7) were 32P-labeled according detecting cosmids likely to carry the functional cDNA.