DOCSLIB.ORG

Induction of the Mouse Serum Amyloid A3 Gene by Cytokines Requires Both C/EBP Family Proteins and a Novel Constitutive Nuclear Factor JIANYI H

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Induction of the Mouse Serum Amyloid A3 Gene by Cytokines Requires Both C/EBP Family Proteins and a Novel Constitutive Nuclear Factor JIANYI H MOLECULAR AND CELLULAR BIOLOGY, July 1994, p. 4475-4484 Vol. 14, No. 7 0270-7306/94/$04.00+0 Copyright © 1994, American Society for Microbiology Induction of the Mouse Serum Amyloid A3 Gene by Cytokines Requires both C/EBP Family Proteins and a Novel Constitutive Nuclear Factor JIANYI H. HUANG AND WARREN S.-L. LIAO* Department ofBiochemistry and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Received 1 December 1993/Returned for modification 2 February 1994/Accepted 1 April 1994 Serum amyloid A (SAA) is a major acute-phase protein synthesized and secreted mainly by the liver. In response to acute inflammation, its expression may be induced up to 1,000-fold, primarily as a result of a 200-fold increase in the rate of SAA gene transcription. We have previously demonstrated that a 350-bp promoter fragment from the mouse SAA3 gene was necessary and sufficient to confer liver-specific and cytokine-induced expression. Deletion studies identified a distal response element that is responsible for the cytokine response and has properties of an inducible transcriptional enhancer. In this study, we further analyzed the distal response element and showed that it consists of three functionally distinct elements: the A element constitutes a weak binding site for C/EBP family proteins, the B element also interacts with C/EBP family proteins but with a much higher binding affinity, and the C element interacts with a novel constitutive nuclear factor, SEF-1. Site-specific mutation studies revealed that all three elements were required for maximum promoter activity. C/EBPoL, C/EBPP, and C/EBPB were capable of interacting with elements A and B. Under noninduced conditions, C/EBPa was the major binding factor, however, upon cytokine stimulation C/EBPID- and C/EBP8-binding activities were dramatically increased and became the predominant binding factors. Consistent with these binding studies were the cotransfection experiments in which C/EBPP and C/EBP8i were shown to be potent transactivators for the SAA3 promoter. Moreover, the transactivation required an intact B element despite the presence of other functional C/EBP-binding sites. Interestingly, although element C did not interact with C/EBP directly, it was nevertheless required for maximum transactivation by C/EBP8. Our studies thus demonstrate that both C/EBP family proteins and SEF-1 are required to transactivate the SAA3 gene. The systemic response to acute inflammation, infection, and scription activation of acute-phase genes (2, 14, 38, 39). All tissue injury is characterized by changes in the concentrations three C/EBP proteins have the basic leucine zipper motif of a wide variety of plasma proteins collectively called the initially found in C/EBPa. and have similar sequence specific- acute-phase reactants (23, 24, 27, 36). Expression of these ities in their DNA binding, each having the modified consensus genes is regulated primarily by the inflammatory cytokines sequence T(T/G)NNG(A/C/T)AA(T/G) (14). During acute interleukin-1 (IL-1), IL-6, and tumor necrosis factor (13, 23, inflammation, expression of C/EBPa is reduced while that of 29, 38) and by the steroid hormone glucocorticoids (7, 13). C/EBPB and C/EBP8 is elevated, although by different mech- Elevated expression of acute-phase genes is regulated at the anisms. The increase in C/EBPfB binding and transactivation transcription level, as a result of increased interaction of activities occurs mainly through posttranslational modification transcription factors induced by inflammatory cytokines with (44, 49, 50). In contrast, elevated C/EBP8 mRNA synthesis their cognate regulatory cis-acting DNA elements (3, 14, 17, contributes to its activation (50). 38, 48, 59, 60). Analyses of many acute-phase promoters have Serum amyloid A (SAA) is one of the major acute-phase revealed three general types of regulatory elements in the proteins synthesized in hepatocytes during acute inflammation transcriptional induction by cytokines-the binding sites for (16, 23, 52). In mice, the SAA gene family consists of four members of the C/EBP transcription factors, the binding sites genes-SAAJ, SAA2, SAA3, and SAAS-and a pseudogene for the NF-KB/Rel family of proteins, and the binding sites for (19, 41, 53). In response to acute inflammation, the concentra- IL-6 response element-binding protein (IL-6 RE BP) and tion of SAA in plasma increases approximately 1,000-fold, acute-phase response factor (APRF) with the consensus bind- primarily because of an increased SAA gene transcription (42). ing sequence of CTGGGA (26) or an extended motif of Whereas expression of SAA1, SAA2, and SAA3 is dramatically (T/G)T(C/A)(C/T)(G/T)G(G/T)AA (59). induced and Several nuclear factors can interact with the C/EBP type of each contributes equally to the increased SAA cytokine response element. In addition to the liver-enriched mRNA levels in the liver (42), SAA5 expression is induced to transcription factor C/EBPa, two others, C/EBPP and a much lower level and with different induction kinetics (19). C/EBP8, have been identified (1, 10, 12, 20, 35, 49) and shown In efforts to unravel the molecular mechanisms of SAA gene to be centrally involved in mediating cytokine-dependent tran- regulation, the promoters of human (22) and rat (38, 39) SAAJ and mouse SAA3 (29, 37) have been studied. A phorbol ester response element containing the NF-KB consensus binding site * Corresponding author. Mailing address: Department of Biochem- was identified in the human SAAJ promoter and shown to be istry and Molecular Biology/Box 117, University of Texas M. D. necessary for its cytokine responsiveness (22). Studies of the Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030. rat SAAJ promoter demonstrated functional importance for Phone: (713) 792-2556. Fax: (713) 790-0329. and cooperative interaction between NF-KB and C/EBP pro- 4475 4476 HUANG AND LIAO MOL. CELL. BIOL. teins in cytokine-induced expression (39). Studies with the mouse SAA3 promoter demonstrated that a 350-bp promoter -169 B -126 fragment was necessary and sufficient to confer liver-specific and cytokine-induced expression (29). A proximal response DRE CGATCACATTTCTGGAAATGCCTAGATGGCGCAATCTGGGGAAAGAT element that contains two adjacent C/EBP-binding sequences DRmA enhances SAA3 gene expression in liver-derived cells (37). A distal response element (DRE) that confers responsiveness to DRmBE -----------------------------A---------------- cytokine induction has properties of an inducible transcrip- tional enhancer (29). In this study, we demonstrate that three DRnB2 -----------------------------GAT-TC------------ functionally distinct elements reside within the DRE. One DRmC -----------A-CA----T--------------------------- element interacts with a novel transcription factor termed SAA enhancer factor 1 (SEF-1) that is detected in variety of cell -140 -128 I 1 types. The other two elements interact with C/EBP family OL-A CGATCTGGGGAAAGAT proteins. All three elements are required for maximum induc- OL-mA ----TCAA-------- tion by cytokines. In addition, our results show that C/EBPOL, -156 -135 C/EBPP, and C/EBP8 can transactivate the SAA3 promoter OL-B CGATGCCTAGATGGCGCAATCTGGTTAT and that the transactivation requires functional binding sites -169 -147 for both C/EBP and SEF-1. OL-C CGATCACATTTCTGGAAATGCCTAGAT OL-mC MATERIALS AND METHODS -117 -99 I I Cell lines, transient-transfection assay, and conditioned OL-117 GAAGGAAAAGTTATCTTCT medium. Hep3B cells were cultured in basal medium consist- ing of minimum essential medium and Waymouth MAB (3:1, OL-IL- 6 CGATACGTCACATTGCACAATCTTAAT vol/vol) plus 10% fetal calf serum (18) and were passaged at OL-Hpx CGATCAGTGATGTAATCA confluence by trypsinization about once a week. DNA transfections were performed by the Polybrene pro- NFXB GATCCGGGGACTTTCCG cedures (34) as described previously (29). Approximately 16 to GATCTATGCAAATG 20 h after transfection, Hep3B cells were stimulated with basal Oct-1 medium, 50% conditioned medium (CM), or 100 U of IL-lot FIG. 1. Oligonucleotide sequences. The nucleotide sequence of DRE is shown, and the regions for elements A, B, and C are indicated per ml. Cell extracts were assayed for protein content by the by the brackets. DRmA, DRmB, and DRmC are oligonucleotides in Bradford assay (9), and chloramphenicol acetyltransferase which site-specific mutations have been introduced into each of the (CAT) activity was determined by modifications (11) of pro- three elements. OL-A, OL-mA, OL-B, OL-C, and OL-mC are oligo- cedures described by Gorman et al. (25). To determine CAT nucleotides corresponding to either wild-type or mutated elements. In activities, we quantitated [14C]chloramphenicol spots corre- all cases, only the mutated nucleotides are indicated. The OL-117 sponding to acetylated and nonacetylated forms by using a sequence corresponds to bp -117 to -99 in the SAA3 promoter and Phosphor Imager (Molecular Dynamic). was used to generate a promoter fragment for the pSAA3(-117) Purified recombinant human IL-la (specific activity, 2.5 X construct. The numbers above the sequences indicate their positions in 109 U/mg) was provided by P. T. Lomedico (Hoffmann- the mouse SAA3 promoter. The sequences of OL-IL-6, OL-Hpx, NF-KB-binding site, and Oct-i-binding site are from the NF-IL6- LaRoche, Nutley, N.J.). CM was prepared from mixed human binding site in human IL-6 promoter (1), the C/EBP-binding site in the lymphocyte cultures stimulated with 0.75% phytohemaggluti- hemopexin promoter (48), the NF-KB-binding site in the immunoglob- nin as described previously (29). ulin K light-chain promoter (4), and the Oct-1-binding consensus Nuclear proteins and electrophoretic mobility shift assay. sequence (55), respectively. Nuclear extracts from Hep3B cells were prepared as described by Li et al. (37). For the induced nuclear extracts, Hep3B cells were treated with 50% CM for 16 to 20 h before harvest. For electrophoretic mobility shift assays, 20 [lI of the reaction then digested with 4 jig of freshly diluted DNase I per ml at mixture [12 mM N-2-hydroxyethylpiperazine-N'-2-ethanesul- room temperature for 30 s.
Load more

Recommended publications
  • REVIEW Signal Transduction, Cell Cycle Regulatory, and Anti
    Leukemia (1999) 13, 1109–1166 1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu REVIEW Signal transduction, cell cycle regulatory, and anti-apoptotic pathways regulated by IL-3 in hematopoietic cells: possible sites for intervention with anti-neoplastic drugs WL Blalock1, C Weinstein-Oppenheimer1,2, F Chang1, PE Hoyle1, X-Y Wang3, PA Algate4, RA Franklin1,5, SM Oberhaus1,5, LS Steelman1 and JA McCubrey1,5 1Department of Microbiology and Immunology, 5Leo Jenkins Cancer Center, East Carolina University School of Medicine Greenville, NC, USA; 2Escuela de Quı´mica y Farmacia, Facultad de Medicina, Universidad de Valparaiso, Valparaiso, Chile; 3Department of Laboratory Medicine and Pathology, Mayo Clinic and Foundation, Rochester, MN, USA; and 4Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA Over the past decade, there has been an exponential increase growth factor), Flt-L (the ligand for the flt2/3 receptor), erythro- in our knowledge of how cytokines regulate signal transduc- poietin (EPO), and others affect the growth and differentiation tion, cell cycle progression, differentiation and apoptosis. Research has focused on different biochemical and genetic of these early hematopoietic precursor cells into cells of the 1–4 aspects of these processes. Initially, cytokines were identified myeloid, lymphoid and erythroid lineages (Table 1). This by clonogenic assays and purified by biochemical techniques. review will concentrate on IL-3 since much of the knowledge This soon led to the molecular cloning of the genes encoding of how cytokines affect cell growth, signal transduction, and the cytokines and their cognate receptors.
    [Show full text]
  • The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
    Subject Review The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Michalis V. Karamouzis,1 Panagiotis A. Konstantinopoulos,1,2 and Athanasios G. Papavassiliou1 1Department of Biological Chemistry, Medical School, University of Athens, Athens, Greece and 2Division of Hematology-Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts Abstract Much of the current anticancer research effort is focused on Respiratory epithelium cancers are the leading cause cell-surface receptors and their cognate upstream molecules of cancer-related death worldwide. The multistep natural because they provide the easiest route for drugs to affect history of carcinogenesis can be considered as a cellular behavior, whereas agents acting at the level of gradual accumulation of genetic and epigenetic transcription need to invade the nucleus. However, the aberrations, resulting in the deregulation of cellular therapeutic effect of surface receptor manipulation might be homeostasis. Growing evidence suggests that cross- considered less than specific because their actions are talk between membrane and nuclear receptor signaling modulated by complex interacting downstream signal trans- pathways along with the activator protein-1 (AP-1) duction pathways. A pivotal transcription factor during cascade and its cofactor network represent a pivotal respiratory epithelium carcinogenesis is activator protein-1 molecular circuitry participating directly or indirectly in (AP-1). AP-1–regulated genes include important modulators of respiratory epithelium carcinogenesis. The crucial role invasion and metastasis, proliferation, differentiation, and of AP-1 transcription factor renders it an appealing survival as well as genes associated with hypoxia and target of future nuclear-directed anticancer therapeutic angiogenesis (7). Nuclear-directed therapeutic strategies might and chemoprevention approaches.
    [Show full text]
  • Signal Transduction and the Ets Family of Transcription Factors
    Oncogene (2000) 19, 6503 ± 6513 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Signal transduction and the Ets family of transcription factors John S Yordy1 and Robin C Muise-Helmericks*,1,2 1Center for Molecular and Structural Biology, Hollings Cancer Center, Medical University of South Carolina, Charleston, South Carolina, SC 29403, USA; 2Department of Cell Biology and Anatomy, Medical University of South Carolina, Charleston, South Carolina, SC 29403, USA Cellular responses to environmental stimuli are con- expression required for cellular growth, dierentiation trolled by a series of signaling cascades that transduce and survival. One group of downstream eectors of extracellular signals from ligand-activated cell surface these signaling pathways is the Ets family of transcrip- receptors to the nucleus. Although most pathways were tion factors. Ets family members can also be initially thought to be linear, it has become apparent that considered upstream eectors of signal transduction there is a dynamic interplay between signaling pathways pathways controlling the expression of a number of that result in the complex pattern of cell-type speci®c signaling components including both receptor tyrosine responses required for proliferation, dierentiation and kinases and intermediate signaling molecules. survival. One group of nuclear eectors of these The Ets family of transcription factors is de®ned by signaling pathways are the Ets family of transcription a conserved winged helix ± turn ± helix DNA binding factors, directing cytoplasmic signals to the control of domain (Papas et al., 1989; Wasylyk et al., 1993; gene expression. This family is de®ned by a highly Werner et al., 1995).
    [Show full text]
  • Quantitative Analysis of NF-B Transactivation Specificity Using A
    Quantitative Analysis of NF-#B Transactivation Specificity Using a Yeast-Based Functional Assay The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Sharma, Vasundhara, Jennifer J. Jordan, Yari Ciribilli, Michael A. Resnick, Alessandra Bisio, and Alberto Inga. “Quantitative Analysis of NF-κB Transactivation Specificity Using a Yeast-Based Functional Assay.” Edited by Sue Cotterill. PLOS ONE 10, no. 7 (July 6, 2015): e0130170. As Published http://dx.doi.org/10.1371/journal.pone.0130170 Publisher Public Library of Science Version Final published version Citable link http://hdl.handle.net/1721.1/99881 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/4.0/ RESEARCH ARTICLE Quantitative Analysis of NF-κB Transactivation Specificity Using a Yeast- Based Functional Assay Vasundhara Sharma1, Jennifer J. Jordan1¤, Yari Ciribilli1, Michael A. Resnick2, Alessandra Bisio1‡*, Alberto Inga1‡* 1 Laboratory of Transcriptional Networks, Centre for Integrative Biology (CIBIO), University of Trento, Trento, Italy, 2 Chromosome Stability Group; National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina, United States of America a11111 ¤ Current address: Department of Biological Engineering, MIT, Boston, MA, USA ‡ These authors are co-last authors on this work. * [email protected] (AB); [email protected] (AI) Abstract κ OPEN ACCESS The NF- B transcription factor family plays a central role in innate immunity and inflamma- tion processes and is frequently dysregulated in cancer. We developed an NF-κB functional Citation: Sharma V, Jordan JJ, Ciribilli Y, Resnick κ MA, Bisio A, Inga A (2015) Quantitative Analysis of assay in yeast to investigate the following issues: transactivation specificity of NF- B pro- NF-κB Transactivation Specificity Using a Yeast- teins acting as homodimers or heterodimers; correlation between transactivation capacity Based Functional Assay.
    [Show full text]
  • ETS1, Nfkb and AP1 Synergistically Transactivate the Human GM ± CSF Promoter
    Oncogene (1997) 14, 2845 ± 2855 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 ETS1, NFkB and AP1 synergistically transactivate the human GM ± CSF promoter Ross S Thomas1, Martin J Tymms1, Leigh H McKinlay1, M Frances Shannon2, Arun Seth3 and Ismarl Kola1 1Molecular Genetics and Development Group, Institute of Reproduction and Development, Monash University, Melbourne 3168, Australia; 2Division of Human Immunology, Hanson Centre for Cancer Research, Institute of Medical and Veterinary Science, Adelaide 5000, Australia; 3Department of Pathology, University of Toronto/Women's College Hospital, Toronto, Ontario, Canada Activation of helper T cells results in coordinate Activating signals ultimately result in cellular prolifera- expression of a number of cytokines involved in tion, and transcriptional induction and secretion of a dierentiation, proliferation and activation of the number of cytokines including IL-2 (interleukin-2), IL-3, haematopoietic system. Granulocyte-macrophage colony IFNg (interferon-gamma) and GM ± CSF (granulocyte- stimulating factor (GM ± CSF) is one such cytokine, macrophage colony-stimulating factor) (Stanley et al., whose increased expression results mostly from increases 1985; Miyajima et al., 1988; Arai et al., 1990). These in transcription. Cis-acting elements with NFkB, AP1 cytokines direct the eector functions of various cell and ETS-like binding motifs have been identi®ed in the types involved in an immune response, including B cells, promoter region of the GM ± CSF gene, and are macrophages, mast cells, eosinophils and neutrophils. important or essential for transcriptional activity follow- GM ± CSF expression in activated T cells is ing T cell activation. ETS1 is a transcription factor of regulated by two mechanisms.
    [Show full text]
  • DNA Binding of USF Is Required for Specific E-Box Dependent Gene
    Oncogene (1999) 18, 7200 ± 7211 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $15.00 http://www.stockton-press.co.uk/onc DNA binding of USF is required for speci®c E-box dependent gene activation in vivo Astrid Kiermaier1,5, Jonathan M Gawn2,5, Laurie Desbarats1, Rainer Sarich3, Wilhelm Ansorge3, Paul J Farrell2,4, Martin Eilers1 and Graham Packham*,2,4 1Institute for Molecular Biology and Tumour Research, University of Marburg, Emil-Mannkop-Str 2, 35033 Marburg, Germany; 2Ludwig Institute for Cancer Research, Imperial College School of Medicine, St. Mary's Campus, Norfolk Place, London, W2 1PG, UK; 3Biochemical Instrumentation Programme, EMBL, Meyerhofstr 1, 69117 Heidelberg, Germany; 4Virology and Cell Biology, Department of Medical Microbiology, Imperial College School of Medicine, St. Mary's Campus, Norfolk Place, London, W2 1PG, UK Although USF-1 and -2 are the major proteins that bind Repression requires an amino-terminal domain con- to Myc-regulated E-box (CACGTG) elements in many served in Mad-like proteins that recruits histone cells, there is no clear role for USF during Myc- deacetylases via an adapter protein, sin3 (e.g. Alland dependent gene regulation. Using dominant negative et al., 1997; Laherty et al., 1997; Sommer et al., 1997). alleles of USF-1 we now show that DNA binding by Little doubt exists that Myc exerts at least part of its USF at a Myc-regulated E-box limits the ability of biological eects through the transcriptional activation another E-box binding factor, TFE-3, to activate a of speci®c target genes although Myc has other target gene of Myc in vivo and to stimulate S phase functions that may contribute to its biological proper- entry in resting ®broblasts.
    [Show full text]
  • 4560.Full.Pdf
    HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 This information is current as Composite Element of the IL-2 Promoter of September 29, 2021. Esther González, Carmen Punzón, Manuel González and Manuel Fresno J Immunol 2001; 166:4560-4569; ; doi: 10.4049/jimmunol.166.7.4560 Downloaded from http://www.jimmunol.org/content/166/7/4560 References This article cites 67 articles, 45 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/166/7/4560.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 29, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 Composite Element of the IL-2 Promoter1 Esther Gonza´lez, Carmen Punzo´n, Manuel Gonza´lez, and Manuel Fresno2 Dysregulation of cytokine secretion plays an important role in AIDS pathogenesis.
    [Show full text]
  • Interaction of the Human Androgen Receptor Transactivation Function with the General Transcription Factor TFIIF
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 8485–8490, August 1997 Biochemistry Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF IAIN J. MCEWAN* AND JAN-ÅKE GUSTAFSSON Department of Biosciences, Novum, Karolinska Institute, S-141 57 Huddinge, Sweden Communicated by Elwood V. Jensen, University of Hamburg, Hamburg, Germany, May 27, 1997 (received for review January 28, 1997) ABSTRACT The human androgen receptor (AR) is a tion factors, and thus the polymerase, to the promoter (re- ligand-activated transcription factor that regulates genes im- viewed in refs. 17–19). This can be achieved by direct contact portant for male sexual differentiation and development. To between the activator and the general transcription factors better understand the role of the receptor as a transcription andyor interactions by means of coactivator proteins (refs. 17 factor we have studied the mechanism of action of the N- and 19–21 and references therein). terminal transactivation function. In a protein–protein inter- In recent years a number of interactions have been described action assay the AR N terminus (amino acids 142–485) between members of the steroid–thyroid hormone receptor selectively bound to the basal transcription factors TFIIF and superfamily and basal transcription factors and co–activator the TATA-box-binding protein (TBP). Reconstitution of the proteins (see ref. 22 and references therein). However, very transactivation activity in vitro revealed that AR142–485 fused to little is known concerning the identity of interacting proteins the LexA protein DNA-binding domain was competent to with the human AR. To better understand the mechanism of activate a reporter gene in the presence of a competing DNA gene regulation by the human AR we have screened a panel of template lacking LexA binding sites.
    [Show full text]
  • Transactivation by the P65 Subunit of NF-B in Response to Interleukin-1
    MOLECULAR AND CELLULAR BIOLOGY, July 2001, p. 4544–4552 Vol. 21, No. 14 0270-7306/01/$04.00ϩ0 DOI: 10.1128/MCB.21.14.4544–4552.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved. Transactivation by the p65 Subunit of NF-␬B in Response to Interleukin-1 (IL-1) Involves MyD88, IL-1 Receptor-Associated Kinase 1, TRAF-6, and Rac1 CAROLINE JEFFERIES,1* ANDREW BOWIE,1 GARETH BRADY,1 EMMA-LOUISE COOKE,2 3 1 XIAOXIA LI, AND LUKE A. J. O’NEILL Department of Biochemistry and Biotechnology Institute, Trinity College, Dublin 2, Ireland1; Department of Cell Biology, Glaxo Wellcome Research and Development, Medicines Research Centre, Stevenage, Hertfordshire SG1 2NY, United Kingdom2; and Department of Molecular Biology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 441953 Received 30 August 2000/Returned for modification 2 October 2000/Accepted 19 April 2001 We have examined the involvement of components of the interleukin-1 (IL-1) signaling pathway in the transactivation of gene expression by the p65 subunit of NF-␬B. Transient transfection of cells with plasmids encoding wild-type MyD88, IL-1 receptor-associated kinase 1 (IRAK-1), and TRAF-6 drove p65-mediated transactivation. In addition, dominant negative forms of MyD88, IRAK-1, and TRAF-6 inhibited the IL-1- induced response. In cells lacking MyD88 or IRAK-1, no effect of IL-1 was observed. Together, these results indicate that MyD88, IRAK-1, and TRAF-6 are important downstream regulators of IL-1-mediated p65 transactivation. We have previously shown that the low-molecular-weight G protein Rac1 is involved in this response.
    [Show full text]
  • Cellular and Viral Trans-Acting Factors Modulate N-Myc2 Promoter Activity in Woodchuck Liver Tumors
    Oncogene (1997) 15, 1103 ± 1110 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 SHORT REPORT Cellular and viral trans-acting factors modulate N-myc2 promoter activity in woodchuck liver tumors Marc Flajolet1, Anne Gegonne2, Jacques Ghysdael2, Pierre Tiollais1, Marie-Annick Buendia1 and GenevieÁ ve Fourel1,3 1Unite de Recombinaison et Expression GeÂneÂtique (INSERM U163), Institut Pasteur, Paris and 2CNRS-URA 1443, Institut Curie, Centre Universitaire, BaÃtiment 110, Orsay, France Activation of the N-myc2 oncogene by integration of of the N-myc gene. Like other myc oncogenes, N-myc2 woodchuck hepatitis virus (WHV) DNA is a central cooperates with activated H-ras in the transformation event in woodchuck liver oncogenesis. In this study, we of rat embryo ®broblasts (Fourel et al., 1990), and its have evaluated the in¯uence of several cellular and viral targeted expression in liver cells induces hepatocellular trans-acting factors and mediators of in¯ammation on N- carcinoma in transgenic mice (CA Renard and G myc2 promoter activity in hepatoma cell lines. Ets Fourel, unpublished results). In addition, forced oncoproteins, including Ets1, Ets2 and PEA3 eciently expression of N-myc2 in rodent hepatic cells triggers activated a chimeric N-myc2 promoter/luciferase repor- a strong proliferative response and an increased ter gene. By electrophoretic mobility shift assays, we propensity to undergo apoptosis, which is inhibited show that Ets1 and Ets2 proteins can eciently bind two by insulin-like growth factor II (Dandri et al., 1996; consensus Ets sites located within a 59 bp sequence Ueda and Ganem, 1996). While N-myc2 transcripts are upstream of the N-myc2 transcription start site.
    [Show full text]
  • AML1 Stimulates G1 to S Progression Via Its Transactivation Domain
    Oncogene (2002) 21, 3247 ± 3252 ã 2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00 www.nature.com/onc AML1 stimulates G1 to S progression via its transactivation domain Florence Bernardin1 and Alan D Friedman*,1 1The Johns Hopkins Oncology Center, Division of Pediatric Oncology, Baltimore, Maryland, MD 21231, USA Inhibition of AML1-mediated transactivation potently Mice lacking either AML1 (RUNX1) or CBFb do slows G1 to S cell cycle progression. In Ba/F3 cells, not develop de®nitive hematopoiesis, indicating a activation of exogenous AML1 (RUNX1)-ER with 4- critical role for these factors in pluripotent hemato- hydroxytamoxifen prevents inhibition of G1 progression poietic stem cells (Okuda et al., 1996; Sasaki et al., mediated by CBFb-SMMHC, a CBF oncoprotein. We 1996; Wang et al., 1996a,b; Niki et al., 1997). The most expressed three AML1-ER variants with CBFb- potent AML1 transactivation domain, corresponding SMMHC in Ba/F3 cells. In these lines, CBFb-SMMHC to residues 318 ± 398 of the human protein (Kanno et expression is regulated by the zinc-responsive metal- al., 1998), is required to rescue the hematopoietic lothionein promoter. Deletion of 72 AML1 C-terminal potential of AML1(7/7) ES cells (Okuda et al., residues, which includes a transrepression domain, did 1999). On the other hand, the C-terminus of AML1, not alter the activity of AML1-ER, whereas further containing a VWRPY motif capable of mediating deletion of 98 residues, removing the most potent AML1 transrepression via interaction with TLE (Aronson et transactivation domain (TAD), prevented rescue of cell al., 1997; Imai et al., 1998; Levanon et al., 1998), is not cycle inhibition.
    [Show full text]
  • Enhancing IL-2 Gene Transactivation Cells by Increasing Mrna Stability
    CD28 Costimulation Augments IL-2 Secretion of Activated Lamina Propria T Cells by Increasing mRNA Stability Without Enhancing IL-2 Gene Transactivation This information is current as of September 29, 2021. Rivkah Gonsky, Richard L. Deem, Doo Han Lee, Alice Chen and Stephan R. Targan J Immunol 1999; 162:6621-6629; ; http://www.jimmunol.org/content/162/11/6621 Downloaded from References This article cites 36 articles, 24 of which you can access for free at: http://www.jimmunol.org/content/162/11/6621.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. CD28 Costimulation Augments IL-2 Secretion of Activated Lamina Propria T Cells by Increasing mRNA Stability Without Enhancing IL-2 Gene Transactivation1 Rivkah Gonsky,* Richard L. Deem,* Doo Han Lee,† Alice Chen,* and Stephan R. Targan2* The pathways leading to activation in lamina propria (LP) T cells are different from peripheral T cells.
    [Show full text]