Dopamine and Norepinephrine Transporter Inhibition in Cocaine Addiction: Using Mice

Expressing Cocaine-Insensitive Transporters

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Bradley Joseph Martin, B.S.

Neuroscience Graduate Studies Program

The Ohio State University

2011

Dissertation Committee:

Howard Haogang Gu, PhD., Advisor

Gary L. Wenk, PhD

Lane J. Wallace, PhD

Robert L. Stephens, Jr., PhD

Bradley Joseph Martin

2011

Abstract

Cocaine’s effects are predominately mediated by inhibiting the reuptake transporters for dopamine, serotonin, and norepinephrine. How each of these transporters contributes to cocaine’s effects is unclear, but such knowledge would aid in efforts to design rational treatments for cocaine addiction.

To directly test the contribution of each of these transporters in cocaine’s effects, three transgenic knockout mouse lines were previously created wherein each transporter gene was individually deleted. These knockout mice studies suggest that no single transporter is critical for mediating cocaine’s rewarding effects. However, this hypothesis contradicts pharmacological studies which indicate that the dopamine transporter (DAT) is critical for cocaine’s rewarding effects. Our lab hypothesized that the compensatory adaptations of knockout mice were responsible for this discrepancy.

To avoid compensatory adaptations, our lab developed transporter knockin mice expressing a mutated, yet functional, transporter that is insensitive to cocaine inhibition.

Unlike transporter knockout mice, these cocaine-insensitive transporter mice retain functioning neurotransmitter systems. We have previously used cocaine-insensitive dopamine transporter mice to reestablish the hypothesis that inhibiting the dopamine transporter is critical for cocaine’s rewarding effects.

ii In this dissertation, I will utilize two knockin mouse lines to further elucidate how inhibiting DAT and norepinephrine transporter (NET) contribute to cocaine’s effects.

First, I used Golgi-Cox techniques to demonstrate that dopamine transporter cocaine insensitive (DAT-CI) mice do not show chronic cocaine-induced increases in spine density on the dendrites of neurons in the nucleus accumbens relative to wild-type mice.

These data suggest that DAT inhibition is critical for cocaine’s ability to produce long- lasting neural adaptations that have been associated with addiction. Second, I performed various molecular, biochemical, and neurochemical techniques to show NET-CI mice are valid tools for studying cocaine addiction. Third, by characterizing the behaviors of NET-

CI mice, I found that NET-CI mice have lower levels of basal locomotion, higher levels of locomotor activity in response to cocaine, and similar reward-related behaviors. These data suggest that NET inhibition influences cocaine’s stimulating but not its rewarding effects. Collectively, these studies further our understanding of how the inhibition of

DAT and NET contributes to cocaine’s many effects. In addition, our data clarify the literature by demonstrating that NET does not play a major role in cocaine reward.

iii

Dedication

To my wife, Amanda, and my mother, Jeannie.

Acknowledgments

I would like to thank my advisor, Dr. Howard Gu, for adopting me into his lab, for being patient and supportive, and for taking on the Sisyphean task of trying to teach molecular biology to a psychology student. I would also like to thank the professors who served on my committees, Drs. Gary Wenk, Lane Wallace, Robert Stephens, Georgia

Bishop, and David Saffeen, for their encouragement and feedback - a special thanks to

Dr. Wallace for giving me plenty of guidance and opportunities to teach.

I would also like to thank my labmates: Drs. Erik Hill, Hua Wei and Michael

Tilley; Keerthi Thirtamara, Bartholomew Naughton, Pauline Chen, Dawn Han, Aravand

Menon, Daniel Yoon, and Brian O’Neill. A special thanks to Brian for always challenging me and to Hua for creating the cocaine-insensitive norepinephrine transporter mice. I would also like to thank my collaborators Drs. A. Courtney Devries, and Dr.

Maria Hadjiconstantinou Neff.

I would like to thank my family and friends; my mother for managing to provide for my brother and I as a single mother; my brother, Alex; my grandparents, Frank and

Bryan Wool, for showing me the value of an education; my dad, Jon Hackett, and my step father, Rusty Van Leuven, for always being proud of me; my wife’s grandparents,

Dr. Bill and Helen Swank and Frank and Marcy Webster, and parents, Dr. Douglas and

Theresa Webster for making Columbus a wonderful place to live and for doting on our v children; my friends Daniel Hendrix, Leonard Greco, Joe Piasick, Dr. Ryan Smith, and

Dr. Michael Stone. I would like to thank my wife, Amanda Martin, for being so supportive and not judging me too much during the ups and downs of this endeavor.

Vita

January 22nd, 1982 ...... Born, Jacksonville, Florida

2000...... Cornwall Central High School

2004...... Colorado State University

2005 ...... Postbac Intramural Research Training

Award (IRTA) recipients

2006 to Present ...... Graduate Research Associate, Department

of Psychiatry and Pharmacology, The Ohio

State University

Publications

Martin BJ, Wei H., Gu HH. Characterizing cocaine reward and stimulation in mice

expressing cocaine-insensitive norepinephrine transporter. (in prep)

Martin BJ, Naughton BJ., Thirthamar, KK. Devries AC., Gu. HH. Dopamine transporter

inhibition is necessary for cocaine’s ability to increase dendritic spine density in

the nucleus accumbens. Synapse. 2011 Jun; 65(6):490-6.

vii Bruno JP, Gash C, Martin B, Zmarowski A, Pomerleau F, Burmeister J, Huettl P,

Gerhardt GA. Second-by-second measurement of acetylcholine release in

prefrontal cortex. European Journal of Neuroscience. 24(10), 2749-57, 2006

Wendland JR, Martin BJ, Kruse MR, Lesch KP, Murphy DL. Simultaneous genotyping

of four functional loci of human SLC6A4, with a reappraisal of 5-HTTLPR and

rs25531. Mol Psychiatry 11(3), 2006.

Kim DK, Tolliver TJ, Huang SJ, Martin BJ, Andrews AM, Wichems C, Holmes A, Lesch

KP, Murphy, DL. Altered serotonin synthesis, turnover and dynamic regulation in

multiple brain regions of mice lacking the serotonin transporter.

Neuropharmacology. 2005 Nov; 49(6):798-810.

Fields of Study

Major Field: Neuroscience Graduate Studies Program

viii

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments ...... v

Vita ...... vii

Publications ...... vii

Table of Contents ...... ix

List of Figures ...... xi

Chapter 1: Introduction to animal models of cocaine addiction ...... 1

Chapter 2: Dopamine Transporter Inhibition is Necessary for Cocaine-Induced Increases in Dendritic Spine Density in the Nucleus Accumbens ...... 22

2.1 Background and Introduction ...... 22

2.2 Materials and Methods ...... 25

2.3 Results ...... 28

2.4 Discussion ...... 30

Chapter 3: Characterizing cocaine reward and stimulation in mice expressing cocaine- insensitive norepinephrine transporter...... 40

3.1 Background and Introduction ...... 40

ix 3.2 Materials and Methods ...... 42

3.3 Results ...... 47

3.4 Discussion ...... 49

Chapter 4: General discussion and future direction ...... 63

References ...... 71

Abbreviations ...... 91

List of Figures

Figure 1. Illustration of cocaine’s three principle binding sites...... 18

Figure 2. Two dimensional serpentine schematic of the mNET transmembrane domains

(TMD) 2 and 3...... 19

Figure 3. Drug inhibitions of mNETCGT and wild-type mNET...... 21

Figure 4. Effects of cocaine on locomotor activity in wild type and DAT-CI mice……. 36

Figure 5. Effects of cocaine on dendritic spine density in the NAC of wild-type and DAT-

CI mice………………………………………………………………………………….. 38

Figure 6. Effects of cocaine on ΔFosB expression in NAC of wild-type and DAT-CI mice...... 39

Figure 7. Targeting strategy for generating NET-CI mice construct...... 55

Figure 8. Relative mRNA expression of NET in WT and NET-CI mice...... 56

Figure 9. Western blots of of NET protein from the prefrontal cortex synaptosomes of

WT and NET-CI mice...... 57

Figure 10. Characterization of the function of NETcgt in mouse cortical synaptosomes.58

Figure 11. Neurochemical changes in NE and DA homeostasis in NET-CI mice...... 59

Figure 12. Locomotor effects of cocaine in WT and NET-CI mice...... 60

Figure 13. Locomotor sensitization to various doses of cocaine in WT and NET-CI mice.

...... 61

Figure 14. Cocaine conditioned place preference in wild-type and NET-CI mice...... 62

Chapter 1: Introduction to animal models of cocaine addiction

Cocaine is a psychostimulant that is regularly abused by 1.6 million Americans

(NSDUH, 2010). In fact, 14% of Americans have experimented with cocaine, making it the second most popular illegal recreational drug abused (SAMHSA, 2001). Cocaine is the most potent stimulant of natural origin and is considered to have a moderately high addictive potential (Office of National Drug Control Policy, 2002). Approximately 8 percent of the individuals who use cocaine become dependent (SAMHSA, 2001). Drug dependent has been described by the World Health Organization (1964) as “a state in which the individual has a need for repeated doses of the drug to feel good or to avoid feeling bad. Its characteristics include: (1) An overpowering desire or need (compulsion) to continue taking the drug and to obtain it by any means; (2) A tendency to increase the dose; (3) A psychic (psychological) and sometimes a physical dependence on the effects of the drug." The toll of cocaine addiction on our society is enormous, especially when considering its association with crimes, deaths, birth defects, family problems, legal fees, human immunodeficiency virus, wasted time at work, and incarceration expenses. In fact, cocaine is associated with a third of all drug related emergency room visits and a sixth of federal prisoners (SAMHSA, 2001).

Cocaine causes diverse subjective symptoms that change after repeated exposures.

The initial exposures of cocaine produce euphoria, a reduction in anxiety, intense feelings 1 of well-being, improved self-confidence, appetite suppression, and alertness (Resnick et al., 1977). After repeatedly using cocaine, however, the intensity of the positive effects associated with cocaine lessen while the negative effects associated with withdrawal intensify (Koob et al., 1997, Ettenberg, 2004). Chronic exposure to cocaine can produce profound abnormalities in an individual’s reward, cognitive, emotional, sensory, and autonomic systems. Cocaine impairs the rewarding system by suppressing natural pleasures (e.g. food, sex, and career achievements (Koob et al., 1997) and by enhancing the rewarding properties of stimuli associated with drugs (i.e. incentive salience;

(Robinson and Berridge, 1993). Cocaine impacts cognitive functions by impairing ability to appreciate long-term goals (i.e. delayed gratification), worsening working memory, biasing attention processes towards drug-related cues, causing paranoia, impairing goal directed behaviors, increasing impulsivity, and lessening effectiveness of decision making (Bolla et al., 1998, Verdejo-Garcia et al., 2006). Cocaine affects the emotional system as it produces dysphoria, malaise, lethargy, and suicidal ideations during withdrawal (Kosten et al., 1998). The sensory abnormalities associated with chronic cocaine exposure are hallucinations, itching, and analgesia (Thirthalli and Benegal,

2006, Smith et al., 2009, Brust, 2010). Cocaine also affects the autonomic nervous system as it causes hypertension, vasoconstriction, tachycardia, and mydriasis (NIDA,

2008). The motor system is also affected by cocaine as individuals addicted to cocaine often have tremors and feelings of restlessness (Brust, 2010). This broad profile of long- lasting negative symptoms facilitates relapse and contributes to the difficulty of overcoming addiction (Koob et al., 1997, Dalley et al., 2005).

The inability to treat cocaine addiction is, in part, a consequence of a poor understanding of how cocaine’s various effects are mediated by its many binding sites.

For example, cocaine stimulates kappa opioid receptors, nicotinic alpha 7 nicotinic receptors, sigma receptors, while simultaneously inhibiting ligand and voltage gated sodium channels, the dopamine, norepinephrine, and serotonin transporters (Ritz et al.,

1987, Kuhar et al., 1988, Reith, 1988, Suzuki et al., 1992, Narayanan et al., 2011).

Cocaine’s actions on the voltage gated sodium channels are thought to be responsible for cocaine’s analgesic (Schwartz et al., 2010). Cocaine’s effects on the sigma receptors are hypothesized to partially mediate cocaine’s hallucinogenic effects (Narayanan et al.,

2011).

The principle targets of cocaine are the plasma membrane transporters that reuptake extracellular dopamine (DAT), serotonin (SERT), and norepinephrine (NET,

Figure 1). Cocaine binds to these transporters with similarly high potencies in vitro: human DAT (KI = 0.23 µM), NET (KI = 0.48 µM), and SERT (KI = 0.74,(Han and Gu,

2006). By blocking monoamine transporters, cocaine prevents neurotransmitters from being recycled, prolonging the amount of time neurotransmitters remain in the extracellular environment (Carboni et al., 1989). Consequently, neurotransmitters accumulate extracellularly, leading to the over-stimulation of dopamine, norepinephrine, and serotonin receptors.

There are two extreme positions that could be used to describe the relationship between cocaine binding targets and cocaine’s effects. On the one hand, each individual cocaine effect (i.e. reward) could be mediated by a specific target (i.e. dopamine). This

3 hypothesis has been coined the “DAT-is-it hypothesis” (Kuhar et al., 1991, Wise, 1994,

Caine, 1998). Conversely, each cocaine effect could be the consequence of multiple targets, which has been termed the “Dirty drug hypothesis” (Uhl et al., 2002). The first position is supported by pharmacological studies showing that cocaine’s reinforcement effects strongly correlate with cocaine’s ability to inhibit DAT (Ritz et al., 1987,

Medvedev et al., 2005). But the DAT-is-it hypothesis appears to be refuted by studies involving mice lacking the dopamine transporter (DAT-KO) that still, unexpectedly, find cocaine rewarding (Sora et al., 1998, Hall et al., 2004, Medvedev et al., 2005).Therefore, the DAT-KO mice appear to support the notion that cocaine produces its rewarding effects through many binding targets, supporting the “dirty drug” hypothesis.” By creating better animal models to study cocaine addiction, we will glean more insights into the relationship between cocaine’s binding sites and its various effects.

Of the monoamine transporters, the dopamine transporter is thought to play a central role in addiction. DAT’s chief role is to regulate the extracellular levels of dopamine; however, DAT also is capable of transporting NE (Moron et al., 2002). The human dopamine transporter was first cloned in 1991 (Giros et al.). DAT is a Na+-/Cl- symporter that has 12 putative transmembrane domain proteins. For dopamine to transport back into the neuron, one chloride ion and two sodium ions must bind to the intracellular side (Torres et al., 2003). The DAT gene is located on human chromosome

5p15.3, is 64 kbp in length, has 15 coding exons, and 14 introns (Gether et al., 2006).

DAT is located outside the synapse (i.e. peri-synaptically), which means dopamine must travel outside the synapse before it is recycled (Nirenberg et al., 1997).

DAT is primary located on the presynaptic terminals of two groups of neurons that project from midbrain, namely the ventral tegmental area (VTA) and substantia nigra

(SN, (Ciliax et al., 1999, Nestler, 2005). The dopamine neurons of the VTA and SN send projections predominantly to the nucleus accumbens (NAC) and caudate putamen, respectively (Nestler, 2005). Dopamine is released in response to stimuli that are perceived as rewarding (Schultz, 1999, Stanwood et al., 2005). This physiological event allows the brain to associate other stimuli with rewarding stimuli (e.g. sex and food) in order to learn which stimuli predict reward. Accordingly, although dopamine is typically viewed as underlying reward, it is more appropriate to view dopamine as underlying the learning of behaviors necessary for attaining rewards (Hyman et al., 2006). Thus, dopamine enables the brain to become more efficient in gathering future rewards, which is essential for survival. Because cocaine causes a greater increase in extracellular levels of dopamine than the amount of dopamine released in response to natural rewards, stimuli associated with cocaine are hypothesized to form stronger associations than stimuli associated with natural rewards (Di Chiara et al., 2004). As a result, the resources of the brain are more biased towards stimuli that predict cocaine than those that predict natural rewards (Nestler, 2005). This misappropriation of neural resources is based on findings that animal models of cocaine abuse have more dendritic spines in the nucleus accumbens relative to drug naïve animals (Robinson et al., 2001, Kolb et al., 2003,

Robinson and Kolb, 2004).

Dopamine’s actions are mediated predominately by 5 difference dopamine receptor subtypes that are organized into two families: D1-like and D2-like receptors.

The D1-like receptors consist of the D1 and D5 receptors and the D2-like family consists of D2, D3, and D5 (Beaulieu and Gainetdinov, 2011). All dopamine receptors are metabotropic G protein-coupled receptors. D1-like receptors couple to Gs subunits and activate adenylyl cyclase, whereas D2-like receptors couple to Gi subunits and inhibit adenylyl cyclase, leading to many changes, including changes in gene expression, kinase activity, and neurochemical alterations (Beaulieu and Gainetdinov, 2011). Although seemingly straight forward at the cellular level, the physiologically role of these receptors is elusive because their functions differ depending on their location on the neurons (i.e dendrite vs. axon). In general, D1 receptors excite neurons and D2 receptors inhibit neurons (Bracci et al., 2002, Centonze et al., 2002). The dopamine receptors located in the striatum and prefrontal cortex (PFC) are implicated in cocaine addiction. For example, imaging and postmortem studies have shown that individuals addicted to cocaine have fewer dopamine D2 receptors (Volkow et al., 2009).

The structure of the brain most integral to cocaine rewarding and addictive effects is the NAC, the ventral portion of the striatum (Nestler, 2005). The NAC is densely innervated by neurons with cell bodies in the VTA and it contains a large number of dopaminergic terminals. Given that all drugs of abuse increase dopamine levels within the NAC, the NAC is considered a reward center (Nestler, 2005). There is an interesting hypothesis that the transition from recreational use to habitual use is accompanied by a migration of neural activity. In animal models, acute exposures of cocaine is hypothesized to trigger neural activity within more medial regions of the ventral striatum while chronic exposures appears to trigger more lateral and dorsal regions of striatum

(Everitt et al., 2001). This so called spiraling hypothesis suggests a neural mechanism to explain how addiction progresses.

Cocaine addiction is often characterized by periods of “highs” while taking the drug, followed by periods of “lows” or withdrawal once the drug has metabolized. These altered states parallel changes in extracellular levels of dopamine in the NAC and PFC.

During the high states, extracellular levels of dopamine are elevated, and during the low states extracellular levels of dopamine are reduced (Imperato et al., 1992, Hitri et al.,

1994, Hitri et al., 1996, Koob and Volkow, 2011). This decrease in extracellular level of dopamine during withdrawal appears to coincide with a decrease in DAT (Zahniser and

Sorkin, 2004).

Pharmacological studies have shown that DAT is critical for cocaine’s rewarding properties. For example, the propensity of most cocaine analogs to produce reinforcement is directly correlated with the drug’s potency to inhibit DAT (but not its potency to NET and SERT (Ritz et al., 1987). While animals will self-administer certain DAT inhibitors, they do not self-administer selective inhibitors of NET or SERT (Ritz and Kuhar, 1989).

In fact, SERT appears to negatively modulate cocaine reward, and NET does not appear to alter cocaine’s rewarding properties (Roberts et al., 1999, Wee et al., 2006). These studies suggest that the inhibition of NET and SERT fails to produce reward or greatly modulate cocaine’s reinforcing effects. Also, lesion studies showed that depleting the dopaminergic and the serotonergic neurons attenuated cocaine self-administration, while noradrenergic lesions had no effect on cocaine self-administration (Roberts et al., 1977,

Roberts and Koob, 1982, Spealman et al., 1992, Tran-Nguyen et al., 1999). Studies aimed

7 at characterizing the roles of dopamine, serotonin, and norepinephrine receptors also indicate that the dopamine system is critical for cocaine’s rewarding effects. Animals will self-administer dopamine receptor agonists, and dopamine receptor antagonists inhibit the rate of cocaine self-administration (Spealman et al., 1992, Weed and Woolverton, 1995).

Although the role of dopamine receptors appear to be straightforward, these reports also found that dopamine receptors modulate an animal’s motivation, complicating interpretations. The role of serotonin receptors is convoluted given that there are 14 different subtypes, and they have subtype specific effects. While neither serotonin 5HT1 receptor agonists nor antagonists are self-administered by animals, serotonin 5HT1 receptor antagonists have been shown to attenuate cocaine self-administration (Filip et al., 2005). Studies characterizing the role of noradrenergic receptors in cocaine self- administration show that adrenergic alpha-2 receptor agonists are reinforcing

(Weinshenker and Schroeder, 2007). However, given that adrenergic alpha 2 receptors are also stimulated by dopamine, this finding does not convincingly suggest that the noradrenergic system is capable of producing reward. Collectively, the pharmacological studies suggest that the dopaminergic system is central to the addictive properties of cocaine.

To study the role of DAT more precisely in cocaine’s effects, transgenic mice were developed lacking DAT. DAT knockout mice were created by inserting a neomycin resistant gene into exon 2 of the DAT gene (Fumagalli et al., 1998). While DAT knockout mice did not show an increase in locomotor activity in response to cocaine

(Gainetdinov et al., 1998), they did appear to find cocaine rewarding as measured by

8 conditioned place preference and self-administration (Rocha et al., 1998; Sora et al.,

1998). Therefore, the rewarding properties of cocaine seem to involve binding targets other than DAT, which refutes the DAT-is-it hypothesis. This series of studies resulted in the logical, yet surprising, hypothesis that DAT is not critical for cocaine’s rewarding effects. These findings lead to the idea that addiction is a consequence of cocaine’s effects on many neurotransmitter systems. Subsequent experiments involved cross breeding DAT-KO mice with other transporter KO mice and found cocaine self- administration only abated in animals without DAT and SERT (Rocha, 2003). In fact, these studies even lead many to suspect that there was an unknown binding site responsible for addiction. While these studies were interesting, they were contrary to the current understanding of drug addiction established by pharmacology.

Our lab hypothesized that the discrepancy between pharmacological and transgenic studies was due to the compensatory adaptations of knockout mice. For example, DAT-knockout mice experience reward from serotonin selective reuptake inhibitors (i.e. fluoxetine) and norepinephrine reuptake inhibitors (i.e. nisoxetine), which wild-type mice do not find rewarding (Hall et al., 2002). Furthermore, fluoxetine elevates dopamine levels in the striatum of DAT-knockout mice, but not in wild-type mice (Hall et al., 2003). Other abnormalities of DAT-knockout mice include profound hyperactivity and abnormal glutamate transmission (Gainetdinov et al., 2004). These adaptations may limit the utility of DAT-knockout mice in evaluating the significance of DAT in cocaine's action. This compelled our lab to develop a new mouse line that would avoid these severe

9 compensatory changes in order to better test the consequences of cocaine's actions on

DAT.

To avoid compensatory adaptation, our lab generated a knockin mouse line that expresses a cocaine-insensitive transporter (DAT-CI mice). To achieve this, our lab discovered several amino acids involved in cocaine inhibition but not in dopamine uptake. Previously, we showed that transmembrane 2 and 3 were important for cocaine inhibition using random mutagenesis. By contrasting the sequences from the genes of several species, certain residues of the DAT gene appeared to be conserved between different species, which gave us clues to which amino acids were critical. To determine whether particular amino acids were involved in cocaine inhibition, we cloned mutated

DAT cDNA into a HeLa cell line. Then, cells expressing the mutated transporters were incubated with various concentrations of cocaine to determine the role of a particular amino acid in cocaine inhibition, and then the cells were incubated in various concentrations of dopamine to determine the effects of mutations on the uptake function of DAT. After screening thousands of mutations, we found several residues of DAT involved in cocaine inhibition. We created a mutant DAT transporter (DATvcv) containing 3 mutations that are involved in cocaine inhibition but minimally involved in dopamine uptake. We found that DATvcv transporters were 89 fold less sensitive to cocaine blockade than WT transporters (DATvcv retained 60% of DA uptake function and the affinity was moderately affected). To determine the role of DAT inhibition in cocaine’s effects, we developed knockin mice genetically modified to express DATvcv.

We validated DAT-CI mice by showing they lacked gross abnormalities in brain structures, dopamine uptake, and general locomotion (Chen et al., 2006b). By contrasting the effects of cocaine between DAT-CI mice and wild-type mice, we identified several cocaine effects that depend on cocaine's actions on DAT. For example, unlike DAT-KO mice, DAT-CI mice lack cocaine-induced increases in extracellular dopamine in the NAC

(Chen et al., 2006b). In addition, DAT-CI mice do not experience cocaine-induced reinforcement as measured by conditioned place preference, behavioral sensitization, or self-administration (Chen et al., 2006b, Caine, 2007, Tilley and Gu, 2008a, Thomsen et al., 2009b). As an important control, amphetamine, which has a different mechanism than cocaine, inhibits dopamine uptake in DAT-CI mice, elevates extracellular dopamine levels in the NAC, and induces conditioned place preference in DAT-CI mice, indicating that DAT-CI mice have intact reward and dopamine systems (Chen et al., 2006b). Thus,

DAT-CI mice show that cocaine's actions on DAT are necessary for cocaine's rewarding and reinforcing properties, supporting pharmacological findings. These studies show that

DAT-CI mice are superior to DAT-knockout mice for understanding the relationship between cocaine's actions on DAT and cocaine's effects.

After we provided strong evidence that confirms DAT is necessary for the reinforcing and stimulating effects of cocaine, other transporters and binding sites could also be necessary for producing cocaine’s effects. We then decided to follow up these experiments by creating mice expressing cocaine- insensitive NET (NET-CI mice) and cocaine-insensitive SERT mice. We made more progress towards the NET-CI mice, while our collaborator Dr. Randy Blakely developed knockin mice expressing serotonin

11 transporters insensitive to cocaine and serotonin selective inhibitors (Thompson et al.,

2011).

Norepinephrine (NE) is a catecholamine that has been implicated in many psychiatric disorders, including attention deficit hyperactivity disorder, post-traumatic stress disorder, depression, and anxiety (Aston-Jones and Cohen, 2005). The norepinephrine system is modulated by various drugs of abuse (e.g. cocaine, amphetamine, and morphine) and selective norepinephrine reuptake inhibitors (SNR) antidepressants (e.g. reboxine, and desipramine). NE is synthesized from dopamine by the enzyme dopamine β- hydroxylase. Noradrenergic neurons originate in the locus coeruleus (LC) and A1-A6 areas. The LC is located beneath in the dorsal medulla under the fourth ventricle and has efferents that project diffusely throughout the entire neural axis. The densest projections of the LC are to the PFC, thalamus, hippocampus, amygdala, spinal cord, and cerebellum (Moore and Bloom, 1978, Moore and Bloom,

1979). The afferents of the LC are the hypothalamus, anterior cingulate gyrus, amygdala, nucleus paragiganocellularis, hypoglossal, and PFC (Moore and Card, 1984). These efferent and afferent connections position the LC to play an important role in that brain regions involved in the autonomic nervous system, the autonomic homeostasis, attention, sleep, and stress responses (Aston-Jones et al., 1999).

The actions of NE are mediated predominantly by 3 types of adrenergic receptors:

α1, α2, and β receptors. There are 9 subtypes: α1 a,b,d, α2 a,b,c, and β1, β 2, β3 (Schank et al., 2008). These receptors have different functions and distributions. The α1 adrenergic receptors are predominately located post-synaptically and are linked to a Gq g-coupled

12 protein receptors. Activating alpha1 receptors causes a stimulation of adenylyl cyclase, which initiates the cAMP/phospholipase C/IP3 and DAG, and this leads to a rise in calcium. The α2 adrenergic receptor is located on the pre-synaptic terminal and serves as an auto-receptor. The β receptors are generally post-synaptic and are excitatory.

Extracellular norepinephrine is regulated by the NET located on the plasma membrane. NET is expressed broadly throughout the brain; however, NET is highly expressed in the locus coeruleus (LC), bed nucleus of striata terminus, hippocampus,

PFC, and hypothalamus. Although the expression profile of NET is widespread, the density of expression is in general low relative to other monoamine transporters. NET was first cloned in humans in 1991 (Amara and Pacholczyk, 1991, Pacholczyk et al.,

1991). The NET sequence is similar to DAT as it shares ~ 75% homology with the DAT amino acid sequence. NET is made up of 12 transmembrane proteins. NET is 617 amino acids in length and is about 69 kDA and has a distinctly large extracellular loop

(Pacholczyk et al., 1991). The NET gene is comprised of 14 exons and 13 introns. Both the NH2 and carboxyl termini are located intracellularly, and transport activity are regulated by many proteins, including protein kinase C, protein lipase C, and cAMP

(Ramamoorthy et al., 2011). Interestingly, unlike DAT, NET is inhibited by its own substrate, NE.

Cocaine has been shown to dose dependently increase extracellular levels of NE in regions such as the PFC, BNST, and hippocampus (Reith et al., 1997). Cocaine’s ability to increase NE is important because it is associated with stressful stimuli and periods of heightened arousal. Although NE is predominately cleared by NET, other

13 transporters such as DAT and organic cation transporters are capable of clearing NE as well (Moron et al., 2002). Interestingly, NET has a higher affinity for DA than for NE

(Horn et al., 1973). Inhibiting NET with NET inhibitors (i.e. nisoxetine) increases dopamine levels in the PFC of wild-type mice, but not in NET-KO mice. This is interesting because many antidepressants that are thought to be selective towards NET may be efficacious through DA signaling. Thus, even though many of these antidepressants are selective towards a particular transporter, their effects could be mediated by multiple transmitters. The promiscuity of the monoamine transporters complicates interpretations because the blockade of DAT could result in an increase in

NE (Carboni et al., 1990).

The NET KO mice were created by replacing exon 2 of NET with a neomyeson gene (Wang et al., 1999). NET mice have lower basal locomotor levels than WT mice, but are supersensitive to cocaine’s locomotor stimulating and rewarding effects (Xu et al.,

2000). This suggests that without NET, cocaine is capable of producing more locomotor activation and more reward. Thus, NET may play an inhibitor role in cocaine’s stimulating and rewarding effects. NET-KO mice do not respond to antidepressants that are predominantly NET inhibitors. In fact, the behaviors of NET-KO mice mirror the behaviors of WT animals pretreated with antidepressants as assessed with forced swim test (Xu et al., 2000). NET-KO mice also appear to have less taste aversions, suggesting that NET plays a role an important role in the aversive properties of cocaine that are associated with withdrawal (Jones et al., 2011).

Because the pharmacological and NET-KO experiments do not completely reinforce each other, it is important to consider what could be the many reasons for this discrepancy. Pharmacological studies could be misleading because ligands always have non-specific binding targets. For example, the NET-selective inhibitor, desipramine, also has high affinity for NE receptors, which is thought to be responsible confounding the interpretations of desipramine findings (Scriabine, 1969). Pharmacology studies, however, typically replicate their findings with multiple ligands to attempt to rule out non-specific targets. Studies utilizing transgenic mice could be difficult to interpret because ablating a gene from birth can have profound effects on animal as it develops thought out life without NET. In fact, NET-KO mice have many compensatory adaptations that could confound interpretations. For example, NET-KO mice have abnormally high levels of extracellular NE and low levels of DA. They also have abnormal body temperatures and are 20% the size of wild-type counterparts (Xu et al.,

2000).

To better understand the role of NET in cocaine addiction, we set out to develop an animal model with fewer compensatory adaptions. To do this, we first discovered several amino acids important for cocaine’s ability to inhibit NET but not essential for norepinephrine uptake (Wei et al., 2009). At first, we found 2 amino acid mutations

(F101C-A105G) on transmembrane 2 rendered the transporter 60 fold less sensitive to cocaine. But the NE uptake function was also severely affected as it was only 35% as functional as WT transporters. We were able to rescue the uptake function by mutating another residue (N153T) on transmembrane 3. These three mutations greatly affected

15 cocaine’s inhibitory effects on NET transport but did not greatly affect the ability of NET to uptake its substrates (i.e. NE and DA). In fact, the triple mutant (NETcgt) only reduces uptake function by 24% relative to WT mice when measured in HeLa cells cultures transfected with various NET cDNA constructs (Wei et al., 2009). Importantly, these 3 mutations did not appear to affect its affinity for NE (i.e. km was unaltered in vitro). In addition to being less sensitive to cocaine inhibition, NETcgt is also less sensitive to the selective NET inhibitors nisoxetine and desipramine but equally sensitive to other inhibitors, such as amphetamine and methylphenidate (Wei et al., 2009).

We created a knockin mouse line expressing cocaine-insensitive NET (NET-CI mice). In NET-CI mice, cocaine should interact with all other binding sites (e.g. DAT and

SERT) but not NET. Thus, cocaine should increase extracellular levels of DA and serotonin in NET-CI mice, but not increase NE. Importantly, because NET is functional in NET-CI mice (unlike in NET-KO mice), NET-CI mice should have fewer compensatory adaptations. Thus, any difference observed between WT and NET-CI mice can be directly attributed to NET inhibition. With fewer compensatory adaptations,

NET-CI mice should provide a useful tool for elucidating the role of NET in cocaine addiction.

Here, we use both DAT-CI mice and NET-CI mice to better understand how DAT and NET inhibition contribute to cocaine’s stimulating and rewarding effects. In chapter

2, cocaine insensitive dopamine transporter mice (DAT-CI mice) were used to study how

DAT inhibition is involved in cocaine’s ability to produce long lasting alterations in

16 neurons within a brain region critical for reward processing. In chapter 3, we use NET-

CI mice to test the impact of NET inhibition in cocaine’s reward and stimulating effects.

In chapter 4, we discuss how DAT-CI and NET-CI mice can be used in future studies to elucidate how DAT and NET inhibition contribute to numerous cocaine effects and to study the mechanisms of several antidepressants.

Figure 1. Illustration of cocaine’s three principle binding sites.

Cocaine binds similiarly to the dopamine transporter (DAT), the norepinephrine transporter (NET), and the serotonin transporter. This leads to an increase in the levels of neurotransmitters in the extracellular space.

Figure 2. Two dimensional serpentine schematic of the mNET transmembrane (TMD) 2 and 3.

The TMD segments are based on sequence alignment with the LeuTaa crystal structure and its alignment with the Na+/Cl- coupled transport proteins. The F101C-A105G-

N153T positions of the cocaine-insensitive mNET mutant are highlighted with a larger font and bold.

Figure 3. Drug inhibitions of mNETCGT and wild-type mNET.

HeLa cells were transiently transfected with the wild-type and mutant mNET cDNAs and incubated in a buffer containing 40 nM [3H]NE and each of 6 different drugs at concentrations indicated by the horizontal axis. The uptake activities are presented as fractional activities relative to those in the absence of drugs. Each data point is expressed as mean ± SEM (n=3-6). The experimental data were fitted using non-linear regression analysis. The 6 drugs tested are: A) Cocaine; B) Methylphenidate (Ritalin); C) AMPH;

D) Methamphetamine; E) Nisoxetine; and F) Desiprimine.

Figure 3.

Chapter 2: Dopamine Transporter Inhibition is Necessary for Cocaine-Induced Increases

in Dendritic Spine Density in the Nucleus Accumbens

2.1 Background and Introduction

Individuals addicted to cocaine have difficulties quitting because they often suffer from intense cravings that can last for years. The enduring nature of these cravings is thought to be a consequence of the many long-lasting adaptations in the nervous system that are produced by cocaine (Nestler, 2001). One of the most long-lasting neural adaptations produced by cocaine is the modification of synaptic connectivity (Nestler,

2001). For example, animal models of drug abuse show that cocaine can influence synaptic connectivity by increasing the density of spines (i.e. connections) on the dendrites of neurons within many brain regions, including the nucleus accumbens (NAC)

(Robinson and Kolb, 1999).

The nucleus accumbens (NAC) plays a central role in drug addiction (Koob,

1998). The NAC is commonly subdivided into two functionally and anatomically distinct areas, the shell (AcbS) and the core (AcbC,(Di Chiara et al., 2004). These two brain areas of the NAC have been shown to play dissociable roles in many behaviors related to drug abuse, such as cocaine-induced locomotor sensitization (Di Chiara, 2002).

Cocaine-induced locomotor sensitization describes the phenomenon that a dose of cocaine produces a greater increase in locomotor activity in drug-exposed animals than in drug-naïve animals (Robinson and Berridge, 1993). Since locomotor sensitization can 22 still be detected after months of withdrawal, it has been used to study the long-lasting effects of cocaine (Markou et al., 1993; Robinson and Berridge, 2008). The sensitizing effects of cocaine are thought to be mediated by changes in dendritic spine density in the

NAC. This suggests that dendritic spine density changes in the NAC are important in long-lasting effects of cocaine abuse (Nestler, 2001, Li et al., 2004, Lee et al., 2006, Ren et al., 2010).

How cocaine exposure increases dendritic spine density in the NAC is difficult to discern because cocaine binds to and inhibits the functions of multiple targets. Cocaine binds with similar high affinities to transporters that reuptake dopamine, norepinephrine, and serotonin (Ritz et al., 1987, Amara and Kuhar, 1993; Han and Gu, 2006), which leads to an increase in extracellular levels of dopamine, norepinephrine, and serotonin (Reith et al., 1997).

Dopamine plays anl established role in cocaine-induced changes in dendritic spine density. For example, dopamine specific lesions created by 6-hydroxydopamine alter dendritic spine density in the NAC (Meredith et al., 1995). Also, cocaine does not increase dendritic spine density in the AcbS of mice lacking the dopamine D1 receptor or in mice pretreated with dopamine D1 receptor selective antagonists (Ren et al., 2010).

Furthermore, cocaine-induced dendritic spine density changes in the NAC are found on neurons that express dopamine D1 or D2 receptors (Lee et al., 2006) .

However, the findings that dopamine (DA) is involved in cocaine-induced increases in dendritic spine changes in the NAC do not necessarily implicate the 23 dopamine transporter (DAT). Studies have shown that the norepinephrine transporter can reuptake dopamine as effectively as norepinephrine in certain regions of the brain (Moron et al., 2002). In addition, in mice with DAT completely removed, cocaine still retains the ability to increase extracellular dopamine in the NAC and produce reward (Gainetdinov et al., 1998; Hall et al., 2002). In light of these findings, it is important to directly test the role of DAT in cocaine-induced increases in dendritic spine density in the NAC.

Our lab has previously made genetically modified mice that express a mutated

DAT that can reuptake dopamine in the presence of concentrations of cocaine (cocaine- insensitive (Chen et al., 2006a). These mice that express cocaine-insensitive DAT (DAT-

CI mice) have a functioning DAT, and therefore, should have fewer compensatory changes than DAT-knockout (DAT-KO) mice which have DAT completely removed

(Gainetdinov et al., 1998; Hall et al., 2002). Thus, the DAT-CI mouse line has been a useful tool for testing the consequences of cocaine inhibiting the reuptake function of

DAT (Chen et al., 2006a, Tilley et al., 2007; Tilley et al., 2009; Thomsen et al., 2009).

The purpose of this study was to investigate the contributions of DAT inhibition in the increase in dendritic spine density in the NAC induced by repeated exposure to cocaine. To test this, we measured the dendritic spine density within the NAC (AcbC and

AcbS) of DAT-CI mice repeatedly injected with cocaine. In addition, to examine how dendritic spine density relates to locomotor activation, we assessed locomotor activity before and after repeated drug exposures.

2.2 Materials and Methods

Animals. DAT-CI mice were generated as previously described (Chen et al.,

2006a) using embryonic stem cells derived from SV129J mice. These have been backcrossed to C57BL/6J for 13 generations. All mice used in this study were male, 10-

15 weeks old, and were bred from heterozygous breeding pairs. Mice were weaned at

4 weeks of age, and subsequently housed 3-5 per cage, under standard conditions, with ad libitum access to food and water, and a 12 h light: dark cycle (lights on at 6:00 a.m.).

Mice were moved to the behavioral room at least one week prior to experiments. The genotype of each mouse was determined by polymerase chain reaction analysis of tail biopsy DNA taken at 10 days of age as previously described (Chen et al., 2006a). This study was approved by the Ohio State University Institutional Animal Care and Use

Committee.

Drug treatment paradigm. DAT-CI and wild-type mice received either cocaine

(15 mg/kg, intraperitoneal) or the vehicle (isotonic saline) on behavioral testing days

(Day 1 and Day 30). On Days 2 - 27, the mice received injections in their home cage of either cocaine (30 mg/kg) or saline (10 µL/ mg) on a schedule of five consecutive days of a once-daily injection, followed by two days without an injection, for a total of 20 injections of 30 mg/kg. This drug regimen was previously shown to increase dendritic spine density on neurons in the NAC and to induce locomotor sensitization in wild-type mice (Li et al., 2004). Saline groups remained drug naïve throughout the entire experiment. All injections and experiments were conducted between 10:00 am and 12 pm. Cocaine-HCL was kindly provided by the drug supply program at the National

Institute on Drug Abuse (National Institutes of Health, Bethesda, MD) and was prepared daily in 0.9% saline.

Locomotor sensitization. Locomotor activity experiments were performed in clear polyacrylic boxes (25 x 25 x 28 cm3). To habituate the animals to the testing boxes, animals were exposed to the boxes for 30 min each day for 2 days before each testing day. Locomotion was measured on the day of the first and the last injections (Days 1 and

30). On the test days, the animals were allowed to explore the boxes for 1 hour before being injected with either 15 mg/kg of cocaine (WT: n = 13, DAT-CI: n = 15) or the same volume of saline solution (WT: n = 11, DAT-CI: n = 10). A lower dose of cocaine was administered during testing days to avoid stereotypic behavior which would obscure locomotor activity interpretations. The locomotor activity was recorded for an hour before and an hour after the injection. The challenge injection was administered after 2 injection-free days (Day 30). Locomotor activity was recorded with a video camera, and the distance traveled was calculated using Limelight software (Whitehall, PA, USA).

Tissue collection and histology. Three days after the challenge injection, all mice were sacrificed by cervical dislocation. Tissue preparation and Golgi staining were performed according to the manufacturer’s instructions for the FD Rapid GolgiStain™ kit

(FD Neurotechnologies, Inc., Ellicott City, MD). In brief, brains were left in vials containing Golgi solution for 9 days, followed by sucrose solution for at least 2 days before being snap frozen in a mixture of dry-ice and isopentane. Brains were cut into 50

µm sections with a cryostat. After the sections dried, they were stained with Nissl and other Golgi solutions (solution D and E). Slides were left to dry for 4-6 months before

26 measuring dendritic spine density. NEUROLUCIDA® image analysis software (MBF

Bioscience, Williston, VT) was used to quantify spine density with a 100X oil immersion objective. Ten representative neurites were assessed for each animal (5 neurites for the

AcbC and 5 neurites for the AcbS). Spines were counted on dendritic segments that were distal (second order) from the cell soma and at least 40 µm in length. Spine density was defined as the number of spines per 10 µm of dendrite. Only neurons in the medial, rostral NAC (~1.34 mm anterior to bregma), AcbS or AcbC were selected (Franklin and

Paxinos, 2001). This anterior coordinate was based on a previous study that showed dendritic spine density changes in the NAC of mice (Lee et al., 2006). Also, infusing dopamine D1 receptor selective antagonists at this coordinate attenuates behaviors associated with cocaine (Ren et al., 2010). Nissl staining was performed in conjunction with Golgi staining to facilitate the identification of the AcbS and AcbC. All neurons analyzed were completely impregnated with stain and were not obscured by other neurons. All dendritic spine density data were manually counted by an investigator who was blind to the mouse's genotype and treatment.

Delta FosB immunohistochemistry was conducted after 2 drug-free days in animals pretreated with daily i.p. injections of saline or cocaine (30 mg/kg) for 2 weeks.

Delta FosB was labeled with a polyclonal rabbit anti-delta fosB primary antibody (1:200, sc 48, Santa Cruz, Biotechniology, Inc). Delta FosB was visualized with an ABC staining kit (Thermo Fisher Scientific, IL, USA).

Statistics. The average dendritic spine densities of the 5 neurites in each region of wild-type and DAT-CI mice treated with saline or cocaine were analyzed with two-way

(genotype x drug) ANOVA for each brain region. Significant main effects were further analyzed with one-way ANOVA (drug) and (genotype). Significance was defined as P <

0.05. All locomotor activity data were analyzed with two-way (time x group) repeated measures analysis of variance (RMANOVA, SPSS 17.0 Software, Chicago, IL).

Significant main effects were further analyzed with one-way ANOVA (group) or

RMANOVA (time).

2.3 Results

Locomotor activity is not altered by repeated cocaine injections in DAT-CI mice.

To determine whether repeated injections of cocaine alter locomotor activity in DAT-CI mice, we selected a cocaine treatment paradigm that has been reported to produce locomotor sensitization in wild type mice (Li et al., 2004; Lee et al., 2006). The dendritic spine density experiments and the locomotor tests were performed using the same group of mice. Wild type mice were treated with either cocaine or saline for 30 days as described in the Material and Methods section. In wild-type mice (as shown in Fig. 4A), the first injection (Day 1) of cocaine (15 mg/kg, i.p.) produced higher locomotor activity than the first injection (Day 1) of saline in wild-type mice (Day 1, F(1, 11) = 7.57, p =

<0.012). Furthermore, the challenge injection of cocaine (15 mg/kg) administered on Day

30 after 20 cocaine treatments (30 mg/kg) caused a greater increase in locomotor activation than the first injection of cocaine (F(1,11) = 41, p < 0.001). In contrast, DAT-CI mice (Figure 4B) did not show an increase in locomotor activity after the first (Day 1) or the last injection (Day 30) of cocaine as compared to the saline injection controls.

Instead, the first injection of cocaine seemed to produce a trend towards reducing

28 locomotor activity compared to the first injection of saline (F(1,10) = 2.578, p= 0.122). To present cocaine effects more clearly, Fig. 4C shows the locomotor activities after the cocaine injection (at 75 min) subtracted from the locomotor activity after the saline injection (at 75 min) for each genotype. In wild-type mice, cocaine-induced increases in locomotor activity after repeated injections (Day 30) were higher than that after a single injection (Day 1) of cocaine (t-test, p < 0.0001). In contrast, in DAT-CI mice, cocaine did not increase locomotor activity on Day 1 or Day 30 (t-test, p =0.89). Interestingly, the locomotor activity observed after the last (Day 30) injection of saline was greater than that after the first (Day 1) injection of saline in DAT-CI mice (p < 0.05). As previously reported (Chen et al., 2006a), DAT-CI mice had significantly higher basal locomotor activity than wild-type mice, which has been attributed to higher levels of extracellular dopamine.

Cocaine does not increase dendritic spine density in DAT-CI mice. To determine how DAT inhibition contributes to the more long lasting changes in the brain, we measured dendritic spine density in the NAC of the animals used in the above locomotor sensitization experiments. Fig. 5A is a schema of brain areas of the NAC where neurons were sampled. Fig. 5B shows a representative neuron (at 40X) in the AcbS of wild-type mice stained with Golgi and Nissl staining procedures. Fig. 5C and 5D shows representative photomicrographs (100X) from the AcbS (Fig. 5C) and AcbC (Fig. 5D) of wild type and DAT-CI mice injected with either cocaine or saline. Two way ANOVA revealed an interaction between genotype and drug (F(1, 80), p = 0.018) in the AcbS.

Following this, one way ANOVA found that repeated injections of cocaine increased

29 dendritic spine density in the AcbS of wild-type mice as compared to repeated injections of saline (Fig. 2E, F(1, 25) =14.6, p < 0.001). The spine density in the AcbS of cocaine- treated wild-type mice was higher than the spine density in the AcbS of saline-treated treated DAT-CI mice (p < 0.05). There was no significant difference between saline- treated wild-type mice and saline treated DAT-CI in dendritic spine density in the AcbS.

In contrast, cocaine did not alter dendritic spine density in the AcbS of DAT-CI mice

(Fig. 2E, F(1,30) = 1.785, p = 0.185). In the AcbC, two-way ANOVA found no differences in dendritic spine density as a result of drug treatments (Fig 2F, F(1, 65), 0.688, p = 0.408) or genotype (F(1,80)= 0.453, p = 0.502).

Chronic Cocaine does not induce ΔFosB expression in the NAC of NET-CI mice.

To better understand how DAT inhibition contributes to the structural changes in the

NAC, we assessed ΔFosB activation because it is a critical transcription factor thought to be involved in mediating many of neural adaptations relevant to addiction (Nestler,

2001). In WT mice, ΔFosB expression was activated in the NAC of WT mice after repeated cocaine exposure (A) but not after saline (C). In NET-CI mice, ΔFosB

2.4 Discussion

We have used genetically modified knock-in mice that express cocaine insensitive

DAT to directly test the role of DAT inhibition in cocaine’s ability to increase the dendritic spine density of neurons within the NAC. We found that repeated exposure to cocaine failed to change dendritic spine density in the NAC of DAT-CI mice. These results suggest DAT inhibition is required for the increase in dendritic spine density in the NAC induced by cocaine. Because the norepinephrine transporter (NET) and the

30 serotonin transporter (SERT) are still, in theory, inhibited by cocaine in DAT-CI mice, these data also indicate that repeatedly inhibiting NET and SERT is insufficient to alter dendritic spine density in the NAC or change locomotor activity. These findings support the hypothesis that DAT inhibition is important in mediating the neuroadaptations underlying drug-seeking behaviors.

Our finding that locomotor sensitization was accompanied by an increase in dendritic spine density in the AcbS (but not the AcbC) of wild-type mice, suggests that the AcbS is important for cocaine-induced locomotor sensitization. There is evidence supporting a role for the AcbS in drug-induced locomotor sensitization. First, amphetamine infused into the AcbS (but not AcbC) induced robust locomotor sensitization, which was blocked by a D1 receptor antagonist pretreatment (Pierce and

Kalivas, 1995). Second, extracellular levels of dopamine increased more in the AcbS than in the AcbC of drug-sensitized animals after a challenge injection (Pontieri et al., 1995).

Third, electrolytic lesions to the AcbS attenuate cocaine-induced locomotor sensitization

(Todtenkopf et al., 2002, Brenhouse et al., 2006). However, there are many studies that suggest a role for the AcbC in cocaine-induced locomotor sensitization (Li et al., 2004).

We also found that chronic cocaine exposure does not activate ΔFosB expression in the nucleus accumbens of DAT-CI mice (Figure 6). Delta FosB is a member of the Fos family of transcription factors. Repeated exposure to cocaine increases the level of

ΔFosB expression. This increase in ΔFosB expression in NAC lasts for months after discontinuation of drug exposure and has been suggested to be involved in long-lasting regulation of gene expression that leads to density changes in the NAC (Nestler, 2001).

Thus, our data suggests that DAT inhibition is necessary for cocaine’s ability to activate delta FosB in the nucleus accumbens. Because delta FosB is hypothesized to be involved in cocaine’s ability to increase dendritic spine density (Nestler, 2001), this finding also supports our conclusion that DAT inhibition is necessary for cocaine induced spine density findings.

We were not able to detect cocaine-induced increases in dendritic spine density in the AcbC of wild-type mice, however, which is inconsistent with a previous study that showed increases in both the AcbS and the AcbC (Li et al., 2004). This discrepancy could be explained by several differences between the two studies. First, the animals are different; while the study by Li (2004) used rats, our study used mice. Although studies from mice and rats typically support each other, there are cases in which cocaine affects the NAC of mice and rats differently. For example, it has been reported that cocaine increases glucose utilization in the NAC of rats but decreases glucose utilization in the

NAC of mice (Zocchi et al., 2001). Second, the cocaine treatments are different between the two studies; in the study by Li (2004), the animals received fewer total injections (8 injections vs. 20 injections) of cocaine and had a longer drug-free period (2 weeks vs. 3 days) before tissue collection. Our data suggest that in mice the AcbS plays an important role in cocaine-induced locomotor sensitization. It is possible that the cocaine induced changes in the AcbS are more marked or easier to detect than that in the AcbC in mice.

Although there are baseline differences in locomotor activity between DAT-CI and wild-type mice, we do not believe these differences explain the observation that repeated exposure to cocaine did not increase locomotor activity in DAT-CI mice. The

32 lack of cocaine-induced locomotor stimulation is unlikely explained by a ceiling effect because DAT-CI mice show a robust increase in locomotor activity in response to drugs other than cocaine, including amphetamine and morphine (Chen et al., 2006a).

Interestingly, even though DAT-CI mice have higher basal levels of locomotor activity, their dendritic spine density in the NAC was similar to wild-type mice treated with saline

(Fig. 5d, 5e). This indicates that levels of basal locomotor activity are not necessarily tightly related to the density of dendritic spines in the NAC; at least it may not be observable with the test paradigm we used.

Spines on the dendrites of medium spiny neurons in the NAC are important for synaptic transmission. These spines serve as convergent centers for glutamatergic and dopaminergic neurons in the NAC (Sesack et al., 2003). While the heads of spines in the

NAC primarily form synapses with glutamatergic neurons (Hering and Sheng, 2001), the shafts of spines form synapses with dopaminergic neurons (Yao et al., 2008).

Furthermore, an increase in dendritic spine density is associated with long-term potentiation (Sarti et al., 2007) and a reduction in dendritic spine density (or spine shrinkage) is associated with long-term depression (Zhou et al., 2004). Thus, our data could indicate that DAT inhibition is involved in cocaine’s ability to modify synaptic strength in the NAC.

In summary, we have used genetically modified knock-in mice to directly test the role of DAT inhibition in cocaine’s ability to increase the dendritic spine density of neurons within the NAC. We have found that without DAT inhibition, cocaine exposure does not increase dendritic spine density in NAC. These data support the notion that DAT

33 inhibition is required for cocaine-induced increases in dendritic spine density in the NAC.

This may also suggest that DAT inhibition is involved in the long-lasting changes in the brain produced by cocaine.

Figure 4. Effects of cocaine on locomotor activity in wild type and DAT-CI mice.

Locomotor activity was measured after the first (Day 1) and last (Day 30) injection of cocaine (15 mg/kg) or saline (n = 12-16/group). Between the test days (days 2-27), animals received one injection per day (5 days on, 2 days off) for a total of 20 injections of cocaine (30 mg/kg). (A) In wild type mice, cocaine-induced locomotor activity was higher on Day 30 than on Day 1. (*) signifies statistically different from saline and (#) signifies statistically different from Day 1. (B) In DAT-CI mice, locomotor activity did not increase after the first (Day 1) or last (Day 30) injection of cocaine. (C) There is a significant increase in locomotor activity after cocaine injection compared to that after saline injection in wild-type mice but not in DAT-CI mice. Data are expressed as mean distance (m) traveled (± SEM) in 15 min intervals. The arrow indicates when the injection was administered. *P<0.05.

Figure 4. 36

Figure 5. Effects of cocaine on dendritic spine density in the NAC of wild-type and DAT-

CI mice.

Three days after the challenge injection of cocaine or saline, brains were processed with

Golgi staining procedures. (A) Schema of a coronal section of the NAC (1.34 mm AP from bregma) showing the sampling areas (shaded areas, figure adapted from the Paxinos and Watson, 1997 atlas). (B) Photo micrograph (X100) of neurites within wild-type

AcbS. The boxed area shows a region of a neurite in focus with spines that are suitable for scoring. Representative photomicrographs of neurites from WT and DAT-CI mice chronically injected with saline “Sal” or cocaine “Coc” in the AcbS (C) and AcbC (D).

The spines are manually counted by a person with no knowledge of the genetic and treatment groups. The mean number of dendritic spines per 10 µm (± SEM) on medium spiny neurons of WT and DAT-CI mice in the AcbS (E) and core (F). (n= 8-11/genotype)

* P<0.05. Delta FosB was labeled in the NAC of WT mice pretreated with cocaine but not in NET-CI mice pretreated with cocaine or mice pretreated with saline controls.

Figure 5.

Figure 6. Effects of cocaine on ΔFosB expression in NAC of wild-type and DAT-CI mice.

Representative photomicrograph (10× magnification) of ΔFosB immunoreactivity in the nucleus accumbens in both wild-type mice treated with cocaine (A) or saline (C) and

DAT-CI mice treated with cocaine (B) and saline (D, n = 4/group).

Chapter 3: Characterizing cocaine reward and stimulation in mice expressing cocaine-

insensitive norepinephrine transporter.

3.1 Background and Introduction

Cocaine is a psychostimulant that is currently estimated to be used by 1.6 million

Americans (NHDUH, 2010). There is no effective pharmacological treatment for cocaine addiction because the binding sites responsible for cocaine’s effects are unclear.

Although cocaine interacts with many binding targets, its three principle targets are the plasma membrane reuptake transporters for dopamine (DAT), serotonin (SERT), and norepinephrine (NET; Ritz et al., 1987; 1990; Giros et al., 1996). These transporters are located on the plasma membrane of the presynaptic terminal and remove neurotransmitters from the extracellular space (Amara and Kuhar, 1993). Determining how these transporters contribute to cocaine’s broad profile could spur novel treatments.

Genetically modified mice have been useful tools for studying cocaine’s actions.

Transgenic knockout (KO) mice were generated to study the individual and combined contributions of DAT, NET, and SERT (for review see Rocha, 2003). Contrary to expectations based on pharmacological studies, which suggest a critical role for DAT

Amara and Kuhar, 1993), knockout mice studies found that no single transporter is necessary for cocaine reward (Sora et al., 1998, Hall et al., 2004; Medvedev et al., 2005).

These findings led to the hypothesis that transporters play redundant roles in cocaine

40 reward (Hall et al., 2004); however, it has become apparent that the severe compensatory adaptations observed in knockout mice constrain conclusions.

To avoid compensatory adaptations, we made knockin mice that express a mutated, yet functional, transporter that is less sensitive to cocaine inhibition. We first developed cocaine-insensitive dopamine transporter (DAT-CI) mice. Contrary to studies using mice lacking DAT (DAT-KO mice), the DAT-CI mouse studies demonstrate that

DAT inhibition is required for many of cocaine’s behavioral, pharmacological, and molecular effects (Chen et al., 2006; Tilley and Gu, 2008; Tilley et al., 2009; Thomsen et al., 2009; Napolitano et al., 2010; Martin et al., 2011). The findings generated with DAT-

CI mice align with pharmacological data, which demonstrate that the knockin approach serves as an effective tool for studying the roles of monoamine transporters in cocaine’s effects (Chen et al., 2006a).

After successfully characterizing DAT-CI mice, we sought out to develop another knock-in mouse line capable of testing the role of NET in cocaine’s effects. NET has been proposed to play an inhibitory role in cocaine’s stimulating and rewarding effects based on findings that NET-KO mice are supersensitive to cocaine’s stimulating and rewarding effects (Xu et al., 2000; Mead et al., 2002). This putative role of NET in cocaine’s reward properties contradicts pharmacological studies which show that NET- inhibitors fail to produce reward or alter the cocaine reward (Mead et al., 2002;

Tzschentke et al., 2006). This discrepancy could be explained by the compensatory adaptions of NET-KO mice. For example, NET-KO mice have behavioral indices similar to animals chronically treated with antidepressants, have reduced weight, show

41 upregulation of SERT and DAT, and are more susceptible to seizures (Xu et al., 2000,

Mead et al., 2002; Kaminski et al., 2005; Solich et al., 2011).

To further elucidate the role of NET inhibition in cocaine's effects, we developed knockin mice that express a functional norepinephrine transporter rendered cocaine- insensitive (NET-CI mice). To do this, we first discovered several amino acids important for cocaine’s ability to inhibit NET but not critical for norepinephrine uptake (Wei et al.,

2009). We then created a triple mutant transporter and showed, in vitro, that these mutations render the NET transporter 37 fold less sensitive (shift in IC50) to cocaine inhibition with a maximum velocity for norepinephrine uptake at 76% of the wild-type value (Wei et al., 2009).

In this study, we authenticated NET-CI mice and then used them to study the role of NET inhibition in cocaine’s rewarding and stimulating effects. We found that like

NET-KO mice, NET-CI mice show a reduction in general locomotor activity and are hypersensitive to cocaine’s stimulating effects. But unlike NET-KO mice, NET-CI mice find cocaine as rewarding as wild-type mice.

3.2 Materials and Methods

Generation of NET-CI mice. NET-CI mice were generated with a targeting vector that contained three mutations as shown in Figure 5. Two mutations were in transmembrane domain (TMD) 2 and 1 mutation was made in TMD 3. In TMD 2, phenylalanine was mutated to cysteine at position 101, and alanine was mutated to glycine at position 105. In TMD 3, arginine was mutated to a threonine at position 153.

Two commercial backbone vectors, pMC1-TK containing a HSV-TK expression cassette and pNeo-loxP containing a Neo expression cassette, were used to generate the final targeting vector. The neomycin resistance gene was placed between TMD2 and TMD3 to select for clones containing mutations in both TMDs. The targeting vector was electroporated into Feeder-independent embryonic stem cells (subclone E14Tg2A.4 derived from the 129/Ola strain of mice by Bay genomics, UC Davis) (Nichols, Evans et al. 1990). The neomycin gene was removed with Sox2 –cre mice (generous gift from Dr.

Gustavo). The NET-CI mice were than backcrossed with C57BL/6J for 2 generations.

Subjects. All mice used in this study were male, 2-4 months old, age-matched littermates, and were bred from heterozygous breeding pairs. Mice were weaned at

4 weeks of age and subsequently housed 2-5 per cage, under standard conditions, with ad libitum access to food and water, and a 12 h light: dark cycle (lights on at 6:00 a.m.).

Mice were moved to the behavioral room at least one week prior to experiments to allow them to acclimate. The genotype of each mouse was determined by polymerase chain reaction analysis of tail biopsy DNA taken at 10 days. This study was approved by the

Ohio State University Institutional Animal Care and Use Committee.

Quantitative real-time PCR (qPCR) of NET mRNA expression. Tissue was extracted from brainstem of wild type and NET-CI mice, and RNA isolated using an

RNAeasy lipid tissue mini kit (Qiagen). Total RNA was then reverse transcribed using cDNA synthesis kit (Biorad laboratories). cDNA amplification was performed using the following primers (forward) CACCTCCATTCTGTTTGCG and (reverse)

GCGGCTTGAAGTTGATGATGCTG with power SYBRgreen® master mix (Applied

Biosystem) and concentrations were measured using a nanodrop (Bioanalyzer, Agilent

Biotechnologies). The following thermocycle conditions were used for the PCR reaction:

95ºC for 6 min followed by 45 cycles of 95ºC for 15s, 55ºC for15s and 68ºC for 20s. A 4- point standard curve was performed for every assay. The relative mRNA expression

(normalized to reference gene actin) was calculated based on an efficiency corrected model. Efficiencies were calculated based on the formula E=10(-1/slope).

Western blot of NET protein expression. Protein samples were prepared from the

PFC of WT and NET-CI mice. 50 ug of total protein was separated on a 10% polyacrylamide gel. Protein was transferred to a PVDF membrane and blocked with 5% non-dairy milk for 30 min. The primary antibodies were mouse polyclonal raised against

NET (NET-05-2, 1:500, Mabtechnologies) and rabbit polyclonal raised against GAPDH

(FL-335, 1:500, sc-25778, Santa Cruz). The secondary antibodies were goat anti-mouse

IgG2b antibody conjugated with horseradish peroxidase (A6154, 1:500, Sigma) and anti - mouse (sc 2060, 1:500, Santa Cruz).

Synaptosomal uptake of norepinephrine. Synaptosomes were prepared as described previously (Moron et al., 2002). For cocaine inhibition studies, the frontal cortex was homogenized with 10 strokes of a polytron in a solution containing 0.32 M sucrose, 1mM EDTA, and 10 mM Tris, pH 7.2. After tissue homogenates were centrifuged at 1,000 x g for 10 min, the supernatants were centrifuged at 16,000 x g for

20 min. Pellets were re-suspended (400 mL/cortex) in 0.32 M sucrose. NE transport was assessed in Ringers solution (125 mM NaCl, 1.2 mM KCl, 1.2 mM mgSO4, 1.2 mM

CaCl2, 22 mM NaHCO3, 1 mM NaH2P04, 10 mM glucose) supplemented with 100 µM ascorbic acid and 10 uM pargyline. Synaptosomes (200-300 ug/rxn) were pre-incubated in the presence of inhibitors (various concentrations of cocaine, 100 nM RTI 113, and

100 nM Sertraline) at 37ºC for 5 min, chilled at 0ºC for 5 min, and then mixed with (Cass et al.)(Cass et al.)(Cass et al.)(Cass et al.)[3H] NE (67 nM) at 37ºC for 5 min. Uptake was terminated by washing with cold Ringers solution and filtering onto GF/B filter paper using a Brandel M-48 harvester (Gaithersburg, MD 20877 USA). RTI 113 and sertraline were used to minimize NE uptake via DAT and SERT. IC50 values were determined by nonlinear regression using Prizm GraphPad software.

Neurotransmitter levels in tissue homogenates. The PFC, hippocampus, striatum, and hypothalamus were extracted and frozen on dry ice. Tissues were sonocated in a solution containing 0.1 M perchloric acid and 100 µM sodium bisulfite and centrifuged at

16 x 1000g for 10 min. Samples were stored at -80°C until analysis. Analysis was performed with high performance liquid chromatography using a microbore column (150 x 3.2 mm). The mobile phase (flow rate 0.6 mL/min) consisted of 75 mM sodium phosphate, 1.7 mM octanesulfonic acid sodium salt, 1 mM triethylamine, 25 µM EDTA, and 10% acetonitrile, pH 3.85.

Open field activity. Locomotor activity and sensitization was measured in chambers (40 x 40 x 40 cm) with video tracking software (ANY-Maze, Stoelting, Wood

Dale, IL). Mice were habituated to the chambers for 30 min for 2 consecutive days prior to experiment. On the test day, animals were placed in the chamber for 1 hr before being injected in the intraperitoneal cavity with either saline or various doses of cocaine. To 45 understand the role of NET in cocaine’s more chronic effects, we assessed cocaine- induced locomotor sensitization by repeating this experiment within the same animals every other day for 3 additional days (4 injections total). A challenge injection of the same dose of cocaine they were exposed to previously was administered seven days after the last injection.

Conditioned Place Preference (CPP). CPP was measured as described previously

(Chen et al 2006). The place conditioning chambers (42 x 12 x 20 cm) were custom made with 3 compartments. The time spent in each compartment and locomotor activity was recorded by video cameras synchronized to a software system (ANY-Maze, Stoelting,

Wood Dale, IL). Animals were habituated to the environment by exposing them to the apparatus (with the cues removed) for 30 min over two consecutive days. On day 3, animals were place in apparatus (with cues), and their baseline preferences for the cues

(grid vs. wavy) were assessed (pre-test phase). Animals that spent more than 70% of the time in one of the compartments during the pretest were excluded from the CPP study (n

= 0). During the conditioning stage, animals were injected with either cocaine or saline and confined to an individual compartment for 30 min. Treatments were administered over eight consecutive days, alternating drug sessions with vehicle sessions (4 pairings each). The cue paired with cocaine was assigned in such a way as to minimize both within group pre-test biases and false positives. The day after the last conditioning day

(post-test phase), animals were handled and placed in the CPP apparatus in a drug-free state and were allowed to explore for 30 min. The change in preference induced by drug

46 conditioning was estimated by subtracting the time spent in the drug-side during the pretest from the time spent in drug-side during the post-test (post-test – pretest).

Data analysis. Statistical analyses were performed using SPSS 18.0. Conditioned place preference data, total locomotor data and Q-PCR data were analyzed with Student’s t-test or ANOVAs using a Bonferroni–Dunn post hoc test. Behavioral data were analyzed by ANOVA using Prism software. Main effects and interaction effects in the ANOVA were analyzed by the Newman–Keuls procedure using the overall sampling error from the ANOVA as denominator. Statistical significance was set at α = 0.05 per experiment.

3.3 Results

NET-CI mice are viable and fertile. The body weight of NET-CI mice is similar to wild-type mice (WT: 28.0 g ± 0.79; NET-CI: 26.1g ±0.71, p = 0.11, n = 9, n = 9) and are physically indistinguishable from wild-type mice.

Molecular authentication

The insertion of vector DNA to the targeted region was confirmed by PCR and sequencing. Sequencing the mRNA of NET-CI mice confirmed that the primary sequence was correct and contained all three mutations (Figure 8). Quantitative real-time

PCR of cDNA did not reveal a difference in NET expression (p = 0.96). Western blots of

PFC synaptosomal protein did not show differences in naïve or glycosylated NET (WT:

67.32±15.74; NET-CI: 52.62±14.58, p = 0.518) between NET-CI and WT (Figure 9).

Synaptosomal NE uptake. To assess how insensitive to cocaine the NETcgt mutant is in vivo, we measured NE uptake in the presence and absence of cocaine in frontal cortex synaptosomes of NET-CI and WT mice (Figure 10a). In the presence of 47

DAT and SERT inhibitors, the IC50 of cocaine for NE upake was slightly higher (3.15 fold) in NET-CI than in WT mice; however, this increase was not significant (p = 0.16).

The maximum uptake of [3H] NE is reduced by 44% in NET-CI mice relative to wild- type (p < 0.05) in the presence of 100 µM RTI-113 and 100 µM Sertraline (selective

DAT and NET inhibitors, respectively, Figure 10B).

HPLC. To characterize neurotransmitter levels in NET-CI mice, we assessed the levels of NE and DA content in homogenates of various brain regions. NET-CI mice had lower levels of NE in the prefrontal cortex (p = 0.03), but not in the hippocampus (p =

0.529) or hypothalamus (Figure 11A). No differences were detected in the levels of DA in either the striatum (p = 0.7168) or the prefrontal cortex (p =0.979) between NET-CI and WT mice (Figure 11B). There was a trend toward a reduction in serotonin levels in the prefrontal cortex (p = 0.059) but not in the hypothalamus of NET-CI mice (p = 0.352

) relative to WT mice. No difference was observed in 3,4-dihydroxyphenylacetic acid

(DOPAC) in the striatum (40.88 ± 2.88 versus 41.70 ± 9.88, p = 0.93).

Locomotor Behavior. To determine the role of NET inhibition in cocaine’s stimulating effects, we assessed the locomotor activity of NET-CI and WT mice in response to various doses of cocaine in an open field chamber. The general locomotor activity of NET-CI mice (n = 23) was 40% less than WT (WT: 67.2 ± 3.29; NET-CI

41.0± 2.47; n > 23; ANOVA p<0.001, Figure 12a). In response to cocaine, NET-CI mice exhibit more of an increase in locomotor activity than wild-type mice to 10mg/kg

(p=0.007) and 20mg/kg (p = 0.0359), but not to 5 mg/kg cocaine (p= 0.31, Figure. 12B).

As a control, NET-CI mice and WT mice showed similar locomotor activity in response

48 to 5mg/kg amphetamine (p =0.62) and saline (p = 0.6) (Figure. 12D). To assess the role of NET inhibition in cocaine’s chronic effects, we assessed cocaine-induced locomotor sensitization (Figure 12C, 13). NET-CI mice and wild-type mice showed similar locomotor activity after a challenge injection of saline (p = 0.64). WT mice showed cocaine induced locomotor sensitization to 10 mg/kg (p = 0.026) and 20 mg/kg (p = 0.03) but not at 5 mg/kg (p = 0.3, Figure 12C, 13). NET-CI mice did not show locomotor sensitization to 5 mg/kg (p = 0.15), 10 mg/kg (p = 0.72) or 20 mg/kg (p = 0.64, Figure

12C, 13).

Conditioned place preference. To determine the role of NET inhibition in cocaine’s rewarding effects, we assessed conditioned place preference with various doses of cocaine in NET-CI and wild-type mice. Both NET-CI and WT showed a preference for the compartment paired with cocaine at 5, 10, 30, 40 mg/kg (Figure 14). Two-way

AVONA (genotype x cocaine dose) failed to show a difference in cocaine preference between NET-CI mice and wild-type mice (p =0.593). ANOVA showed no differences in saline conditioned place preference (WT= 4, NET-CI= 8, p = 0.68), 5 mg (WT = 9, NET-

CI 7, p = 0.76), 10 mg (WT = 8, NET-CI = 8, p = 0.5378), 30 mg (WT = 14, NET-CI 13, p = 0.18), and 40 mg cocaine (WT=4, NET-CI=4, p = 0.52).

3.4 Discussion

The present study investigated the contributions of NET inhibition in several of cocaine’s effects by using mice expressing cocaine-insensitive NET (NET-CI mice).

NET-CI mice are hypersensitive to cocaine’s stimulating effects but show similar responses to cocaine’s rewarding effects as compared to WT litter mates. These data

49 suggest that NET inhibition is involved in cocaine’s stimulating effects (Figure 12) but is not critical for its rewarding effects (Figure 14). NET-CI mice appear to be useful tools for elucidating the role of NET inhibition in cocaine’s action.

Our finding that NET-CI mice are hypersensitive to cocaine’s stimulating effects agrees with both NET-KO mice and pharmacological studies. Similar to NET-CI mice,

NET-KO mice are hyper-sensitive to cocaine's stimulating effects. Interestingly, while

NET-CI mice are hypersensitive to locomotor activating effects at higher doses (10 and

20 mg/kg) of cocaine, they are not at lower dose (5 mg/kg). This may indicate that NET inhibition is more involved in the effects produced by higher doses of cocaine. There are two alternative explanations that could explain this phenomenon. First, there is a possibility that higher doses of cocaine exceed the threshold of cocaine necessary to inhibit NET-CI uptake. Although this is possible, the number of NETs inhibited by cocaine should be fewer than WT mice. Second, it is also possible that the reduction in the capacity to take up NE found in NET-CI mice (figure 10B) may have caused compensatory adaptations that render the animal hypersensitive to the stimulating effects of cocaine. The possibility that compensatory adaptations are responsible for the locomotor effects seems unlikely because there was no difference in amphetamine- induced locomotor activation between WT and NET-CI mice (Figure 12d). Our conclusion that NET is involved in cocaine's stimulating effects is further supported by pharmacological studies. For example, selective NET inhibitors, such as desipramine and reboxetine, reduce general locomotor activity and prevent cocaine-induced stimulation

(Mitchell et al., 2006). Collectively, we believe our data provide confirmation that NET inhibition plays an inhibitory role in cocaine-induced locomotion.

The mechanism underlying the increase in cocaine-induced locomotion in NET-

CI mice is presumably due to differences in cocaine-induced increases in extracellular

NE between NET-CI mice and WT mice. Without NET inhibition, perhaps less NE accumulates in the extracellular environment, which leads to a disinhibited DA system that elicits a larger locomotor response. Microdialysis will be necessary to assess the neurochemical mechanisms of our findings.

Our finding that NET-CI mice and WT mice have similar preferences for cocaine’s rewarding effects is in agreement with the pharmacological literature, but contradicts NET-KO mice studies. Pharmacological studies report that NET-inhibitors do not produce rewarding effects in humans or in animal models (Ritz et al., 1987).

Furthermore, NET-inhibitors do not reliably modulate the rewarding effects of cocaine

(Sofuoglu and Sewell, 2009; Ritz et al., 1987). Our data, however, do not agree with findings that NET-KO mice exhibit more reward-related behaviors in response to cocaine than WT littermates (Xu et al., 2000; Hall et al., 2002). The hypersensitivity of

NET-KO mice to cocaine’s rewarding properties could be a consequence of compensatory adaptations due to lack of NET during development. Compensatory adaptations were capable of affecting the reward system of DAT-KO mice to such an extent that DAT-KO mice appeared to find SERT-inhibitors (i.e. Fluoxetine) rewarding, which is not observed in WT mice (Hall et al., 2002). Although we will need to further support our finding by determining how NET-CI mice find cocaine reinforcing in self-

51 administration studies, we believe our data confirm pharmacological studies and suggest

NET-inhibition is not a critical mediator of cocaine’s rewarding effects.

We found that the concentration of cocaine required to inhibit NE uptake was different between our in vitro and in vivo uptake assays. Uptake assays using HeLa cells transiently expressing either NETcgt or WT-NET showed a 37-fold lower cocaine sensitivity; however, synaptosomes uptake assays show that three times as much cocaine is required to inhibit NE uptake in NET-CI mice (~3 fold shift to the right). There could be several reasons for this discrepancy. In comparison to cells transfected with only NET, synaptosomal preparations contain several proteins other than NET that have the capacity to uptake NE. For example, DAT and organic cation transporter 3 are both capable of transporting NE. Because these NET-independent mechanisms could confound our understanding of NET-CI, we attempted to minimize these non-specific uptake mechanisms by performing our assays using the frontal cortex, wherein NET is believed to be predominantly responsible for NE uptake (Moron et al., 2002). In our hands, however, we observed that a large portion of our NE uptake was sensitive to DAT inhibition. To further minimize NET-independent mechanisms, we pre-incubated the synaptosomes with selective DAT and SERT inhibitors. These attempts may not have been sufficient to detect in vivo the robust differences that were observed in vitro.

However, this approach may not have been effective because these inhibitors could have blocked NET nonspecifically, which would exacerbate the reduction in total uptake of

NE uptake in NET-CI mice to such a degree that it could have made the IC50 values

52 inaccurate. Another explanation for differences between in-vitro and in vivo IC50 values could be that in in vivo preparations there could exist an accessory protein that is absent in HeLa cells. While we believe our data suggest NET-CI have functional differences in cocaine inhibition compared to WT, we will confirm this by performing microdiaysis to determine how cocaine-induced changes in NE differ between NET-CI and WT mice.

We hypothesize that NET-CI mice will require higher concentrations of cocaine in order to see increases in NE concentrations.

While NET-CI mice appear to be a valid model, we did detect several changes relative to wild-type mice. NET-CI mice have lower basal levels of locomotor activity

(Figure 12A), which is similar in the NET-KO mice. We also observed that NE levels were reduced in the PFC and hypothalamus of NET-CI mice. The reduction in general locomotor activity and in NE levels could be a consequence of reduced NE uptake capacity of NET in NET-CI (Figure 10B). Although NET-CI mice have compensatory adaptations, they appear to be fewer and less severe than those observed in NET-KO mice. For example, NET-CI mice appear to have similar striatal dopamine levels to those of WT mice (Figure 11B), which is contrary to NET-KO mice which have higher DA levels (Xu et al., 2000). In addition, NET-CI mice show similar locomotor activation in response to amphetamine as compared to WT litter-mates (Figure 12D), which could suggest that NET-CI mice have a minimally altered dopaminergic system. This could offer a distinct advantage over NET-KO mice, which have upregulated D2/D3 receptors and an increase in tissues levels of dopamine (Xu et al., 2000). NET-CI mice also did not appear to have the reduction in body weight that is observed in NET-KO mice, and are

53 indistinguishable by general observation from WT mice littermates. Thus, NET-CI mice may prove a useful animal model for identifying the role of NET inhibition in cocaine’s effects.

In conclusion, we have developed a new mouse line to study the role of NET inhibition in cocaine’s effect. NET-CI mice suggest that NET-inhibition is important for cocaine’s stimulating effects but not in its rewarding effects. These NET-CI mice appear to be valid animal model for testing the role of NET in cocaine’s effects.

Figure 7. Targeting strategy for generating NET-CI mice construct.

Thin lines, mouse genomic DNA; thick lines, sequences included in the targeting construct; K, KpnI sites; open box, mNET exon 3; open box with a line, exon 3 with the triple mutation and a KpnI site; open arrow, Neo cassette; triangles, LoxP sites; shaded arrow, thymidine kinase gene; shaded box,; arrows, PCR primers. (B) PCR using primer f1 external of the short arm and mutant-specific primer r1. (C) PCR using specific primer f2 and primer r2 external of the long arm. (D) PCR using primers f3 and r3, which amplify a 564-bp fragment from the WT allele and a 667-bp fragment from the mutant allele.

1.0

0.8

0.6

0.4

0.2

Relative mRNA Expression mRNA Relative 0.0 WT NET CI

Figure 8. Relative mRNA expression of NET in WT and NET-CI mice.

RNA was extracted from brainstem tissue, reverse transcribed, and quantified with real time PCR using SYBRgreen®. No differences in expression levels of NET were detected between the two genotypes relative to actin.

Figure 9. Western blots of of NET protein from the prefrontal cortex synaptosomes of

WT and NET-CI mice.

(A) Shows an 80 kD band representing the glycosylated NET (NET(gylco) and a 60

KD band representing the naïve NET (NET). GAPDH was used as a control for loading errors. The primary antibody was NET-05. (B) Quantification of NET protein

(n = 4/group).

Figure 10. Characterization of the function of NETcgt in mouse cortical synaptosomes.

(a) [3H] NE uptake in the presence of various concentrations of cocaine in WT (n =3) and

NET-CI (n =3). (b) [3H] NE uptake capacity was assessed in WT and NET-CI mice with

67 nM [3H] NE. Synaptosomes were pre-incubated with DAT- and SERT-selective inhibitors (100 nM RTI-113 and Sertraline) to minimize non-specific uptake of [3H] NE * p < 0.05).

Figure 11. Neurochemical changes in NE and DA homeostasis in NET-CI mice.

(a) NE levels contents in prefrontal cortex, hippocampus, and hypothalamus homogenates of WT (n =4-6) mice and mutant (n =4-6) mice. (b) DA tissue content of WT (n = 6) and

NET-CI (n = 4) mice in the striatum * p < 0.05).

Figure 12. Locomotor effects of cocaine in WT and NET-CI mice.

(A) Basal locomotor activity in an open field of wild-type mice (n = 25) and NET-CI mice (n=23). (B) Dose-dependent changes in locomotor activity following treatment with different concentrations of cocaine in wild-type and NET-CI mice (n = 8 -12). (C)

Cocaine-induced locomotor sensitization in WT and NET-CI mice. The locomotor activities are presented as horizontal distances traveled (mean ± SEM in meters) in 60 min after drug injection in mice (n = 6–12). (D) AMPH-induced locomotor activity (15 min) in both WT and NET-CI mice. Arrow signifies the time of injection. 60

Figure 13. Locomotor sensitization to various doses of cocaine in WT and NET-CI mice.

Locomotor sensitization in WT mice (A) and NET-CI mice (B). Locomotor activity was assessed after the first injection (Day 1) and two weeks later after the animal was given a challenge injection (challenge). * p < 0.05.

Figure 14. Cocaine conditioned place preference in wild-type and NET-CI mice.

Time difference (in seconds) between pre- and post- conditioning tests (mean ±SEM) that mice spend in the drug-paired chamber (n = 8–15). Four pairings of either 5, 10, 30, and

40 mg/kg cocaine produced significant CPP in both WT mice and NET-CI mice compared with saline mice (for genotype difference).

Chapter 4: General discussion and future direction

In this dissertation, we show that mice expressing cocaine-insensitive dopamine transporters (DAT-CI) do not show an increase in the number of spines on the dendrites of neurons in the nucleus accumbens (NAC) and do not have an alteration in locomotor activity in response to a chronic cocaine paradigm (Martin et al., 2011). We have also characterized mice expressing a cocaine-insensitive norepinephrine transporter (NET-CI mice) and showed it was a valid model for studying the molecular mechanisms of action of cocaine’s effects. NET-CI mice are hyper-responsive to cocaine’s stimulating effects but show similar preferences for cocaine’s rewarding effects.

These findings are significant because they provide a better understanding of the mechanisms responsible for cocaine’s many effects. Knowing that DAT is necessary for cocaine’s ability to cause long-lasting increases in dendritic spine density in the NAC suggests that DAT is important in cocaine’s ability to produce the neuronal changes underlying addiction. Although, many have asserted that the dopamine system is involved in cocaine’s ability to produce neuronal changes (Nestler, 2001), our experiment using DAT-CI mice provides the strongest support for this hypothesis. Because these long-lasting neuronal changes are thought to underlie cocaine addiction, these data support the idea that normalizing the dopamine system is important for treating addiction.

The finding that inhibiting DAT can initiate neuronal changes is also relevant to

Parkinson’s disease (PD). PD is commonly treated with drugs such as levodopa that modulate the dopamine system (Villa et al., 2011). There is evidence suggesting that an intact dopamine system is critical for the maintenance of dendritic spine density in the brain (Garcia et al., 2010; Soderstrom et al., 2010). Our data support the idea that PD treatments can affect dendritic spine density on neurons in the striatum.

In addition to further characterizing the DAT-CI mice to gain insights into how

DAT contributes to cocaine’s effects, we also characterized a novel NET-CI mouse line.

This mouse line adds a valuable model capable of identifying the role of NET in cocaine’s many effects. These mice will be made available to anyone wishing to use them, which will provide the field with another valuable tool for studying cocaine addiction.

The finding that NET-CI mice are hyper-responsive to cocaine-induced locomotor activity confirms the role of NET in cocaine’s stimulating effects. Since, in theory, cocaine does not inhibit NET in NET-CI mice as much as it does in WT mice (Wei et al.,

2009, Figure 10), extracellular levels of NE should be lower in NET-CI mice than in WT mice following cocaine exposure. Given that beta-adrenergic receptor antagonists potentiate cocaine’s effects on locomotor activity and increases extracellular dopamine

(Harris et al., 1996), perhaps the hyper-responsiveness to cocaine of NET-CI mice is a result of less stimulation on beta-adrenergic receptors in NET-CI mice. Our data may suggest that NE plays an inhibitory role in cocaine stimulation. Treatments capable of

64 modulating the NE system may provide a method for attenuating the stimulating effects of cocaine.

The finding that WT and NET-CI mice show no difference in cocaine conditioned place preference clarifies discrepancies within the literature. While pharmacological studies have repeatedly found that NET is not a major factor in cocaine’s rewarding properties, animals lacking NET find cocaine more rewarding than WT mice (Xu et al.,

2000). This has left the field uncertain of how NET contributes to cocaine’s rewarding effects. By finding that NET-CI mice have typical reward-like behaviors relative to WT mice, we have provided strong evidence in support of the pharmacological literature (Ritz et al., 1987, Kuhar et al., 1988, Ritz et al., 1988). In addition, because this finding differs between the NET-KO and NET-CI mice, we believe that these data show the importance of making animal models that have fewer compensatory adaptations.

There are limitations to this dissertation. For example, it is likely that some of our findings are the result of compensatory adaptations in response to altering the amino acid sequence of NET. After further investigations, we may discover more compensatory adaptations that could constrain our conclusions. Although this will always be a concern, we believe our efforts to minimize the functional impairment of NET reuptake capacity in NET-CI mice by only selecting amino acid mutations that are minimally involved in

NE transport make this scenario less likely. To test whether compensatory adaptations are responsible for behavioral differences observed in NET-CI mice, we could utilize NET-

KO mice as controls. By contrasting our NET-CI mice to NET-KO (-/-) and NET-KO

(+/-) mice, we can identify the behavioral effects due to NET-inhibition and those due to having fewer NET.

Another limitation of NET-CI mice is that there is less of an IC50 shift ex vivo

(i.e. synaptosomal uptake) relative to the IC50 found in vitro (i.e. cell culture). While we observed a 37 fold shift in the amount of cocaine necessary to inhibit NE upake in vitro, we only observed a 3 fold shift ex vivo. To make sure this phenomenon is not an artifact of the particular synaptosomes conditions, we used various brain regions and various concentrations of selective DAT and SERT inhibitors. By looking at various brain regions, we minimized the chances that cocaine mediated inhibition of NE uptake was different within brain regions with differing ratios of DAT and NET expression. We assayed cocaine inhibition on NET uptake from synaptosomes extracted from the hypothalamus, prefrontal cortex, hippocampus, and locus coeruleus (because of low N values and a lack of difference between cortex values, data was not shown). For the synaptosomes data shown here (Figure 10), experiments were performed in the cortex because it has relatively high levels of NET and low levels of DAT (Moll et al., 2000).

Second, we minimized non–specific uptake with various uptake inhibitors. In particular, because DAT can uptake NE (Moron et al., 2002) (Wu and Gu, 1999), our efforts to assess how NET takes up NE could be confounded by high levels of DAT within the synaptic preparations. Synaptosomes are derived from a homogenate of a rather large section of tissue. Therefore, synaptosomal preparations may not be sensitive enough to reveal how NET functions in discrete brains that are enriched with NE. We have ongoing experiments attempting to assess, indirectly, NET inhibition and NET function with

66 microdialysis and high performance liquid chromotography to provide a more informative characterization of the NET-CI in vivo. Given that we attempted multiple brain regions and excluded a high percentage of non-specific NE uptake with selective

DAT and SERT inhibitors, it is likely that there are differences in cocaine inhibition difference between in vitro and ex vivo preparations. Proteomic experiments may discover pairing proteins within ex vivo preparations that are absent in in vitro preparations.

Another possible concern is our selection of NET mutant. There is possibility that another NET mutation that is more insensitive to cocaine inhibition could yield more robust effects. In fact, while the mutant we selected for the NET-CI mice was 37 fold less sensitive to cocaine inhibition, the mutation we selected for the DAT-CI mice was 87 fold less sensitive. We decided to choose this particular NET-CI mutant because this it was more functional than other NET-CI mutants. We chose a NET-CI mutant with more uptake function because our primarily concern was to create an animal model with few compensatory adaptations. Thus, we decided against other NET mutants that were more insensitive to cocaine inhibition because they were also were less able to take up NE. By making an animal model with a highly functional NET, we believe we made a more valid animal model to study the role of NET in cocaine’s effects.

Future directions

Now that our lab has validated two animal models for studying mechanisms of cocaine’s effects, there are many possible future directions. We will begin by further characterizing our DAT-CI and NET-CI mouse lines. While we have focused

67 predominantly on how DAT and NET contribute to cocaine’s stimulatory and rewarding effects, we have not investigated into how these transporters relate to other cocaine effects, such as cocaine-induced cognitive deficits. Cocaine impairs working memory problems, judgment, impulsivity control, and attentional problems in humans and animal models (Stalnaker et al., 2009). Although cognitive impairments may seem secondary to cocaine’s rewarding properties in regard to addiction, cocaine’s ability to alter an individual’s ability to make healthy decisions may directly contribute to relapse (Garavan and Hester, 2007, Hester et al., 2010). Because both DAT and NET have been implicated in cognition, using our mice to test how DAT and NET contribute to cocaine’s cognitive effects may provide clarity to a critical question that has been difficult to study with current methods.

Another future direction of our lab will be to crossbreed NET-CI and DAT-CI mice. This will allow us to identify which cocaine effects are present in the absence of

NET and DAT inhibition. This may allow us indirectly study how the serotonin transporter (SERT) contributes to cocaine’s effects. In the same vein, our collaborator,

Dr. Randy Blakely, has recently created a cocaine insensitive SERT mouse line

(Thompson et al., 2011). By crossbreeding cocaine insensitive NET, DAT, and SERT mice, we may be able to identify cocaine effects that are independent of the monoamine system.

Our knockin animals could also be used to study how neurotransmitter systems compensate for each other. Interestingly, serotonergic neurons within DAT-KO mice appear to uptake and release dopamine (Larsen et al., 2011). Moreover, DAT-KO mice

68 appear to find SERT inhibitors rewarding, which is not observed in WT mice (Hall et al.,

2002). Thus, the DAT-KO mice and NET-KO mice provide situations in which one neurotransmitter systems compensates for deficits in another neurotransmitter system. By understanding more about this phenomenon, we may be able to better understand neurological disorders associated with deficient neurotransmitter systems, such as

Parkinson’s disease, depression and Alzheimer’s disease. Because our DAT-CI and NET-

CI mice have fewer compensatory adaptions than DAT-KO and NET-KO mice, contrasting these lines could improve our understanding of plasticity our neurotransmitter systems.

Another fruitful direction may be to identify the role of NET and DAT in the mechanisms of antidepressants. Although our goal was to select mutant transporters that are cocaine insensitive, these transporter are also insensitive to anti-depressants as well.

For example, in vitro studies show the NET-CI is 24 fold less insensitive to desipramine and 8 fold less sensitive to nisoxetine (Wei et al., 2009). Therefore, in addition to our animal models being suitable for studying cocaine’s effects, they will also serve as valid animal models for understanding how antidepressants produce their effects.

The last avenue of study will be to elucidate the toxicological effects of cocaine.

If an individual consumes a large quantity of cocaine, they may die from heart failure

(Kloner et al., 1992). By utilizing NET-CI and DAT-CI mice we may be able to identify the mechanism responsible for cocaine’s lethal effects. This may provide insights into treating individuals that have overdosed on cocaine.

Collectively, our efforts to create sophisticated animal models to elucidate the specific roles of each predominant binding site involved in cocaine’s effects should enable us to one day understand how the inhibition of each transporter individually contributes to cocaine’s effects and how it interacts with other transporters to yield the numerous cocaine effects. Our hope is that understanding the way each of these transporters contributes to cocaine’s effects will spur the development of sophisticated polydrug strategies.

References

Amara, S. G. and Kuhar, M. J., 1993. Neurotransmitter transporters: recent progress.

Annu Rev Neurosci. 16, 73-93.

Amara, S. G. and Pacholczyk, T., 1991. Sodium-dependent neurotransmitter reuptake

systems. Curr Opin Neurobiol. 1, 84-90.

Aston-Jones, G. and Cohen, J. D., 2005. An integrative theory of locus coeruleus-

norepinephrine function: adaptive gain and optimal performance. Annu Rev

Neurosci. 28, 403-450.

Aston-Jones, G., Rajkowski, J. and Cohen, J., 1999. Role of locus coeruleus in attention

and behavioral flexibility. Biol Psychiatry. 46, 1309-1320.

Beaulieu, J. M. and Gainetdinov, R. R., 2011. The physiology, signaling, and

pharmacology of dopamine receptors. Pharmacol Rev. 63, 182-217.

Bolla, K. I., Cadet, J. L. and London, E. D., 1998. The neuropsychiatry of chronic

cocaine abuse. J Neuropsychiatry Clin Neurosci. 10, 280-289.

Bracci, E., Centonze, D., Bernardi, G. and Calabresi, P., 2002. Dopamine excites fast-

spiking interneurons in the striatum. J Neurophysiol. 87, 2190-2194.

Brenhouse, H. C., Montalto, S. and Stellar, J. R., 2006. Electrolytic lesions of a discrete

area within the nucleus accumbens shell attenuate the long-term expression, but

not early phase, of sensitization to cocaine. Behav Brain Res. 170, 219-223.

Brust, J. C., 2010. Substance abuse and movement disorders. Mov Disord. 25, 2010-

2020.

Caine, S. B., 1998. Cocaine abuse: hard knocks for the dopamine hypothesis? Nat

Neurosci. 1, 90-92.

Caine, S. B., 2007. The role of DAT inhibition in cocaine self-administration. In

preparation.

Carboni, E., Imperato, A., Perezzani, L. and Di Chiara, G., 1989. Amphetamine, cocaine,

phencyclidine and nomifensine increase extracellular dopamine concentrations

preferentially in the nucleus accumbens of freely moving rats. Neuroscience. 28,

653-661.

Carboni, E., Tanda, G. L., Frau, R. and Di Chiara, G., 1990. Blockade of the

noradrenaline carrier increases extracellular dopamine concentrations in the

prefrontal cortex: evidence that dopamine is taken up in vivo by noradrenergic

terminals. J Neurochem. 55, 1067-1070.

Cass, W. A., Gerhardt, G. A., Mayfield, R. D., Curella, P. and Zahniser, N. R., 1992.

Differences in dopamine clearance and diffusion in rat striatum and nucleus

accumbens following systemic cocaine administration. J Neurochem. 59, 259-

266.

Centonze, D., Picconi, B., Baunez, C., Borrelli, E., Pisani, A., Bernardi, G. and Calabresi,

P., 2002. Cocaine and amphetamine depress striatal GABAergic synaptic

transmission through D2 dopamine receptors. Neuropsychopharmacology. 26,

164-175.

Chen, R., Tilley, M. R., Wei, H., Zhou, F., Zhou, F. M., Ching, S., Quan, N., Stephens, R.

L., Hill, E. R., Nottoli, T., Han, D. D. and Gu, H. H., 2006a. Abolished cocaine

reward in mice with a cocaine-insensitive dopamine transporter. Proc Natl Acad

Sci U S A. 103, 9333-9338.

Chen, R., Wu, X., Wei, H., Han, D. D. and Gu, H. H., 2006b. Molecular cloning and

functional characterization of the dopamine transporter from Eloria noyesi, a

caterpillar pest of cocaine-rich coca plants. Gene. 366, 152-160.

Ciliax, B. J., Drash, G. W., Staley, J. K., Haber, S., Mobley, C. J., Miller, G. W., Mufson,

E. J., Mash, D. C. and Levey, A. I., 1999. Immunocytochemical localization of

the dopamine transporter in human brain. J Comp Neurol. 409, 38-56.

Dalley, J. W., Laane, K., Pena, Y., Theobald, D. E., Everitt, B. J. and Robbins, T. W.,

2005. Attentional and motivational deficits in rats withdrawn from intravenous

self-administration of cocaine or heroin. Psychopharmacology (Berl). 182, 579-

587.

Di Chiara, G., 2002. Nucleus accumbens shell and core dopamine: differential role in

behavior and addiction. Behav Brain Res. 137, 75-114.

Di Chiara, G., Bassareo, V., Fenu, S., De Luca, M. A., Spina, L., Cadoni, C., Acquas, E.,

Carboni, E., Valentini, V. and Lecca, D., 2004. Dopamine and drug addiction: the

nucleus accumbens shell connection. Neuropharmacology. 47 Suppl 1, 227-241.

Ettenberg, A., 2004. Opponent process properties of self-administered cocaine. Neurosci

Biobehav Rev. 27, 721-728.

Everitt, B. J., Dickinson, A. and Robbins, T. W., 2001. The neuropsychological basis of

addictive behaviour. Brain Res Brain Res Rev. 36, 129-138.

Filip, M., Frankowska, M., Zaniewska, M., Golda, A. and Przegalinski, E., 2005. The

serotonergic system and its role in cocaine addiction. Pharmacol Rep. 57, 685-

700.

Franklin, K. and Paxinos, G., 2001. The mouse brain in stereotaxic coordinates.

Academic Press, 2001.

Fumagalli, F., Jones, S., Bosse, R., Jaber, M., Giros, B., Missale, C., Wightman, R. M.

and Caron, M. G., 1998. Inactivation of the dopamine transporter reveals essential

roles of dopamine in the control of locomotion, psychostimulant response, and

pituitary function. Adv Pharmacol. 42, 179-182.

Gainetdinov, R. R., Jones, S. R., Fumagalli, F., Wightman, R. M. and Caron, M. G.,

1998. Re-evaluation of the role of the dopamine transporter in dopamine system

homeostasis. Brain Res Brain Res Rev. 26, 148-153.

Gainetdinov, R. R., Premont, R. T., Bohn, L. M., Lefkowitz, R. J. and Caron, M. G.,

2004. Desensitization of G Protein-Coupled Receptors and Neuronal Functions.

Annu Rev Neurosci. 27, 107-144.

Garavan, H. and Hester, R., 2007. The role of cognitive control in cocaine dependence.

Neuropsychol Rev. 17, 337-345.

Garcia, B. G., Neely, M. D. and Deutch, A. Y., 2010. Cortical regulation of striatal

medium spiny neuron dendritic remodeling in parkinsonism: modulation of

glutamate release reverses dopamine depletion-induced dendritic spine loss.

Cereb Cortex. 20, 2423-2432.

Gether, U., Andersen, P. H., Larsson, O. M. and Schousboe, A., 2006. Neurotransmitter

transporters: molecular function of important drug targets. Trends Pharmacol Sci.

27, 375-383.

Giros, B., el Mestikawy, S., Bertrand, L. and Caron, M. G., 1991. Cloning and functional

characterization of a cocaine-sensitive dopamine transporter. FEBS Lett. 295,

149-154.

Giros, B., Jaber, M., Jones, S. R., Wightman, R. M. and Caron, M. G., 1996.

Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking

the dopamine transporter. Nature. 379, 606-612.

Hall, F. S., Li, X. F., Goeb, M., Roff, S., Hoggatt, H., Sora, I. and Uhl, G. R., 2003.

Congenic C57BL/6 mu opiate receptor (MOR) knockout mice: baseline and

opiate effects. Genes Brain Behav. 2, 114-121.

Hall, F. S., Li, X. F., Sora, I., Xu, F., Caron, M., Lesch, K. P., Murphy, D. L. and Uhl, G.

R., 2002. Cocaine mechanisms: enhanced cocaine, fluoxetine and nisoxetine place

preferences following monoamine transporter deletions. Neuroscience. 115, 153-

161.

Hall, F. S., Sora, I., Drgonova, J., Li, X. F., Goeb, M. and Uhl, G. R., 2004. Molecular

mechanisms underlying the rewarding effects of cocaine. Ann N Y Acad Sci.

1025, 47-56.

Han, D. D. and Gu, H. H., 2006. Comparison of the monoamine transporters from human

and mouse in their sensitivities to psychostimulant drugs. BMC Pharmacol. 6, 6.

Harris, G. C., Hedaya, M. A., Pan, W. J. and Kalivas, P., 1996. beta-adrenergic

antagonism alters the behavioral and neurochemical responses to cocaine.

Neuropsychopharmacology. 14, 195-204.

Hering, H. and Sheng, M., 2001. Dendritic spines: structure, dynamics and regulation.

Nat Rev Neurosci. 2, 880-888.

Hester, R., Lubman, D. I. and Yucel, M., 2010. The role of executive control in human

drug addiction. Curr Top Behav Neurosci. 3, 301-318.

Hitri, A., Hurd, Y. L., Wyatt, R. J. and Deutsch, S. I., 1994. Molecular, functional and

biochemical characteristics of the dopamine transporter: regional differences and

clinical relevance. Clin Neuropharmacol. 17, 1-22.

Hitri, A., Little, K. Y. and Ellinwood, E. H., Jr., 1996. Effect of cocaine on dopamine

transporter receptors depends on routes of chronic cocaine administration.

Neuropsychopharmacology. 14, 205-210.

Horn, A. S., Baumgarten, H. G. and Schlosserberger, H. G., 1973. Inhibition of the

uptake of 5-hydroxytryptamine, noradrenaline and dopamine into rat brain

homogenates by various hydroxylated tryptamines. J Neurochem. 21, 233-236.

Hyman, S. E., Malenka, R. C. and Nestler, E. J., 2006. Neural mechanisms of addiction:

the role of reward-related learning and memory. Annu Rev Neurosci. 29, 565-

598.

Imperato, A., Mele, A., Scrocco, M. G. and Puglisi-Allegra, S., 1992. Chronic cocaine

alters limbic extracellular dopamine. Neurochemical basis for addiction. Eur J

Pharmacol. 212, 299-300.

Jones, J. D., Hall, F. S., Uhl, G. R. and Riley, A. L., 2011. Dopamine, norepinephrine and

serotonin transporter gene deletions differentially alter cocaine-induced taste

aversion. Pharmacol Biochem Behav. 94, 580-587.

Kaminski, R. M., Shippenberg, T. S., Witkin, J. M. and Rocha, B. A., 2005. Genetic

deletion of the norepinephrine transporter decreases vulnerability to seizures.

Neurosci Lett. 382, 51-55.

Kloner, R. A., Hale, S., Alker, K. and Rezkalla, S., 1992. The effects of acute and chronic

cocaine use on the heart. Circulation. 85, 407-419.

Kolb, B., Gorny, G., Li, Y., Samaha, A. N. and Robinson, T. E., 2003. Amphetamine or

cocaine limits the ability of later experience to promote structural plasticity in the

neocortex and nucleus accumbens. Proc Natl Acad Sci U S A. 100, 10523-10528.

Koob, G. F., 1998. Circuits, drugs, and drug addiction. Adv Pharmacol. 42, 978-982.

Koob, G. F., Caine, S. B., Parsons, L., Markou, A. and Weiss, F., 1997. Opponent

process model and psychostimulant addiction. Pharmacol Biochem Behav. 57,

513-521.

Koob, G. F. and Volkow, N. D., 2011. Neurocircuitry of addiction.

Neuropsychopharmacology. 35, 217-238.

Kosten, T. R., Markou, A. and Koob, G. F., 1998. Depression and stimulant dependence:

neurobiology and pharmacotherapy. J Nerv Ment Dis. 186, 737-745.

Kuhar, M. J., Ritz, M. C. and Boja, J. W., 1991. The dopamine hypothesis of the

reinforcing properties of cocaine. Trends Neurosci. 14, 299-302.

Kuhar, M. J., Ritz, M. C. and Sharkey, J., 1988. Cocaine receptors on dopamine

transporters mediate cocaine-reinforced behavior. NIDA Res Monogr. 88, 14-22.

Larsen, M. B., Sonders, M. S., Mortensen, O. V., Larson, G. A., Zahniser, N. R. and

Amara, S. G., 2011. Dopamine transport by the serotonin transporter: a

mechanistically distinct mode of substrate translocation. J Neurosci. 31, 6605-

6615.

Lee, K. W., Kim, Y., Kim, A. M., Helmin, K., Nairn, A. C. and Greengard, P., 2006.

Cocaine-induced dendritic spine formation in D1 and D2 dopamine receptor-

containing medium spiny neurons in nucleus accumbens. Proc Natl Acad Sci U S

A. 103, 3399-3404.

Li, Y., Acerbo, M. J. and Robinson, T. E., 2004. The induction of behavioural

sensitization is associated with cocaine-induced structural plasticity in the core

(but not shell) of the nucleus accumbens. Eur J Neurosci. 20, 1647-1654.

Markou, A., Weiss, F., Gold, L. H., Caine, S. B., Schulteis, G. and Koob, G. F., 1993.

Animal models of drug craving. Psychopharmacology (Berl). 112, 163-182.

Martin, B. J., Naughton, B. J., Thirtamara-Rajamani, K., Yoon, D. J., Han, D. D.,

Devries, A. C. and Gu, H. H., 2011. Dopamine transporter inhibition is necessary

for cocaine-induced increases in dendritic spine density in the nucleus accumbens.

Synapse. 65, 490-496.

Mead, A. N., Rocha, B. A., Donovan, D. M. and Katz, J. L., 2002. Intravenous cocaine

induced-activity and behavioural sensitization in norepinephrine-, but not

dopamine-transporter knockout mice. Eur J Neurosci. 16, 514-520.

Medvedev, I. O., Gainetdinov, R. R., Sotnikova, T. D., Bohn, L. M., Caron, M. G. and

Dykstra, L. A., 2005. Characterization of conditioned place preference to cocaine

in congenic dopamine transporter knockout female mice. Psychopharmacology

(Berl). 180, 408-413.

Meredith, G. E., Ypma, P. and Zahm, D. S., 1995. Effects of dopamine depletion on the

morphology of medium spiny neurons in the shell and core of the rat nucleus

accumbens. J Neurosci. 15, 3808-3820.

Mitchell, H. A., Ahern, T. H., Liles, L. C., Javors, M. A. and Weinshenker, D., 2006. The

effects of norepinephrine transporter inactivation on locomotor activity in mice.

Biol Psychiatry. 60, 1046-1052.

Moll, G. H., Mehnert, C., Wicker, M., Bock, N., Rothenberger, A., Ruther, E. and

Huether, G., 2000. Age-associated changes in the densities of presynaptic

monoamine transporters in different regions of the rat brain from early juvenile

life to late adulthood. Brain Res Dev Brain Res. 119, 251-257.

Moore, R. Y. and Bloom, F. E., 1978. Central catecholamine neuron systems: anatomy

and physiology of the dopamine systems. Annu Rev Neurosci. 1, 129-169.

Moore, R. Y. and Bloom, F. E., 1979. Central catecholamine neuron systems: anatomy

and physiology of the norepinephrine and epinephrine systems. Annu Rev

Neurosci. 2, 113-168.

Moron, J. A., Brockington, A., Wise, R. A., Rocha, B. A. and Hope, B. T., 2002.

Dopamine uptake through the norepinephrine transporter in brain regions with

low levels of the dopamine transporter: evidence from knock-out mouse lines. J

Neurosci. 22, 389-395.

Napolitano, F., Bonito-Oliva, A., Federici, M., Carta, M., Errico, F., Magara, S.,

Martella, G., Nistico, R., Centonze, D., Pisani, A., Gu, H. H., Mercuri, N. B. and

Usiello, A., 2010. Role of aberrant striatal dopamine D1 receptor/cAMP/protein

kinase A/DARPP32 signaling in the paradoxical calming effect of amphetamine. J

Neurosci. 30, 11043-11056.

Narayanan, S., Mesangeau, C., Poupaert, J. H. and McCurdy, C. R., 2011. Sigma

receptors and cocaine abuse. Curr Top Med Chem. 11, 1128-1150.

Nestler, E. J., 2001. Molecular neurobiology of addiction. Am J Addict. 10, 201-217.

Nestler, E. J., 2005. The neurobiology of cocaine addiction. Sci Pract Perspect. 3, 4-10.

NHDUH, 2010. Results from the 2009 National Survey on Drug Use and Health: Volume

I. Summary of National Findings). (Office of Applied Studies, NSDUH Series H-

38A, HHS Publication No. SMA 10-4856 Findings). Rockville, MD.

Nirenberg, M. J., Chan, J., Pohorille, A., Vaughan, R. A., Uhl, G. R., Kuhar, M. J. and

Pickel, V. M., 1997. The dopamine transporter: comparative ultrastructure of

dopaminergic axons in limbic and motor compartments of the nucleus accumbens.

J Neurosci. 17, 6899-6907.

NSDUH, S. A. a. M. H. S. A., 2010. Results from the 2009 National Survey on Drug Use

and Health :Summary of National Findings. 1.

Office of National Drug Control Policy, 2002. Drug Facts: Cocaine,.

Pacholczyk, T., Blakely, R. D. and Amara, S. G., 1991. Expression cloning of a cocaine-

and antidepressant-sensitive human noradrenaline transporter. Nature. 350, 350-

354.

Pierce, R. C. and Kalivas, P. W., 1995. Amphetamine produces sensitized increases in

locomotion and extracellular dopamine preferentially in the nucleus accumbens

shell of rats administered repeated cocaine. J Pharmacol Exp Ther. 275, 1019-

1029.

Pontieri, F. E., Tanda, G. and Di Chiara, G., 1995. Intravenous cocaine, morphine, and

amphetamine preferentially increase extracellular dopamine in the "shell" as

compared with the "core" of the rat nucleus accumbens. Proc Natl Acad Sci U S

A. 92, 12304-12308.

Ramamoorthy, S., Shippenberg, T. S. and Jayanthi, L. D., 2011. Regulation of

monoamine transporters: Role of transporter phosphorylation. Pharmacol Ther.

129, 220-238.

Reith, M. E., 1988. Cocaine receptors on monoamine transporters and sodium channels.

NIDA Res Monogr. 88, 23-43.

Reith, M. E., Li, M. Y. and Yan, Q. S., 1997. Extracellular dopamine, norepinephrine,

and serotonin in the ventral tegmental area and nucleus accumbens of freely

moving rats during intracerebral dialysis following systemic administration of

cocaine and other uptake blockers. Psychopharmacology (Berl). 134, 309-317.

Ren, Z., Sun, W. L., Jiao, H., Zhang, D., Kong, H., Wang, X. and Xu, M., 2010.

Dopamine D1 and N-methyl-d-aspartate receptors and extracellular signal-

regulated kinase mediate neuronal morphological changes induced by repeated

cocaine administration. Neuroscience.

Resnick, R. B., Kestenbaum, R. S. and Schwartz, L. K., 1977. Acute systemic effects of

cocaine in man: a controlled study by intranasal and intravenous routes. Science.

195, 696-698.

Ritz, M. C., Cone, E. J. and Kuhar, M. J., 1990. Cocaine inhibition of ligand binding at

dopamine, norepinephrine and serotonin transporters: a structure-activity study.

Life Sci. 46, 635-645.

Ritz, M. C. and Kuhar, M. J., 1989. Relationship between self-administration of

amphetamine and monoamine receptors in brain: comparison with cocaine. J

Pharmacol Exp Ther. 248, 1010-1017.

Ritz, M. C., Lamb, R. J., Goldberg, S. R. and Kuhar, M. J., 1987. Cocaine receptors on

dopamine transporters are related to self-administration of cocaine. Science. 237,

1219-1223.

Ritz, M. C., Lamb, R. J., Goldberg, S. R. and Kuhar, M. J., 1988. Cocaine self-

administration appears to be mediated by dopamine uptake inhibition. Prog

Neuropsychopharmacol Biol Psychiatry. 12, 233-239.

Roberts, D. C., Corcoran, M. E. and Fibiger, H. C., 1977. On the role of ascending

catecholaminergic systems in intravenous self-administration of cocaine.

Pharmacol Biochem Behav. 6, 615-620.

Roberts, D. C. and Koob, G. F., 1982. Disruption of cocaine self-administration

following 6-hydroxydopamine lesions of the ventral tegmental area in rats.

Pharmacol Biochem Behav. 17, 901-904.

Roberts, D. C., Phelan, R., Hodges, L. M., Hodges, M. M., Bennett, B., Childers, S. and

Davies, H., 1999. Self-administration of cocaine analogs by rats.

Psychopharmacology (Berl). 144, 389-397.

Robinson, T. E. and Berridge, K. C., 1993. The neural basis of drug craving: an

incentive-sensitization theory of addiction. Brain Res Brain Res Rev. 18, 247-291.

Robinson, T. E. and Berridge, K. C., 2008. Review. The incentive sensitization theory of

addiction: some current issues. Philos Trans R Soc Lond B Biol Sci. 363, 3137-

3146.

Robinson, T. E., Gorny, G., Mitton, E. and Kolb, B., 2001. Cocaine self-administration

alters the morphology of dendrites and dendritic spines in the nucleus accumbens

and neocortex. Synapse. 39, 257-266.

Robinson, T. E. and Kolb, B., 1999. Alterations in the morphology of dendrites and

dendritic spines in the nucleus accumbens and prefrontal cortex following

repeated treatment with amphetamine or cocaine. Eur J Neurosci. 11, 1598-1604.

Robinson, T. E. and Kolb, B., 2004. Structural plasticity associated with exposure to

drugs of abuse. Neuropharmacology. 47 Suppl 1, 33-46.

Rocha, B. A., 2003. Stimulant and reinforcing effects of cocaine in monoamine

transporter knockout mice. Eur J Pharmacol. 479, 107-115.

SAMHSA, S. A. a. M. H. S. A., 2001.

Sarti, F., Borgland, S. L., Kharazia, V. N. and Bonci, A., 2007. Acute cocaine exposure

alters spine density and long-term potentiation in the ventral tegmental area. Eur J

Neurosci. 26, 749-756.

Schank, J. R., Liles, L. C. and Weinshenker, D., 2008. Norepinephrine signaling through

beta-adrenergic receptors is critical for expression of cocaine-induced anxiety.

Biol Psychiatry. 63, 1007-1012.

Schultz, W., 1999. The Reward Signal of Midbrain Dopamine Neurons. News Physiol

Sci. 14, 249-255.

Schwartz, B. G., Rezkalla, S. and Kloner, R. A., 2010. Cardiovascular effects of cocaine.

Circulation. 122, 2558-2569.

Scriabine, A., 1969. Some observations on the adrenergic blocking activity of

desipramine and amitriptyline on aortic strips of rabbits. Experientia. 25, 164-165.

Sesack, S. R., Carr, D. B., Omelchenko, N. and Pinto, A., 2003. Anatomical substrates

for glutamate-dopamine interactions: evidence for specificity of connections and

extrasynaptic actions. Ann N Y Acad Sci. 1003, 36-52.

Smith, M. J., Thirthalli, J., Abdallah, A. B., Murray, R. M. and Cottler, L. B., 2009.

Prevalence of psychotic symptoms in substance users: a comparison across

substances. Compr Psychiatry. 50, 245-250.

Soderstrom, K. E., O'Malley, J. A., Levine, N. D., Sortwell, C. E., Collier, T. J. and

Steece-Collier, K., 2010. Impact of dendritic spine preservation in medium spiny

neurons on dopamine graft efficacy and the expression of dyskinesias in

parkinsonian rats. Eur J Neurosci. 31, 478-490.

Sofuoglu, M. and Sewell, R. A., 2009. Norepinephrine and stimulant addiction. Addict

Biol. 14, 119-129.

Solich, J., Faron-Gorecka, A., Kusmider, M., Palach, P., Gaska, M. and Dziedzicka-

Wasylewska, M., 2011. Norepinephrine transporter (NET) knock-out upregulates

dopamine and serotonin transporters in the mouse brain. Neurochem Int.

Sora, I., Hall, F. S., Andrews, A. M., Itokawa, M., Li, X. F., Wei, H. B., Wichems, C.,

Lesch, K. P., Murphy, D. L. and Uhl, G. R., 2001. Molecular mechanisms of

cocaine reward: combined dopamine and serotonin transporter knockouts

eliminate cocaine place preference. Proc Natl Acad Sci U S A. 98, 5300-5305.

Sora, I., Wichems, C., Takahashi, N., Li, X. F., Zeng, Z., Revay, R., Lesch, K. P.,

Murphy, D. L. and Uhl, G. R., 1998. Cocaine reward models: conditioned place

preference can be established in dopamine- and in serotonin-transporter knockout

mice. Proc Natl Acad Sci U S A. 95, 7699-7704.

Spealman, R. D., Bergman, J., Madras, B. K., Kamien, J. B. and Melia, K. F., 1992. Role

of D1 and D2 dopamine receptors in the behavioral effects of cocaine.

Neurochem Int. 20 Suppl, 147S-152S.

Stalnaker, T. A., Takahashi, Y., Roesch, M. R. and Schoenbaum, G., 2009. Neural

substrates of cognitive inflexibility after chronic cocaine exposure.

Neuropharmacology. 56 Suppl 1, 63-72.

Stanwood, G. D., Parlaman, J. P. and Levitt, P., 2005. Anatomical abnormalities in

dopaminoceptive regions of the cerebral cortex of dopamine D1 receptor mutant

mice. J Comp Neurol. 487, 270-282.

Suzuki, T., Shiozaki, Y., Masukawa, Y., Misawa, M. and Nagase, H., 1992. The role of

mu- and kappa-opioid receptors in cocaine-induced conditioned place preference.

Jpn J Pharmacol. 58, 435-442.

Thirthalli, J. and Benegal, V., 2006. Psychosis among substance users. Curr Opin

Psychiatry. 19, 239-245.

Thompson, B. J., Jessen, T., Henry, L. K., Field, J. R., Gamble, K. L., Gresch, P. J.,

Carneiro, A. M., Horton, R. E., Chisnell, P. J., Belova, Y., McMahon, D. G.,

Daws, L. C. and Blakely, R. D., 2011. Transgenic elimination of high-affinity

antidepressant and cocaine sensitivity in the presynaptic serotonin transporter.

Proc Natl Acad Sci U S A. 108, 3785-3790.

Thomsen, M., Han, D. D., Gu, H. H. and Caine, S. B., 2009a. Lack of cocaine self-

administration in mice expressing a cocaine-insensitive dopamine transporter. J

Pharmacol Exp Ther.

Thomsen, M., Han, D. D., Gu, H. H. and Caine, S. B., 2009b. Lack of cocaine self-

administration in mice expressing a cocaine-insensitive dopamine transporter. J

Pharmacol Exp Ther. 331, 204-211.

Tilley, M. R., Cagniard, B., Zhuang, X., Han, D. D., Tiao, N. and Gu, H. H., 2007.

Cocaine reward and locomotion stimulation in mice with reduced dopamine

transporter expression. BMC Neurosci. 8, 42.

Tilley, M. R. and Gu, H. H., 2008a. Dopamine transporter inhibition is required for

cocaine induced stereotopy. Submitted.

Tilley, M. R. and Gu, H. H., 2008b. Dopamine transporter inhibition is required for

cocaine-induced stereotypy. Neuroreport. 19, 1137-1140.

Tilley, M. R., O'Neill, B., Han, D. D. and Gu, H. H., 2009. Cocaine does not produce

reward in absence of dopamine transporter inhibition. Neuroreport. 20, 9-12.

Todtenkopf, M. S., Carreiras, T., Melloni, R. H. and Stellar, J. R., 2002. The dorsomedial

shell of the nucleus accumbens facilitates cocaine-induced locomotor activity

during the induction of behavioral sensitization. Behav Brain Res. 131, 9-16.

Torres, G. E., Gainetdinov, R. R. and Caron, M. G., 2003. Plasma membrane monoamine

transporters: structure, regulation and function. Nat Rev Neurosci. 4, 13-25.

Tran-Nguyen, L. T., Baker, D. A., Grote, K. A., Solano, J. and Neisewander, J. L., 1999.

Serotonin depletion attenuates cocaine-seeking behavior in rats.

Psychopharmacology (Berl). 146, 60-66.

Tzschentke, T. M., Magalas, Z. and De Vry, J., 2006. Effects of venlafaxine and

desipramine on heroin-induced conditioned place preference in the rat. Addict

Biol. 11, 64-71.

Uhl, G. R., Hall, F. S. and Sora, I., 2002. Cocaine, reward, movement and monoamine

transporters. Mol Psychiatry. 7, 21-26.

Verdejo-Garcia, A., Bechara, A., Recknor, E. C. and Perez-Garcia, M., 2006. Executive

dysfunction in substance dependent individuals during drug use and abstinence:

an examination of the behavioral, cognitive and emotional correlates of addiction.

J Int Neuropsychol Soc. 12, 405-415.

Villa, C., Pascual-Sedano, B., Pagonabarraga, J. and Kulisevsky, J., 2011. Impulse

control disorders and dopaminergic treatments in Parkinson's disease. Rev Neurol

(Paris).

Volkow, N. D., Fowler, J. S., Wang, G. J., Baler, R. and Telang, F., 2009. Imaging

dopamine's role in drug abuse and addiction. Neuropharmacology. 56 Suppl 1, 3-

Wang, Y. M., Xu, F., Gainetdinov, R. R. and Caron, M. G., 1999. Genetic approaches to

studying norepinephrine function: knockout of the mouse norepinephrine

transporter gene. Biol Psychiatry. 46, 1124-1130.

Wee, S., Wang, Z., He, R., Zhou, J., Kozikowski, A. P. and Woolverton, W. L., 2006.

Role of the increased noradrenergic neurotransmission in drug self-

administration. Drug Alcohol Depend. 82, 151-157.

Weed, M. R. and Woolverton, W. L., 1995. The reinforcing effects of dopamine D1

receptor agonists in rhesus monkeys. J Pharmacol Exp Ther. 275, 1367-1374.

Wei, H., Hill, E. R. and Gu, H. H., 2009. Functional mutations in mouse norepinephrine

transporter reduce sensitivity to cocaine inhibition. Neuropharmacology. 56, 399-

404.

Weinshenker, D. and Schroeder, J. P., 2007. There and back again: a tale of

norepinephrine and drug addiction. Neuropsychopharmacology. 32, 1433-1451.

WHO, 1964. expert Committee on addiction-Producing Drugs. Thirteenth report of the

WHO Expert Committee. Geneva,World Health Organization,1964 (WHO

Technical Report Series, NO.273).

Wise, R. A., 1994. Cocaine reward and cocaine craving: the role of dopamine in

perspective. NIDA Res Monogr. 145, 191-206.

Wu, X. and Gu, H. H., 1999. Molecular cloning of the mouse dopamine transporter and

pharmacological comparison with the human homologue. Gene. 233, 163-170.

Xu, F., Gainetdinov, R. R., Wetsel, W. C., Jones, S. R., Bohn, L. M., Miller, G. W.,

Wang, Y. M. and Caron, M. G., 2000. Mice lacking the norepinephrine

transporter are supersensitive to psychostimulants. Nat Neurosci. 3, 465-471.

Yao, W.-D., Spealman, R. D. and Zhang, J., 2008. Dopaminergic signaling in dendritic

spines. Biochemical Pharmacology. 75, 2055-2069.

Zahniser, N. R. and Sorkin, A., 2004. Rapid regulation of the dopamine transporter: role

in stimulant addiction? Neuropharmacology. 47 Suppl 1, 80-91.

Zhou, Q., Homma, K. J. and Poo, M. M., 2004. Shrinkage of dendritic spines associated

with long-term depression of hippocampal synapses. Neuron. 44, 749-757.

Zocchi, A., Conti, G. and Orzi, F., 2001. Differential effects of cocaine on local cerebral

glucose utilization in the mouse and in the rat. Neurosci Lett. 306, 177-180.

Abbreviations

NET; Norepinephrine transporter

DAT; Dopamine transporter

NE; norepinephrine

DA; dopamine

SERT; serotonin transporter

5-HT; serotonin

NAC; nucleus accumbens

PFC; prefrontal cortex

LC; locus coeruleus

NET-CI mice; cocaine-insensitive norepinephrine transporter mice

DAT-CI mice; cocaine-insensitive dopamine transporter mice

SERT-CI mice; cocaine-insensitive serotonin transporter mice

NET glyco; glycosylated NET

GAPDH;

qRT-PCR; quantitative real-time polymerase chain reaction

VTA; ventral tegmental area

SN; substantia nigra