DOCSLIB.ORG

Correction of Chromosomal Instability and Sensitivity to Diverse

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Correction of Chromosomal Instability and Sensitivity to Diverse Proc. Natl. Acad. Sci. USA Vol. 92, pp. 6354-6358, July 1995 Genetics Correction of chromosomal instability and sensitivity to diverse mutagens by a cloned cDNA of the XRCC3 DNA repair gene (irslSF/crosslinking agents/genetic complementation/chromosomal aberrations) ROBERT S. TEBBS*t, YING ZHAOt, JAMES D. TUCKER*, JULIA B. SCHEERER*, MICHAEL J. SICILIANOt, MONA HWANG*, NAN LIU*, RANDY J. LEGERSKIt, AND LARRY H. THOMPSON*§ *Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, Livermore, CA 94551-0808; and tDepartment of Molecular Genetics, University of Texas Cancer Center, Houston, TX 77030 Communicated by Evelyn Witkin, Princeton, NJ, March 24, 1995 ABSTRACT The mutagen-sensitive CHO line irslSF was thecin (5-fold), and the cross-linking agents mitomycin C (MMC), previously isolated on the basis of hypersensitivity to ionizing cisplatin, nitrogen mustard, and melphalan (all 20- to 60-fold) radiation and was found to be chromosomally unstable as well (refs. 6 and 7 and results presented here). irslSFwas also reported as cross-sensitive to diverse kinds of DNA-damaging agents. to have '50% reduced efficiency of both single-strand break The analysis of somatic cell hybrids formed between irslSF rejoining and repair replication, elevated spontaneous chromo- and human lymphocytes implicated a human gene (defined as somal aberrations (10-24% abnormal cells), hypomutability in XRCC3; x-ray repair cross-complementing), which partially response to x-rays, but a normal baseline for sister chromatid restored mitomycin C resistance to the mutant. A functional exchange (6). We describe here the cloning of a cDNA sequence cDNA that confers mitomycin C resistance was transferred to that corrects x-ray and cross-linking sensitivities, as well as irslSF cells by transforming them with an expression cDNA spontaneous chromosomal aberrations of irslSF, and we have library and obtaining primary and secondary transformants. localized the corresponding gene to human chromosome 14q32.3. Functional cDNA clones were recovered from a cosmid library prepared from a secondary transformant. Transformants also MATERIALS AND METHODS showed partial correction of sensitivity to cisplatin and y-rays, efficient correction of chromosomal instability, and Cell Culture and Mutagen Exposure. Wild-type CHO AA8, substantially improved plating efficiency and growth rate. irslSF, and transformants (TFs) were cultured in monolayer or The XRCC3 cDNA insert is -2.5 kb and detects an -3.0-kb suspension at 37°C as described (8). Cell survival curves in the mRNA on Northern blots. The cDNA was mapped by fluores- presence of MMC or cisplatin were obtained by exposing cence in situ hybridization to human chromosome 14q32.3, exponentially growing 10-ml cultures of 105 cells to the drug at which was consistent with the chromosome concordance data 37°C for 1 h in suspension. Treatment was terminated on ice, of two independent hybrid clone panels. and the cells were centrifuged and resuspended in fresh medium for plating. Plating efficiency was assessed in triplicate DNA repair is a universal process in living cells that maintains 10-cm dishes (300 cells each), and survival was measured by the structural integrity of chromosomal DNA molecules in the using triplicate dishes with various inocula. Cells were exposed face of damage arising from environmental insults, as well as to 137Cs 'y-rays in 15-ml polystyrene tubes at 104 cells per ml in from normal metabolic processes. Considerable progress has 10 ml of medium at a dose rate of 2.83 Gy/min. Cells were kept been made in identifying genes in human cells that determine on ice before and after exposure until they were plated. Dishes DNA-repair pathways, especially nucleotide and base excision were incubated sufficiently long to allow the majority of repair. Nucleotide excision repair (NER) is responsible for colonies to be clearly macroscopic in size-plates exposed to removing most types of bulky chemical adducts and the major high doses were incubated longer than those exposed to low photoproducts arising from UV radiation. The excision prod- doses. For chromosome aberration analysis, colcemid was uct is an oligonucleotide 27-29 bases in length (1). Base added to 0.1 ,ug/ml to cultures 4 h prior to harvest. The cells excision repair acts on smaller lesions including (m)ethylated, were then fixed three times in methanol/acetic acid (3:1, oxidized, and depurinated bases, as well as nonligatable breaks, vol/vol), dropped onto slides and air dried. After aging for and results in a repair patch of one or several nucleotides (2, 3). several days, the slides were stained in 5% Giemsa and coded. The use of mutant cell lines assigned to genetic complementation DNA Transfections. The human cDNA expression library in groups has been the main approach to identifying the individual vector pEBS7 (9) was isolated by using Qiagen column chro- enzymatic steps of the NER pathway (4). matography (Qiagen, Chatsworth, CA). Calcium phosphate/ In rodent cells a wide variety of mutants showing sensitivity DNA precipitates containing 15 ,ug (fraction 2, 2-4 kb) of this to ionizing radiation have been reported, and many of these DNA were used to transfect irslSF cells in 10-cm dishes (4 x mutants have complex phenotypes showing sensitivity to other 106 cells per dish) as described (10). Cells were then incubated kinds of DNA-damaging agents (5). The analysis of these for a 48-h expression period (approximately two doubling mutants and their complementing genes holds considerable times for irslSF; see Table 1), trypsinized, and plated at 1 x promise for identifying components of mammalian DNA 106 cells per dish in 25 ml of medium containing 15 nM MMC repair that remain poorly understood. Mutants isolated on the (Sigma) and 70 ,g of hygromycin B (Calbiochem) per ml. basis of hypersensitivity to one agent have often shown much Secondary transfections were done by using precipitates con- greater sensitivity to other agents. An example is the CHO taining 25 jig of high molecular weight genomic DNA (from mutant irslSF that was isolated as a moderately (2-fold) x-ray- sensitive mutant (6) but was found to have cross-sensitivity to UV Abbreviations: MMC, mitomycin C; NER, nucleotide excision repair; radiation (2.5-fold), ethyl methanesulfonate (2.3-fold), campto- TF, transformant; FISH, fluorescence in situ hybridization. tPresent address: Laboratory of Radiobiology and Environmental Health, University of California, San Francisco, CA 94143-0750. The publication costs of this article were defrayed in part by page charge §Biology and Biotechnology Research Program, L452, Lawrence payment. This article must therefore be hereby marked "advertisement" in Livermore National Laboratory, P.O. Box 808, Livermore, CA accordance with 18 U.S.C. §1734 solely to indicate this fact. 94551-0808. 6354 Downloaded by guest on September 28, 2021 Genetics: Tebbs et al. Proc. Natl. Acad. Sci. USA 92 (1995) 6355 TF F2.bl) per dish with 2 x 106 irslSF cells. Electroporation filter, and photographed without image processing onto Kodak was used to test cosmid and plasmid clones for correcting Ektachrome 160 slide film as described (17). activity; 6 x 106 irslSF cells were electroporated (BRL Cell Porator) with 10 ,ug of cosmid DNA or 5 ,ug of pXR3 plasmid (see below) DNA at 230 V/1600 ,F. RESULTS Cosmid Library Construction and Screening. Vector Su- Cloning a Functional cDNA That Confers MMC Resistance perCos 1 was prepared according to the manufacturer's sug- to irslSF. We exploited the MMC sensitivity of mutant irslSF gestions (Stratagene). Genomic DNA from secondary trans- to clone the complementing cDNA by transfecting cells with a formant 2T.4 was prepared as described (11) and ligated to cDNA expression library in pEBS7, which carries the gene for SuperCos 1 arms. The ligation mixture was packaged accord- hygromycin resistance and the cytomegalovirus viral promoter ing to the manufacturer's protocol by using Gigapack II Gold for the cDNA (9). Since pEBS7 may not replicate episomally packaging extract (Stratagene). Packaged cosmids were used in hamster cells, it was used as an integrating vector. Trans- to infect host bacteria DH5aMCR, which were then spread fected irslSF cells were selected in medium containing 70 ,ug onto filters (Whatman HATF045) on 15-cm dishes containing of hygromycin per ml and 15 nM MMC. From the equivalent Luria broth and 50 ,ug of kanamycin sulfate (Boehringer of 4.7 x 105 hygromycin-resistant TFs, two colonies showing Mannheim) per ml at 8 x 104 colony-forming units per dish. significant MMC resistance were isolated. Genomic DNA was Colonies were lysed, and the DNA was fixed to the filters as isolated from one primary TF (F2.bl) and used in a secondary described (8). PCR primers 5'-CTCTCGGAGGGCGAA- transformation to obtain four MMC-resistant clones from 2.7 GAAT and 5'-AGATGTTGGCGACCTCGTAA were used x 108 transfected cells selected in MMC and hygromycin. to synthesize a 616-bp hygromycin gene fragment, which was Transformants were analyzed by Southern blotting, and sec- labeled by using random primers (Boehringer Mannheim) and ondary TF 2T.4 showed a single BamHI restriction fragment used to probe the cosmid library. Cosmid Cosmid DNAs when probed with the hygromycin gene, while the primary TF Analysis. digested with restriction F2.bl contained bands not Genomic enzymes were separated by electrophoresis through a 0.8% multiple (results shown). agarose gel and analyzed by Southern blotting as described DNA from TF 2T.4 was used to construct a cosmid library, (11) with minor modifications. Oligonucleotides 5'-CTA- which was probed with a 616-bp fragment of the hygromycin GAGAACCCACTGCTTAACTGGC and 5'-TGTCACAC- gene. Since the hygromycin gene is located <1.5 kb from the CACAGAAGTAAGGTTCC (located 5' and 3', respectively, cDNA insert in vector pEBS7, it served as a linked marker for of the cloning site in vector pEBS7) were 32P-labeled according detecting cosmids likely to carry the functional cDNA.
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • Protein Biomarkers Analysis Within Muscular Dystrophies
    EXAMENSARBETE INOM BIOTEKNIK, AVANCERAD NIVÅ, 30 HP STOCKHOLM, SVERIGE 2017 Protein biomarkers analysis within muscular dystrophies SANDRA MENA KTH SKOLAN FÖR BIOTEKNOLOGI PROTEIN BIOMARKERS ANALYSIS WITHIN MUSCULAR DYSTROPHIES Master thesis Author: Sandra Carolina Mena Pérez Supervisor: Cristina Al-Khalili Szigyarto Stockholm 2017 Master’s program: Medical Biotechnology Kungliga Tekniska Högskolan Content Abstract .........................................................................................................................................................1 Abstrakt .........................................................................................................................................................1 Introduction .................................................................................................................................................1 Materials and Methods ............................................................................................................................ 3 Results and Discussion ............................................................................................................................ 4 Conclusion .................................................................................................................................................. 11 Future Perspectives ................................................................................................................................. 11 Aknowledgments ....................................................................................................................................
    [Show full text]
  • Integration of the Drug-Gene Interaction Database (Dgidb) with Open Crowdsource Efforts
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.301721; this version posted September 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Integration of the Drug-Gene Interaction Database (DGIdb) with open crowdsource efforts Sharon Freshour1,2,†, Susanna Kiwala2,†, Kelsy C. Cotto1,2,†, Adam C. Coffman2, Joshua F. McMichael2, Jonathan Song1,2, Malachi Griffith1,2,3,4,*, Obi L. Griffith1,2,3,4,*, Alex H. Wagner1,2,5,6,* 1 Department of Medicine, Division of Oncology, Washington University School of Medicine, St Louis, MO, 63110, USA 2 McDonnell Genome Institute, Washington University School of Medicine, St Louis, MO, 63108, USA 3 Department of Genetics, Washington University School of Medicine, St Louis, MO, 63110, USA 4 Siteman Cancer Center, Washington University School of Medicine, St Louis, MO, 63110, USA 5 The Steve and Cindy Rasmussen Institute for Genomic Medicine, Nationwide Children’s Hospital, Columbus, OH, 43215, USA 6 Department of Pediatrics, The Ohio State University College of Medicine, Columbus, OH, 43210, USA * To whom correspondence should be addressed. Tel: 1-614-355-1645; Fax: 1-614-355-6833; Email: [email protected] Correspondence may also be addressed to Obi L. Griffith. Tel: 1-314-747-9248; Fax: 1-314-286-1810; Email: [email protected] Correspondence may also be addressed to Malachi Griffith. Tel: 1-314-286-1274; Fax: 1-314-286-1810; Email: [email protected] † The authors wish it to be known that, in their opinion, the first three authors should be regarded as joint First Authors ABSTRACT The Drug-Gene Interaction Database (DGIdb, www.dgidb.org) is a web resource that provides information on drug-gene interactions and druggable genes from various sources including publications, databases, and other web-based sources in one resource.
    [Show full text]
  • Anti-CKB Monoclonal Antibody, Clone 904DU30.2.2 (DCABH-6668) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-CKB monoclonal antibody, clone 904DU30.2.2 (DCABH-6668) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Mouse monoclonal to Creatine kinase B type Antigen Description Reversibly catalyzes the transfer of phosphate between ATP and various phosphogens (e.g. creatine phosphate). Creatine kinase isoenzymes play a central role in energy transduction in tissues with large, fluctuating energy demands, such as skeletal muscle, heart, brain and spermatozoa. Immunogen Recombinant full length protein (His-tag) corresponding to Creatine kinase B type aa 1- 381.Database link: P12277 Isotype IgG Source/Host Mouse Species Reactivity Mouse, Human Clone 904DU30.2.2 Purity Protein G purified Purification This antibody is purified through a protein G column, eluted with high and low pH buffers and neutralized immediately, followed by dialysis against PBS. Conjugate Unconjugated Applications WB Positive Control MDA-MB453; 293 and Y-79 cell lysates; Mouse stomach and Mouse brain tissue lysates Format Liquid Size 400 μl Buffer Preservative: 0.09% Sodium azide; Constituent: 99% PBS Storage Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C long term. Avoid freeze / thaw cycle. Ship Shipped at 4°C. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION Gene Name CKB creatine kinase, brain [ Homo sapiens ] Official Symbol CKB Synonyms CKB; creatine
    [Show full text]
  • JAX-CKB), Which Can Be Queried Readily to Access Comprehensive Data for Clinical Reporting Via Customized Reporting Queries
    Patterson et al. Human Genomics (2016) 10:4 DOI 10.1186/s40246-016-0061-7 PRIMARY RESEARCH Open Access The clinical trial landscape in oncology and connectivity of somatic mutational profiles to targeted therapies Sara E. Patterson, Rangjiao Liu, Cara M. Statz, Daniel Durkin, Anuradha Lakshminarayana and Susan M. Mockus* Abstract Background: Precision medicine in oncology relies on rapid associations between patient-specific variations and targeted therapeutic efficacy. Due to the advancement of genomic analysis, a vast literature characterizing cancer- associated molecular aberrations and relative therapeutic relevance has been published. However, data are not uniformly reported or readily available, and accessing relevant information in a clinically acceptable time-frame is a daunting proposition, hampering connections between patients and appropriate therapeutic options. One important therapeutic avenue for oncology patients is through clinical trials. Accordingly, a global view into the availability of targeted clinical trials would provide insight into strengths and weaknesses and potentially enable research focus. However, data regarding the landscape of clinical trials in oncology is not readily available, and as a result, a comprehensive understanding of clinical trial availability is difficult. Results: To support clinical decision-making, we have developed a data loader and mapper that connects sequence information from oncology patients to data stored in an in-house database, the JAX Clinical Knowledgebase (JAX-CKB), which can be queried readily to access comprehensive data for clinical reporting via customized reporting queries. JAX-CKB functions as a repository to house expertly curated clinically relevant data surrounding our 358-gene panel, the JAX Cancer Treatment Profile (JAX CTP), and supports annotation of functional significance of molecular variants.
    [Show full text]
  • Rad51c Deficiency Destabilizes XRCC3, Impairs Recombination and Radiosensitizes S/G2-Phase Cells
    Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title Rad51C deficiency destabilizes XRCC3, impairs recombination and radiosensitizes S/G2- phase cells Permalink https://escholarship.org/uc/item/2fp0538b Authors Lio, Yi-Ching Schild, David Brenneman, Mark A. et al. Publication Date 2004-05-01 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Rad51C deficiency destabilizes XRCC3, impairs recombination and radiosensitizes S/G2-phase cells Yi-Ching Lio1, 2,*, David Schild1, Mark A. Brenneman3, J. Leslie Redpath2 and David J. Chen1 1Life Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA; 2Department of Radiation Oncology, University of California, Irvine, Irvine, CA 92697, USA; 3Department of Genetics, Rutgers University, Piscataway, NJ 08854, USA. * To whom correspondence should be addressed: Yi-Ching Lio MS74-157, Life Sciences Division Lawrence Berkeley National Laboratory One Cyclotron Road Berkeley, CA 94720 Phone: (510) 486-5861 Fax: (510) 486-6816 e-mail: [email protected] Running title: Human Rad51C functions in homologous recombination Total character count: 52621 1 ABSTRACT The highly conserved Rad51 protein plays an essential role in repairing DNA damage through homologous recombination. In vertebrates, five Rad51 paralogs (Rad51B, Rad51C, Rad51D, XRCC2, XRCC3) are expressed in mitotically growing cells, and are thought to play mediating roles in homologous recombination, though their precise functions remain unclear. Here we report the use of RNA interference to deplete expression of Rad51C protein in human HT1080 and HeLa cells. In HT1080 cells, depletion of Rad51C by small interfering RNA caused a significant reduction of frequency in homologous recombination. The level of XRCC3 protein was also sharply reduced in Rad51C-depleted HeLa cells, suggesting that XRCC3 is dependent for its stability upon heterodimerization with Rad51C.
    [Show full text]
  • Contribution of DNA Double-Strand Break Repair Gene XRCC3 Genotypes to Oral Cancer Susceptibility in Taiwan
    ANTICANCER RESEARCH 34: 2951-2956 (2014) Contribution of DNA Double-strand Break Repair Gene XRCC3 Genotypes to Oral Cancer Susceptibility in Taiwan CHIA-WEN TSAI1,3, WEN-SHIN CHANG2,3, JUHN-CHERNG LIU2,3, MING-HSUI TSAI3, CHENG-CHIEH LIN3,4 and DA-TIAN BAU1,2,3 Graduate Institutes of 1Basic Medical Science and 2Clinic Medical Science, China Medical University, Taichung, Taiwan, R.O.C.; 3Terry Fox Cancer Research Laboratory, Department of Medical Research, in China Medical University Hospital, Taichung, Taiwan, R.O.C.; 4Asia University, Taichung, Taiwan, R.O.C. Abstract. The DNA repair gene X-ray repair cross and neck cancers in Taiwan (2). Three major lifestyle factors, complementing protein 3 (XRCC3) is thought to play a major namely the use of tobacco, alcohol and betel nuts, are main role in double-strand break repair and in maintaining causes of oral cancer in Taiwan, while the genomic etiology genomic stability. Very possibly, defective double-strand of oral cancer is of great interest but largely unknown. break repair of cells can lead to carcinogenesis. Therefore, a Human DNA repair mechanisms protect the genome from case–control study was performed to reveal the contribution various insults caused by endogenous and exogenous DNA- of XRCC3 genotypes to individual oral cancer susceptibility. damaging agents (3) and defects in the DNA repair system In this hospital-based research, the association of XRCC3 are thought to be essential in tumorigenesis (4, 5). Therefore, rs1799794, rs45603942, rs861530, rs3212057, rs1799796, it is logical to suspect that some genetic variants of DNA rs861539, rs28903081 genotypes with oral cancer risk in a repair genes might contribute to oral cancer pathogenesis.
    [Show full text]
  • Profiling Haplotype Specific Cpg and Cph Methylation Within A
    www.nature.com/scientificreports OPEN Profling haplotype specifc CpG and CpH methylation within a schizophrenia GWAS locus on chromosome 14 in schizophrenia and healthy subjects Margarita Alfmova*, Nikolay Kondratyev, Arkadiy Golov & Vera Golimbet Interrogating DNA methylation within schizophrenia risk loci holds promise to identify mechanisms by which genes infuence the disease. Based on the hypothesis that allele specifc methylation (ASM) of a single CpG, or perhaps CpH, might mediate or mark the efects of genetic variants on disease risk and phenotypes, we explored haplotype specifc methylation levels of individual cytosines within a genomic region harbouring the BAG5, APOPT1 and KLC1 genes in peripheral blood of schizophrenia patients and healthy controls. Three DNA fragments located in promoter, intronic and intergenic areas were studied by single-molecule real-time bisulfte sequencing enabling the analysis of long reads of DNA with base-pair resolution and the determination of haplotypes directly from sequencing data. Among 1,012 cytosines studied, we did not fnd any site where methylation correlated with the disease or cognitive defcits after correction for multiple testing. At the same time, we determined the methylation profle associated with the schizophrenia risk haplotype within the KLC1 fourth intron and confrmed ASM for cytosines located in the vicinity of rs67899457. These genetically associated DNA methylation variations may be related to the pathophysiological mechanism diferentiating the risk and non-risk haplotypes and merit further investigation. Schizophrenia is a common, highly heritable disorder characterized by positive, negative, and cognitive symp- toms. Large genome-wide association studies (GWAS) of the Psychiatric Genomics Consortium (PGC) have identifed more than 100 genomic regions that are signifcantly associated with schizophrenia1,2.
    [Show full text]
  • Identification of Expression Qtls Targeting Candidate Genes For
    ISSN: 2378-3648 Salleh et al. J Genet Genome Res 2018, 5:035 DOI: 10.23937/2378-3648/1410035 Volume 5 | Issue 1 Journal of Open Access Genetics and Genome Research RESEARCH ARTICLE Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics Salleh MS1,2, Mazzoni G2, Nielsen MO1, Løvendahl P3 and Kadarmideen HN2,4* 1Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark Check for 2Department of Bio and Health Informatics, Technical University of Denmark, Lyngby, Denmark updates 3Department of Molecular Biology and Genetics-Center for Quantitative Genetics and Genomics, Aarhus University, AU Foulum, Tjele, Denmark 4Department of Applied Mathematics and Computer Science, Technical University of Denmark, Lyngby, Denmark *Corresponding author: Kadarmideen HN, Department of Applied Mathematics and Computer Science, Technical University of Denmark, DK-2800, Kgs. Lyngby, Denmark, E-mail: [email protected] Abstract body weight gain and net merit). The eQTLs and biological pathways identified in this study improve our understanding Background: Residual feed intake (RFI) is the difference of the complex biological and genetic mechanisms that de- between actual and predicted feed intake and an important termine FE traits in dairy cattle. The identified eQTLs/genet- factor determining feed efficiency (FE). Recently, 170 can- ic variants can potentially be used in new genomic selection didate genes were associated with RFI, but no expression methods that include biological/functional information on quantitative trait loci (eQTL) mapping has hitherto been per- SNPs. formed on FE related genes in dairy cows. In this study, an integrative systems genetics approach was applied to map Keywords eQTLs in Holstein and Jersey cows fed two different diets to eQTL, RNA-seq, Genotype, Data integration, Systems improve identification of candidate genes for FE.
    [Show full text]
  • (EZH2) Genotypes with Bladder Cancer Risk in Taiwan
    ANTICANCER RESEARCH 36 : 4509-4514 (2016) doi:10.21873/anticanres.10997 Association of Enhancer of Zeste 2 ( EZH2 ) Genotypes with Bladder Cancer Risk in Taiwan WEN-SHIN CHANG 1,2* , CHENG-HSI LIAO 1,2,3,8* , CHIA-WEN TSAI 2* , PEI-SHIN HU 2,4 , HSI-CHIN WU 2, SHIH-WEI HSU 1,2,3,8 , CHIEH-LUN HSIAO 1,2 , CHANG-HSIEN HSU 5, YI-WEN HUNG 6 and DA-TIAN BAU 1,2,7 1Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan, R.O.C.; 2Terry Fox Cancer Research Laboratory, China Medical University Hospital, Taichung, Taiwan, R.O.C.; 3Taichung Armed Forces General Hospital, Taichung, Taiwan, R.O.C.; 4Department of Ophthalmology, Changhua Christian Hospital, Changhua, Taiwan, R.O.C.; Departments of 5Business Administration, and 7Bioinformatics and Medical Engineering, Asia University, Taichung, Taiwan, R.O.C.; 6Department of Medicine Research, Taichung Veterans General Hospital, Taichung, Taiwan, R.O.C.; 8National Defence Medical Center, Taipei, Taiwan, R.O.C. Abstract. Aim: Bladder cancer is the sixth most common associated with the lower risk of bladder cancer development, cancer worldwide and its incidence is particularly high in especially among non-smokers. many developed regions including southwestern Taiwan. However, the genetic contribution to the etiology of bladder Bladder cancer is the most serious urinary neoplasm cancer is not well-understood. The aim of this study was to worldwide, with high incidence rates of approximately evaluate the association of the enhancer of zeste homolog 2 10/100,000 and 3/100,000 in more and less developed (EZH2) genotypes with Taiwan bladder cancer risk.
    [Show full text]
  • Screening for the Proteins That Can Interact with Grouper Nervous Necrosis Virus Capsid Protein
    viruses Article Screening for the Proteins That Can Interact with Grouper Nervous Necrosis Virus Capsid Protein 1, 2, 2 2 3 Po-Yu Huang y, Han-Chia Hsiao y, Szu-Wen Wang , Shao-Fu Lo , Ming-Wei Lu and Li-Li Chen 1,2,* 1 Center of Excellence for the Oceans, National Taiwan Ocean University, No. 2, Pei-Ning Road, Keelung 20224, Taiwan; [email protected] 2 Institute of Marine Biology, National Taiwan Ocean University, No. 2, Pei-Ning Road, Keelung 20224, Taiwan; [email protected] (H.-C.H.); [email protected] (S.-W.W.); [email protected] (S.-F.L.) 3 Department of Aquaculture, National Taiwan Ocean University, No. 2, Pei-Ning Road, Keelung 20224, Taiwan; [email protected] * Correspondence: [email protected] These authors contributed equally to this work. y Received: 17 August 2020; Accepted: 1 September 2020; Published: 4 September 2020 Abstract: Nervous necrosis virus (NNV) can infect many species of fish and has an 80–100% mortality rate. NNV capsid protein (NNVCP) is the only structural protein of NNV, but there are few studies on the protein–protein interaction between NNVCP and the host cell. To investigate NNV morphogenesis, native NNV capsid protein (NNVCP) was used to screen for protein–protein interactions in this study. The results identified that 49 grouper optic nerve proteins can interact with NNVCP and may function as putative receptor or co-receptor, cytoskeleton, glucose metabolism and ATP generation, immunity, mitochondrial ion regulation, and ribosomal proteins. Creatine kinase B-type (CKB) is one of those 49 optic nerve proteins.
    [Show full text]