DOCSLIB.ORG

Cellular and Viral Trans-Acting Factors Modulate N-Myc2 Promoter Activity in Woodchuck Liver Tumors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cellular and Viral Trans-Acting Factors Modulate N-Myc2 Promoter Activity in Woodchuck Liver Tumors Oncogene (1997) 15, 1103 ± 1110 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 SHORT REPORT Cellular and viral trans-acting factors modulate N-myc2 promoter activity in woodchuck liver tumors Marc Flajolet1, Anne Gegonne2, Jacques Ghysdael2, Pierre Tiollais1, Marie-Annick Buendia1 and GenevieÁ ve Fourel1,3 1Unite de Recombinaison et Expression GeÂneÂtique (INSERM U163), Institut Pasteur, Paris and 2CNRS-URA 1443, Institut Curie, Centre Universitaire, BaÃtiment 110, Orsay, France Activation of the N-myc2 oncogene by integration of of the N-myc gene. Like other myc oncogenes, N-myc2 woodchuck hepatitis virus (WHV) DNA is a central cooperates with activated H-ras in the transformation event in woodchuck liver oncogenesis. In this study, we of rat embryo ®broblasts (Fourel et al., 1990), and its have evaluated the in¯uence of several cellular and viral targeted expression in liver cells induces hepatocellular trans-acting factors and mediators of in¯ammation on N- carcinoma in transgenic mice (CA Renard and G myc2 promoter activity in hepatoma cell lines. Ets Fourel, unpublished results). In addition, forced oncoproteins, including Ets1, Ets2 and PEA3 eciently expression of N-myc2 in rodent hepatic cells triggers activated a chimeric N-myc2 promoter/luciferase repor- a strong proliferative response and an increased ter gene. By electrophoretic mobility shift assays, we propensity to undergo apoptosis, which is inhibited show that Ets1 and Ets2 proteins can eciently bind two by insulin-like growth factor II (Dandri et al., 1996; consensus Ets sites located within a 59 bp sequence Ueda and Ganem, 1996). While N-myc2 transcripts are upstream of the N-myc2 transcription start site. Site- undetectable in normal adult hepatocytes, they are directed mutagenesis of these Ets-binding motifs abol- abundantly produced in a majority of liver tumors ished transactivation of the N-myc2 promoter by Ets induced by woodchuck hepatitis virus (WHV) (Fourel proteins. Addition of interleukin-6 (IL-6) induced a weak et al., 1990). A prominent role of WHV DNA but reproducible activation of the N-myc2 promoter, integration in the process of N-myc2 activation has while IL-1 was ineective. We further show that the N- been demonstrated. In most woodchuck tumors, viral myc2 promoter can be transactivated by the hepadna- integration sites were found to be clustered either in the virus X protein, and that distal promoter sequences are vicinity of the N-myc2 coding region or at a 160 ± required for both IL-6 and X responsiveness. Similar 200 kb distance in the win locus (Fourel et al., 1990, eects of these factors were observed in the context of 1994). N-myc2 promoter activity was highly enhanced the N-myc2 promoter activated by WHV cis-regulatory in all cases, and the capacity of WHV enhancer elements. In view of the high-level expression of the N- elements to cis-activate the N-myc2 promoter was myc2 oncogene in most woodchuck liver tumors, the Ets demonstrated in transient transfection assays in oncoproteins, in¯ammation-associated cytokine IL-6 and hepatoma-derived cells (Fourel et al., 1996; Ueda et the viral X transactivator might play important roles in al., 1996a,b; Wei et al., 1992). At preneoplastic stages, hepadnavirus-associated tumorigenesis. N-myc2 expression is activated in precancerous lesions similar to altered hepatic foci occurring in rats exposed Keywords: N-myc2; woodchucks; IL-6 to carcinogenic regimens (Toshkov et al., 1990; Yang et al., 1993; reviewed in Fourel, 1994). At this stage however, it was not established whether N-myc2 transcription was activated through viral insertional The myc genes family contains three well-characterized mutagenesis or through independent, trans-acting proto-oncogenes c-myc,N-myc and L-myc, which share pathways. a common three exon structure and encode structurally In a previous report, a short N-myc2 promoter and functionally related proteins (reviewed in DePinho including a variant TATA box and potential binding et al., 1991). These genes play important roles in the sites for several transcription factors was mapped regulation of cellular proliferation, dierentiation and within sequences homologous to the 5' untranslated apoptosis. Oncogenic activation of myc genes by region of the second N-myc exon (Fourel et al., 1992). chromosomal translocation, gene ampli®cation, or In this study, we set out to investigate cellular and viral retroviral insertion is widespread in human and transcriptional trans-acting factors controlling the animal cancers (Marcu et al., 1992). activity of the woodchuck N-myc2 promoter in We recently described the presence of an additional hepatoma cells. gene of the myc family, termed N-myc2, in a subset of rodent species including woodchucks and squirrels Binding of Ets-1 and Ets-2 proteins at two dierent sites (Fourel et al., 1990; Transy et al., 1992). The in the minimal N-myc2 promoter intronless N-myc2 gene is a functional retrotransposon The ®nding of two sequences matching the consensus Ets-binding site (Wasylyk et al., 1993) in the N-myc2 Correspondence: M Flajolet promoter, as illustrated in Figure 1, led us to 3Present address: Ecole Normale Supe rieure de Lyon, Lyon, France investigate whether Ets proteins can bind and activate Received 2 October 1996; revised 7 May 1997; accepted 7 May 1997 the N-myc2 promoter. Electrophoretic mobility shift Transactivation of the N-myc2promoter M Flajolet et al 1104 Figure 1 Nucleotide sequence of the N-myc2 promoter. Numbering starts at the major transcription initiation site, indicated by an arrow. Here is shown the 406 bp RsaI±BglII fragment (positions 7332/+74). The translation initiation site (position +49) is shown in bold character. The 5' ends of deletion mutants analysed in this study are indicated by dots and positions. Two sequences homologous to the Acute Phase Response Element (APRE) (Poli and Ciliberto, 1994), which is responsible for IL-6-responsiveness of a subset of IL-6-sensitive promoters, and putative Ets-binding sites (Ets-Pu1 and Ets-Pu2) are boxed. CAAT, Sp1, TATA and initiator (Inr) motifs are overlined. The boundaries of the N-myc2 domains homologous to N-myc exons 1 and 2 are indicated assays (EMSA) were performed using whole cellular with cell extracts containing the Ets1 protein. As extracts from insect cells infected with Ac-NPV-Ets1 or shown in Figure 2, lane 14, the N-myc2.Pu1/Ets1 Ac-NPV-Ets2 recombinant baculoviruses as described interaction was detected as a major band with expected (Bosselut et al., 1990). Synthetic oligonucleotides used mobility in gel retardation assay. The unlabeled wild in this study were as follows: type N-myc2.Pu1 (lanes 15 and 16), N-myc2.Pu2 and E74 oligonucleotides (not shown) competed for Ets1 U N-myc2.Pul/U61 to 37: protein binding, while the mutated oligo (lanes 17 and TCGGACCCTAGGGAAGGAAGCACCCCCC 18) was ineective. The abilities of N-myc2.Pu1 and N- TGGGATCCCTTCCTTCGTGGGGGGAGCC; myc2.Pu2 to bind Ets2 protein were similarly demon- strated in gel retardation assays (results not shown). U N-myc2.Pu2/U27 to 3: TCGGAAGAGCTGAGCGGAAAGAAGCTCT TTCTCGACTCGCCTTTCTTCGAGAAGCC; The N-myc2 promoter is eciently activated by Ets expression E74:TCGGGCTCGAGATAAACAGGAAGTGGTC Chimeric N-myc2/luciferase constructs were generated CGAGCTCTATTTGTCCTTCACCAGAGCC by inserting dierent fragments of the N-myc2 promoter in pSVOALD5', a plasmid carrying the These double-stranded oligomers and corresponding promoterless luciferase (LUC) gene and SV40 small-t mutated oligonucleotides (N-myc2.Pu1mut: AAGGA- intron/polyadenylation signal (De Wet et al., 1987). AGC?AACCAAGC and N-myc2.Pu2mut: GCGG- The full length (71100) N-myc2 promoter consists of a AAA?GCCCAAA) were labeled by ®ll-in with large 1174 bp HindIII ± BglII fragment, and the 7332 fragment of DNA polymerase I (Klenow). The E74 construct contains a 406 bp RsaI±BglII DNA frag- oligonucleotide corresponds to a strong binding motif ment as shown in Figure 1. The 759 and 737 of the drosophila ecdysone-inducible E74A protein, constructs were obtained after PCR ampli®cation of shown to be recognized by other ETS-domain proteins 133 bp and 111 bp N-myc2 sequences spanning the (Urness and Thummel, 1990). transcription initiation site. The DNA sequence of the The capacity of each of the two consensus Ets- fragments generated by PCR was con®rmed by binding motifs from N-myc2 promoter to compete for nucleotide sequencing. In all constructs, N-myc2 binding of Ets1 to the high-anity Ets-binding site E74 sequences terminated at the BglII site (position +74) was ®rst investigated. Incubation of the 32P-labeled E74 and included the ®rst 27 bp of the N-myc2 open probe with the Ets1-containing extracts yielded a major reading frame (ORF) fused in frame with the LUC DNA-protein complex (Figure 2, lanes 2 and 8) that ORF. did not appear using extracts from insect cells infected Hepatoma-derived Huh7 cells were transfected with with the empty vector (not shown). In competition expression plasmids directing the expression of either experiments, in which a 100- to 400-fold excess of the Ets1, Ets2 or PEA3 together with reporter constructs unlabeled N-myc2.Pu1 or N-myc2.Pu2 oligonucleotides carrying the LUC gene under control of the N-myc2 was included with the labeled E74 probe, both N-myc2 promoter. The pEts1 and pEts2 plasmids carrying Ets1 oligos competed eectively for the DNA-protein and Ets2 cDNAs linked to the SV40 early promoter complex (lanes 3, 4, 9 and 10); the mutated oligos have been described previously (Prosser et al., 1992), were ineective (lanes 5, 6, 11 and 12). Similarly, when and the plasmid carrying a PEA3 cDNA controlled by E74 was used as a probe, unlabeled N-myc2.Pu2 the SV40 early promoter was a gift from J Hassell. (Figure 2, lanes 21 and 22) as well as N-myc2.Pu1 Cells were transfected by the calcium phosphate oligonucleotides (data not shown) competed eectively coprecipitation method, using 15 mg of plasmid DNA for Ets2 protein binding, while a mutated oligo (lanes per 25 cm2 dishes and 2 mg of the b-galactosidase 23 and 24) had no eect.
Load more

Recommended publications
  • REVIEW Signal Transduction, Cell Cycle Regulatory, and Anti
    Leukemia (1999) 13, 1109–1166 1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu REVIEW Signal transduction, cell cycle regulatory, and anti-apoptotic pathways regulated by IL-3 in hematopoietic cells: possible sites for intervention with anti-neoplastic drugs WL Blalock1, C Weinstein-Oppenheimer1,2, F Chang1, PE Hoyle1, X-Y Wang3, PA Algate4, RA Franklin1,5, SM Oberhaus1,5, LS Steelman1 and JA McCubrey1,5 1Department of Microbiology and Immunology, 5Leo Jenkins Cancer Center, East Carolina University School of Medicine Greenville, NC, USA; 2Escuela de Quı´mica y Farmacia, Facultad de Medicina, Universidad de Valparaiso, Valparaiso, Chile; 3Department of Laboratory Medicine and Pathology, Mayo Clinic and Foundation, Rochester, MN, USA; and 4Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA Over the past decade, there has been an exponential increase growth factor), Flt-L (the ligand for the flt2/3 receptor), erythro- in our knowledge of how cytokines regulate signal transduc- poietin (EPO), and others affect the growth and differentiation tion, cell cycle progression, differentiation and apoptosis. Research has focused on different biochemical and genetic of these early hematopoietic precursor cells into cells of the 1–4 aspects of these processes. Initially, cytokines were identified myeloid, lymphoid and erythroid lineages (Table 1). This by clonogenic assays and purified by biochemical techniques. review will concentrate on IL-3 since much of the knowledge This soon led to the molecular cloning of the genes encoding of how cytokines affect cell growth, signal transduction, and the cytokines and their cognate receptors.
    [Show full text]
  • The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
    Subject Review The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Michalis V. Karamouzis,1 Panagiotis A. Konstantinopoulos,1,2 and Athanasios G. Papavassiliou1 1Department of Biological Chemistry, Medical School, University of Athens, Athens, Greece and 2Division of Hematology-Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts Abstract Much of the current anticancer research effort is focused on Respiratory epithelium cancers are the leading cause cell-surface receptors and their cognate upstream molecules of cancer-related death worldwide. The multistep natural because they provide the easiest route for drugs to affect history of carcinogenesis can be considered as a cellular behavior, whereas agents acting at the level of gradual accumulation of genetic and epigenetic transcription need to invade the nucleus. However, the aberrations, resulting in the deregulation of cellular therapeutic effect of surface receptor manipulation might be homeostasis. Growing evidence suggests that cross- considered less than specific because their actions are talk between membrane and nuclear receptor signaling modulated by complex interacting downstream signal trans- pathways along with the activator protein-1 (AP-1) duction pathways. A pivotal transcription factor during cascade and its cofactor network represent a pivotal respiratory epithelium carcinogenesis is activator protein-1 molecular circuitry participating directly or indirectly in (AP-1). AP-1–regulated genes include important modulators of respiratory epithelium carcinogenesis. The crucial role invasion and metastasis, proliferation, differentiation, and of AP-1 transcription factor renders it an appealing survival as well as genes associated with hypoxia and target of future nuclear-directed anticancer therapeutic angiogenesis (7). Nuclear-directed therapeutic strategies might and chemoprevention approaches.
    [Show full text]
  • Signal Transduction and the Ets Family of Transcription Factors
    Oncogene (2000) 19, 6503 ± 6513 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Signal transduction and the Ets family of transcription factors John S Yordy1 and Robin C Muise-Helmericks*,1,2 1Center for Molecular and Structural Biology, Hollings Cancer Center, Medical University of South Carolina, Charleston, South Carolina, SC 29403, USA; 2Department of Cell Biology and Anatomy, Medical University of South Carolina, Charleston, South Carolina, SC 29403, USA Cellular responses to environmental stimuli are con- expression required for cellular growth, dierentiation trolled by a series of signaling cascades that transduce and survival. One group of downstream eectors of extracellular signals from ligand-activated cell surface these signaling pathways is the Ets family of transcrip- receptors to the nucleus. Although most pathways were tion factors. Ets family members can also be initially thought to be linear, it has become apparent that considered upstream eectors of signal transduction there is a dynamic interplay between signaling pathways pathways controlling the expression of a number of that result in the complex pattern of cell-type speci®c signaling components including both receptor tyrosine responses required for proliferation, dierentiation and kinases and intermediate signaling molecules. survival. One group of nuclear eectors of these The Ets family of transcription factors is de®ned by signaling pathways are the Ets family of transcription a conserved winged helix ± turn ± helix DNA binding factors, directing cytoplasmic signals to the control of domain (Papas et al., 1989; Wasylyk et al., 1993; gene expression. This family is de®ned by a highly Werner et al., 1995).
    [Show full text]
  • Quantitative Analysis of NF-B Transactivation Specificity Using A
    Quantitative Analysis of NF-#B Transactivation Specificity Using a Yeast-Based Functional Assay The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Sharma, Vasundhara, Jennifer J. Jordan, Yari Ciribilli, Michael A. Resnick, Alessandra Bisio, and Alberto Inga. “Quantitative Analysis of NF-κB Transactivation Specificity Using a Yeast-Based Functional Assay.” Edited by Sue Cotterill. PLOS ONE 10, no. 7 (July 6, 2015): e0130170. As Published http://dx.doi.org/10.1371/journal.pone.0130170 Publisher Public Library of Science Version Final published version Citable link http://hdl.handle.net/1721.1/99881 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/4.0/ RESEARCH ARTICLE Quantitative Analysis of NF-κB Transactivation Specificity Using a Yeast- Based Functional Assay Vasundhara Sharma1, Jennifer J. Jordan1¤, Yari Ciribilli1, Michael A. Resnick2, Alessandra Bisio1‡*, Alberto Inga1‡* 1 Laboratory of Transcriptional Networks, Centre for Integrative Biology (CIBIO), University of Trento, Trento, Italy, 2 Chromosome Stability Group; National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina, United States of America a11111 ¤ Current address: Department of Biological Engineering, MIT, Boston, MA, USA ‡ These authors are co-last authors on this work. * [email protected] (AB); [email protected] (AI) Abstract κ OPEN ACCESS The NF- B transcription factor family plays a central role in innate immunity and inflamma- tion processes and is frequently dysregulated in cancer. We developed an NF-κB functional Citation: Sharma V, Jordan JJ, Ciribilli Y, Resnick κ MA, Bisio A, Inga A (2015) Quantitative Analysis of assay in yeast to investigate the following issues: transactivation specificity of NF- B pro- NF-κB Transactivation Specificity Using a Yeast- teins acting as homodimers or heterodimers; correlation between transactivation capacity Based Functional Assay.
    [Show full text]
  • ETS1, Nfkb and AP1 Synergistically Transactivate the Human GM ± CSF Promoter
    Oncogene (1997) 14, 2845 ± 2855 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 ETS1, NFkB and AP1 synergistically transactivate the human GM ± CSF promoter Ross S Thomas1, Martin J Tymms1, Leigh H McKinlay1, M Frances Shannon2, Arun Seth3 and Ismarl Kola1 1Molecular Genetics and Development Group, Institute of Reproduction and Development, Monash University, Melbourne 3168, Australia; 2Division of Human Immunology, Hanson Centre for Cancer Research, Institute of Medical and Veterinary Science, Adelaide 5000, Australia; 3Department of Pathology, University of Toronto/Women's College Hospital, Toronto, Ontario, Canada Activation of helper T cells results in coordinate Activating signals ultimately result in cellular prolifera- expression of a number of cytokines involved in tion, and transcriptional induction and secretion of a dierentiation, proliferation and activation of the number of cytokines including IL-2 (interleukin-2), IL-3, haematopoietic system. Granulocyte-macrophage colony IFNg (interferon-gamma) and GM ± CSF (granulocyte- stimulating factor (GM ± CSF) is one such cytokine, macrophage colony-stimulating factor) (Stanley et al., whose increased expression results mostly from increases 1985; Miyajima et al., 1988; Arai et al., 1990). These in transcription. Cis-acting elements with NFkB, AP1 cytokines direct the eector functions of various cell and ETS-like binding motifs have been identi®ed in the types involved in an immune response, including B cells, promoter region of the GM ± CSF gene, and are macrophages, mast cells, eosinophils and neutrophils. important or essential for transcriptional activity follow- GM ± CSF expression in activated T cells is ing T cell activation. ETS1 is a transcription factor of regulated by two mechanisms.
    [Show full text]
  • DNA Binding of USF Is Required for Specific E-Box Dependent Gene
    Oncogene (1999) 18, 7200 ± 7211 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $15.00 http://www.stockton-press.co.uk/onc DNA binding of USF is required for speci®c E-box dependent gene activation in vivo Astrid Kiermaier1,5, Jonathan M Gawn2,5, Laurie Desbarats1, Rainer Sarich3, Wilhelm Ansorge3, Paul J Farrell2,4, Martin Eilers1 and Graham Packham*,2,4 1Institute for Molecular Biology and Tumour Research, University of Marburg, Emil-Mannkop-Str 2, 35033 Marburg, Germany; 2Ludwig Institute for Cancer Research, Imperial College School of Medicine, St. Mary's Campus, Norfolk Place, London, W2 1PG, UK; 3Biochemical Instrumentation Programme, EMBL, Meyerhofstr 1, 69117 Heidelberg, Germany; 4Virology and Cell Biology, Department of Medical Microbiology, Imperial College School of Medicine, St. Mary's Campus, Norfolk Place, London, W2 1PG, UK Although USF-1 and -2 are the major proteins that bind Repression requires an amino-terminal domain con- to Myc-regulated E-box (CACGTG) elements in many served in Mad-like proteins that recruits histone cells, there is no clear role for USF during Myc- deacetylases via an adapter protein, sin3 (e.g. Alland dependent gene regulation. Using dominant negative et al., 1997; Laherty et al., 1997; Sommer et al., 1997). alleles of USF-1 we now show that DNA binding by Little doubt exists that Myc exerts at least part of its USF at a Myc-regulated E-box limits the ability of biological eects through the transcriptional activation another E-box binding factor, TFE-3, to activate a of speci®c target genes although Myc has other target gene of Myc in vivo and to stimulate S phase functions that may contribute to its biological proper- entry in resting ®broblasts.
    [Show full text]
  • 4560.Full.Pdf
    HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 This information is current as Composite Element of the IL-2 Promoter of September 29, 2021. Esther González, Carmen Punzón, Manuel González and Manuel Fresno J Immunol 2001; 166:4560-4569; ; doi: 10.4049/jimmunol.166.7.4560 Downloaded from http://www.jimmunol.org/content/166/7/4560 References This article cites 67 articles, 45 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/166/7/4560.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 29, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 Composite Element of the IL-2 Promoter1 Esther Gonza´lez, Carmen Punzo´n, Manuel Gonza´lez, and Manuel Fresno2 Dysregulation of cytokine secretion plays an important role in AIDS pathogenesis.
    [Show full text]
  • Interaction of the Human Androgen Receptor Transactivation Function with the General Transcription Factor TFIIF
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 8485–8490, August 1997 Biochemistry Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF IAIN J. MCEWAN* AND JAN-ÅKE GUSTAFSSON Department of Biosciences, Novum, Karolinska Institute, S-141 57 Huddinge, Sweden Communicated by Elwood V. Jensen, University of Hamburg, Hamburg, Germany, May 27, 1997 (received for review January 28, 1997) ABSTRACT The human androgen receptor (AR) is a tion factors, and thus the polymerase, to the promoter (re- ligand-activated transcription factor that regulates genes im- viewed in refs. 17–19). This can be achieved by direct contact portant for male sexual differentiation and development. To between the activator and the general transcription factors better understand the role of the receptor as a transcription andyor interactions by means of coactivator proteins (refs. 17 factor we have studied the mechanism of action of the N- and 19–21 and references therein). terminal transactivation function. In a protein–protein inter- In recent years a number of interactions have been described action assay the AR N terminus (amino acids 142–485) between members of the steroid–thyroid hormone receptor selectively bound to the basal transcription factors TFIIF and superfamily and basal transcription factors and co–activator the TATA-box-binding protein (TBP). Reconstitution of the proteins (see ref. 22 and references therein). However, very transactivation activity in vitro revealed that AR142–485 fused to little is known concerning the identity of interacting proteins the LexA protein DNA-binding domain was competent to with the human AR. To better understand the mechanism of activate a reporter gene in the presence of a competing DNA gene regulation by the human AR we have screened a panel of template lacking LexA binding sites.
    [Show full text]
  • Transactivation by the P65 Subunit of NF-B in Response to Interleukin-1
    MOLECULAR AND CELLULAR BIOLOGY, July 2001, p. 4544–4552 Vol. 21, No. 14 0270-7306/01/$04.00ϩ0 DOI: 10.1128/MCB.21.14.4544–4552.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved. Transactivation by the p65 Subunit of NF-␬B in Response to Interleukin-1 (IL-1) Involves MyD88, IL-1 Receptor-Associated Kinase 1, TRAF-6, and Rac1 CAROLINE JEFFERIES,1* ANDREW BOWIE,1 GARETH BRADY,1 EMMA-LOUISE COOKE,2 3 1 XIAOXIA LI, AND LUKE A. J. O’NEILL Department of Biochemistry and Biotechnology Institute, Trinity College, Dublin 2, Ireland1; Department of Cell Biology, Glaxo Wellcome Research and Development, Medicines Research Centre, Stevenage, Hertfordshire SG1 2NY, United Kingdom2; and Department of Molecular Biology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 441953 Received 30 August 2000/Returned for modification 2 October 2000/Accepted 19 April 2001 We have examined the involvement of components of the interleukin-1 (IL-1) signaling pathway in the transactivation of gene expression by the p65 subunit of NF-␬B. Transient transfection of cells with plasmids encoding wild-type MyD88, IL-1 receptor-associated kinase 1 (IRAK-1), and TRAF-6 drove p65-mediated transactivation. In addition, dominant negative forms of MyD88, IRAK-1, and TRAF-6 inhibited the IL-1- induced response. In cells lacking MyD88 or IRAK-1, no effect of IL-1 was observed. Together, these results indicate that MyD88, IRAK-1, and TRAF-6 are important downstream regulators of IL-1-mediated p65 transactivation. We have previously shown that the low-molecular-weight G protein Rac1 is involved in this response.
    [Show full text]
  • AML1 Stimulates G1 to S Progression Via Its Transactivation Domain
    Oncogene (2002) 21, 3247 ± 3252 ã 2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00 www.nature.com/onc AML1 stimulates G1 to S progression via its transactivation domain Florence Bernardin1 and Alan D Friedman*,1 1The Johns Hopkins Oncology Center, Division of Pediatric Oncology, Baltimore, Maryland, MD 21231, USA Inhibition of AML1-mediated transactivation potently Mice lacking either AML1 (RUNX1) or CBFb do slows G1 to S cell cycle progression. In Ba/F3 cells, not develop de®nitive hematopoiesis, indicating a activation of exogenous AML1 (RUNX1)-ER with 4- critical role for these factors in pluripotent hemato- hydroxytamoxifen prevents inhibition of G1 progression poietic stem cells (Okuda et al., 1996; Sasaki et al., mediated by CBFb-SMMHC, a CBF oncoprotein. We 1996; Wang et al., 1996a,b; Niki et al., 1997). The most expressed three AML1-ER variants with CBFb- potent AML1 transactivation domain, corresponding SMMHC in Ba/F3 cells. In these lines, CBFb-SMMHC to residues 318 ± 398 of the human protein (Kanno et expression is regulated by the zinc-responsive metal- al., 1998), is required to rescue the hematopoietic lothionein promoter. Deletion of 72 AML1 C-terminal potential of AML1(7/7) ES cells (Okuda et al., residues, which includes a transrepression domain, did 1999). On the other hand, the C-terminus of AML1, not alter the activity of AML1-ER, whereas further containing a VWRPY motif capable of mediating deletion of 98 residues, removing the most potent AML1 transrepression via interaction with TLE (Aronson et transactivation domain (TAD), prevented rescue of cell al., 1997; Imai et al., 1998; Levanon et al., 1998), is not cycle inhibition.
    [Show full text]
  • Enhancing IL-2 Gene Transactivation Cells by Increasing Mrna Stability
    CD28 Costimulation Augments IL-2 Secretion of Activated Lamina Propria T Cells by Increasing mRNA Stability Without Enhancing IL-2 Gene Transactivation This information is current as of September 29, 2021. Rivkah Gonsky, Richard L. Deem, Doo Han Lee, Alice Chen and Stephan R. Targan J Immunol 1999; 162:6621-6629; ; http://www.jimmunol.org/content/162/11/6621 Downloaded from References This article cites 36 articles, 24 of which you can access for free at: http://www.jimmunol.org/content/162/11/6621.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. CD28 Costimulation Augments IL-2 Secretion of Activated Lamina Propria T Cells by Increasing mRNA Stability Without Enhancing IL-2 Gene Transactivation1 Rivkah Gonsky,* Richard L. Deem,* Doo Han Lee,† Alice Chen,* and Stephan R. Targan2* The pathways leading to activation in lamina propria (LP) T cells are different from peripheral T cells.
    [Show full text]
  • Β-Catenin-Mediated Transactivation and Cell
    Oncogene (2002) 21, 8414 – 8427 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc b-Catenin-mediated transactivation and cell – cell adhesion pathways are important in curcumin (diferuylmethane)-induced growth arrest and apoptosis in colon cancer cells Aruna S Jaiswal1,2, Benjamin P Marlow1,2, Nirupama Gupta1,2 and Satya Narayan*,1,2 1Department of Anatomy and Cell Biology, College of Medicine, The University of Florida, Gainesville, Florida, FL 32610, USA; 2UF Shands Cancer Center, College of Medicine, The University of Florida, Gainesville, Florida, FL 32610, USA The development of nontoxic natural agents with Introduction chemopreventive activity against colon cancer is the focus of investigation in many laboratories. Curcumin Dysregulation of the Wingless/Wnt (Wnt) signaling (feruylmethane), a natural plant product, possesses such pathway is believed to play an important role in the chemopreventive activity, but the mechanisms by which it pathogenesis of colorectal cancer (Polakis, 2000). In a prevents cancer growth are not well understood. In the simple model, Wnt signaling regulates the assembly of present study, we examined the mechanisms by which a complex consisting of Axin (and its homolog Axil curcumin treatment affects the growth of colon cancer and conductin), adenomatous polyposis coli (APC), b- cells in vitro. Results showed that curcumin treatment catenin, and glycogen synthase-3b kinase (GSK3b). causes p53- and p21-independent G2/M phase arrest and Axin binds to APC, b-catenin, and GSK3b and thereby apoptosis in HCT-116(p53+/+), HCT-116(p537/7) and promotes b-catenin phosphorylation and subsequent HCT-116(p217/7) cell lines.
    [Show full text]