DOCSLIB.ORG

Characterization and Antimicrobial Resistance of Listeria Monocytogenes Isolated from Food-Related Environments

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization and Antimicrobial Resistance of Listeria Monocytogenes Isolated from Food-Related Environments PEER-REVIEWED ARTICLE Dongryeoul Bae,1 Ronald D. Smiley,2 3 1* Food Protection Trends, Vol 36, No. 5, p.357–361 Ezat H. Mezal and Ashraf A. Khan Copyright© 2016, International Association for Food Protection 6200 Aurora Ave., Suite 200W, Des Moines, IA 50322-2864 1*Division of Microbiology, National Center for Toxicological Research, U.S. Food and Drug Administration, Jefferson, AR 72079, USA 2Arkansas Regional Laboratory, Office of Regulatory Affairs, U.S. Food and Drug Administration, Jefferson, AR 72079, USA 3Dept. of Biology, University of Thi-Qar, Thi-Qar, Iraq Food Products and Processing Facilities Linked to Recent Outbreaks of Listeriosis in the US Frozen Vegetables (2016, WA) Cheeses (2013, WI) Raw Milk Caramel Apples Soy Products (2016, PA) (2014 – 2015, CA) (2014, IL) Packaged Salads Dairy Products (2016, OH) (2014, DE) Caramel Apples (2014 – 2015, MO) Soft Cheese Ice Cream (2015, CA) (2015, OK) Ice Cream (2015, AL) Ice Cream Product (2015, TX) Soft Cheese (2014, FL) Data source: Centers for Disease Control and Prevention www.cdc.gov/listeria/outbreaks/index,html Characterization and Antimicrobial Resistance of Listeria monocytogenes Isolated from Food-related Environments ABSTRACT streptomycin and tetracycline. No strain was resist- The purpose of this study was to determine the ant to 3 or more antimicrobial classes. All tetracy- diversity and antimicrobial resistance of Listeria cline-resistant strains were serotype 1/2a, and only monocytogenes strains isolated from food-related tetM was amplified from the chromosomal DNA. This environments in the United States. Nineteen unre- study, which reports the genetic diversity and anti- lated strains of L. monocytogenes were recovered microbial resistance of foodborne L. monocytogenes, from approximately 1300 food and food processing may be useful in food safety control programs to environmental samples collected from 2007 to 2011 reduce the risk of transmission of L. monocytogenes as part of the U.S. Food and Drug Administration to food products. pathogen surveillance program. The L. monocyto- genes environmental isolates were characterized by INTRODUCTION serotyping, subtyping, and identification of antimicro- Listeria monocytogenes, a Gram-positive, facultatively bial resistance determinants. The serovars of intracellular foodborne bacterial pathogen that causes L. monocytogenes were 1/2a, 4b, and 1/2b. PFGE human listeriosis (6, 13), is widely distributed in the using AscI digested total DNA showed genetic natural environment and foods. L. monocytogenes has been diversity; there were 10 PFGE pulse-types and 5 recognized as a major human foodborne pathogen ever PFGE groups. All strains except one strain were since a large Listeria outbreak occurred in 1983 in the susceptible to ampicillin, erythromycin, vancomycin, United States (U.S.) from improperly pasteurized milk ciprofloxacin, and chloramphenicol but resistant to (13). The hospitalization (91.0%) and mortality (19.5%) extended-spectrum cephalosporins (ESC). The envi- rates due to listeriosis are estimated to be the highest ronmental strains were predominantly resistant to among those caused by foodborne pathogens in the U.S. *Corresponding author: Phone: +1 870.543.7601; Fax: +1 870.543.7307; E-mail: [email protected] September/October Food Protection Trends 357 (4, 18). Higher mortality rates are typically associated Bacterial cultivation and pulsed-field gel electrophoresis with immunocompromised persons, the elderly, pregnant (PFGE) women, and neonates (9). L. monocytogenes isolates were cultured in BHI broth Of the recognized Listeria species, only L. monocytgenes is (Difco Laboratories, Detroit, MI). Turbidity measurements associated with human listeriosis outbreaks, with serotype and PFGE analysis for subtyping were based on the CDC 4b being the most commonly implicated serotype (2). standard protocol (http://www.cdc.gov/pulsenet/protocols/ Although serotypes 1/2a and 1/2b are more frequently pulsenet_listeria_protocol%20.pdf) as modified for a isolated from food products, serotype 4b is more frequently previous study (1). The restriction enzymesAsc I and ApaI isolated from clinical specimens (8). Hence, serotyping and were used to digest the DNA plugs. subtyping of L. monocytogenes isolates are epidemiologically important steps in identification and classification of this Antimicrobial susceptibility assays and MIC pathogen during human listeriosis outbreaks as well as in determination routine regulatory surveillance. Antimicrobial susceptibility was determined according L. monocytogenes in food products is believed to be to the Clinical and Laboratory Standards Institute (CLSI) derived from the food processing environment despite guidelines (http://www.microbiolab-bg.com/CLSI. a lack of direct evidence linking a specific foodborne pdf). Broth microdilution assays were used to determine L. monocytogenes strain to the food processing plant the minimum inhibitory concentration (MIC) of each environment (7, 19). Listeria species that persist in the antimicrobial: ampicillin, cephalothin, cefoxitin, ceftriaxone, food processing environment may develop resistance to cefepime, gentamicin, kanamycin, streptomycin, tetracycline, chemicals used in cleaning and sanitation (3, 11, 14). erythromycin, vancomycin, rifampicin, ciprofloxacin, Therefore, persistent monitoring of this pathogen in food- sulfamethoxazole-trimethoprim, and chloramphenicol. related environments is important to prevent or minimize Antibiotic diffusion disks (BD, Franklin Lakes, NJ) were contamination of the final food product. In addition, used to confirm antimicrobial resistance of all strains. microbiological environmental monitoring provides Staphylococcus aureus (ATCC 25923) and L. monocytogenes useful information for food safety control programs such EGD-e were used as reference strains (1). as Hazard Analysis Critical Control Point (HACCP) and good manufacturing practices (GMPs) (5). Detection of genes involved in antimicrobial resistance The National Antimicrobial Resistance Monitoring The polymerase chain reaction (PCR) was used to detect System (NARMS) has monitored the antimicrobial resis- genes conferring aminoglycoside, ß-lactam, or tetracycline tance of all of the major foodborne pathogens, except resistance. Primers used in this study are shown in Table L. monocytogenes, since 1996. L. monocytogenes is asso- 1. Genomic DNA was extracted from resistant strains by ciated with high hospitalization and mortality rates, and use of the Qiagen DNeasy Blood and Tissue kit (Qiagen, antimicrobial resistance appears to be increasing (4, 15, Valencia, CA), or plasmid DNA was extracted by a previously 18). The contamination of food products by L. monocy- described method (12). Amplification reactions were done togenes is a major concern to regulatory agencies and the with the Taq PCR Master Mix Kit (Qiagen) and 400 nM food industry, both of which seek to minimize consumer primers (Table 1) by use of an Applied Biosystem Veriti™ 96 exposure to this organism. Therefore, the purpose of this well thermal cycler (Life Technologies: Grand Island, NY, study was to genotypically and phenotypically character- USA). PCR for tetM was performed under the following ize food-related environmental L. monocytogenes isolates conditions: initially incubated at 95°C for 10 min, then and determine their antimicrobial resistance. subjected to 35 cycles of 95°C for 15 sec, 56°C for 15 sec, and 72°C for 30 sec, with a final extension at 72°C for 5 min. MATERIALS AND METHODS PCR conditions for other antimicrobial-resistance genes were Isolation and identification of Listeria spp. strains published previously (15). The samples were collected from food processing facilities in the U.S. during 2007 to 2011 by the Pacific RESULTS AND DISCUSSION Regional Laboratory-Southwest of the FDA (PRL, Irvine, Phenotypic and genotypic diversity of L. monocytogenes CA), using FDA guidance. The guidance is available isolates at http://www.fda.gov/Food/GuidanceRegulation/ Nineteen L. monocytogenes strains were recovered from GuidanceDocumentsRegulatoryInformation/ food-processing environments in the U.S.: nine, six, and four FoodProcessingHACCP/ucm073110.htm#app4. strains of serotypes 1/2a, 4b, and 1/2b, respectively. Nineteen L. monocytogenes strains were recovered, L. monocytogenes isolates were grouped into 10 pulse-types by identified, and serotyped as described in the U.S. Food dendrogram analysis of the PFGE banding patterns fromAsc I and Drug Administration Bacteriological Analytical restriction enzyme digestion of total DNA, using a threshold of Manual (BAM) and in previous studies (1, 10). > 90% genetic similarity among the strains within each pulse- 358 Food Protection Trends September/October Table 1. Primer sequences used in the study Primer Squences (5'-3') Gene Forward Reverse Size (bp) Reference aad6 AGAAGATGTAATAATATAG CTGTAATCACTGTTCCCGCCT 978 (15) dfrD AGAGTAATCGGCAAGGATAACG AATGGGCAATTTCACAATCC 199 (15) tet(K) CGATAGGAACAGCAGTATGG TTAGCCCACCAGAAAACAAACC 614 (15) tet(L) CCACCTGCGAGTACAAACTGG TCGGCAGTACTTAGCTGGTGA 739 (15) tet(M) CATTCACATCGAAGTGCCGC ACACCGAGCAGGGATTTCTC 463 This study tet(S) ATCAAGATATTAAGGAC TTCTCTATGTGGTAATC 589 (15) Figure 1. Analysis of PFGE profiles by AscI-digestion and descriptions of L. monocytogenes isolated from food-related environments. A total of 19 L. monocytogenes environmental isolates were classified by more than 90% similarity of PFGE band pattern among the strains. Edemiological data show detection year, serotype and
Load more

Recommended publications
  • Control of Listeria Monocytogenes in Ready-To-Eat Foods: Guidance for Industry Draft Guidance
    Contains Nonbinding Recommendations Control of Listeria monocytogenes in Ready-To-Eat Foods: Guidance for Industry Draft Guidance This guidance is being distributed for comment purposes only. Although you can comment on any guidance at any time (see 21 CFR 10.115(g)(5)), to ensure that FDA considers your comment on this draft guidance before we begin work on the final version of the guidance, submit either electronic or written comments on the draft guidance within 180 days of publication in the Federal Register of the notice announcing the availability of the draft guidance. Submit electronic comments to http://www.regulations.gov. Submit written comments to the Division of Dockets Management (HFA-305), Food and Drug Administration, 5630 Fishers Lane, rm. 1061, Rockville, MD 20852. All comments should be identified with the docket number FDA–2007–D–0494 listed in the notice of availability that publishes in the Federal Register. For questions regarding this draft document contact the Center for Food Safety and Applied Nutrition (CFSAN) at 240-402-1700. U.S. Department of Health and Human Services Food and Drug Administration Center for Food Safety and Applied Nutrition January 2017 Contains Nonbinding Recommendations Table of Contents I. Introduction II. Background A. Regulatory Framework B. Characteristics of L. monocytogenes C. L. monocytogenes in the Food Processing Environment III. How to Apply This Guidance to Your Operations Based on the Regulatory Framework That Applies to Your Food Establishment IV. Controls on Personnel A. Hands, Gloves and Footwear B. Foamers, Footbaths, and Dry Powdered Sanitizers C. Clothing D. Controls on Personnel Associated with Specific Areas in the Plant E.
    [Show full text]
  • Foodcore Salmonella, Shiga Toxin-Producing E. Coli, and Listeria
    FoodCORE Norovirus, Other, and Unknown (NOU) Metrics Rationale and Intent The FoodCORE performance metrics are a list of measurable activities covering diverse aspects of outbreak response. These activities span from outbreak surveillance and detection through investigation, response, control, and prevention measures. Using the metrics*, each center provides data about the burden, timeliness, and completeness of foodborne disease activities related to the key areas of activity. The rationale and intent of these metrics are for investigation activities for norovirus, other enteric disease pathogens, such as Campylobacter, Cryptosporidium, or Giardia, and outbreaks of unknown etiology. Collectively, these are referred to as the NOU metrics, for norovirus, other etiologies, and unknown etiologies. Other etiologies are enteric illnesses with determined etiology that are not Salmonella, Shiga toxin-producing Escherichia coli, Listeria, or norovirus. Unknown etiologies are enteric illness with no determined/identified etiology from case, product, or environmental testing to indicate the etiologic agent. This can be because no specimen or sample yielded an isolate or other positive result, and would also include investigations where no specimens or samples were collected. Sections Total NOU Investigations ................................2 Laboratory-based Metrics ...............................2 Investigation-based Metrics .............................4 Outbreak-based Metrics .................................6 Norovirus Campylobacter Unknown
    [Show full text]
  • Recovery of <I>Salmonella, Listeria Monocytogenes,</I> and <I>Mycobacterium Bovis</I> from Cheese Enteri
    47 Journal of Food Protection, Vol. 70, No. 1, 2007, Pages 47–52 Copyright ᮊ, International Association for Food Protection Recovery of Salmonella, Listeria monocytogenes, and Mycobacterium bovis from Cheese Entering the United States through a Noncommercial Land Port of Entry HAILU KINDE,1* ANDREA MIKOLON,2 ALFONSO RODRIGUEZ-LAINZ,3 CATHY ADAMS,4 RICHARD L. WALKER,5 SHANNON CERNEK-HOSKINS,3 SCARLETT TREVISO,2 MICHELE GINSBERG,6 ROBERT RAST,7 BETH HARRIS,8 JANET B. PAYEUR,8 STEVE WATERMAN,9 AND ALEX ARDANS5 1California Animal Health and Food Safety Laboratory System (CAHFS), San Bernardino Branch, 105 West Central Avenue, San Bernardino, California 92408, and School of Veterinary Medicine, University of California, Davis, California 95616; 2Animal Health & Food Safety Services Downloaded from http://meridian.allenpress.com/jfp/article-pdf/70/1/47/1680020/0362-028x-70_1_47.pdf by guest on 28 September 2021 Division, California Department of Food and Agriculture, 1220 North Street, Sacramento, California 95814; 3California Office of Binational Border Health, California Department of Health Services, 3851 Rosecrans Street, San Diego, California 92138; 4San Diego County Public Health Laboratory, 3851 Rosecrans Street, San Diego, California 92110; 5CAHFS-Davis, Health Sciences Drive, School of Veterinary Medicine, University of California, Davis, California 95616; 6Community Epidemiology Division, County of San Diego Health and Human Services, 1700 Pacific Highway, San Diego, California 92186; 7U.S. Food and Drug Administration, 2320 Paseo De
    [Show full text]
  • Listeria Monocytogenes Meningitis Complicating Rotavirus Gastroenteritis in an Immunocompetent Child
    CASE REPORT Listeria monocytogenes Meningitis Complicating Rotavirus Gastroenteritis in an Immunocompetent Child Takuma Ohnishi,1,2 Akiko Kawano,2 Mayumi Araki,2 Yuko Hamahata,2 Machiko Usui,2 Motoko Shimoyamada,2 Takuya Tamame, 2 Masayuki Akashi2 and Seiji Sato2 1 Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan 2 Department of Pediatrics, Saitama City Hospital, Saitama, Japan (Received for publication on July 2, 2016) (Revised for publication on October 9, 2016) (Accepted for publication on November 28, 2016) (Published online on April 7, 2017) Listeria monocytogenes only occasionally causes bacterial meningitis in immunocompetent children. We report a case of L. monocytogenes meningitis associated with rotavirus gastroenteritis. The patient was a previously healthy 20-month-old girl who was admitted because of sustained fever and lethargy after suffering from gastroenteritis for 6 days. The patient’s peripheral white blood cell count was 18,600/µL and the C-reactive protein level was 2.44 mg/dL. A stool sample tested positive for rotavirus antigen. A cerebrospinal fluid (CSF) sample showed pleocytosis. Cultures of the CSF and stool samples revealed the presence of L. monocytogenes. The patient was successfully treated with ampicillin and gentamicin. We speculate that translocation of enteric flora across the intestinal epithelium that had been dam- aged by rotavirus gastroenteritis might have caused bacteremia that disseminated into the CSF. Both listeriosis and secondary systemic infection after rotavirus gastroenteritis are rare but not unknown. Initiation of appropriate treatment as soon as possible is important for all types of bacterial meningitis. This rare but serious complication should be taken into consideration even if the patient does not have any medical history of immune-related problems.
    [Show full text]
  • Listeria Monocytogenes: Attributes and Prevention of Transmission by Food
    Volume 10 No 1 March 1989 Publlstl ed as a service to mic robiology by Oxold Limited Oxold IS a registered trade mark. Listeria monocytogenes: attributes and prevention of transmission by food EH Kampelmacher, DVM PhD, Professor-Emeritus, Food Microbiology and Hygiene, Agricultural University, Wageningen and OM Mossel, 8M, MA, PhD, Chair of Medical Food Microbiology, Faculty of Veterinary Medicine, Department of the Science of Food of Animal Origin, Neth. Gov!. University, Utrecht, The Netherl ands. Pathogenic properties, clinical attributes of L, monocytogenes' always rely on the strictly quantitative prevalence and ecology Table 1: Lag times (days} of Listeria monocytogenes in comparison (i) the aUeged elevated heat resis· approach known as Holistic Risk 4oAI Listeria monocytogenes was discover­ to other psychrotrophic pathogens and spoilage agents, at tance,37 a point which we will Analysis. The essentials of the ed as a pathogen of animals and man temperatures ranging from 0 - 10 °C. discuss later: procedure will be summarlsed In the in the 1930'5,1 .2 As far as humans (Ii) the ability for relatively rapid next section. The result s allow an are concerned the organism was Temperature, °C growth at refrigeration tempera­ unbiased approach to the often initially Identified as a cause of tures, as Illustrated by the data in emotive subject of food·borne abortion In early pregnancy, stillbirth listeriOSIS, Orgamsms 0-1 2-3 5 7-8 9-10 Tables 1 and 2; Of a sepbCaeml(l (granulomatOSIS ~IO a marked tolerance of reduced Infanbsepuca) aher an unevenrful pH-values;38 Food transmitted listeriosis: blnh J ~ A hydrophila >22 6 -10 3-4 2 <I (iv) growth In the presence of over risk assessment Later, meningitis and flncephalitis In L.
    [Show full text]
  • VINELAND's FOOD SAFETY NEWSLETTER February 2015
    VINELAND’S FOOD SAFETY NEWSLETTER February 2015 Produced by the Vineland Health Department- May be copied! Vacuum packing- what you need to know before you start! Vacuum packaging of foods will extend the shelf life of potentially hazardous foods. However, there are some significant risks associated with this practice that must be controlled or you could kill or paralyze your customers. By removing the oxygen from the package, you leave the food much more likely to grow clostridium botulinum bacteria (cause of botulism) and Listeria monocytogenes. Botulism can cause paralysis to death. Listeria can cause miscarriages and death. Not a good idea! In order to safely vacuum package potentially hazardous foods, you must have a food safety expert create a special plan for you on how you will control these hazards. It is called a HACCP plan. This plan must be submitted to the Health Department for approval prior to starting the process. If you have any questions about this, please feel free to call us! Did you know…? Alternating sanitizers (such as quaternary Cut leafy greens are capable of growing ammonia and bleach- never together) may disease causing bacteria. The FDA help prevent Listeria from developing recommends that these food items be kept resistance to sanitizers and building under temperature controls. While not a NJ biofilms. law yet, it is a good practice to start now. Increasing sanitizer strength above the If your business wishes to or already recommended levels will not increase the donates food to an organization that amount of bacteria and viruses destroyed, redistributes to people in need, you need to but may result in harmful levels of let us know.
    [Show full text]
  • APPLICATION of QUANTITATIVE RISK ANALYSIS METHODS to IMPROVING MICROBIAL FOOD SAFETY in the U.S. and KENYA a Dissertation Presen
    APPLICATION OF QUANTITATIVE RISK ANALYSIS METHODS TO IMPROVING MICROBIAL FOOD SAFETY IN THE U.S. AND KENYA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Matthew Stasiewicz May 2015 © 2015 Matthew Stasiewicz APPLICATION OF QUANTITATIVE RISK ANALYSIS METHODS TO IMPROVING MICROBIAL FOOD SAFETY IN THE U.S. AND KENYA Matthew Stasiewicz, Ph. D. Cornell University 2015 Risk analysis is an approach that guides efforts to reduce foodborne disease risk through the distinct activities of risk assessment, risk management, and risk communication. In three projects, I improve two categories of risk analysis tools for two distinct food safety risks in two distinct geographic regions: risk assessment of the bacterial pathogen Listeria monocytogenes in the United States and risk management of the mycotoxins aflatoxin and fumonisin in Kenya. First, I use quantitative microbial risk assessment to show increasing high temperature, short time (HTST) pasteurization temperatures to respond to a bioterror threat would increase the risk of listeriosis from consuming pasteurized fluid milk. I incorporate experimental findings that increased HTST pasteurization temperatures (from 72°C to 82°C) increase outgrowth of L. monocytogenes following post-pasteurization contamination of fluid milk. Conservative estimates show annual listeriosis deaths would increase from 18 to 670, a 38-fold increase, if all U.S. fluid milk were pasteurized at the higher temperature. Second, I apply whole genome sequence technology to identify which repeatedly observed strains of L. monocytogenes are more likely persistent within individual delicatessens or are repeatedly reintroduced from outside sources.
    [Show full text]
  • Burden of Foodborne Diseases in the Netherlands
    Country experience Burden of Foodborne Diseases in the Netherlands Lapo Mughini-Gras, DVM PhD [email protected] Background ● Highly industrialized, densely populated country with high food safety standards ● FBDs still have substantial public health and economic impact ● Empirical approach (to generate evidence) for informing policy ● Performed by the RIVM yearly since 2008 under mandate of MoH ● Standard panel of 14 enteric pathogens 2 Burden of foodborne diseases in the Netherlands | 29-06-01 Metrics and health effects Pathogen D* GE GBS ReA IBD IBS HUS ESRD Hep Men ND AL CR CNS HC IC Campylobacter spp. X X X X X X STEC O157 X X X X Salmonella spp. X X X X X Infectious gastroenteritis Norovirus X X Rotavirus X X Cryptosporidium X X spp. Giardia lamblia X X B. cereus toxin X BoD measured Toxin C. perfringens toxin X X producers S. aureus toxin X X in DALYs L. monocytogenes - perinatal X X X - acquired X X X X Systemic Hepatitis-A virus X X infections Hepatitis-E virus X X Toxoplasma gondii - perinatal X X X X X - acquired X CoI (€) includes healthcare costs, costs for the patient and caregivers (e.g. travel, external care), productivity losses 3 Burden of foodborne diseases in the Netherlands | 29-06-01 Data sources • N: Incident cases Surveillance / studies • t: Duration of disease Scientific literature / own data • w: disability weight Scientific literature / GBD • D: mortatlity Statistics Netherlands • e: life expectancy at the age of death Statistics Netherlands = × × = × � � 4 Burden of foodborne diseases in the Netherlands | 29-06-01 5 Burden of foodborne diseases in the Netherlands | 29-06-01 Campylobacter spp.
    [Show full text]
  • Destruction of Escherichia Coli O157:H7, Salmonella, Listeria Monocytogenes, and Staphylococcus Aureus Achieved During Manufactu
    2034 Journal of Food Protection, Vol. 73, No. 11, 2010, Pages 2034–2042 Copyright G, International Association for Food Protection Destruction of Escherichia coli O157:H7, Salmonella, Listeria monocytogenes, and Staphylococcus aureus Achieved during Manufacture of Whole-Muscle Beef Jerkyin Home-Style Dehydrators SARAH DIERSCHKE, STEVEN C. INGHAM, AND BARBARA H. INGHAM* Department of Food Science, University of Wisconsin–Madison, 1605 Linden Drive, Madison, Wisconsin 53706, USA MS 10-085: Received 27 February 2010/Accepted 9 July 2010 ABSTRACT Adequate lethality in jerky manufacture destroys appropriate levels of Escherichia coli O157:H7, Salmonella, Listeria monocytogenes, and Staphylococcus aureus. Our goal was to evaluate the lethality of four home-style dehydrator processes against these pathogens. Whole-muscle beef strips were inoculated with L. monocytogenes (five strains), S. aureus (five strains), or a mixed inoculum of E. coli O157:H7 (five strains) and Salmonella (eight strains). After allowing for attachment, strips were marinated in Colorado-, Original-, or Teriyaki-seasoned marinade for 22 to 24 h and dried in three home-style dehydrators (Garden Master, Excalibur, and Jerky Xpress) at 57.2 to 68.3uC. Samples were taken postmarination; after 4, 6, and 8 h of drying; and after drying, followed by heating for 10 min in a 135uC oven. Surviving inocula were enumerated. With a criterion of $5.0- log CFU/cm2 reduction as the standard for adequate process lethality, none of the samples achieved the target lethality for any pathogen after 4 h of drying, even though all samples appeared ‘‘done’’ (water activity of less than 0.85). A postdehydration oven-heating step increased the proportion of samples meeting the target lethality after 4 h of drying to 71.9, 88.9, 55.6, and 77.8% for L.
    [Show full text]
  • Pdf/66/3/382/1674080/0362-028X-66 3 382.Pdf by Guest on 01 October 2021 MS02-200:Received 20June 2002/ Accepted 18October 2002
    382 Journalof Food Protection, Vol. 66, No. 3, 2003, Pages 382– 389 Viabilityof Clostridiumperfringens, Escherichia coli, and Listeria monocytogenes SurvivingMild Heat or AqueousOzone Treatment onBeef Followedby Heat, Alkali,or Salt Stress † JOHN S.NOVAK 1* AND JAMES T.C.YUAN 2 1U.S.Department of Agriculture, Agricultural Research Service, EasternRegional Research Center,Microbial Food Safety Research Unit,600 East MermaidLane, Wyndmoor, Pennsylvania 19038; and 2AmericanAir Liquide, Chicago Research Center,5230 South East Avenue, Countryside,Illinois 60525, USA Downloaded from http://meridian.allenpress.com/jfp/article-pdf/66/3/382/1674080/0362-028x-66_3_382.pdf by guest on 01 October 2021 MS02-200:Received 20June 2002/ Accepted 18October 2002 ABSTRACT Thethreat of pathogen survival following ozone treatment of meatnecessitates careful evaluation of themicroorganisms survivingunder such circumstances. The objective of this study was to determine whether sublethal aqueous ozone treatment (3 ppm of O3 for5 min)of microorganisms on beef surfaces would result in increased or decreased sur vivalwith respect to subsequentheat, alkali, or NaCl stress. A mildheat treatment (55 8Cfor30 min) was used for comparison. Reductions in three-straincocktails of Clostridiumperfringens, Escherichia coli O157:H7,and Listeriamonocytogenes onbeef following theheat treatment were 0.14, 0.77, and 1.47 log 10 CFU/g,respectively, whereas reductions following ozone treatment were 1.28,0.85, and 1.09 log 10 CFU/g,respectively. C.perfringens cellsexhibited elevated heat resistance at 60 8C (D60 [time at 608Crequiredto reduce the viable cell population by 1 log 10 unitsor 90%] 5 17.76min) following heat treatment of beef (558Cfor30 min) but exhibited reduced viability at 60 8Cfollowingozone treatment ( D60 5 7.64min) compared with the viabilityof untreated control cells ( D60 5 13.84min).
    [Show full text]
  • Control of Listeria Monocytogenes
    CONTROL OF LISTERIA MONOCYTOGENES GUIDANCE FOR THE U.S. DAIRY INDUSTRY Page 1 Issued: October 15, 2015 Revised: June 14, 2017 The information provided herein is for informational purposes only. The Innovation Center for U.S. Dairy (“the Innovation Center”) makes no representation or warranty with respect to the completeness, accuracy, reliability, or suitability of any information contained herein. We recommend that practitioners consult an attorney concerning the laws applicable to any particular situation as well as their own scientific experts to evaluate the applicability of any recommendation to their particular situation. By utilizing the materials contained herein, you agree to release the Innovation Center from any and all liability that may result from your use of the information provided. Acknowledgements Authors: Edith Wilkin (Leprino Foods), Richard Brouillette (Commercial Food Sanitation), Julie Carver (Sargento Foods, Inc.), Brian Cords (Foremost Farms USA), Amandeep Dhillon (Michigan Milk Producers Association), Scott Hall (Leprino Foods), Tom Hedge (Schreiber Foods), David Kedzierski (Agrimark), Lori Ledenbach (Kraft Heinz, Inc.), Vickie Lewandowski (Saputo Cheese), Mindy Smith (Schreiber Foods), Joe Stout (Commercial Food Sanitation), Tim Stubbs (Dairy Management Inc.) Reviewers: John Allan (IDFA), Judy Fraser-Heaps (Land O’Lakes), Kathy Glass (UW - Food Research Institute), Clay Hough (IDFA), Janet Raddatz (Sargento Foods Inc.), Ben Warren (Land O’Lakes) Special Thanks To: John Sheehan (Food and Drug Administration),
    [Show full text]
  • Mycobacterium Bovis (M
    Maryland DHMH Advisory Mycobacterium bovis (M. bovis) tuberculosis in Maryland - Healthcare Provider Information Statement of Problem In the last eight months in Maryland, M. bovis tuberculosis has been detected in three (3) U.S. born children of Latin American parents, with one (1) death. This number of cases is a substantial increase from previous years. Two (2) children presented with abdominal symptoms, and one (1) with meningitis. All had eaten different Mexican-style soft cheeses, which were likely contaminated with M. bovis. In prior years, two (2) other cases were diagnosed in the lymph nodes, and both children have suffered a recurrence of M. bovis tuberculosis. One (1) case recurred again in the lymph nodes, and the other case recurred in the brain. How do humans acquire M. bovis tuberculosis? Humans may acquire M. bovis by eating or drinking unpasteurized (raw) milk products produced in regions or countries where M. bovis disease is common in cattle, such as Mexico. In particular, the following unpasteurized dairy products have been previously associated with infections, including M. bovis infection: • Cotija • Crema Mexicana • Queso fresco • Queso blanco Young children and immunosuppressed individuals are at higher risk for disease. What are the symptoms of M. bovis tuberculosis? M. bovis infection can cause respiratory and/or gastrointestinal illnesses. Symptoms include: • Fever • Night sweats • Cough (may be productive) • Weight loss • Abdominal pain/diarrhea (gastrointestinal) • Swelling in neck (lymph node disease) How is M. bovis tuberculosis diagnosed? M. bovis tuberculosis is diagnosed by isolating the bacteria from sites of infection in a patient, such as lymph nodes in the neck or abdomen, or from sputum produced by coughing.
    [Show full text]